WO2007076115A2 - Nitrogen-efficient monocot plants - Google Patents

Abstract

Methods of increasing nitrogen utilization efficiency in monocot plants through genetic modification to increase the levels of alanine aminotransferase expression and plants produced there from are described. In particular, methods for increasing the biomass and yield of transgenic monocot plants grown under nitrogen limiting conditions compared to non-transgenic plants are described. In this way, monocot plants may be produced that maintain a desired yield while reducing the need for high levels of nitrogen application.

Description

NITROGEN-EFFICIENT MONOCOT PLANTS

CROSS REFERENCE TO RELATED APPLICATIONS

[001] This application claims the benefit of U.S. App. No. 60/753,818, filed on December 23, 2005.

FIELD OF INVENTION

[002] The invention relates to monocot plants having enhanced nitrogen utilization efficiency (NUE), to methods for enhancing NUE in monocot plants, and to methods of increasing biomass and seed yield in monocot plants grown under nitrogen limiting conditions. This invention also relates to monocot antiquitin promoters.

BACKGROUND OF THE INVENTION

[003] In many ecosystems, both natural and agricultural, the productivity of plants is limited by the three primary nutrients: nitrogen, phosphorous and potassium. The most important of these three limiting nutrients is usually nitrogen. Nitrogen sources are often the major components in fertilizers (Hageman and Lambert, I. Corn and Corn

Improvement, 3rd ed., Sprague & Dudley, American Society of Agronomy, pp. 431-461 , 1988). Since nitrogen is usually the rate-limiting element in plant growth, most field crops have a fundamental dependence on inorganic nitrogenous fertilizer. The nitrogen source in fertilizer is usually ammonium nitrate, potassium nitrate, or urea. [004] Each year, approximately 85 to 90 million metric tons (MMt) of nitrogenous fertilizers are added to the soil worldwide. This is up from only 1.3 MMt in 1930 and from 10.2 MMt in 1960. It is predicted to increase to 240 MMt by the year 2050 (Tilman et al, Proc. Nat. Acad. Sci. USA. 96: 5995-6000, 1999). It is estimated that 50% to 70% of the applied nitrogen is lost from the plant-soil system. Because MO₃ ^" is soluble and not retained by the soil matrix, excess NO₃ ^" may leach into the water and be depleted by microorganisms. In fact, most of the applied nitrogen is rapidly depleted by soil microorganisms, leaching, and other factors, rather than being taken up by the plants. [005] Increased nitrogen utilization efficiency by plants would have a number of beneficial effects. For example, nitrogen utilization efficient plants would be able to grow and yield better than conventional plants in nitrogen poor soils. The use of nitrogen efficient plants would reduce the requirement for the addition of nitrogenous fertilizers to crops. Since fertilizer application accounts for a significant percentage of the costs associated with crop production, such a reduction in fertilizer use would result in a direct monetary savings. [006] A reduction in fertilizer application would also lessen the environmental damage resulting from extensive nitrogenous fertilizer use. These detrimental effects of nitrogenous fertilizer use on the environment are manifested in increased eutrophication, acid rain, soil acidification, and the greenhouse effect. [007] Monocots represent a large percentage of the crops grown on the world's 3.7 billion acres of cultivable land. In the United States alone, over 80 million acres of maize, 59 million acres of wheat, 4 million acres of barley and 3 million acres of rice were planted in 2004.

[008] Given the worldwide requirements for monocots and the diminishing fertility of existing fields, it is desirable to generate monocot plants that are able to grow under suboptimal nutrient conditions. One means for accomplishing this goal is to generate monocot plants that can utilize nitrogen more efficiently. Such monocot plants would have the advantage of being able to grow in soils that are poorer in nitrogen, as a result of being able to more efficiently use the nitrogen that is available. Additionally, such monocot plants may demonstrate enhanced productivity in soils that have normal nitrogen levels as well.

[009] Rice is routinely used as the model crop for genetic and physiological studies in other monocot crops including maize, wheat, sugarcane, barley, sorghum, rye and grass. Because of its importance as a model crop, rice was the first crop plant to be sequenced. The International Rice Genome Sequencing Project, a consortium of publicly funded laboratories, completed the sequencing of the rice genome in December 2004.

Rice has a small, diploid genome that is well conserved and syntenic across monocots. It is easily transformed and transgenic studies have been performed in rice to study a number of phenotypic traits, including flowering, abiotic stress response, disease resistance, drought tolerance, and morphological development. [010] Because of the critical importance of nitrogen to plant growth, previous studies have attempted to increase the efficiency of nitrogen utilization in plants using a variety of means. These methods have included conventional breeding programs directed toward the development of plants that are more efficient at nitrogen utilization. Recombinant deoxyribonucleic acid (DNA) and transgenic plant methods have also been employed in an attempt to generate nitrogen efficient plants. [OHJ A variety of different genes have been over expressed in dicot plants to increase nitrogen use efficiency with variable results (for review, see Good et ah, Trends Plant Sci 9:597-605, 2004). However, monocots and dicots differ from each other in many ways including morphologically, developmental Iy, metabolically, phenotypically, and genetically. Because of these numerous differences, it would not be predictable that successful whether successful approaches to increase nitrogen utilization efficiency in dicots would necessarily work in monocots.

[012] In the dicot canola, over expression of the enzyme alanine aminotransferase (AIaAT) under the direction of the Brassica turgor gene-26 (also known as antiquitin) promoter elevates AIaAT levels and increases NUE (U.S. Patent No. 6,084, 153). However, whether over expression of AIaAT would increase NUE in monocot plants has not been previously reported. [013] Increasing NUE within monocot plants is desired within the art.

SUMMARY OF THE INVENTION [014] The invention addresses the need for monocot plants with enhanced growth characteristics and nitrogen utilization efficiencies when grown under low nitrogen conditions by providing such plants and methods for generating transgenic monocot plants with elevated levels of AIaAT.

[015] In one aspect, the invention provides transgenic monocot plants including a recombinant DNA sequence encoding an AIaAT. The transgenic monocot plant may be barley, rice, sugar cane, maize, sorghum, rye, wheat, or grass. Grass includes lawn, turfgrass, forage and the like. Preferably, the AIaAT is operably linked to a promoter, most preferably, a monocot antiquitin promoter. Seeds from the transgenic monocot plants are also provided. [016] In other embodiments, transgenic rice, maize, wheat, sorghum, barley, and sugar cane include a recombinant DNA sequence encoding an AIaAT and seeds therefrom. [017] In another aspect of the invention, a method of producing a transgenic monocot plant is provided including the steps of: (1) selecting a nucleic acid encoding an AIaAT, (2) selecting a promoter that is operable in a monocot plant, (3) coupling the selected nucleic acid to the selected promoter to form a genetic construct, (4) transforming a monocot plant cell with the genetic construct to form a transformed cell, and (5) growing a transgenic monocot plant from the transformed cell to produce a transgenic plant. In this embodiment, overexpression of AlaAT causes at least a 5% to 7.5%, 7.5 to 10%, IO to 15% or 15 to 20%, or more increase in plant biomass and/or seed yield when expressed in a transgenic monocot plant compared to the plant biomass or seed yield of a comparable monocot plant not expressing this construct when the plants are grown under suboptimal nitrogen conditions.

[018] In other embodiments of the invention, a similar methods of producing transgenic rice, maize, wheat, and sorghum plants are provided. [019] In yet another aspect of the invention, transgenic monocot plants are described wherein the transgenic monocot plant expresses a recombinant AlaAT and exhibits at least a 5% increase in plant biomass or seed yield compared to biomass or seed yield of a comparable plant lacking the recombinant AlaAT. Also described are seeds produced from the transgenic monocots. The monocots include but are not limited to, maize, wheat, rice, barley and rye. [020] A method for increasing biomass of a monocot plant by contacting and introducing into a plant an AlaAT coding region in operative linkage with monocot antiquitin promoter is described. Similar methods for increasing seed yield of a plant and are also provided. [021] The nucleic acids encoding AlaAT that are used in the genetic constructs of these inventions may be derived from any organism preferably a plant, and most preferably from a monocot plant including, but not limited to, barley, rice, sugar cane, rye, wheat, maize, or grass.

[022] In yet another aspect, the invention provides an isolated monocot antiquitin promoter sequence. The monocot promoter sequence may be from barley, rice, sugar cane, maize, sorghum, rye, wheat, or grass. In certain embodiments, it is a sorghum promoter that includes SEQ ID NO: 9 or an active fragment thereof. In other embodiments, it is a maize promoter that includes SEQ ID NO: 10 or an active fragment thereof.

1023] Also provided are methods of directing expression of a target gene by contacting and introducing into a plant a target gene in operative linkage with a monocot antiquitin promoter.

[024] Also described are genetic constructs, transformed plants, and plant seeds including a monocot antiquitin promoter sequence operatively linked with a target gene. Preferably, the target gene encodes a nitrogen utilization protein, such as, for example, a high affinity nitrate transporter, a low affinity nitrate transporter, an ammonium transporter, an ammonia transporter, an amino acid transporter, alanine dehydrogenase, glutamine synthetase, asparagine synthetase, glutamate synthase, glutamate 2:oxogluturate amino transferase, asparaginase, glutamate dehydrogenase, nitrate reductase, aspartate aminotransferase, or AIaAT.

BRIEF DESCRIPTION OF THE DRAWINGS [025] FIGURE 1 shows a schematic representation of the key steps in nitrogen utilization in a plant cell. Nitrate (NCV) is transported into the plant cell and converted to nitrite (NO₂ ^") by nitrate reductase (NR). Nitrite is translocated from the cytoplasm to the chloroplast where it is reduced by nitrite reductase (NiR) to ammonium (NH₄ ⁺). Glutamine synthetase (GS) functions in assimilating or recycling ammonium. An enzyme couple glutamine synthetase (GS)/glutamate synthase (GOGAT) catalyzes the conversion of glutamine (GIn) to glutamate (GIu). Glutamate is a building block of many amino acids. In addition, alanine is synthesized by the enzyme AIaAT from pyruvate and glutamate in a reversible reaction. [026] FIGURE 2 shows an alignment of the amino acid sequences (SEQ ID NO:s 29 to 45) of AIaAT from various organisms. Note that some of sequences used for these alignments are truncated sequences which contain less than the complete sequence of the cited AIaAT. The alignment was performed using the methionine (M) of the barley AIaAT sequence as the reference first residue. [027] FIGURE 3 shows an alignment of the amino acid sequences (SEQ ID NO:s 29 to 40) of AIaAT from various plant species. Note that some of sequences used for these alignments are truncated sequences that contain less than the complete sequence of the cited AIaAT. The alignment was performed using the methionine (M) of the barley AIaAT sequence as the reference first residue.

[028] FIGURE 4 shows the nucleotide sequence for the OS Ant 1 promoter of the invention (SEQ ID NO:!). The sequence was isolated using a blastn search of the National Center for Biotechnology Information (NCBI) database using the nucleotide sequence (366-3175 bp) of the Brassica btg26 gene (Stroeher et al., 1995, Plant MoI. Biol. 27:541-551) to identify the homologous rice nucleotide sequence (accession number AF323586). This sequence was then used in turn against the TIGR Oryza saliva sequencing project (see: tigr.org/tdb/e2kl/osal/), as set out in Example 1. The putative TATA box is shown in bold and the primers used in PCR amplifying the sequence from the rice genome are underlined.

[029] FIGURE 5 shows a schematic representation of the steps for producing the genetic construct OsAntlpro-Gus, using the reporter gene beta-glucuronidase (GUS) in accordance with the method described in Example 1. [030] FIGURE 6 shows a schematic representation of the steps for producing the genetic construct OsAntlpro-AlaAT in accordance with the method described in Example 1.

