WO2007091073A1

WO2007091073A1 - Systeme promoteur

Info

Publication number: WO2007091073A1
Application number: PCT/GB2007/000441
Authority: WO
Inventors: Michael John Bromley
Original assignee: F2G Ltd
Priority date: 2006-02-07
Filing date: 2007-02-07
Publication date: 2007-08-16
Also published as: GB0602435D0

Abstract

L'invention concerne une méthode d'expression d'une séquence polynucléotidique, qui consiste à exprimer cette séquence à partir d'une construction. Cette construction comprend ladite séquence liée de manière fonctionnelle à un promoteur présentant: i) une séquence d'ADN codant un promoteur fongique; ou ii) une séquence au moins à moitié identique à la séquence de i); ou iii) un fragment de i) ou de ii). Le système de l'invention met en oeuvre des méthodes améliorées de régulation contrôlée de gènes, qui permettent de rechercher un caractère essentiel, et donc de déterminer si un gène est une cible de médicament appropriée.

Description

PROMOTER SYSTEM Field of the invention

The present invention relates to the use of isolated fungal promoters for controlling expression of a gene and/or producing a polypeptide and/or producing an antisense construct and/or producing an RNAi construct. The present invention also relates to DNA constructs, vectors, and host cells comprising these promoters in operative association with sequences encoding genes, polypeptides, antisense constructs or RNAi constructs.

Background of the invention In recent years the filamentous fungus Aspergillus fumigatus has become a significant cause of infection in man and as such has become the focus of much study. It is thought to be the leading mould pathogen in leukaemia and transplant patients and is responsible for mortality in a large number of individuals with immunological disorders. Until quite recently the "gold standard" treatment for aspergillus infection has been the intravenous application of amphotericin B. However significant side-effects coupled with a poor treatment outcome has lead to the search for more efficacious and less toxic drugs. The available alternatives, e.g., voriconazole and itraconazole, show little improvement in outcome but do have fewer side- effects. However isolates resistant to these azoles have been identified. Current anti-fungal drugs are directed against a narrow range of pathways and proteins and the identification of novel targets is critical in the search for new anti-fungal drugs. One aspect of this is the development of new validation technologies. In particular, improved methods for controlled regulation of genes may be used to investigate essentiality and therefore determine whether a gene is suitable as a drug target.

Several inducible promoter systems have been developed in filamentous fungi, systems exploiting carbon catabolite repression where expression can be modulated by the choice of carbon source have been particularly useful in filamentous fungi. These include the glucoamylase (glaA) and alcohol dehydrogenase (alcA) systems in Aspergilli and the cellulose (cbhl) system in Trichoderma. Both the glaA and cbhl systems although inducible to high levels are particularly leaky when repressed. This has been highlighted recently where the glaA promoter was used to exemplify anti-sense regulation of the alb J gene of A. fumigatus. Although successful in anti-sense repression of the albl gene, incomplete repression by the glaA promoter prevented restoration of the wild-type phenotype. The alcA system has been used to validate the essentiality of nudC in A. fumigatus however it is unclear if expression in this system can be totally repressed. Two inducible systems based on non- carbon based induction have been reported for use in Aspergilli. The thiA promoter of Aspergillus oryzae is responsible for regulation of thiamine biosynthesis and is repressed at the transcription and translation levels by thiamine and has been shown to regulate egfp expression in Aspergillus nidulans as well as A. oryzae. An E. coli promoter system based on the tetracycline-resistance operon has been adapted for use in A. fumigatus. This system provides a significant advance in inducible promoter systems in filamentous fungi as it has the potential for regulation during in vivo infection experiments. Both of these systems however share the same problem as the previously described carbon based systems in that significant expression still occurs in repressed or 'off states.

Summary of the invention

The inventors have found that a system based on the A. fumigatus promoter of the cellobiohydrolase gene cbhB, provides an improvement over the repression abilities of other systems and is suitable for inducible anti-sense experiments Accordingly, the invention provides the following:

A method for expression of a coding sequence in a host cell, comprising the following steps: (a) providing a DNA construct comprising (i) a promoter DNA sequence SEQ ID NO:1; (ii) a DNA sequence at least 50% identical to (i); (iii) a DNA sequence capable of hybridizing with a DNA sequence of (i); (iv) a variant of any of (i) - (iii); or (v) a subsequence of any of the DNA sequences of (i) to (iv), and a coding sequence, (b) transforming a suitable host cell with said DNA construct and (c) expressing the coding sequence under the control of said promoter DNA sequence.

A method for production of a polypeptide encoded by a coding sequence that is under control of the promoter of the invention in a suitable fungal host comprising the following steps: (a) providing a DNA construct comprising (i) a promoter DNA sequence SEQ ID NO:1; (ii) a DNA sequence at least 50% identical to (i); (iii) a DNA sequence capable of hybridizing with a DNA sequence of (i); (iv) a variant of any of (i) - (iii); or (v) a subsequence of any of the DNA sequences of (i) to (iv), and a coding sequence, (b) transforming a suitable host cell with said DNA construct, (c) culturing the suitable fungal host under suitable culture conditions conducive to expression of the polypeptide, (d) recovering the polypeptide from the culture medium or measuring the activity or presence of the polypeptide in the culture medium or a fraction prepared from it.

A method for altering the expression of a coding sequence encoding a polypeptide which is endogenous to a fungal host cell comprising the following steps: (a) providing a DNA construct comprising (i) a promoter DNA sequence SEQ ID NO: 1 ; (ii) a DNA sequence at least 50% identical to (i); (iii) a DNA sequence capable of hybridizing with a DNA sequence of (i); (iv) a variant of any of (i) - (iii); or (v) a subsequence of any of the DNA sequences of (i) to (iv), and all or part of a coding sequence, (b) transforming a suitable host cell with said DNA construct, (c) selecting for strains where the promoter construct has integrated into the genome to replace all or part of the endogenous promoter, and (d) observing mRNA expression, protein expression, protein function, or phenotype under inducing or suppressing conditions.

A method for altering expression of a gene by antisense comprising the following steps: (a) providing a DNA construct comprising (i) a promoter DNA sequence SEQ ID NO:1; (ii) a DNA sequence at least 50% identical to (i); (iii) a DNA sequence capable of hybridizing with a DNA sequence of (i); (iv) a variant of any of (i) - (iii); or (v) a subsequence of any of the DNA sequences of (i) to (iv), and an anti-sense construct, (b) transforming a suitable host cell with said DNA construct, (c) expressing the anti-sense sequence under the control of said promoter DNA sequence, and (d) observing the effect of antisense inhibition on the expression of the gene of interest directly or indirectly.

A method for altering expression of a gene by RNAi comprising the following steps: (a) providing a DNA construct comprising the (i) a promoter DNA sequence SEQ ID NO: 1 ; (ii) a DNA sequence at least 50% identical to (i); (iii) a DNA sequence capable of hybridizing with a DNA sequence of (i); (iv) a variant of any of (i) - (iii); or (v) a subsequence of any of the DNA sequences of (i) to (iv), and an RNAi construct, (b) transforming a suitable host cell with said DNA construct and (c) expressing the RNAi sequence under the control of said promoter DNA sequence, and (d) observing the effect of RNAi on the expression of the gene of interest directly or indirectly. A vector comprising the promoter of the invention associated with a coding sequence, anti-sense construct or RNAi construct.

A host cell which is transgenic for (or which has been transformed with) a vector comprising the promoter of the invention associated with sequence such as a coding sequence, antisense construct or RNAi construct.

Description of the Figures

Figure 1 depicts schematic representations of plasmid constructs ρMJB104, pMJB107, pMJBHO, ρMJB201, and ρALBR2. Plasmid pMJB104 shows the cbhB expression cassette (PcbhB-TcbhB) in the same orientation as the selectable marker for hygromycin (hph). In pMJB107 the orientation of the selectable marker is reversed. Plasmids pMJBl 10 and 201 are derivatives of pMJB104 and 107 with the E. coli lacZ gene under the control of the cbhB promoter. Plasmid ρALBR2 is a derivative of pMJB107 with the albl antisense construct immediately downstream of the cbhB promoter, followed by a buffer fragmant (X), followed by albl sense sequence.

Figure 2 depicts β-galactosidase activity of crude protein extracts from wild-type (AF293) and transformant AFl 10-1, -2, AF201-1 and -2 strains. After incubation for 14 hours in 1% glucose cultures, 0.3g wet weight biomass was transferred to fresh cultures. Samples were taken from either 1% glucose (4 hours after transfer) or 1% CMC (2, 4, 6 or 8 hours after transfer) cultures.

Figure 3 depicts relative expression levels of cbhB and lacZ in transformant strains AFl 10-1, and -2, AF201-1 and -2. After incubation for 14 hours in 1% glucose cultures, 0.3g wet weight biomass was transferred to fresh cultures. Samples were taken 4 hours after transfer from either 1% glucose or 1% CMC cultures. No expression of the native cbhB gene was detected in the glucose cultures (not shown).

Figure 4 depicts relative expression levels of albl in the AF293 wild-type strain and the transformant strain R2B harbouring the albl antisense construct. After incubation for 14 hours in 1% glucose cultures, 0.3 g wet weight biomass was transferred to fresh cultures. Samples were taken 4 hours after transfer from either 1% glucose or 1% CMC cultures. Expression was normalised to β-tubulin so direct comparisons could be made.

Detailed description of the invention

The polynucleotides, vectors or cells described herein may be in isolated form. The present invention relates to use of a promoter DNA sequence selected from the group consisting of:

(a) a DNA sequence comprising the nucleotide sequence of SEQ ID NO:1,

(b) a DNA sequence being at least 50% identical to a DNA sequence of (a),

(c) a DNA sequence capable of hybridizing with a DNA sequence of (a)

(d) a variant of any of (a) or (b), and (e) a subsequence of any of the DNA sequences of (a) to (d).

In the context of this invention, a promoter DNA sequence is a DNA sequence, which is capable of controlling or causing the expression of a sequence, when this promoter DNA sequence is in operative association (or operably linked) with a coding sequence, antisense construct or RNAi construct. The term "in operative association" is defined herein as a configuration in which a promoter DNA sequence is appropriately placed at a position relative to the expressed sequence such that the promoter DNA sequence directs the expression of the sequence (normally upstream or to the 5'of the sequence to be expressed).

The term "expressed sequence" is defined herein as a nucleic acid sequence which is expressed under the control of the promoter of the invention. The expressed sequence may or may not be translated into a polypeptide.

The term "coding sequence" is defined herein as a nucleic acid sequence that is transcribed into mRNA, which is translated into a polypeptide when placed under the control of the appropriate control sequences. A coding sequence can include, but is not limited to, genomic DNA, cDNA, semisynthetic, synthetic, and recombinant nucleic acid sequences.

The term "antisense construct" is defined herein as DNA sequence transcribed in an antisense orientation such that the transcribed RNA will generally bind to sense mRNA encoding a gene of interest and typically prevent or inhibit translation of the sense mRNA. An antisense construct is typically at least 21 bases and may extend to the length of the gene of interest.

The term "RNAi construct" is defined herein as a DNA construct typically encoding stem loop structure formed by sense DNA , followed by a linker sequence, followed by the antisense sequence complementary to the sense DNA. The sense DNA sequence is generally at least 21 bases and may extend to the length of the gene of interest, the expression of which is being modulated by RNAi. The order of the sense and antisense DNA in the construct may be swapped.

More specifically, the term "promoter" is defined herein as a DNA sequence that generally binds the RNA polymerase and directs the polymerase to the correct downstream transcriptional start site of a sequence to initiate transcription. The term "promoter" will generally also be understood to include cis-acting transcription control elements such as enhancers, and other nucleotide sequences capable of interacting with transcription factors.

Promoter sequences

In a preferred embodiment, the promoter DNA sequence of the invention is a sequence according to SEQ ID NO : 1.

Promoter activity is preferably determined by measuring the amount of RNA message expressed by the sequence in operative association with the promoter. According to a preferred embodiment, the promoter activity (and its strength) is determined by measuring the levels of mRNA of the β galactosidase gene. The mRNA levels can, for example, be measured by Real-Time PCR or by a Northern blot. Alternatively the promoter activity is determined by measuring the enzymatic activity of the protein coded by the expressed sequence which is in operative association with the promoter. According to another preferred embodiment, the promoter activity is determined by measuring expressed β galactosidase activity.