[031] FIGURE 7 shows expression of the GUS reporter gene directed by the

OsAntl promoter of the invention. Expression is present in the cell expansion area of root tips of developing roots (panel A); in root hairs of developing roots (panel B); and in lateral roots of roots (panel C) of an Oryza saliva plant transformed with the genetic construct OsAntl pro-Gus as shown in FIGURE 5, in accordance with the method described in Example 1. Darkly stained areas indicate expression of the GUS reporter gene. [032] FIGURE 8 shows the average dry weight biomass (grams) of Oryza sativa plants transformed with the genetic construct OsAntl pro-AlaAT as shown in FIGURE 6 compared to the average dry weight biomass (grams) of control, wild-type Oryza sativa plants grown under the same growth conditions as given in Example 1. [033] FIGURE 9 shows the average total seed weight (grams) of seeds collected from Oryza sativa plants transformed with the genetic construct OsAntl pro-AlaAT as shown in FIGURE 6 compared to the average total seed weight (grams) of seeds collected From control, wild-type Oryza sativa plants grown under the same growth conditions as given in Example 1.

[034] FIGURE 10 shows the relationship between dry weight biomass (grams) and total seed weight (grams) for each transgenic plant. [035] FIGURE 11 shows the nucleotide sequence of the sorghum antiquitin promoter of the invention (SEQ ID NO:9). The sequence was derived from accession CW033386 as described in Example 5 and includes 443 nucleotides of sequence upstream of the ATG start codon of a sorghum antiquitin gene. [036] FIGURE 12 shows the nucleotide sequence of a partial maize antiquitin promoter (SEQ ID NO: 10). The sequence was derived from accession BH215004 as described in Example 5 and contains 204-bp upstream of a maize antiquitin gene.

DETAILED DESCRIPTION

[037] Monocot plants having enhanced NUE, methods for enhancing NUE in monocot plants, and methods of increasing biomass and seed yield in monocot plants grown under nitrogen limiting conditions are described herein. Limiting nitrogen conditions are conditions under which the plant biomass or seed yield are reduced as a result of reduced nitrogen levels. Under such conditions, the plant biomass or seed yield can be increased by increasing the amount of available nitrogen by fertilization or other means. Limiting conditions are also known as suboptimal conditions. [038] Nitrogen assimilation and metabolism in plants occurs through the coordinated action of a variety of enzymes acting upon a variety of substrates (Figure 1). Nitrogen assimilation occurs primarily through the activities of glutamine synthetase (GS) and glutamate synthase (GOGAT). From the GS-GOGAT cycle, glutamate is used as a nitrogen source to supply nitrogen for other required metabolic reactions. The metabolic flow of nitrogen is principally mediated by transamination reactions in which an amino group of glutamate is transferred to other carbon skeletons. The transfer of the amino group from glutamate to these other carbon skeletons results in the disposition of nitrogen in more readily usable forms such as other amino acids like aspartate or alanine. Examples of such enzymes are the aminotransferases. Figure 1 shows the reaction catalyzed by the enzyme AIaAT which catalyzes the transfer of an amino group from glutamate to pyruvate thus generating alanine. [039] While not limiting the invention to a particular mechanism, it is believed that over expression of AIaAT increases nitrogen efficiency by depleting the available pools of nitrogen storing amino acids such as glulamate, which in turn leads to upreguiation of the uptake and assimilation pathways in the plant. By transferring an amino group from glutamate to pyruvate, the action of AIaAT depletes the pools of glutamate, a nitrogen storage compound. Moreover, the pool of alpha-ketoglutarate is replenished. To compensate for glutamate depletion, the plant increases uptake and assimilation of nitrogen to restore the balance. The increased uptake and assimilation activity allows the plant to more effectively utilize lower (suboptimal) levels of nitrogen present in the soil. [040] Monocot antiquitin promoters, such as rice, sorghum, and maize, are also described herein for use with any type of coding regions of interest. Definitions

[041] The language "transgenic" refers to a monocot plant that contains an exogenous nucleic acid molecule that can be derived from the same monocot plant species, from a heterologous plant species, or from a non-plant species.

[042] A "promoter" is a regulatory nucleic acid sequence, typically located upstream (5') of a gene or protein coding sequence that, in conjunction with various cellular proteins, is responsible for regulating the expression of the gene or protein coding sequence. Such promoters can be the full length promoter or active fragments thereof. By "active fragment" is meant a fragment that has at least about 0.1%, preferably at least about 10%, and more preferably at least about 25% of the activity of a reference promoter sequence as tested via methods known to those of skill in the art for detecting promoter activity, e.g., measurement of GUS reporter gene levels. DNA sequences necessary for activity can be identified by synthesizing various fragments and testing for expression or introducing point mutations in certain regions and testing for loss of activity.

[043] Heterologous fragments of promoters or other promoter sequences may be combined to mediate the activity of a promoter sequence. For example, the CaMV 35S promoter or other known promoter sequences may be combined with the promoter sequence described herein to mediate expression of a coding region of interest. |044] The language "coding region of interest" or "target gene" includes any gene that is desirably expressed in one or more than one plant tissue. Likewise, a "target protein" refers to any protein that is desirably expressed in one or more than one plant tissue. Examples of a coding region of interest which may advantageously be utilized in conjunction with the methods described herein include nucleic acid sequences that encode one or more than one protein involved in nitrogen assimilation, nitrogen utilization, nitrogen uptake or a combination thereof.

[045] The term "elevated levels" of a protein of interest, as used herein in reference to protein levels in a transgenic monocot plant, means higher levels of protein as compared to the protein levels of a corresponding monocot plant variety lacking the transgene such as an over expressed nucleic acid molecule encoding an AIaAT. [046] The gene constructs described herein can also include further enhancers, either translation or transcription enhancers, as may be required. These enhancer regions are well known to persons skilled in the art and can include the ATG initiation codon and adjacent sequences. The initiation codon must be in phase with the reading frame of the coding sequence to ensure translation of the entire sequence. The translation control signals and initiation codons can be from a variety of origins, both natural and synthetic. Translational initiation regions may be provided from the source of the transcriptional initiation region or from the structural gene. The sequence can also be derived from the promoter selected to express the gene and can be specifically modified to increase translation of the messenger ribonucleic acid (mRNA). |047] The gene constructs of the invention can further include a 3'-untranslated (or terminator) region that contains a polyadenylation signal and other regulatory signals capable of effecting mRNA processing or gene expression. Nonlimiting examples of suitable 3 -regions are the 3'-transcribed non-translated regions containing a polyadenylation signal of Agrobacterium tumor-inducing (Ti) plasmid genes such as the nopaline synthase {Nos gene), plant genes such as the soybean storage protein genes, and the small subunit of the ribulose-1 , 5-bisphosphate carboxylase (ssRUBISCO) gene. [048] By "operatively linked" or "operative linkage" it is meant that the particular sequences interact either directly or indirectly to carry out an intended function, such as mediation or modulation of gene expression. The interaction of operatively linked sequences may be mediated, for example, by proteins that interact with the operatively linked sequences. [049] The term "exogenous" as used herein in reference to a nucleic acid molecule means a nucleic acid molecule originating from outside the plant. An exogenous nucleic acid molecule can have a naturally occurring or non-naturally occurring nucleotide sequence. One skilled in the art understands that an exogenous nucleic acid molecule can be a heterologous nucleic acid molecule derived from the same plant species or a different plant species than the plant into which the nucleic acid molecule is introduced. Alternatively, it can be a nucleic acid molecule derived from a non-plant species such as fungi, yeast, bacteria or other non-plant organisms. [050] The following description is of a preferred embodiment. Overview of alanine aminotransferases (AIaATs)

[051 ] As a general class of enzymes, aminotransferases are pyridoxal phosphate- dependent enzymes that catalyze reactions known as transamination reactions. The transamination reaction catalyzed by aminotransferases involves the transfer of an α- amino group from an amino acid to the α-keto position of an α-keto acid. In the process, the amino acid becomes an α-keto acid while the α-keto acid acceptor becomes an α- amino acid. The specific aminotransferase, AIaAT, utilizes glutamate as the amino group donor and pyruvate as the amino group acceptor. Transamination of pyruvate to form alanine is found in virtually all organisms. Accordingly, enzymes with AIaAT activity are also found in virtually all organisms as well. This group of AIaATs forms a basis for the isolation and selection of the AIaATs of the invention. Identification of AIaATs

[052] Because most organisms possess AIaAT activity and enzymes, a number of methods can be used to identify and isolate these sequences from different species. Given the strong correlation between structure and function, one may use knowledge of the sequences of known members of the AIaAT family to collect additional family members that can serve as candidate AIaATs for use in the invention. [053] Database searching: One method that can be used to generate a group of

AIaAT sequences for use in the invention is database searching. Because the genomes of a number of organisms have been sequeπced, computer-based database searching based on amino acid or nucleic acid homology will reveal sequences which are homologous to a known AIaAT that is used as the query sequence. One common tool for such computer database searching is the BLAST program available from the NCBl. The NCBl Basic Local Alignment Search Tool (BLAST) (Altschu! et al., J. MoL Biol 215(3):403-410, 1990) is available from several sources, including the National Center for Biotechnology Information (NCBl, Bethesda, MD) and on the Internet, for use in connection with the sequence analysis programs blastp, blastn, blastx, tblastn and tblastx. It can be accessed at the NCBI website. A description of how to determine sequence identity using this program is available at the NCBl website. An example of using a BLAST program to identify members of the AIaAT family is described in Example 7. The use of computer programs such as Softberry and PSORT can be used to determine the subcellular localization of these enzymes to exclude enzymes that are targeted to less optimal sites, i.e., to the peroxisome.

[054J Among the methods for sequence alignment which are well known in the art are the programs and alignment algorithms described in: Smith and Waterman, J. MoL Biol. 147(1):195-197, 1981 ; Needleman and Wunsch, J. MoL Biol. 48(3):443-453, 1970; Pearson and Lipman, Proc. Nail. Acad. Sci. U. S .A. 85(8):2444-2448, 1988; Higgins and Sharp, Gene 73(l):237-244, 1988; Higgins and Sharp, Comput. Appl. Biosci. 5(2): 151-3. (1989); Corpet, Nucleic Acids Res. 16(22): 10881-90, 1988; Huang et al., Comput. Appl. Biosci. 8(2): 155-65, 1992; and Pearson et al., Methods MoL Biol. 25:365-389, 1994. Altschul et al. {Nature Genet. 6(2): 1 19-129, 1994) present a detailed consideration of sequence alignment methods and homology calculations.