According to another preferred embodiment, if the promoter is driving expression of an anti-sense or RNAi construct, promoter activity may be is determined by measuring the level of mRNA of the gene against which the antisense or RNAi is directed. Alternatively, the enzymic activity of the gene product may be measured. As a further alternative, a phenotypic assay may be used if the expressed sequence is associated with a measurable or observable phenotype. According to another preferred embodiment of the invention, the promoter activity is determined by observing spore colour in response to RNAi inactivation of the Albl gene.

The antisense or RNAi construct may be designed to inhibit the expression of a known or putative essential gene or virulence determinant gene. According to another preferred embodiment, the promoter DNA sequence of the invention is a DNA sequence, which is at least 50% identical to SEQ ID NO: 1. Preferably, the DNA sequence is at least 55% identical, more preferably at least 60%, more preferably at least 65%, more preferably at least 70%, even more preferably at least 75% preferably about 80%, more preferably about 90%, even more preferably about 95%; and most preferably about 97% identical to SEQ ID NO: 1.

For purposes of the present invention, the degree of identity between two nucleic acid sequences is preferably calcluated from an alignment as (N/T)*100, where N is the number of positions at which the two sequences share an identical residue, and T is the total number of positions compared. Alternatively, percentage identity can be calculated as (N/S)*100 where S is the length of the shorter sequence being compared. The preferred method for generating a multiple alignment is by the ClustalX program; pairwise parameters: gap opeining 10.0, gap extension 0.1 matrix IUB; multiple parameters: gap opening 10.0, gap extension 0.2, delay divergent sequences 30%, DNA transition weight 0.5, negative matrix off, DNA weight IUB. According to another preferred embodiment, the promoter DNA sequence of the invention is a DNA sequence which hybridizes to the sequences shown in SEQ ID NO: 1 , or its complement under stringent conditions. By stringent conditions, we mean the nucleotide hybridises to filter-bound DNA or RNA in 6x sodium chloride/sodium citrate (SSC) at approxmiately 45⁰C followed by at least one wash in 0.2x SSC/0.1% SDS at approximately 5- In another embodiment of the invention, the promoter DNA sequence is a variant of SEQ ID NO 1. The term "variant" or "variant promoter" is defined herein as a promoter having a nucleotide sequence comprising a substitution, deletion, and/or insertion of one or more nucleotides of a parent promoter, wherein the variant promoter has more or less promoter activity than the corresponding parent promoter. The term "variant promoter" will encompass natural variants and in vitro generated variants obtained using methods well known in the art such as random or site-directed mutagenesis. A variant promoter may have one or more mutations. Each mutation is an independent substitution, deletion, and/or insertion of a nucleotide. In another preferred embodiment, the promoter is a subsequence of; (i) SEQ ID NO: 1,

(ii) a sequence which is at least 50% identical, at least 55% identical, more preferably at least 60%, more preferably at least 65%, more preferably at least 70%, even more preferably at least 75% preferably about 80%, more preferably about 90%, even more preferably about 95%; and most preferably about 97% identical to SEQ ID NO:1., (iii) a DNA sequence capable of hybridizing with a DNA sequence SEQ ID NO. 1, or (iv) or a variant of SEQ ID NO. 1, the subsequence still having promoter activity. The subsequence preferably corresponds to:

(i) nucleotides 1 to 1252 of SEQ ID NO:1, preferably nucleotides 100 to 1252, more preferably 200 to 1252, even more preferably 300 to 1252, even more preferably 350 to 1252 and most preferably 400 to 1252,

(ii) a subsequence of (i). The subsequence may be at least 100 nucleotides, preferably at least 200 nucleotides, more preferably at least 300 nucleotides, even more preferably at least 400 nucleotides and most preferably at least 500 nucleotides, or (iii) a complementary strand of (i). In another preferred embodiment, a subsequence is a nucleic acid sequence encompassed by SEQ ID NO:1 except that one or more nucleotides from the 5' and/or 3' end have been deleted, the DNA sequence still having promoter activity.

The promoter of the invention can be a promoter whose sequence may be provided with linkers for the purpose of introducing specific restriction sites facilitating ligation of the promoter sequence to other sequences, e.g., the coding region of a nucleic acid sequence encoding a polypeptide, an anti-sense construct or an RNAi construct. The promoter need not be immediately adjacent to these sequences to be operably associated.

The present invention encompasses functional promoter equivalents typically containing mutations that do not alter the biological function of the promoter it concerns. The term "functional equivalents" also encompasses orthologs from other Aspergillus species such as Aspergillus αculeαtus, Aspergillus αwαmori, Aspergillus flαvus, Aspergillus foetidus, Aspergillus fumigαtus, Aspergillus jαponicus, Aspergillus nidulαns, Aspergillus niger, Aspergillus oryzαe, Aspergillus parasiticus and Aspergillus terreus. Orthologs of the promoter sequences are DNA sequences that can be isolated from other strains or species and possess a similar or identical biological activity.

The promoter sequences of the present invention may be obtained from a fungal source, preferably from a filamentous fungus selected from the genera Acremonium, Aspergillus, Aureobasidium, Cryptococcus, Filibasidium, Fusarium, Humicola, Magnaporthe, Mucor, Myceliophthora, Neocallimastix, Neurospora, Paecilomyces, Penicillium, Piromyces, Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium, and Trichoderma strain, more preferably from a filamentous fungus selected from the species Aspergillus aculeatus, Aspergillus awamori, Aspergillus flavus, Aspergillus foetidus, Aspergillus fumigatus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger, Aspergillus oiγzae, Aspergillus parasiticus, Aspergillus terreus, Humicola insolens, Humicola lanuginosa, Magnaporthe grisea, Mucor miehei, Myceliophthora thermophila, Neurospora crassa, Penicillium purpurogenum, Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma reesei, and Trichoderma viride.

In another preferred embodiment, the promoter sequences are obtained from a yeast selected from the genera Candida, Hansenula, Kluyveromyces, Pichia, Saccharomyces, Schizosaccharomyces, or Yarrowia, more preferably. from a yeast selected from the species Candida albicans, Candida glabrata or Saccharomyces cerevisiae.