[055] Depending upon the extent and placement of regions of homology, homologous sequences, identified using computer-based search methods such as those described above, can be reasonably suspected of encoding an AIaAT. Whether such a sequence actually encodes an AIaAT can be determined by a number of means. As a first indicator, the annotation to a GenBank entry is used. Many sequences have been previously identified and tested by investigators as corresponding to AIaAT activity and the annotation to such a GenBank entry would so indicate. [056] Alternatively, a sequence identified from a search can be tested experimentally to determine if it encodes an AIaAT activity. In the case of a nucleic acid sequence that has been identified, it can be isolated for testing using a variety of methods known in the art. For example, the sequence of interest can be amplified by polymerase chain reaction (PCR) using primers that correspond to the 5' and 3' ends of the complementary DNA (cDNA). Such PCR methods are well known in the art and are disclosed in sources such as the laboratory manual PCR Protocols: A Guide to Methods and Applications by M. Innes, et ah, Academic Press, 1989. Alternatively, the desired sequence can be obtained by conventional hybridization screening using oligonucleotides corresponding to the known nucleic acid sequence to screen a cDNA library. Screening methods based on hybridization are well known in the art and are disclosed in Sambrook, Fritsch and Maniatis, MOLECULAR CLONING: A LABORATORY MANUAL, 2nd edition, 1989; CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (F. M. Ausubel

[057] Once a DNA sequence encoding the candidate AIaAT has been obtained, it can be cloned into a variety of expression vectors using conventional molecular biological methods to verify that an AIaAT has been isolated. [058] The AIaAT coding region can be modified in any suitable way. For example, it can be modified to be transcribable and translatable in the plant system; for example, the nucleotide sequence encoding the AIaAT protein can be modified such that it contains all of the necessary poly-adenylation sequences, start sites and termination sites which allow the coding sequence to be transcribed to mRNA and the mRNA to be translated in the monocot plant. Further, the coding region may be modified such that its codon usage is more similar to that of native genes of the monocot plant {i.e., plant optimized sequence may be used). Such nucleotide sequence modifications and the methods by which they may be made are well known to one of skill in the art. [059] Many vectors for protein expression in E. coli, yeast, mammalian cells, or plants are commercially available. Expression of such a construct containing an AIaAT in an appropriate host cell, such as an E. coli, using a plamid such as pET vectors available from Novagen (www.Novagen.com), wilJ reveal if the plasmid encodes an AIaAT activity. Methods for assaying for AIaAT activity are well known in the art. One such method is disclosed in U.S. Patent No. 6,084,153, which is hereby incorporated by reference in its entirety. In this method, leaf tissue is weighed and then ground with sand in a mortar and pestle in extraction buffer containing 0.1 M Tris-HCl (pH 8.5), 10 mM dithiothreitol, 15% glycerol, and 10% (w/v) PVPP. The extract is clarified by centrifugation at 6000 rpm, and the supernatant was assayed for enzyme activity. Alanine is added to start the reaction as described. See Good and Crosby, Plant Physiol. 90: 1305-1309, 1989. This assay can be utilized for other organisms such as bacteria and yeast by simply substituting bacteria or yeast extract for the leaf tissue extract. [060] Hybridization and PCR methods: Other methods can be used to isolate

AIaATs that may be used in the invention. In particular, high, medium, or low stringency hybridization methods can be used to isolate orthologues or homologues of known AIaATs that maybe used in the practice of this invention. Hybridization conditions are sequence dependent and vary according to the experimental parameters used. Generally, stringent hybridization conditions are selected to be about 5° C to 20° C lower than the thermal melting point (T_m) for the specific sequence at a defined ionic strength and pH. The T_m is the temperature (under defined ionic strength and pH) at which 50% of the target sequence hybridizes to a perfectly matched probe. Conditions for nucleic acid hybridization and calculation of stringencies can be found in Sambrook el al. (1989) and Tijssen (Hybridization with Nucleic Acid Probes, Part II, pp. 415. Elsevier, Amsterdam, ^"Netherlands, 1993). Examples of factors that affect nucleic acid hybridization include: temperature, salt conditions, the presence of organic solvents in the hybridization mixtures, and the lengths and base compositions of the sequences to be hybridized and the extent of base mismatching. An example of high stringency conditions for hybridizing a probe to a filter-bound DNA is 5 X SSC, 2% sodium dodecyl sulfate

(SDS), 100 ug/ml single stranded DNA at 55-65° C overnight, and washing twice in 0.1 X SSC and 0.1% SDS at 60-65° C for 20 minutes.

[061 j Reduced stringency conditions can be used to isolate nucleic acid sequences that are related but have mismatches. Examples of such conditions include lowering the hybridization and wash temperatures or raising the salt concentrations of the wash solutions. Protocols for such medium and low stringency hybridization methods can be found in commonly used molecular biology manuals such as the aforementioned Sambrook, et al, and Ausubel, et al. references. [062] Other methods that can be used to isolate orthologues or homologues suitable for use in the invention include PCR cloning. Unique or degenerate primers can be designed to encode conserved regions in AIaAT nucleotide or amino acid sequences. Such conserved regions can be identified by aligning the sequences of known AIaATs using the alignments disclosed above. The PCR primers so designed can be used in PCR reactions to generate a portion of an AIaAT sequence from a species of interest which then can be used to isolate a full length cDNA by conventional library screening methods or by means of additional PCR methods such as Rapid Amplification of cDNA Ends (RACE). Protocols for such PCR methods are well known in the art and can be found in sources such as PCR Protocols: A Guide to Methods and Applications by M. Innes, et al., Academic Press, 1989. [063] An alternative strategy for identifying AIaATs for use in the invention entails the biochemical purification of AIaATs from a source of interest based on enzymatic activity. Because enzymatic assays for AIaAT activity are well known in the art, a skilled artisan would be able to fractionate a cell or tissue of interest and use conventional biochemical methods such as chromatography to purify an AIaAT to homogeneity. Such biochemical methods are available in sources such as Protein Purification: Principles and Practice by Robert K. Scopes, Springer Advanced Texts in Chemistry, 3rd edition, 1994; Guide to Protein Purification (Methods in Enzymology Series, Vol. 182, 1990) by Abelson et al., Protein Purification Techniques: A Practical Approach (Practical Approach Series, 2001) by Simon Roe (Editor). The AIaAT, once purified to homogeneity, can be used to derive partial amino acid sequences, from which oligonucleotides can be designed to clone the corresponding cDNA by conventional molecular biological methods such as library screening or PCR as described above. [064] Figures 2 and 3 and Tables 1 and 2 show alignments between AIaATs from a variety of species, ranging from E. coli to humans and including a number of plant species. The percent homologies range from over 90% to under 25% when the sequence of each AIaAT is compared with that of every other AIaAT as shown in Table 1. A number of highly conserved amino acid sequences that are present in all AIaAT sequences are highlighted in black in Figures 2 and 3. Such evolutionarily conserved amino acid sequences represent consensus sequences or sequence motifs that are characteristic of AIaATs. Frequently, such sequences form active sites or other functionally significant regions of a protein. Table 1

Tabic 2

Qverexpression of AIaATs in monocot plants

(065] Once an AIaAT has been identified and verified as corresponding to a bona fide AIaAT, a construct for overexpression of the AIaAT in a monocot plant of interest is generated using methods well known in the art. A variety of plasmids are available for this purpose as disclosed below. A variety of promoters such as constitutive promoters, various inducible promoters, or tissue-specific promoters can be used for expression. Promoters

[066] The promoters suitable for use in the constructs of this invention are functional in monocot plants and in host organisms used for expressing the constructs described. Many plant promoters are publicly known and several examples are listed below. These include constitutive promoters, inducible promoters, tissue- and cell- specific promoters and developmentally regulated promoters. Methods are disclosed below for the selection of promoters that are suitable for use in practicing the invention. [067] Promoters can be isolated by procedures well known in the art of plant molecular biology. Exemplary, but non-limiting, promoters that can be used in the practice of this invention include: the rice antiquitin (OsAntl) promoter, which is described in Example 1 below, as well as other antiquitin promoters, as described in Example 5 below; the rice actin 1 (Act-1) promoter, which is described in U.S. Patent No. 5,641,876; the maize ubiquitin-1 (Ubi-1) promoter, which is described in U.S. Patent Nos. 5,510,474, 6,054,574, and 6,977,325; the maize alcohol dehydrogenase- 1 (Adh 1 ) promoter, which is described in Kyozuka et al, MoI. Gen. Genet. 228(1 -2): 40-48, 1991 ; and the CaMV 35S and 19S promoters, which are described in U.S. Patent No. 5,352,605. For other promoters useful in monocots, see cambia.org'). [068] One type of promoter particularly useful for expression of a target gene such as AIaAT in a plant is a monocot antiquitin promoter. The rice antiquitin promoter is described in Example 1. Other antiquitin promoters are described in Example 5. Knowing the monocot antiquitin promoters disclosed in these Examples, one of skill could readily identify other monocot antiquitin promoters using methods similar to those described in Example 1 for identification of the rice antiquitin promoter using the btg 26 gene. For example, the sequence can be subject to analysis with a promoter prediction software such as the TSSP plant promoter prediction software found at http://softberry.com to identify likely TATA box sequences and other promoter sequence elements and further analyzed for promoter motifs that may be recognition sites for transcription factors using Signal Scan Software (Prestridge, 1991 ; available at bimas.dcrt.nih.gov/molbio/signal). [069] Sequences likely to encode promoters can be confirmed by synthesizing various fragments and testing for expression or introducing point mutations in certain regions and testing for loss of activity using any assay system known to those of skill in the art as being useful for measuring the promoter activity, such as expression of a reporter gene under the control of a promoter sequence. Reporter genes can be any polynucleotide the transcription of which under the control of a promoter sequence, the subsequent translation thereof, or both, can be readily detected by a skilled artisan. The reporter gene does not have to encode a full length protein. In some instances, the reporter gene can even be an oligonucleotide. Most commonly, the reporter gene encodes a protein with detectable activity. Common reporter genes include GUS, luciferase, GFP, beta-galactosidase, CAT, alkaline phosphatase, etc. In preferred embodiments, the reporter gene is GUS.

(070J The expression of the reporter gene can be measured at either the mRNA or protein level using any method known to those of skill in the art. For example, mRNA levels can be detected using a cell-free transcription assay. Alternatively, protein levels can be measured by detecting enzyme activity, using antibodies specific for the protein, or a transcription-translation assay, which allows detection of both the mRNA level and the protein or peptide level.

[071] Promoters from genes that are regulated similarly to the aπtiquitin genes in plants might also find use in the invention. These genes could be turgor responsive genes that are expressed in root tissues and could be induced by ABA and/or under stress conditions such as drought and salt.

Transformation methods

[072| After a suitable construct has been made, transgenic plants of interest can be generated using transformation methods well known in the art and described herein as well as in the Examples below. An exogenous nucleic acid molecule can be introduced into a monocot plant for ectopic expression using a variety of transformation methodologies including Agrobacterium-mediated transformation and direct gene transfer methods such as electroporation and microprojectile-mediated transformation (see, generally, Wang et al. (eds), Transformation of Plants and Soil Microorganisms, Cambridge, UK: University Press, 1995, which is incorporated herein by reference).

Transformation methods based upon the soil bacterium, Agrobacterium lumefaciens, are particularly useful for introducing an exogenous nucleic acid molecule into a seed plant. The wild-type form of Agrobacterium contains a Ti (tumor-inducing) plasmid that directs production of tumorigenic crown gall growth on host plants. Transfer of the tumor- inducing T-DNA region of the Ti plasmid to a plant genome requires the Ti plasmid- encoded virulence genes as well as T-DlMA borders, which are a set of direct DNA repeats that delineate the region to be transferred. An Agrobacterium-based vector is a modified form of a Ti plasmid, in which the tumor inducing functions are replaced by the nucleic acid sequence of interest to be introduced into the plant host. [073] Agrobαcterium-mεd^'iated transformation generally employs cointegrate vectors or, preferably, binary vector systems, in which the components of the Ti plasmid are divided between a helper vector, which resides permanently in the Agrobacterium host and carries the virulence genes, and a shuttle vector, which contains the gene of interest bounded by T-DNA sequences. A variety of binary vectors are well known in the art and are commercially available, for example, from Clontech (Palo Alto, CA).