In the present invention, the promoter DNA sequence may also be a hybrid promoter comprising a portion of one or more promoters of the present invention; a portion of a promoter of the present invention and a portion of another known promoter, e. g., a leader sequence of one promoter and the transcription start site from the other promoter; or a portion of one or more promoters of the present invention and a portion of one or more other promoters. The other promoter may be any promoter sequence which shows transcriptional activity in the fungal host cell of choice including a variant, truncated, and hybrid promoter, and may be obtained from genes encoding extracellular or intracellular polypeptides either homologous or heterologous to the host cell. The other promoter sequence may be native or foreign to the nucleic acid sequence encoding the polypeptide and native or foreign to the cell.

As a preferred embodiment, important regulatory subsequences of the promoter identified can be fused to other 'basic' promoters to enhance their promoter activity. In the present invention, the promoter DNA sequence may also be a "tandem promoter". A "tandem promoter" is defined herein as two or more promoter sequences each of which is in operative association with a coding sequence and mediates the transcription of an associated sequence. The tandem promoter comprises two or more promoters of the present invention or alternatively one or more promoters of the present invention and one or more other known promoters, such as those exemplified above useful for the construction of hybrid promoters. The two or more promoter sequences of the tandem promoter may simultaneously promote the transcription of the nucleic acid sequence. Alternatively, one or more of the promoter sequences of the tandem promoter may promote the transcription of the nucleic acid sequence at different stages of growth of the cell or morphological different parts of the mycelia.

DNA constructs

The invention further relates to a DNA construct comprising at least one promoter DNA sequence as defined above and a sequence in operative association with said promoter DNA sequence such that the sequence can be expressed under the control of the promoter DNA sequence in a given fungal host cell.

The expressed sequence may encode a polypeptide that may be native or heterologous to the fungal host cell of interest. The polypeptide maybe secreted. The expressed sequence encoding a polypeptide of interest may be obtained from any prokaryotic, eukaryotic, or other source.

Alternatively, the expressed sequence may be an antisense RNA and/or an RNAi construct. The expressed sequence may be a heterologous one, i.e. it is not the coding sequence of the A. furnigatus cellobiohydrolase gene. In the present invention, the promoter DNA sequence may also be used to drive antisense expression of a gene by placing the promoter at or beyond the 3 ' end of a coding sequence, such that the sense message is transcribed by another promoter, and the antisense RNA is transcribed by the promoter of the invention.

The promoter of the invention may be used to replace the promoter of an endogenous gene ("promoter replacement") thereby placing the endogenous gene under the control of the promoter of the invention.

The DNA construct may comprise one or more control sequences in addition to the promoter DNA sequence, which direct the expression of the associated sequence in a suitable host cell. The term "control sequences" is defined herein to include all components, which are necessary or advantageous for the expression of a sequence, including the promoter of the invention. Such control sequences may include, but are not limited to, a leader, an optimal translation initiation sequence, a polyadenylation sequence, a propeptide sequence, a signal peptide sequence, an upstream activating sequence, the promoter of the invention including variants, fragments, and hybrid and tandem promoters derived thereof and a transcription terminator. At a minimum, the control sequences include transcriptional and translational stop signals and (part of) the promoter of the invention.

The control sequences may be provided with linkers for the purpose of introducing specific restriction sites facilitating ligation of the control sequences with the expressed sequence. The control sequence may be a suitable transcription terminator sequence, i. e. a sequence recognized by a host cell to terminate transcription. Any terminator, which is functional in the host cell of choice may be used in the present invention. Preferred terminators for filamentous fungal host cells are terminators from the following genes; A. fumigatus cbhB , A. oryzae TAKA amylase, A, niger glucoamylase, A. nidulans anthranilate synthase, A. niger alpha-glucosidase, trpC gene, and Fusarium oxysporum trypsin-like protease.

The control sequence may also be a suitable leader sequence, i. e. a 5' non-translated region of a mRNA which is important for translation by the host cell. The leader sequence is in operative association with the 5' terminus of the expressed nucleic acid sequence encoding a polypeptide. Any leader sequence that is functional in the host cell of choice may be used in the present invention.

The control sequence may also be a polyadenylation sequence, a sequence in operative association with the 3¹ terminus of the expressed sequence and which, when transcribed, is recognized by the host cell as a signal to add polyadenosine residues to transcribed mRNA. Any polyadenylation sequence, which is functional in the host cell of choice may be used in the present invention.

The control sequence may also be a signal peptide coding region that codes for an amino acid sequence linked to the amino terminus of a polypeptide and directs the encoded polypeptide into the cell's secretory pathway.

Vectors

The present invention also relates to recombinant expression vectors comprising a promoter of the present invention and a coding sequence under the control of the promoter. For promoter replacement, a recombinant vector may be constructed comprising all or a 5' part of a gene of interest and/or an upstream region including all or part of its endogenous promoter, where the region 5' of the ATG start has inserted or substiuted the promoter of the present invention. The present invention also relates to vectors comprising a promoter of the present invention and an antisense or RNAi construct under the control of the promoter.

The various sequences described above may be joined together to produce a recombinant vector which may include one or more convenient restriction sites to allow for insertion or substitution of the promoter and/or expressed sequence. Alternatively, fusion of the coding sequence and promoter can be done using PCR.

The vectors of the present invention preferably contain one or more selectable markers, which permit easy selection of transformed cells. Selectable markers for use in a filamentous fungal host cell include, but are not limited to, amdS (acetamidase), argB (ornithine carbamoyltransferase), bar (phosphinothricin acetyltransferase), hygB (hygromycin phosphotransferase), niaD (nitrate reductase), pyrG (orotidine-5¹- phosphate decarboxylase), sC (sulfate adenyltransferase), trpC (anthranilate synthase), ShBIe (Zeocin resistance) as well as equivalents thereof. Marker conferring resistance against e. g. phleomycin, hygromycin B or G418 can also be used. A preferred selection marker gene is the hygromycin resistance gene. For integration into the host cell genome, the vector may rely on the promoter sequence and/or expressed sequence or any other element of the vector for stable integration of the vector into the genome by homologous or non- homologous recombination. Alternatively, the vector may contain additional nucleic acid sequences for directing integration by homologous recombination into the genome of the host cell. The integrational elements should preferably contain a sufficient number of nucleic acids, such as 100 to 2,000 base pairs, preferably 400 to 1,500 base pairs, more preferably 800 to 1,500 base pairs, and most preferably at least 2kb, which are highly homologous with the corresponding target sequence to enhance the probability of homologous recombination. The integrational elements may be any sequence that is homologous with the target sequence in the genome of the host cell. Furthermore, the integrational elements may be non-encoding or encoding nucleic acid sequences. In order to promote targeted integration, the cloning vector is preferably linearized prior to transformation of the host cell. Linearization is preferably performed such that at least one but preferably either end of the cloning vector is flanked by sequences homologous to the target locus. Cells