Methods of co-culturing Agrobacterium with cultured plant cells or wounded tissue such as root explants, hypocotyledons, stem pieces or tubers, for example, also are well known in the art (Glick and Thompson, Methods in Plant Molecular Biology and Biotechnology. CRC Press, Boca Raton, FL, pp 179-20519, 1993). Wounded cells within the plant tissue that have been infected by Agrobacterium can develop organs fife novo when cultured under the appropriate conditions; the resulting transgenic shoots eventually give rise to transgenic plants that ectopically express a nucleic acid molecule encoding an AIaAT protein. Agrobacterium also can be used for transformation of whole seed as described in Bechtold et al., CR. Acad. Sci. Paris. Life Sci. 316:1 194-1 199, 1993, (which is incorporated herein by reference).

transformation is useful for producing a variety of transgenic seed plants (Wang et αi, supra, 1995). [074] Microprojectile-mediated transformation also can be used to produce a transgenic plant that ectopically expresses AIaAT. This method, first described by Klein et al. {Nature 327:70-73, 1987, which is incorporated herein by reference), relies on microprojectiles such as gold or tungsten that are coated with the desired nucleic acid molecule by precipitation with calcium chloride, spermidine or PEG. The microprojectile particles are accelerated at high speed into a plant tissue using a device such as the BIOLISTIC PD- 1000 (Biorad, Hercules, CA).

[075] Microprojectile-mediated delivery or "particle bombardment" is especially useful to transform plants that are difficult to transform or regenerate using other methods. Microprojectile-mediated transformation has been used, for example, to generate a variety of transgenic plant species, including cotton, tobacco, maize, hybrid poplar and papaya (see G lick and Thompson, supra, 1993) as well as cereal crops such as wheat, oat, barley, sorghum and rice (Duan et al, Nature Biotech. 14:494-498, 1996; Shimamoto, Curr. Opin. Biotech. 5:158-162, 1994; each of which is incorporated herein by reference). In view of the above, the skilled artisan will recognize that

Agrobacterium-medlated or microprojectile-mediated transformation, as disclosed herein, or other methods known in the art can be used to produce a transgenic seed plant of the invention.

1076] Alternative gene transfer and transformation methods useful in the invention include, but are not limited to, liposomes, electroporation or chemical-mediated uptake of free DNA, calcium phosphate co-precipitation techniques, and micro- or macro injection, direct DNA transformation, and may involve Ti plasmids, Ri plasmids, or plant virus vectors. Such transformation methods are well documented in the art. Growth and NUE assays [077] The resulting transgenic plant of interest are tested for expression of the

AIaAT transgene and those plant lines that express the AIaAT transgene are tested for the effect of the expressed transgene on plant growth or nitrogen utilization. Suitable tests for monocot plant growth can include a variety of assays such as measuring plant height, seed weight, stem diameter, number of plant leaves, plant biomass as measured in fresh weight or dry weight of roots, leaves, shoots, buds, and flowers, to name but a few such measurement parameters. Tests for NUE can include growth of transgenic plants under different suboptimal nitrogen conditions. Tests may be Field test, greenhouse or growth chamber tests or in vitro tests. Plants may be grown hydroponically in Perlite™, other commercially available growing material, soil, or in agar-based media. Use of monoeot antiquitin promoters to direct expression of other coding regions [078] Monoeot antiquitin promoters can also be used to direct expression of coding regions other than AIaAT.

[079] The coding region of interest, or target gene, operatively linked to the monoeot antiquitin promoter may be any nucleotide sequence that is desirably expressed within a plant. General classes of coding regions which may be advantageously employed in the methods and constructs of the invention include nucleotide sequences encoding structural proteins; proteins involved in the transport of nitrogen; proteins involved in the uptake of nitrogen; proteins involved in both the transport and uptake of nitrogen; enzymes and proteins involved in nitrogen utilization; proteins involved in plant resistance to pesticides or herbicides; proteins involved in plant resistance to nematodes, viruses, insects, or bacteria; proteins involved in plant resistance to stress, for example but not limited to osmotic, temperature, pH, or oxygen stress; proteins involved in stimulation or continuation of plant growth; proteins involved in phytoremediation; or proteins having pharmaceutical properties or encoding enzymes which produce compounds having pharmaceutical properties. [080] For example, the coding region of interest may encode a nitrogen utilization protein and, in particular, an enzyme that assimilates ammonia into amino acids or uses the formed amino acids in biosynthetic reactions. This protein may be selected from, but not limited to, a nitrate transporter (high or low affinity), an ammonium transporter, an ammonia transporter, an amino acid transporter, alanine dehydrogenase, glutamine synthetase (GS), asparagine synthetase (AS), glutamate synthase (also known as glutamate 2:oxogluturate amino transferase and GOGAT), asparaginase (ANS), glutamate dehydrogenase (GDH), nitrate reductase, aspartate aminotransferase (AspAT), AIaAT, and other known aminotransferases. Such proteins are disclosed in US Patent Application Publication Number 2005/0044585, which is hereby incorporated by reference in its entirety. 1081] The target gene or coding region of interest may be naturally expressed in the plant or it may be heterologous to the plant. The gene may originate from any source, including viral, bacterial, plant or animal sources. Preferably, the coding region of interest is heterologous to the monocot antiquitin promoter sequence to which it is operatively linked, in that it is not from the gene the monocot antiquitin promoter sequence is naturally linked to.

[082] The coding region can be modified in any suitable way in order to engineer a gene with desirable properties. The coding region can be modified to be transcribable and translatable in the plant system; for example, the nucleotide sequence encoding the protein of interest can be modified such that it contains all of the necessary poly- adenylation sequences, start sites and termination sites which allow the coding sequence to be transcribed to mRNA (messenger ribonucleic acid) and the mRNA to be translated in the plant. Further, the coding region may be modified such that its codon usage is more similar to that of native genes of the plant (i.e., plant optimized sequence may be used). Such nucleotide sequence modifications and the methods by which they may be made are well known to one of skill in the art.

[083] The methods and constructs described herein allow the production of plants and seeds having expression of one or more desired genes in the plant. There is a wide variety of possible applications of the plants described herein, including, but not limited to, the production of plants having increased stress tolerance, improved nitrogen uptake, improved nitrogen utilization, improved nutrient content, improved nutrient yields of desired compounds, and phytoremediative properties. Specific applications are further described below. [084] The following examples further demonstrate several preferred embodiments of this invention. While the examples illustrate the invention, they are not intended to limit the invention.

EXAMPLES

Example 1: Demonstration of NUE in rice expressing barley AIaAT Identification and characterization of a rice antiquitin promoter COsΛntl ) [085] The nucleotide sequence (bp 366-3175) of the btg26 gene (Stroeher et al.,

Plant MoI. Biol. 27:541-551, 1995; accession number S77096) was used to search the nucleotide database at NCBl using the blastn search tool. A rice sequence (accession number AF323586) was identified and this nucleotide sequence was used to search the TIGR Oryza sativa sequencing project (tigr.org/tdb/e2kl/osal/). The rice homologue of btg26, Oryza sativa antiquitin (OsAntl), was identified on chromosome 9 of rice (accession number AP005570; 100216-91996 base pairs). A 973-bp sequence

(nucleotides 101 1 89-100216 of AP005570) upstream of the start codon of OsAnt l is shown in Figure 4 (SEQ ID NO: 1 ).

[086] The sequence of the 403 bps upstream (5') of the ATG start codon of the

OsAntl gene was selected for further analysis. To determine if the sequence was likely to function as a promoter sequence, the sequence was analyzed using the TSSP plant promoter prediction software found at http://softberry.com/. The analysis predicted that the sequence was a plant promoter sequence. The most likely location of the TATA box (bold in Figure 4), as well as other promoter sequence elements, was determined. (087J Since the projected OsAnt l promoter sequence was predicted to contain promoter elements according to the Softberry analysis, the sequences were analyzed for promoter motifs that may be recognition sites for transcription factors using Signal Scan Software (Prestridge, Compvt Appl Biosci 7(2):203-6, 1991 ; http://bimas.dcrt.nih.gov/molbio/signal). Five different signal sequences were predicted in the OsAntl promoter, including ADRl , DBF-A, GAL4, HSTF and RAF transcription factor binding sites.

[088] The OsAnt l sequence was compared to nucleic acid sequences of btg26 promoter sequences from Brassica napus and Arabidopsis using the ClustalW 1.8 multiple sequence alignment software on the BCM Search Launcher homepage (searchlauncher.bcm.tmc.edu/) and BOXSHADE server (ch.embnet.org/software/BOX_forrn.html). Inspection of conserved nucleotides revealed that the Brassica and Arabidopsis turgor gene-26 promoter sequences are more similar to each other than to the OsAntl sequence. A feature among all three promoter sequences (rice, Brassica, Arabidopsis) is the polypyrimidine (CT) tracts evident within the nucleotide sequences. These tracts range from 20-22 bases and are found just upstream of the probable TATA boxes in all three promoter sequences. Furthermore, the OsAntl sequence has a second polypyrimidine tract just upstream of the ATG start codon. Cloning of a rice antiquitin promoter

[089] Rice genomic DNA was isolated from cv. Kitaake. The following PCR primers (positions underlined in Figure 4) corresponding to the OsAntl promoter region were selected: Primer 1 : AGGAAGTGATTTTTAGCGTAGCTG (SEQ ID NO:2);

Primer 2: ATGGCAGAAGAGAGAGAGAGAGAGG (SEQ ID NO:3). [090] Touch-down PCR was conducted using rice genomic DNA and the above primers. A 975-bp fragment was produced. The amplified PCR fragment was ligated into pCR^®II-TOPO vector (Invitrogen) and transformed into E. coli, TOP 10 cells. The resulting piasmid is designated pT-riceOsAntl pro.

[091 J Sequence analysis indicated that the 975-bp PCR fragment encodes a promoter sequence designated the OsAntl promoter sequence. Comparison of the OsAntl promoter from cv. Kitaake with that of cv. Nipponbare (obtained from the database) revealed that they share 99.9% identity. The putative TATA box was found 145-bps upstream of the start codon.

Production of the OsAntlpro-GUS construct

[092] The beta-glucuronidase (GUS) reporter gene driven by OsAntl was produced using the steps shown schematically in Figure 5. The RiceOsAntl pro-GUS construct was produced by amplifying the pT-RiceOsAntlpro template using the following primers:

[093] Primer 3: EcoRI-OsAntl promoter sequence GGAATTCAGGAA GTGATTTTT

(SEQ ID NO:4)

[094] Primer 4: NcoI-OsAnt 1 promoter sequence CATGCCATGGATGGCAGAAGA

(SEQ 1D NO:5) [095J The resultant PCR fragments were ligated into the plant binary vector, pCAMBlA 1305.1 , digested with EcoRl and Ncol to produce a pCAMBlA 1305.1- riceOsAntlpro-GUS construct. The EcoRI and Ncol sequences at the end of primers 3 and 4, respectively, allowed insertion of the PCR fragment into the pCAMBlA1305.1 vector, replacing the existing CaMV35s promoter with the OsAntl promoter sequence. The Ncol sequence (CCATGG) includes a Met codon, ATG, which is in frame with the GUS reporter gene and allows expression of the GUS reporter gene from the OsAntl promoter sequence.

Production of the OsAntlpro-AlaAT construct

1096] The barley AIaAT gene driven by OsAntl was produced using the steps shown schematically in Figure 6. The RiceOsAntl pro-AlaAT construct was produced by amplifying the pT-RiceOsAnt 1 pro template using the following primers:

[097] Primer 3: EcoRl-OsAntl promoter sequence GG AATTCAGG A AGTG ATTTTT

(SEQ ID NO:4)

[098] Primer 5: Pstl-OsAntl promoter sequence AACTGCAGATGGCAGAAGA (SEQ ID NO.-6)

[099] The resultant PCR fragments, digested with EcoRl and Pstl, were ligated into the plant binary vector, pCAMBIA1300, and digested with EcoRl and Pstl to produce pCAMBl A 1300-riceOsAnt 1 pro.