The present invention also relates to recombinant host cells, comprising a promoter DNA sequence of the present invention in operative association with a sequence encoding a polypeptide, antisense or RNAi construct construct. A vector comprising a promoter of the present invention in operative association with a sequence is introduced into a host cell so that the vector is maintained as a chromosomal integrant or as a self-replicating extra- chromosomal vector as described earlier. The choice of a host cell will to a large extent depend upon the gene encoding the polypeptide and its source. The host cell may be any fungal cell useful in the methods of the present invention. In a preferred embodiment, the fungal host cell is a filamentous fungal cell.

In a more preferred embodiment, the filamentous fungal host cell is a cell of a genera selected from Acremonium, Aspergillus, Aureobasidium, Cryptococcus, Filibasidium, Fusarium, Humicola, Magnaporthe, Mucor, Myceliophthora, Neocallimastix, Neurospora, Paecilomyces, Penicillium, Piromyces, Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium and Trichoderma. More preferably the filamentous fungus cell is selected from the species Aspergillus aculeatus, Aspergillus awamori, Aspergillus flavus; Aspergillus foetidus, Aspergillus fumigatus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, Aspergillus parasiticus, Aspergillus terreus, Humicola insolens, Humicola lanuginosa, Magnaporthe grisea, Mucor miehei, Myceliophthora thermophila, Neurospora crassa, Penicillium purpurogenum, Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma reesei and Trichoderma viride. In another preferred embodiment, the fungal host cell is a yeast cell of a genera selected from the genera Candida, Hansenula, Kluyveromyces, Pichia, Saccharomyces, Schizosaccharomyces, or Yarrowia, more preferably from a yeast selected from the species Candida albicans, Candida glabrata and Saccharomyces cerevisiae.

The reader's attention is directed to all papers and documents which are filed concurrently with or previous to this specification in connection with this application and which are open to public inspection with this specification, and the contents of all such papers and documents are incorporated herein by reference.

AU of the features disclosed in this specification (including any accompanying claims, abstract and drawings), and/or all of the steps of any method or process so disclosed, may be combined in any combination, except combinations where at least some of such features and/or steps are mutually exclusive. Each feature disclosed in this specification (including any accompanying claims, abstract and drawings), may be replaced by alternative features serving the same, equivalent or similar purpose, unless expressly stated otherwise. Thus, unless expressly stated otherwise, each feature disclosed is one example only of a generic series of equivalent or similar features.

The invention is not restricted to the details of the foregoing embodiment(s). The invention extends to any novel one, or any novel combination, of the features disclosed in this specification (including any accompanying claims, abstract and drawings), or to any novel one, or any novel combination, of the steps of any method or process so disclosed. Embodiments of the invention will now be described by way of example.

Examples

Materials and methods Aspergillus strains and culture conditions

All methods described used A. fumigatus clinical isolate AF293 (NCPF7367) available to the public from the NCPF at the Health Protection Agency; Bristol, U.K. or modifications of this strain described elsewhere in this section. Conidia were collected from 4-7 day old cultures grown on Sabouraud Dextrose agar flasks at 37 ⁰C.

Construction of the expression plasmids and modified A. fumigatus strains Oligonucleotide primers cbhBp_f (SEQ ID No. 2; CAA TTG CCC AGG CCT AAT

GCA TGC TG) and cbhBp_r (SEQ ID No. 3; CAA TTG CGG TAG GAG AAG GTG GAG GCC) with Muni linkers (underlined) were used to amplify a 1.2 kb fragment from-lbp of the ATG codon from the A. fumigatus cbhB gene (ΫcbhB). This fragment was cloned into the EcoRΪ site of pucl9. Primers cbhBt_f (SEQ ID No. 4; TCT AGA_GCT AGC ATG GGA GTG GTG GCC TCC TCG) and cbhBt_r (SEQ ID No. 5; ACT AGT_CCA GGG GAC TGT CGT GGT CAA) withyβ>αl and Spel linkers respectively (underlined) were used to amplify a 0.8 kb from +1 of the TAG stop from the A. fumigatus cbhB gene (TcbhB). This fragment was cloned into the Xbal site of the pucl9-Pcb/zi? plasmid. The hygromycin selectable marker hph was amplified from the pAN7.1 vector using primers hyg_f (SEQ ID No. 6; GGC GCC_ATC GAT GTA CAG TGA CCG GTG ACT CT) and hyg_r (SEQ ID No. 7; GGC GCC AAG AAG GAT TAC CTC TAA ACA) and cloned into the Narl site of the pxicW-VcbhB-TcbhB plasmid to give plasmids pMJB104 and pMJB107 (Figure 1).

The E. coli lacZ gene was amplified from pDEl (FGSC) using primers \acZ-Xhol_f (SEQ ID No. 8; CTC GAG ATG GTC GTT TTA CAA CGT CGT GAC) and lacZ-XholJ (SEQ ID No. 9; CTC GAG TTA TTA TTA TTT TTG ACA CCA) with Xhol linkers and cloned into the Xhol site of the pMJB104 and pMJB107 expression cassettes immediately downstream of the promoter to act as a reporter gene giving plasmids pMJBl 10 and pMJB201 respectively. The reporter cassettes were introduced into A. fumigatus AF293 protoplasts to generate strains AF 110- 1 and AF 110-2 from plasmid pMJB 110 and AF201 - 1 and AF201 -2 from plasmid pM JB201.

The albl RNAi construct was produced in a similar manner to that described in Liu et al, 2002 (Genetics 160: 463-470). Primers RNAi_albl_sense2_F (SEQ ID No. 10; GAG CTC AGC AAC GCA CGT GCT GCA T) and RNAi_albl_sense2_R (SEQ ID No. 11 ; CCC GGG AGC GAG TCC ATG CCC ATC T) with Sad and CfiΘl linkers respectively were used to amplify the sense albl fragment and primers RNAi_albl_ant2_F (SEQ ID No. 12; TCT AGA AGC AAC GCA CGT GCT GCA T) and RNAi_albl_ant2_R (SEQ ID No. 13; TCT AGA AGC GAG TCC ATG CCC ATC T), which are the same as the antisense primers but with Xbal linkers, to produce the albl antisense fragment. A buffer fragment was obtained using primers RNAiJBGFPJF (SEQ ID No. 14; CCCGGGTCCAGGAGCGCACCATCTT) and RNAi_EGFP_R (SEQ ID No. 15; TCTAGACTTCAGCTCGATGCGGTTC) to ^'amplify a 0.1 kb fragment of the EGFP (Enhanced Green Fluorescent Protein) gene from the pGFP-zeo plasmid. Cfr9\ and Xbal sites were included respectively at the 5' and 3' ends of the EGFP fragment. These fragments were sequentially cloned into pMJB107 to give plasmid pALBR2 (Figure 1). This cassette was introduced into A. fumigatus AF293 protoplasts to generate strains ALBR2 A-D.

B-galactosidase assay

The assay for B-galactosidase activity was performed on crude protein extracts. For strains AFl 10-1, AFl 10-2, AF201-1 and AF201-2: IxIO⁶ conidia ml ^"1 were inoculated into 50 ml of Vogel's media supplemented with 1% w/v glucose (proposed repressing conditions). Cultures were incubated for 14h at 37 ⁰C with shaking at 220 rpm. Biomass was collected and 0.3 g wet weight was used to inoculate Vogel's media supplemented with either 1% w/v glucose or 1% w/v carboxymethylcellulose (CMC). Cultures were incubated for 2h, 4h, 6h and 8h at 37 ⁰C with shaking at 220 rpm for CMC cultures and 4h only for the glucose cultures.

Protein extraction was carried out on 50 mg wet weight biomass that was placed in tubes containing DNA lysing matrix (Bio 101) with 1 mL protein extraction buffer (50 mM NaH₂PO₄ (pH 7.0), 5 mM EDTA, 10 mM β-mercaptoethanol, 25 μg/ml PMSF). The tubes were processed in the fast prep FP 120 (Bio 101) for 20 seconds at speed 5. The sample was cooled on ice for 5 minutes and processed again as before. The lysate was allowed to cool on ice for 20 minutes. The protein extracts were separated from cellular debris by centrifugation and stored in 200 μL aliquots at -8O⁰C.

The assay was performed in 96 well plates using 100 μ\ sample or standard (β- galactosidase from E. coli; Sigma) in protein extraction buffer. The assay was initiated by the addition of 100 μ\ ort/zo-nitrophenol-β- D-galactoside (2 mg/ml) and incubated at 37°C for Ih after which absorbance readings at 415 nm were taken. RT-PCR analysis

RT-PCR analysis was performed on the invB, cbhA and cbhB genes. For expression studies of the invA and invδ genes, IxIO⁶ conidia ml ^"' were inoculated into 50 ml of Vogel's media with 1% w/v glucose (proposed repressing conditions) or 1% w/v sucrose (proposed inducing conditions) as the sole carbon source. Cultures were incubated for 12, 16 and 24 hours at 37⁰C with shaking at 220 rpm. For expression studies of the cbhA and cbhB genes cultures were set up as for the inv genes however 1% carboxymethyl cellulose was used instead of sucrose in the inducing medium.

Total RNA was extracted using the FastRNA kit (QBIOgene) following the manufacturer's instructions. DNA contamination was removed by the addition of DNAse

RQl (promega) followed by purification using the Qiagen RNA purification kit (Qiagen). The RNA was quantified using the ribogreen RNA quantification kit (molecular probes). cDNA was synthesised from 1 μg RNA using an Avian Myeloblastosis Virus-Reverse Transcriptase (AMV-RT) Reverse Transcription kit (Promega) with random hexamers. The final cDNA concentration was adjusted to 50 ng/μl, aliquoted and stored at -2O⁰C. Semi quantitative PCR was carried out using appropriate dilutions of cDNA and primers; actin, ACT470F (SEQ ID No. 16; TGG TGT CAC TCA CGT TGT CC) and ACT960R (SEQ ID No. 17; TCA TAG ACG AGG GAG CAA GG); invB, INVBF (SEQ ID No. 18; TGC GTG CTT CTT TCA TTC TC) and INVBR (SEQ ID No. 19; TGC GTC TGT AGC GTC TCA GT); cbhA, CBHAF (SEQ ID No. 20; CTCCTCATCCCTGTGACGAT) and CBHAR (SEQ ID No. 21 ; GGCAACGTTGGAGACAGAGT); and cbhB, CBHBF (SEQ ID No. 22; GCTCAGCAGGTCGGTACTTC) and CBHBR (SEQ ID No. 23;

GCCTGACCGTTGATGAACTT). AU PCR comprised 30 cycles of; 95⁰C 1 min, 55⁰C 1.5 min and 72⁰C 1 min.

Realtime PCR analysis

Real-time PCR reactions were performed using a BioRad light cycler typically in replicates of three in 96-well plates with each 25 μl reaction containing 12.5μl iQ SYBR Green Super-mix (BioRad), 5 pmol of each primer and 50 ng template cDNA.

Expression of the lacZ gene under the control of the cbhB promoter, the cbhB gene and jS-tubulin gene were studied. cDNA was prepared as described above from 50 mg wet weight biomass. For strains AF 104-1, AF 104-2, AFl 10-1 and AFl 10-2 growth conditions were as described in the /3-galactosidase assay section, but samples were taken after 4 hours incubation with either Vogel's supplemented with 1% w/v glucose or 1% w/v carboxymethylcellulose. Analysis of expression of alb 1 in antisense strain R2B was performed in the same way.