[01001 ^An AIaAT DNA fragment was amplified by PCR using pAGOOl as a template. pAGOOl is described in U.S. Patent No. 6,084,153 where it is identified as pbtg26/AlaAT/nos. It contains the btg26 promoter linked to the barley AIaAT gene with a nopaline synthase terminator. The barley AlaAT/nos terminator sequences were amplified from pAGOOl using the following primers;

10101J Primer 6: PstlAlaAT sequence AACTGCAGATGGCTGCCACCG (SEQ ID NO:7)

[0102] Primer 7: HindlH-NOS terminator sequence CCCAAGCTTCCCGATCTAGTA

(SEQ ID NO:8)

[0103] The resulting AlaAT/nos fragment was digested with Pst and Hindlll and ligated into the pCAMBIA 1300-riceOsAntl pro digested with Pstl and Hindlll to produce a pCAMBlAHOO-riceOsAntl pro-AlaAT construct.

Transformation of rice

[0104] Rice transformation methods are well known in the art (Sridevi et al., Current Sci.

88: 128-132, 2005; Saharan et al, African J. Biotech 3(1 1):572-575, 2004; Khanna e/ al.,

Aust. J. Plant Physiol. 26:3 1 1-324, 1999; Zhang et al, Molecular Biotechnology 8(3):223-231₅ 1988; Rashid et al, Plant Cell Rep. 15:727-730, 1996; AIdemita and

Hodges, Planta 199:612-617, 1996; Hiei et al., Plant J. 6:271-282, 1997; Li et al., Plant Cell Rpt 12:250-255, 1993; Christou el al, Biotechnology 9:957-962, 1991). Agrobacterium-med^'iated transformation of rice was carried out as modified from U.S. Patent No. 5,591 ,616 as described below.

J0105] pCAMBlA l SOS. l -riceOsAntl pro-GUS and pCAMBlA πOO-riceOsAnt l pro- AIaAT were transferred into Agrobacteriυm strain EHA 105 (Hood et al., Transgenic Res. 2: 208-21 8, 1993) by electroporation (Sambrook et al., supra, 1989). Agrobactehum cells were plated on solid AB medium (Chilton et al., Proc. Natl. Acad. ScL USA 71 :3672-3676, 1974) containing 50 mg/1 kanamycin and incubated at 28° C for 3 days. The bacteria were then collected with a flat spatula and resuspended in liquid co- cultivation medium (R.2-CL, Table 3) by gentle vortexing prior to transforming the rice tissues.

[0106] Mature seeds of rice (Orγza saliva L. cv. Nipponbare) were used in the transformation experiment. The seeds were dehusked and surface sterilized by dipping (1 min) in 70% (v/v) ethanol followed by soaking in 50% bleach plus 0.1 % Tween-20 for 10 min and then rinsing five times in sterile distilled water. Following sterilization, seeds were cultured on callus induction medium (NB, Table 3) and incubated for three weeks in the dark at 28°C.

J0107] Table 3. Medium used for callus induction, inoculation, co-culture, resting phase, selection, regeneration and rooting Medium Composition

NB^H N6 major salt and iron source (Chu ( 1975) Sci. Sin. 5:

Callus induction medium 659-668) + B5 major salts and vitamins (Oamborg et

(filter sterilize) al. ( 1968) Exp. Cell Res. 50: 1 51 -158) + 3AA (100 mg/1 L-tryptophan + 500 mg/1 L-proline + 500 mg/l L- glutamine) ^■+^■ 500 mg/1 casein hydrolysate + 2.0 mg/1 2,4-D + 0.5 mg/1 picloram + 30 g/1 sucrose, pH 5.8, 0.3% gelrite

R2-CL R2 major and minor salts, vitamins and iron source

Liquid co-culture medium without sucrose (Ohira et al. (1973) Plant and Cell

(filter sterilize) Physiol. 14: 1 1 13-1 121) + 0.25 M glucose + 125 μM acetosyringone + 10 mM MES buffer, pH 5.2 + 50 mM potassium phosphate buffer, pH 5.2 + 400 mg/I L- cysteine + 2.0 mg/1 2,4-D + 0.5 mg/1 picloram + 0.5 mg/I BAP, pH 5.2

R2-CS R2 major and minor salts, vitamins and iron source

Solid co-culture medium without sucrose (Ohira et al. (1973) Plant and Cell (filter sterilize) Physiol. 14: 1 1 13-1 121) + 0.25 M glucose + 125 μM acetosyringone + 10 mM MES buffer, pH 5.2 + 50 mM potassium phosphate buffer, pH 5.2 + 400 mg/1 L- cysteine + 2.0 mg/1 2,4-D + 0.5 mg/1 picloram + 0.5 mg/1 BAP, pH 5.2 + 0.3% gelrite

R2-AS R2 major and minor salts, vitamins and iron source

Resting phase without sucrose + 0.25 M sucrose + 0.5 mM (filter sterilize) acetosyringone + 10 mM MES buffer, pH 5.0 + 50 mM potassium phosphate buffer, pH 5.0 + 10 mM CaC l₂ +

400 mg/1 L-cysteine + 2.0 mg/1 2,4-D + 0.5 mg/1 picloram + 0.5 mg/1 BAP + 250 mg/1 cefotaxime + 250 mg/1 amoxicillin, pH 5.0, 0.3% gelrite

R2S R2 major and minor salts, vitamins and iron source +

Selection medium 30 g/1 sucrose + 2.0 mg/1 2,4-D + 0.5 mg/1 picloram + (filter sterilize) 50 mg/1 hygromycin + 250 mg/1 cefotaxime + 100 mg/1 amoxicillin, pH 5.8, 0.3% gelrite

NBS NB medium + 3AA + 2.0 mg/1 2,4-D + 0.5 mg/I

Selection medium-ll Picloram + 50 mg/1 hygromycin + 250 mg/I cefotaxime

(filter sterilize) + 100 mg/t amoxicillin, pH 5.8, 0.3% gelrite

PRN NB medium + 3AA + 5 mg/1 ABA + 2 mg/1 BAP + 0.5

Pre-regeneration medium mg/1 NAA + 50 mg/1 hygromycin + 100 mg/1

(filter sterilize) cefotaxime + 50 mg/1 amoxicillin, pH 5.8, 0.4% gelrite

RN NB medium + 3 mg/1 BAP + 0.5 mg/1 NAA + 50 mg/1

Regeneration medium hygromycin + 100 mg/1 cefotaxime + 50 mg/1

(filter sterilize) amoxicillin, pH 5.8, 0.4% gelrite

R '/4MS (Murashige and Skoog (1962) Physiol. Plant 15: Rooting medium 473-497) + 50 mg/i hygromycin*³ + 100 mg/l

(Autoclave/filter sterilize) cefotaxime + 50 mg/l amoxicillin, pH 5.8, 0.3% gelrite

³NB medium with 1.25 mg/l CUSO₄ "Optional

[0108] After three weeks, 3-5 mm long embryogenic nodular units released from the scutellum-derived callus at the explant/medium interface were immersed into 25 ml of liquid co-culture medium (R2-CL, Table 3) containing Agrobacterium cells at the density of 3-5 x 10⁹ cells/ml (ODβoo ⁼ 0 in a 100 mm-diameter Petri dish for 10-15 minutes. Embryogenic units were then blotted dry on sterilized filter paper, transferred to a Petri dish containing solid co-culture medium (R2-CS, Table 3) and incubated for three days at 25°C in the dark. Co-cultured embryogenic calli were then transferred to resting medium (R2-AS, Table 3) and incubated at 28°C in the dark for a week. [0109J After a week, uncontaminatcd embryogenic units were then individually transferred to selection medium (R2S, Table 3) containing hygromycin for selection of transformed tissue and incubated at 28°C in the dark. Following 3 weeks of selection on R2S medium, the embryogenic units that turned dark brown with brownish protuberances arising throughout the callus surface were transferred to NBS selection medium (Table 3). After 5 weeks of co-culture, the protuberances developed into brownish globular structures that were gently teased apart from callus and incubated for 2 weeks in the resealed Petri dish. After 2 weeks, these globular structures converted into round shaped, compact and yellowish calli.

[0110] The putatively transgenic, hygromycin-resistant calli were gently picked out, transferred, cultured on pre-regeneration medium (PRN, Table 3) and then incubated for a further week. All of the resistant calli originating from a single co-cultured embryogenic nodular unit were grouped in a sector of the PRN dish. Creamy-white, lobed calli with a smooth and dry appearance were individually transferred to regeneration medium (RN, Table 3), incubated for 2 days in the dark, then maintained for three weeks under a 12/12-h (day/night) photoperiod with light provided at an intensity of 55 μmo l/m per sec. Green shoots regenerating from a resistant callus were dissected and sub-cultured in test tube containing rooting medium (R, Table 3) for 1 -2 weeks to promote vigorous roots and tillers before being transferred to pots in growth rooms. Transgenic plants were grown to maturity in 16-cm pots containing soil-less potting mixture (Metromix 220). Plants were maintained in growth rooms set to 28° C and 14/10 hours day/night photoperiods. Fertilizer was applied twice a week starting two weeks after planting in pots. The fertilizer mix contained 225 g 20/20/20 fertilizer, 50 g of plant micronutrients, 6.1 g of CuSO₄.5H₂O, 140 g FeEDTA, 13.8 g ZnSO₄.7H₂0, 260 g

MgSO₄.7H₂O, 3.7 g H₃BO₃ for a total of 712.4 g. Two grams of the fertilizer mix are dissolved in 8 liters of water and applied twice a week to 24 plants.

Analysis of expression directed by the OsAntl promoter sequence

[0111] Induction of expression directed by the OsAntl promoter sequence was examined using rice plants transformed with the OsAntl pro-GUS construct. Plants were germinated and grown hydroponically in sterile conditions in Magenta jars. Two-week- old plants were stained for in vivo GUS activity by injecting into the root media 5 mis of 50 mM phosphate buffer (pH 7.5) containing 0.2 mM X-gluc (5-bromo-4-chloro-3- indolyl-beta-glucuronic acid) and incubating the plants in this media for 1-24 hours. Root tissue was then viewed under a dissection microscope and photographs were taken, which are shown in Figure 7.

[0112] Dark stained areas in Figure 7 indicate expression of the GUS reporter gene. There is no expression of the GUS reporter gene driven by the OsAntl promoter in the root tip (specifically the dividing cells); however, expression begins very quickly in the cell expansion zone, just behind the root tip. The OsAntl promoter sequence directed expression of the GUS reporter gene in the root hairs as well. Further from the root tip in more mature roots, expression is lost from the main root, but lateral roots stain very heavily, indicating that OsAntl directs expression in these lateral roots very strongly. Analysis of transformed rice plants containing the AIaAT construct [0113] Fifty-eight OsAntl /A laAT/NOS transgenic plants were generated and measurements for flowering, tiller number, seed weights and biomass at maturity were recorded for the To generation plants.

|0114] The dry weight biomass of OsAntl/AlaAT plants and control plants was measured at maturity, and the data is presented in Figure 8. The average biomass of the transgenic OsAnt l/AlaAT plants was higher than the average biomass of control plants. [0115] Seeds were collected from OsAntl/AlaAT plants and control plants at maturity and the total weight of the seeds was measured. The results are shown in Figure 9, which shows that the total seed weight of seeds collected from OsAntl/AlaAT plants was higher than that of the seed weight from control plants. [01 J6J Figure 10 shows the relationship between dry weight biomass and total seed weight for each transgenic plant. A substantially linear correlation is shown, which indicates that an increase in biomass results in a corresponding increase in total seed weight in OsAntl/AlaAT plants. [0117] These results indicate that OsAntl/AlaAT transgenic plants are capable of optimizing the utilization of available nutrients thereby resulting in an increase in plant biomass, seed yield or a combination thereof.