Reactions were performed in an iCycler thermal cycler fitted with iQ real-time PCR 5 Detection System (BioRad) running iCycler iQ Optical System software (version 3 a,

BioRad). PCR conditions were: 3 min at 95⁰C then 60 cycles of 30s at 95⁰C , 30s at 55 ⁰C and 15s at 72⁰C. Fluorescence was measured at the end of the annealing step. A melt curve analysis was included at the end of every PCR to analyse the products of each reaction. PCR reaction efficiencies were calculated for primer sets RtlacZF (SEQ ID No. 24; ATC CTC

10 TGC ATG GTC AGG TC) and RtlacZR (SEQ ID No. 25; TAT TGG CTT CAT CCA CCA CA) QacZ), RtcbhBF (SEQ ID No. 26; TTC GAT GTC GAT GTC TCC AA) and RtcbhBR (SEQ ID No. 27; GCC TGA CCG TTG ATG AAC TT) (cbhB), RtbtubF (SEQ ID No. 28; GCT CAC TCT TTC CGT GCT GTC T) and RtbτubR (SEQ ID No. 29; AGC AGG TGA GGT AAC GTC CAT T) (/3-tubulin), RtalbF (SEQ ID No. 30; GGA GGA TGC TGA GGC

15 TGA C) and RtalbR (SEQ ID No. 31 ; TCG TGT GGG TTG GTG TTG G) (alb 1 ) and these were used in the expression studies.

To calculate relative expression of the lacZ, cbhB and albl gene to β -tubulin, average Ct points were calculated and the delta delta Ct method was used (Pfaffl, M.W., 2001, Nucl. Acids Res. 29: 2002-2007), represented by the equation: _EucZ ^{deita Ct UcZ (repressed}-^ind _UC ^ed) , _Eβ_ r_j rv delta Ct /3-tubulin (repressed-induced)

^^υ tubulin

Results

Regulation of the cellobiohydrola.se and invertase genes

Many of the fungal cellulases and invertases are known to be regulated by carbon catabolite repression, via the creA mediated regulatory pathway. As the regulatory mechanisms of the genes identified in this study are not known, our initial experiments assessed their expression in conditions thought to induce and repress expression.

Semi-quantitative PCR was used to assess the expression of the invertase gene invB from mycelia grown for 12, 16 and 24 hours in Vogel's media using either 1% glucose or 1% sucrose as the sole carbon source. At the 12-hour time-point products were detected for invB at cDNA dilution factors to 1 in 500 in the presence of glucose and 1 in 5000 in the presence of sucrose indicating a 10 fold increase of invB expression on sucrose but clearly incomplete repression on glucose. By the 16 and 24-hour time-points, no difference could be seen in the glucose and sucrose samples. This probably reflects glucose exhaustion in the culture media. Similar analysis was conducted for the invA gene. In this case no difference could be seen at any time point (data not shown).

Levels of mRNA for cbhA and cbhB were monitored in cultures grown for 16 and 24 hours in Vogel's media with either 1% glucose or 1% carboxymethyl cellulose (CMC) as the sole carbon source. Expression of cbhA and cbhB genes was detected at 16 and 24 hours in cultures grown with CMC, the cbhA gene being expressed approximately 50 fold higher than the cbhB gene. No message could be detected for cbhB in the presence of glucose at 16 or 24 hours even after extending the number of PCR cycles to 60, indicating complete repression. Low levels of expression, representing an approximate 1000 fold reduction on the CMC grown levels, were detected for cbhA in glucose grown cultures. The promoter of the cbhB gene was chosen for the development of an inducible system as it showed optimal expression characteristics.

Reporter gene analysis of the cellobiohydrolase B promoter

It is supposed that transcriptional cis acting elements are generally restricted to lkb upstream of the initiation codon in filamentous fungi (Punt et al., 1995, MoI. Cell Biol. 15: 5688-5699). In order to ensure all elements were included in any construct, 1.2 kB of the cbhB upstream regulatory region was amplified by PCR and used in analysis of the promoter. Two plasmids were constructed using the cbhB promoter coupled to the lacZ reporter gene with the hygromycin marker gene hph, under control of the strong gpdA promoter, in opposite orientations. These constructs were used to transform A. fumigatus strain AF293. Transformant strains AFl 10-1 and AFl 10-2 from plasmid pMJB104 and strains AF201-1 and AF201-2 from plasmid pMJB201 were selected for further analysis. All strains showed no obvious phenotypic variation from the wild-type strain and carried only single copies of the transforming plasmid (data not shown). To study the regulation of the cbhB promoter over time, β-galactosidase activity was determined in crude protein extracts from mycelia. Low levels of native β-galactosidase activity were detected in the wild-type strain AF293 reaching a maximum of around 0.9 U per mg of protein 8 hours after transfer to CMC (Figure 2). No activity could be detected after 4 hours on glucose indicating that native B-galactosidase activity is repressed in the presence of glucose.

Transformant strains AFl 10-1 and AFl 10-2 showed similar reporter gene expression patterns. Levels of β-galactosidase activity significantly above basal levels could be seen after only 2 hours on CMC and activity increased dramatically at the 4-hour timepoint (Figure 2). In comparison no activity could be detected in the 4-hour glucose sample indicating complete repression of the artificial construct. Interestingly transformants that were generated using the pMJB201 plasmid, in which the cbhB promoter is divergent from the selectable marker, showed no β-galactosidase activity above basal levels even in the presence of CMC (Figure 2).

mRNA levels in transformant strains

To see if the absence of β-galactosidase activity in pMJB201 transformant strains (AF201-1 and —2) represented inactivity of the promoter, quantitative analysis of mRNA levels were performed using real-time PCR. Cultures were grown as for the β-galactosidase activity experiment and samples were taken 4 hours after transfer to inducing or repressing media.

Expression of the reporter gene could be detected in both pMJB104 transformed strains (AFl 10-1 and -2) and pMJB201 transformed strains (AF201-1 and -2). In AFl 10-1 and —2 transformants, under inducing conditions, lacZ levels were approximately a third of the control β-tubulin level, however expression could still be detected in repressing conditions at values 100 fold lower than that in the induced samples (Figure 3). In AF201-1 and AF201- 2 lacZ expression was approximately 300-fold less than β-tubulin levels under inducing conditions, accounting for the inability to detect β-galactosidase activity in these strains. Again under repressing conditions lacZ expression was 100 fold lower than under inducing conditions (Figure 3). Expression of the native cbhB could not be detected in any of the transformed stains under repressing conditions, mirroring the results from the wild-type-strain (data not shown) . However, under inducing conditions, expression of cbhB could be clearly seen (Figure 3). The levels of cbhB expression in the highly expressing lacZ strains AFl 10-1 and -2 were reduced approximately five-fold compared to the AF201-1 and -2 strains indicating that the activity of the reporter gene was impacting on the expression levels of the native cbhB gene (Figure 3).