Example 2: Demonstration of NUE in maize using OsAntl/barley AIaAT The OsAntl -pro-AlaAT construct can be incorporated into suitable plant binary vectors for use in Agrobacterium-mediated transformation of maize. Many methods for transformation of immature embryos of maize using a variety of selectable markers are known in the art (Ishida et αl, Nature Biotech. 14:745-750, 1996; Lupotto, Maydica 44:21 1-218, 1999; Zhao et al, Molec. Breeding 8:323-333, 2001; Frame et al, Plant Physiol 129: 13-22, 2002 and Miller et al., Transgenic Res. 1 1 :381 -396, 2002, U.S. Patent No. 5,591 ,616. Contract production of transgenic maize plants is also available through facilities such as the Plant Transformation Facility, Iowa State University, Ames, Iowa.

10118] Alternatively, the OsA ntlpro-A IaAT sequence can be used similarly in biolistic transformation methods for maize (Wright et al, Plant Cell Reports 20(5):429-436, 2001 ; Brettschneider et al, Theorel. Appl Genet. 94:737-748, 1997; Gordon-Kamm et al, Plant Cell 2(7):603-6l 8, 1990; Fromm et al, Biotechnology (N Y). 8(9):833-9. 1990). [0119] Maize plants can be tested forNUE by measurement of biomass and seed yield during growth under various nitrogen fertilizer regimes including limiting nitrogen. Plant biomass can be fresh weight or dry weight, total plant weight, leaf weight or root weight. Suboptimal nitrogen conditions are those conditions in which nitrogen concentrations limit growth. Under such conditions, addition of added nitrogen such as fertilizer will increase growth. For each of these tests, biomass and seed yield can be evaluated in growth chamber, greenhouse or field tests . Example 3: Demonstration of NUE in wheat using OsAntl/barley AIaAT [0120] Similar to maize, the OsAntl-pro-AlaAT construct can be used for particle-gun bombardment transformation methods of wheat (Pastori et al, J. Exp. Bot. 52(357):857- 863, 2001 ; Becker et al, Plant J. 5:299-307, 1994) or incorporated into suitable plant binary vectors for use in Λgrobactenum-med'iated transformation of wheat (Cheng et αl, Plant Physiol. 1 15:971-980, 1997; U.S. Patent Application US2003/0024014A l) Other methods for wheat transformation are established in the art. (0121 J Wheat plants can be tested for NUE by measurement of biomass and seed yield during growth under various nitrogen fertilizer regimes including limiting nitrogen. Plant biomass can be fresh weight or dry weight, total plant weight, leaf weight or root weight. Suboptimal nitrogen conditions are those conditions in which nitrogen concentrations limit growth. Under such conditions, addition of added nitrogen such as fertilizer will increase growth. For each of these tests, biomass and seed yield can be evaluated in growth chamber, greenhouse or field tests .

Example 4: Demonstration of NUE in sorghum using OsAntl/barley AIaAT [0122] Λgrobacteήum-mediated sorghum transformation of immature embryos with a binary vector containing any of the OsAnt promoter/AlaAT constructs can be achieved according to methods established in the art (Zhao et αl., Plant MoI. Biol. 44(6):789-98, 2000; Gao et al, Genome 48(2):321-33, 2005; Zhao, Z. Y., Methods MoI Biol 343:233- 44, 2006; Howe et al, Plant Cell Rep. 25(8):784-91, 2006).

[0123] Sorghum plants can be tested for NUE by measurement of biomass and seed yield during growth under various nitrogen fertilizer regimes including limiting nitrogen. Plant biomass can be fresh weight or dry weight, total plant weight, leaf weight or root weight. Suboptimal nitrogen conditions are those conditions in which nitrogen concentrations limit growth. Under such conditions, addition of added nitrogen such as fertilizer will increase growth. For each of these tests, biomass and seed yield can be evaluated in growth chamber, greenhouse or field tests. Example 5: Identification of alternate (antiquitin) promoter sequences for use in NUE constructs

10124] Other antiquitin promoter sequences useful in monocots can be identified in sequence databases. As described for isolation of the rice promoter in Example 1 , the nucleotide sequence (bp 366-3175) of the btg26 gene (Stroeher et al., Plant MoI. Biol. 27:541-551 , 1995; accession number S77096) is used to search the nucleotide database at NCBI using the blastn search tool. In addition to the rice sequence identified, other monocot antiquitin sequences are identified in the nr database including sorghum (accession number U87982), maize (accession numbers AY103614 and BT017791), cocoa (Theobroma cacao; accession number DQ448866; and Curculigo latifolia, accession number X641 10). ESTs for wheat, sugarcane and switchgrass can also be identified in databases using the identified rice antiquitin nucleotide or amino acid sequences using various search algorithms. [01251 Similar to the identification of the OsAntl promoter, a sorghum promoter sequence was identified by using the rice nucleotide sequence of the antiquitin clone (accession number AF323586) in a BLAST search of the sorghum sequences in the NCBl Genome Sequence Survey (gss) Database. Clone CW033386 was identified as containing 443 nucleotides of sequence upstream of the ATG start codon of a sorghum antiquitin gene (SEQ ID NO:9, Figure 1 1). This sequence can be used as a promoter sequence alone or methods to clone and sequence larger genomic fragments can be used to identify sequences further upstream. These fragments can be parts of BAC sequences or from further genome sequencing efforts in sorghum or the like. One skilled in the art could also walk-up the genome using methods such as inverse PCR and genome walking kits. [0126J An upstream sequence of the maize antiquitin gene was identified in a BLAST search using the sequence of the rice antiquitin clone against the Zea mays sequences in the NCBI Genome Survey Sequences Database. Accession BH2i 5004 was identified as containing a 204-bp sequence upstream of a maize antiquitin gene (SEQ ID NO: 10, Figure 12). This sequence can be used as a promoter sequence alone or methods to clone and sequence larger genomic fragments can be used to identify sequences up to 1.5 kb upstream of this particular antiquitin gene. Sequences including the longer promoters could be used to design promoter/A IaAT gene constructs as described below.

Example 6: Construction of alternate expression cassettes for NUE constructs

[0127] Promoter cassettes for expression of various genes are constructed by combining the promoter of interest with a nos terminator with convenient restriction sites in between the promoter and terminator for gene cloning. Other restriction sites flank the promoter and terminator to facilitate movement of the cassette to a binary vector for plant transformation.

[0128] A base vector containing the nos terminator is constructed by PCR amplifying the nos region contained in the binary vectors described in U.S. Patent No. 6,084,153 with the primers NOSupper2: 5'-CCTAGGCCATGGTTCAAACATTTGGCAATAAAGTTT-

3' (SEQ ID NO: 1 1) and NOSlower: 5'-

TTAATTAACGATCTAGTAACATAGATGACA-3' (SEQ 1D NO: 12). NOSupper2 supplies Avrll and Ncol restriction sites at the 5'-end of the nos terminator and NOSlower supplies a Pacl site at the 3'end of the amplified fragment. PCR was performed using the BD Advantage™ 2 PCR kit following manufacturer's instructions.

The resulting 263 bp fragment is cloned into pCR^®2.1 -TOPO^® vector using a TOPO TA

Cloning^® Kit (Invitrogen) and One Shot^® E. coli cells following manufacturer's instructions. This plasmid is Nos/PCR2.1. [0129] The Ncol site in the kanamycin resistance gene in the Nos/pCR2.1 backbone is removed using the QuikChange^® XL Site-Directed Mutagenesis Kit (Stratagene) following manufacturer's instructions. Primers that may be used to introduce a silent nucleotide change are NcoIpCR2.1 Lower 5'-

GCAGGCATCGCCATGAGTCACGACGAGATC-3' (SEQ ID NO: 13) and NcoIpCR2.1 Upper 5'-GATCTCGTCGTGACTCATGGCGATGCCTGC-S' (SEQ ID

NO: 14). Deletion of the Ncol site may be verified by restriction analysis and growth of the E. coli on kanamycin. This resulting plasmid is Nos/pCR2.1 mut.

[0130] An alternative expression cassette for expressing genes from the OsAntl promoter is made in the following manner. The OsAntl promoter is cloned from rice var. Nipponbare genomic DNA (made by manufacturer's recommendation, Sigma Extract-n-

AMP™) using PCR. Primers for a slightly longer version of the OsAntl promoter than that shown in SEQ ID NO: 1 are: Forward primer 5'-

ATTAAACCTAGGTTAATTAAGTTTAAACGACCTATAAAGTCAAATGCAAAT- 3' (SEQ ID NO: 15) and reverse primer 5 -

TTTAATTCATGAGACGTCTTTGCGATCGCGCAGAAGAGAGAGAGAGAGAGGT 5 AG - 3' (SEQ ID NO: 16).

[01311 The forward primer incorporates Avr II, Pad and Pmel restriction sites and the reverse primer incorporates BspHl, Aat II and AsiSI and restriction sites to facilitate further cloning steps. The resulting 1.1 kb fragment (corresponding to nucleotides 101336-100216 of AP005570) is cloned into pCR®2.1-TOPO® vector using a TOPO

I O TA cloning® Kit (Invitrogen) and One Shot E. coli cells following manufacturer's instructions. The resulting plasmid is digested with restriction enzymes Avr II and BspH l and is cloned into Nos/pCR2.1 mut that has been digested with Avr 11 and Ncol . The resulting construct has an OsAntl promoter and a nos3'-region with unique AsiSI and AatII sites between them for cloning genes of interest. The expression cassette is flanked

15 by Avr II, Pac I, and Pme I restriction sites on the 5 '-end and a Pacl restriction site on the 3'-end to facilitate movement into a plant binary expression vector. [0132] An expression cassette utilizing a sorghum Ant promoter is designed in a similar manner. Forward primer 5 '- ATTAAACCTAGGTTAATTAAGTTTAAACGATTCGACAATATTTATCAAAT- S' 0 (SEQ ID NO: 17) and reverse primer 5 -

TTTAATTCATGAGACGTCTTTGCGATCGCGGCGCCGGCGGCGTTGGCAGGT- 3' (SEQ ID NO: 18) can be used to amplify a 443-bp Ant promoter (SEQ ID NO:9) from sorghum genomic DNA as described above for the OsAntl promoter and rice DNA. The cloned promoter

25 fragment is flanked by Avrll, Pac 1 and Pme 1 restriction sites on the 5'-end and BspHl, Aat II and Asi SI sites on the 3'-end. The promoter fragment is digested with restriction enzymes Avr II and BspH l and is cloned into Nos/pCR2.tmut that has been digested with Avr II and Ncol . The resulting construct has a sorghum Ant promoter and a nos3'- region with unique AsiSI and Aat Il sites between them for cloning genes of interest. The

30 expression cassette is flanked by Avr II, Pac I, and Pme I restriction sites on the 5'-end and a Pacl restriction site on the 3'-end to facilitate movement into a plant binary expression vector.

[0133] An expression cassette utilizing a maize Ant promoter (see Example 5) is also designed in a similar manner to that described for the rice and sorghum. Promoter regions from other antiquitin genes can also be used as they are identified from genome sequencing projects and other technologies.

Example 7: Identification and cloning of alternate alanine aminotransferase (AIaAT) genes for use in NUE constructs [0134] Aminotransferases are enzymes which catalyze the reversible transfer of amino groups from amino acids to oxo acids. They can be divided into four subgroups based on mutual structural relatedness (Mehta et ai, Eur. J. Biochem. 214(2):549-561, 1993). AIaAT enzymes catalyze the reversible interconversion of alanine and 2-oxoglutarate to pyruvate and glutamate and belong to subgroup 1. In addition to the barley alanine aminotransferase, other alanine aminotransferases are useful for conferring NUE in monocots.

10135J To identify homologous AIaAT genes, the barley AIaAT protein sequence (NCBl accession number CAA81231) was used as a query to search the ^"NCBI protein sequence database using the BLAST algorithm. Genes with a high degree of sequence homology to barley AIaAT were found in all major classes of eukaryotes. Related sequences were also found in bacteria. A tBlastn search of the NCBI EST database revealed that AIaAT homologs are widespread in plants, but because most of these sequences were not full length they were not analyzed further. As additional genomic sequences for monocots become available, additional homologs may be identified using these methods. [0136] Full length sequences identified in the BLAST search were further analyzed using the AlignX program (part of Vector NTI program suite, lnvitrogen). A lineup of representative sequences and the corresponding homology table using sequences from a range of organisms is shown in Figure 2 and Table 1. The most homologous sequences were plant sequences. A lineup of representative plant sequences and the corresponding homology table is shown in Figure 3 and Table 2. Note that some of sequences used for these alignments have been truncated so that they contain less than the complete sequence of the cited AIaAT. The alignment was performed using the methionine (M) of the barley AIaAT sequence as the reference first residue. mRNA isolation and cDNA synthesis

[0137] Tissue for RNA isolation was prepared from maize (A 188) and rice (Nipponbare) in the following manner. Seeds were germinated in H₂O on germination paper at 24°C in a sealed bag (maize, rice). After 7 days root tissue was collected and stored in RNAlater^® (Ambion) for RNA isolation. Seedlings of pepper {Capsicum annuum, Pepper Hot Asia, Santaka, Botanical Interests Broomfϊeld, CO) were sterilized and germinated in half strength MS and whole seedlings were used. Leaves from soil-grown Arabidopsis plants (Columbia 0) were used.

10138] RNA was prepared from the plant tissues using the RNAqueous™-4PCR kit (Ambion). cDNΛ was synthesized from purified RNA using the Superscript Hl platinum^® 2-step q-RT-PCR kit (Invitrogen) as per the manufacturer's instructions. PCR amplification of AIaAT [0139] AIaAT genes may be amplified by PCR from cDNA from many sources including maize {Zea mays), rice {Otyza sativa), Arabidopsis thaliana, or pepper {Capsicum annuum). The template for barley (Hordeum vulgarβ L. cv Himalaya) AIaAT is plasmid pAGOOl (obtained from Allen Good, University of Alberta) which contains the barley AIaAT coding sequences as described in Muench and Good, 1994, GenBank accession CAA81231. PCR primers contain an AsiS I restriction site on the 5'-end and an Aat II restriction site at the 3 '-end to facilitate cloning into expression cassettes. The primer pairs for the individual genes are listed below: [0140] Barley Fw: 5'~ ATTAAAGCGATCGCACCATGGCTGCCACCGTCGCCGTGGA-S' (SEQ ID NO: 19) [0141] Barley Rv: 5'-TAGTGAGACGTCTTAGTCACGATACTCTGACA-S' (SEQ ID NO: 20)

[0142] Maize Fw: 5'-

ATTAAAGCGATCGCACCATGGCCGCCAGCGTCACCGTGGA-S' (SEQ ID NO: 21) [01431 Maize Rv: 5-TAGTGAGACGTCTTAGTCGCGGTACTCGGCCAA-S' (SEQ ID NO: 22) [0144] Rice Fw: 5 '-ATTAAAGCGATCGCACCATGGCTGCTCCCAGCGTCGCCGT-

3' (SEQ ID NO: 23)

[0145] Rice Rv: 5'-TAGTGAGACGTCTCAGTCGCGGTACGCTGCCATGAA-S'

(SEQ ID NO: 24) [0146] Arabidopsis AtI gl 7290 Fw:5'-

ATTAAAGCGATCGCACCATGCGGAGATTCGTGATTGGCCAA-S' (SEQ ID NO:

25)

[0147] Arabidopsis At I gI 7290 Rv: 5'-

TAGTGAGACGTCTTAGTCGCGGAACTCGTCCATGAA-3' (SEQ ID NO: 26) [0148] Pepper Fw: 5'-ATTAAAGCGATCGCACCATGGATTCCATCACTATrGAT-S'

(SEQ ID NO: 27)

[0149] Pepper Rv: 5'-TAGTGAGACGTCTTAGCCGCAGAATTCATCCAT-S' (SEQ

ID NO: 28)

[0150] AIaAT genes may be amplified using the BD Advantage™ 2 PCR kit following manufacturer's instructions (Clontech, Mountain View, CA). The resulting PCR products may be purified using QIAquick™ Purification Kit (Qiagen®, Hilden,

Germany) and digested with AsiSI and Aat Il restriction enzymes. The products may be ligated to the OsAntl, sorghum Ant or maize Ant expression cassettes described above that have been digested with AsiSI and Aat II restriction enzymes. [0151] The AIaAT gene in each of the expression constructs is sequence verified for PCR fidelity and integrity of the ATG start codon.

Example 8: Binary vector construction and plant transformation.

[0152] The Ant promoter/AlaAT gene/nos 3' expression cassettes are cloned into a binary vector for plant transformation by digestion with Pmel and Pacl and ligation with pARC 1 10 digested with the same enzymes. pARCl 10 is an Agrobacterium binary vector originally based on pZPl OO (Hajdukiewicz et al, Plant MoI. Biol. 25, 989-994,

1994). pARCl 10 utilizes a Basta selectable marker driven by a CaMV 35S promoter and a nos terminator. The selectable marker is located near the left border, and the unique restriction sites Xba I, Avr II, Pac 1, and Pst I have been engineered close to the RB for gene cloning. The chloramphenicol bacterial selectable marker in the backbone of pZPlOO was also replaced with the kanamycin resistance gene (nptlϊl) from the pCAMBlA 1304 vector (found on the internet at the site cambia.org.au'). [0153] The promoter/AlaAT/nos 3' gene binary vectors can be introduced into Agrobacteήum turnefaciens strains for Agrobacterium-mediateά transformation of monocot crop plants or vector DNA is used for particle gun bombardment methods of plant transformation.

Example 9: Use of alternate antiquitin/AlaAT constructs in rice transformation using selection on bialophos [0154] Agrobαcteriurn-med\ated rice transformation with the OsAntl /AIaAT construct, or any alternate Ant/AlaAT construct, is achieved using a transformation method based on the method described in U.S. Patent No. 7,060,876 and European Patent No. 672752B1. A detailed description follows.

[0155] Plasmids were transferred into Agrobαcterium strain EHA 105 (Hood el αl., Transgenic Res. 2: 208-218, 1993) by electroporation (Sambrook el at. in Molecular Cloning, A Laboratory Manual Cold Spring Harbor, N.Y.: Cold Spring Harbor

Laboratory Press, 1989). Agrobacterium cells were plated on solid AB medium (Chilton el al, 1974) containing 50 mg/1 kanamycin and incubated at 28° C for 3 days. The bacteria were then collected with a flat spatula and resuspended in liquid co-cultivation medium (R2-CL, Table 4) by gentle vortexing prior to transforming the rice tissues. [0156] Mature seeds of rice (Oryza sativa L. cv. Nipponbare) were used in the transformation experiment. The seeds were dehusked and surface sterilized by dipping (1 min) in 70 % (v/v) ethanol followed by soaking in 50% bleach plus 0.1% Tween-20 for 10 min and then rinsing five times in sterile distilled water. Following sterilization, seeds were cultured on callus induction medium (N6C, Table 4) and incubated for three weeks in the dark at 26°C.

[0157] Table 4. Medium used for callus induction, inoculation, co-culture, resting phase, selection, regeneration and rooting

Medium Composition

N6C N6 major salt, iron source, minor salts and vitamins

Callus induction medium (Chu (1975) Sc/. Sin. 5: 659-668) + 3AA (100 mg/1

(autoclave) myo-inositol + 500 mg/1 L-proline + 500 mg/1 L- glutamine) + 300 mg/1 casein hydrolysate + 2.0 mg/1 2,4-D + 30 g/1 sucrose, pH 5.8, 0.35% gellan gum

R2-CL R2 major and minor salts, vitamins and iron source

Liquid co-culture medium without sucrose (Ohira et al. (1973) Plant and Cell (filter sterilize) Physiol. 14:1 1 13-1 121) + 0.25 M glucose + 125 μM acetosyringone + 2.0 mg/1 2,4-D, pH 5.2

R2-CS R2-CL + 0.35% gellan gum

Solid co-culture medium

(filter sterilize)

N6S N6C medium + 200 mg/1 Timentin + 7.5 mg/1

Selection medium bialaphos, pH 5.8

(filter sterilize)

RN MS medium (Murashige & Skoog (1962) Physiol Plant

Regeneration medium 15: 473-497) + 2 mg/1 kinetin + 0.02 mg/1 NAA + 200 mg/1 Timentin + 7.5 mg/1 bialaphos, pH 5.8, 0.35% gellan gum

R Vi strength MS medium (Murashige & Skoog (1962)

Rooting medium Physiol. Plant 15: 473-497) + 100 mg/1 Timentin, pH 5.8, 0.35% gellan gum

[0158] After three weeks, 3-5 mm long embryogenic nodular units released from the scutellum-derived callus at the explant/medium interface were immersed into 25 ml of liquid co-culture medium (R2-CL, Table 4) containing Agrobacterium cells at the density of 10⁹ cells/ml (OD_60O = 0.3) in a 100 mm-diameter Petri dish for 10-15 minutes. Embryogenic units were then blotted dry on sterilized filter paper, transferred to a Petri dish containing solid co-culture medium (R2-CS, Table 4) and incubated for three days at 25°C in the dark. Co-cultivated embryogenic calli were then transferred to N6 liquid medium containing 400 mg/1 Timentin for disinfection and placed for 4 hours on an orbital shaker (100 rpm) at 26°C in the dark. After dry blotting on sterile filter paper, calli were placed on N6 selection medium (N6S, Table 4) and kept at 26°C in dark. 10159] After 4 weeks of culture, uncontaminated embryogenic units had developed into large yellowish globular structures that were transferred onto fresh N6S medium and cultured for another 4-5 weeks at 26°C in dark.

[0160] The globular structures had proliferated many round-shaped, compact and yellowish calli. These putatively transgenic, bialaphos-resistant calli were gently picked out, transferred and cultured on regeneration medium (RH, Table 4), incubated for 1 week in the dark, then maintained for 4-5 weeks under a 14/10 hours day/night photoperiod with light provided at an intensity of 70 μmol/m per sec. Green shoots regenerating from a resistant callus were dissected and sub-cultured in culture vessels containing rooting medium (R, Table 4) for 2 weeks to promote vigorous roots and tillers before being transferred to 2-inch pots filled with sterile Sunshine Mix #3. The transgenic plantlets were acclimated by maintaining them in growth rooms set to 26° C, 14/10 hours day/night photoperiod and high humidity. Fertilizer was applied three times a week starting two weeks after planting in pots. The fertilizer mix is Simmons Solution (San Joaquin Sulphur Co., Lodi, CA) with addition of calcium nitrate. Sixteen g of Simmons and 6Og of calcium nitrate are mixed for 40 gallons of fertilizer. [0161 ] Nitrogen efficient monocol plants including but not limited to maize, sorghum, barley, wheat, rye and grass can be developed using the methods outlined in the above examples. [0162] The invention has been described with regard to one or more embodiments.

However, it will be apparent to persons skilled in the art that a number of variations and modifications can be made without departing from the scope of the invention as defined in the claims. The following statements of the invention are intended to characterize possible elements of the invention according to the foregoing description given in the specification. Because this application is a provisional application, these statements may be changed upon preparation and filing of the complete application. Such changes are not intended to affect the scope of equivalents according to the claims issuing from the complete application, if such changes occur. [0163] All citations are hereby incorporated by reference.

Claims

WE CLAIM:

1. A transgenic monocotplant comprising a recombinant DNA sequence encoding an alanine aminotransferase.

2. The transgenic monocot plant of claim 1 wherein said monocot is selected from the group consisting of barley, rice, sugar cane, maize, sorghum, rye, wheat, and grass.