The cbhB promoter can be used to regulate RNAi

Previous examples of regulated RNAi in A. fumigatus have showed incomplete recovery of the wild-type phenotype, presumably due to the leaky nature of the inducible promoters used. The strong regulation exhibited by the cbhB promoter suggests that it could provide an improved regulatory element for RNAi experiments.

We investigated the ability of the cbhB promoter, transcribed divergently from the marker gene hph, to control the expression of interfering RNA aimed at the albl gene which encodes polyketide synthetase involved in spore pigmentation. In &lb\^~ strains, conidia have white as opposed to the green-blue appearance of wild-type spores. Of four transformants containing the anti-sense construct pALBR2 (Figure 1) all showed a spore colour change compared to the wild-type strain when placed on inducing media, two (R2B and R2C) having pure white colonies indicative of complete repression of albl. When placed on repressing media R2B showed no obvious spore colour difference when compared to the wild-type strain, while R2C presented light green spores indicating partial reduction in albl activity.

Real-time PCR was performed on the R2B strain to assess expression of albl. In repressing conditions albl expression matched that of the wild-type strain indicating no RNAi was occurring. Upon induction, levels of albl expression were >98% less than the wild-type strain (Figure 4).

Claims

1. A method of expressing a polynucleotide sequence comprising expressing said sequence from a construct, wherein the construct comprises said sequence operably linked to a promoter comprising: (i) SEQ ID NO: I₃ or

(ii) a sequence which is at least 50% identical to SEQ ID NO:1, or (iii) a fragment of (i) or (ii)

2. A method for expression of a coding sequence in a host cell, comprising the following steps:

(a) providing a DNA construct comprising (i) a promoter DNA sequence SEQ ID NO:1; (ii) a DNA sequence at least 50% identical to (i); (iii) a DNA sequence capable of hybridizing with a DNA sequence of (i); (iv) a variant of any of (i) — (iii); or (v) a subsequence of any of the DNA sequences of (i) to (iv), and a coding sequence,

(b) transforming a suitable host cell with said DNA construct and

(c) expressing the coding sequence under the control of said promoter DNA sequence.

3. A method for production of a polypeptide encoded by a coding sequence that is under control of the promoter of the invention in a suitable fungal host comprising the following steps:

(a) providing a DNA construct comprising (i) a promoter DNA sequence SEQ ID NO:1; (ii) a DNA sequence at least 50% identical to (i); (iii) a DNA sequence capable of hybridizing with a DNA sequence of (i); (iv) a variant of any of (i) - (iii); or (v) a subsequence of any of the DNA sequences of (i) to (iv), and a coding sequence,

(b) transforming a suitable host cell with said DNA construct,

(c) culturing the suitable fungal host under suitable culture conditions conducive to expression of the polypeptide, and optionally.

(d) recovering the polypeptide from the culture medium or measuring the activity or presence of the polypeptide in the culture medium or a fraction prepared from it.

4. A method for altering the expression of a coding sequence encoding a polypeptide which is endogenous to a fungal host cell comprising the following steps: (a) providing a DNA construct comprising (i) a promoter DNA sequence SEQ ID NO: 1 ; (ii) a DNA sequence at least 50% identical to (i); (iii) a DNA sequence capable of hybridizing with a DNA sequence of (i); (iv) a variant of any of (i) - (iii); or (v) a subsequence of any of the DNA sequences of (i) to (iv), and all or part of a promoter and/or coding sequence corresponding to an endogenous gene,

(b) transforming a suitable host cell with said DNA construct,

(c) selecting for strains where the promoter construct has integrated into the genome to functionally replace the endogenous promoter, and

(d) observing mRNA expression, protein expression, protein function, or phenotype under inducing or suppressing conditions.

5. A method for altering expression of a gene by antisense comprising the following steps:

(a) providing a DNA construct comprising (i) a promoter DNA sequence SEQ ID NO:1; (ii) a DNA sequence at least 50% identical to (i); (iii) a DNA sequence capable of hybridizing with a DNA sequence of (i); (iv) a variant of any of (i) - (iii); or (v) a subsequence of any of the DNA sequences of (i) to (iv), and an antisense construct,

(b) transforming a suitable host cell with said DNA construct,

(c) expressing the antisense sequence under the control of said promoter DNA sequence, and optionally.

(d) observing the effect of anti-sense inhibition on the expression of the gene of interest directly or indirectly.

6. A method for altering expression of a gene by RNAi comprising the following steps: (a) providing a DNA construct comprising the (i) a promoter DNA sequence SEQ ID NO: 1 ;

(ii) a DNA sequence at least 50% identical to (i); (iii) a DNA sequence capable of hybridizing with a DNA sequence of (i); (iv) a variant of any of (i) - (iii); or (v) a subsequence of any of the DNA sequences of (i) to (iv), and an RNAi construct, (b) transforming a suitable host cell with said DNA construct, (c) expressing the RNAi sequence under the control of said promoter DNA sequence, and optionally

(d) observing the effect of RNAi on the expression of the gene of interest directly or indirectly.

7. A vector comprising a promoter as defined in any preceding claim associated with a coding sequence, endogenous promoter sequence, anti-sense construct or RNAi construct.

8. A host cell which is transgenic for a vector according to claim 7.

9. The host cell according to claim 7, wherein the host cell is an Aspergillus species.

10. The host cell according to claim 7, wherein the host cell is Aspergillus fumigatus .

11. A polynucleotide comprising a promoter as defined in an one of claims 1 to 6, and optionally further comprising a coding sequence operably linked to the promoter.

12. Use of a promoter as defined in any one of claims 1 to 6 to express a polynucleotide sequence.

13. A method, polynucleotide or use according to any one of claims 1 to 6, 11 or 12 wherein the promoter is operably linked to a heterologous sequence.

14. A method of repressing expression of a polynucleotides sequence comprising contacting a polynucleotide or construct as defined in any one of claims 1 to 7, 11 or 13 with suppressing conditions.