3. The transgenic monocot plant of claim 1 further including a promoter operably linked to said recombinant DNA sequence.

4. The transgenic monocot plant of claim 3 wherein said promoter is an antiquitin promoter.

5. The transgenic monocot plant of claim 1 , wherein said alanine aminotransferase is a plant alanine aminotransferase.

6. The transgenic monocot plant of claim 5, wherein said plant alanine aminotransferase is a monocot alanine aminotransferase.

7. The transgenic monocot plant of claim 6, wherein said monocot alanine aminotransferase is selected from the group consisting of barley, rice, sugar cane, maize, sorghum, rye, wheat and grass alanine aminotransferases.

8. Seed from the plant of claim 1.

9. A transgenic rice plant comprising a recombinant DNA sequence encoding a monocot alanine aminotransferase.

10. The transgenic rice plant of claim 9 wherein said monocot alanine aminotransferase is selected from the group consisting of barley, rice, sugar cane, maize, sorghum, rye, wheat and grass alanine amino transferases.

1 1. Seed from the rice plant of claim 9.

12. A transgenic maize plant comprising a recombinant DNA sequence encoding a monocot alanine aminotransferase.

13. The transgenic maize plant of claim 12 wherein said monocot alanine aminotransferase is selected from the group consisting of barley, rice, sugar cane, maize, sorghum, rye, wheat and grass alanine amino transferases.

14. Seed from the maize plant of claim 12.

15. A transgenic wheat plant comprising a recombinant DNA sequence encoding a monocot alanine aminotransferase.

16. The transgenic wheat plant of claim 15 wherein said monocot alanine aminotransferase is selected from the group consisting of barley, rice, sugar cane, maize, sorghum, rye, wheat and grass alanine amino transferases.

17. Seed from the wheat plant of claim 15.

18. A transgenic sorghum plant comprising a recombinant DNA sequence encoding a monocot alanine aminotransferase.

19. The transgenic sorghum plant of claim 18 wherein said monocot alanine amino transferase is selected from the group consisting of barley, rice, sugar cane, maize, sorghum, rye, wheat and grass alanine amino transferases.

20. Seed from the sorghum plant of claim 18.

21 . A transgenic barley plant comprising a recombinant DNA sequence encoding a monocot alanine aminotransferase.

22. The transgenic barley plant of claim 21 wherein said monocot alanine aminotransferase is selected from the group consisting of barley, rice, sugar cane, maize, sorghum, rye, wheat and grass alanine amino transferases.

23. Seed from the barley plant of claim 21.

24. A transgenic sugar cane plant comprising a recombinant DNA sequence encoding a monocot alanine aminotransferase.

25. The transgenic sugar cane plant of claim 24 wherein said monocot alanine aminotransferase is selected from the group consisting of barley, rice, sugar cane, maize, sorghum, rye, wheat and grass alanine aminotransferases.

26. Seed from the sugar cane plant of claim 24.

27. A method of producing a transgenic monocot plant comprising the steps of: (1) selecting a nucleic acid encoding an alanine amino transferase, (2) selecting a promoter that is operable in a monocot plant, (3) coupling the selected nucleic acid to the selected promoter to form a genetic construct, (4) transforming a monocot plant cell with the genetic construct to form a transformed cell, and (5) growing a transgenic monocot plant from the transformed cell to produce a transgenic monocot plant wherein expression of said nucleic acid in said monocot plant causes at least a 5% to 7.5%, 7.5 to 10%, 10 to 15% or 15 to 20%, or more increase in plant biomass and/or seed yield when expressed in a transgenic monocot plant compared to the plant biomass or seed yield of a comparable monocot plant not expressing said construct when the plants expressing the construct and not expressing the construct are grown under suboptimal nitrogen conditions.

28. The method of claim 27 wherein said alanine aminotransferase is selected from the group consisting of barley, rice, sugar cane, maize, sorghum, rye, wheat and grass alanine amino transferases.

29. A method of producing a transgenic rice plant comprising the steps of: (1) selecting a nucleic acid encoding an alanine amino transferase, (2) selecting a promoter that is operable in a rice plant, (3) coupling the selected nucleic acid to the selected promoter to form a genetic construct, (4) transforming a rice plant cell with the genetic construct to form a transformed rice cell, and (5) growing a transgenic rice plant from the transformed rice cell to produce a transgenic rice plant wherein expression of said nucleic acid in said transgenic rice plant causes at least a 5% to 7.5%, 7.5 to 10%, 10 to 15% or 15 to 20%, or more increase in plant biomass and/or seed yield when expressed in a transgenic rice plant compared to the plant biomass or seed yield of a comparable rice plant not expressing said construct when the rice plants expressing the construct and not expressing the construct are grown under suboptimal nitrogen conditions.

30. The method of claim 29 wherein said alanine amino transferase is selected from the group consisting of barley, rice, sugar cane, maize, sorghum, rye, wheat and grass alanine amino transferases.

31. A method of producing a transgenic maize plant comprising the steps of: (1) selecting a nucleic acid encoding an alanine amino transferase, (2) selecting a promoter that is operable in a maize plant, (3) coupling the selected nucleic acid to the selected promoter to form a genetic construct, (4) transforming a maize plant cell with the genetic construct to form a transformed maize cell, and (5) growing a transgenic maize plant from the transformed maize cell to produce a transgenic maize plant wherein expression of said nucleic acid in said maize plant causes at least a 5% to 7.5%, 7.5 to 10%, 10 to 15% or 15 to 20%, or more increase in plant biomass and/or seed yield when expressed in a transgenic maize plant compared to the plant biomass or seed yield of a comparable maize plant not expressing said construct when the maize plants expressing the construct and not expressing the construct are grown under suboptimal nitrogen conditions.

32. The method of claim 31 wherein said alanine aminotransferase is selected from the group consisting of barley, rice, sugar cane, maize, sorghum, rye, wheat and grass alanine amino transferases.

33. A method of producing a transgenic wheat plant comprising the steps of: (1) selecting a nucleic acid encoding an alanine amino transferase, (2) selecting a promoter that is operable in a wheat plant, (3) coupling the selected nucleic acid to the selected promoter to form a genetic construct, (4) transforming a wheat plant cell with the genetic construct to form a transformed wheat cell, and (5) growing a transgenic wheat plant from the transformed wheat cell to produce a transgenic wheat plant wherein expression of said nucleic acid in said wheat plant causes at least a 5% to 7.5%, 7.5 to 10%, 10 to

15% or 15 to 20%, or more increase in plant biomass and/or seed yield when expressed in a transgenic wheat plant compared to the plant biomass or seed yield of a comparable wheat plant not expressing said construct when the wheat plants expressing the construct and not expressing the construct are grown under suboptimal nitrogen conditions.

34. The method of claim 33 wherein said alanine aminotransferase is selected from the group consisting of barley, rice, sugar cane, maize, sorghum, rye, wheat and grass alanine amino transferases.

35. A method of producing a transgenic sorghum plant comprising the steps of: (1) selecting a nucleic acid encoding an alanine amino transferase, (2) selecting a promoter that is operable in a sorghum plant, (3) coupling the selected nucleic acid to the selected promoter to form a genetic construct, (4) transforming a sorghum plant cell with the genetic construct to form a transformed sorghum cell, and (5) growing a transgenic sorghum plant from the transformed sorghum cell to produce a transgenic sorghum plant wherein expression of said nucleic acid in said sorghum plant causes at least a 5% to 7.5%, 7.5 to 10%, 10 to 15% or 15 to 20%, or more increase in plant biomass and/or seed yield when expressed in a transgenic sorghum plant compared to the plant biomass or seed yield of a comparable sorghum plant not expressing said construct when the sorghum plants expressing the construct and not expressing the construct are grown under suboptimal nitrogen conditions.

36. The method of claim 35 wherein said alanine aminotransferase is selected from the group consisting of barley, rice, sugar cane, maize, sorghum, rye, wheat and grass alanine amino transferases.

37. A transgenic monocot plant expressing a recombinant alanine aminotransferase wherein said transgenic monocot plant exhibits at least a 5% increase in plant biomass or seed yield compared to a comparable monocot plant lacking seed recombinant alanine aminotransferase when said transgenic plant and said comparable plant are grown under suboptimal nitrogen conditions.

38. Seed from the transgenic monocot plant of claim 37.

39. The transgenic monocot plant of claim 37 wherein said monocot plant is selected from the group consisting of maize, rice, wheat, barley and rye.

40. The transgenic monocot plant of claim 37 wherein said alanine aminotransferase is selected from the group consisting of barley, rice, sugar cane, maize, sorghum, rye, wheat and grass alanine amino transferases.

41 . An isolated monocot antiquitin promoter sequence.

42. The isolated monocot antiquitin promoter sequence of claim 41 , wherein said monocot antiquitin promoter sequence is selected from the group consisting of barley, rice, sugar cane, maize, sorghum, rye, wheat, and grass antiquitin promoter sequences.

43. The isolated monocot antiquitin promoter sequence of claim 42, wherein said monocot antiquitin promoter sequence is a sorghum antiquitin promoter sequence.

44. The isolated monocot antiquitin promoter sequence of claim 43, wherein said sorghum antiquitin promoter sequence comprises SEQ ID NO: 9 or active fragments thereof.

45. The isolated monocot antiquitin promoter sequence of claim 42, wherein said monocot antiquitin promoter sequence is a maize antiquitin promoter sequence.

46. The isolated monocot antiquitin promoter sequence of claim 45, where said maize antiquitin promoter sequence comprises SEQ ID NO: 10 or active fragments thereof.

47. A genetic construct comprising a monocot antiquitin promoter sequence operatively linked with a target gene.

48. The genetic construct of claim 47, wherein said target gene encodes a nitrogen utilization protein.

49. The genetic construct of claim 48, wherein said nitrogen utilization protein is selected from the group consisting of: a high affinity nitrate transporter, a low affinity nitrate transporter, an ammonium transporter, an ammonia transporter, an amino acid transporter, alanine dehydrogenase, glutamine synthetase, asparagine synthetase, glutamate synthase, glutamate 2:oxogluturate amino transferase, asparaginase, glutamate dehydrogenase, nitrate reductase, aspartate aminotransferase, and alanine aminotransferase.

50. The genetic construct of claim 49, wherein said nitrogen utili2ation protein is alanine am inotran sfcrase .

51. A vector including the genetic construct of claim 47.

52. A transformed plant comprising a target gene in operative linkage with a monocot antiquitin promoter sequence.

53. The plant of claim 52, wherein said target gene encodes a nitrogen utilization protein selected from the group consisting of a high affinity nitrate transporter, a low affinity nitrate transporter, an ammonium transporter, an ammonia transporter, an amino acid transporter, alanine dehydrogenase, glutamine synthetase, asparagine synthetase, glutamate synthase, glutamate 2:oxogluturate amino transferase, asparaginase, glutamate dehydrogenase, nitrate reductase, aspartate aminotransferase and alanine aminotransferase.

54. The plant of claim 53 wherein said nitrogen utilization protein is alanine aminotransferase.

55. A plant seed comprising a target gene in operative linkage with a monocot antiquitin promoter sequence.

56. The plant seed of claim 55, wherein said target gene encodes a nitrogen utilization protein selected from the group consisting of a high affinity nitrate transporter, a low affinity nitrate transporter, an ammonium transporter, an ammonia transporter, an amino acid transporter, alanine dehydrogenase, glutamine synthetase, asparagine synthetase, glutamate synthase, glutamate 2:ox.ogluturate amino transferase, asparaginase, glutamate dehydrogenase, nitrate reductase, aspartate aminotransferase and alanine aminotransferase.

57. The plant seed of claim 56, wherein said nitrogen utilization protein is alanine aminotransferase.