WO2007075956A2 - Methods for producing and using pancreatic endocrine cells - Google Patents

Abstract

Isolated populations of committed mesenchymal cells are disclosed that can proliferate in vitro, and, under appropriate conditions, can differentiate into pancreatic endocrine cells. Committed mesenchymal cells can undergo a mesenchymal-to-epithelial transition to form epithelial cell clusters, which can be transplanted into a recipient, such as a subject with diabetes. Tissue culture media is disclosed that is of use for expanding and differentiating committed mesenchymal cells. Methods for identifying agents of use in treating diabetes are also provided.

Description

METHODS FOR PRODUCING AND USING PANCREATIC ENDOCRINE CELLS

PRIORITY CLAIM

This claims the benefit of U.S. Provisional Application No. 60/752,822, filed December 21, 2005, which is incorporated by reference herein in its entirety.

FIELD This application relates to the field of diabetes, specifically to cells and culture conditions of use in producing human endocrine cells.

BACKGROUND

A mammalian pancreas is composed of two subclasses of tissue: the exocrine cells of the acinar tissue and the endocrine cells of the islets of Langerhans. The exocrine cells produce the digestive enzymes which are secreted through the pancreatic duct to the intestine. The islet cells produce the polypeptide hormones which are involved in carbohydrate metabolism. The islands of endocrine tissue that exist within the adult mammalian pancreas are termed the islets of Langerhans. Adult mammalian islets are composed of four major cell types, the α, β, δ, and PP cells, which produce glucagon, insulin, somatostatin, and pancreatic polypeptide, respectively. Insulin is synthesized, processed and secreted by pancreatic β cells, the major endocrine cell type in the islets of Langerhans that are distributed throughout the pancreas. Pancreatic β cells secrete insulin in response to an increase in extracellular glucose concentration.

Diabetes is defined as a failure of cells to transport endogenous glucose across their membranes either because of an endogenous deficiency of insulin or an insensitivity to insulin. Diabetes is a chronic syndrome of impaired carbohydrate, protein, and fat metabolism owing to insufficient secretion of insulin or to target tissue insulin resistance. It occurs in two major forms: type I and type II diabetes mellitus which differ in etiology, pathology, genetics, age of onset, and treatment. The two major forms of diabetes are both characterized by an inability to deliver insulin in an amount and with the precise timing that is needed for control of glucose homeostasis. Type I diabetes is caused by the destruction of β cells, which results in insufficient levels of endogenous insulin. Type II diabetes is believed to be caused by a primary defect in either the insulin receptor or in post-receptor signal transduction processing but also involves failure in the β cell. Despite these differences in etiology, a common therapeutic goal for the two disorders is to restore the capacity for glucose-mediated insulin release to its normal level.

A goal of diabetes research is to generate large numbers of islets of Langerhans (or beta cells) for use in screening agents that promote beta cells growth, and for use in replacement therapy ( Shapiro et ah, N Engl J Med 343, 230, 2000; Soria, Differentiation 68, 205, 2001 ; Zwillich, Science 289, 531, 2000). Although beta cells proliferate in vivo (Dor et al, Nature 429, 41 (2004)) and in vitro (Lechner and Habener, Am J Physiol Endocrinol Metab 284, E259, 2003), well- differentiated cells do not proliferate rapidly ( Hay, Acta Anat (Basel) 154, 8

(1995)). It is likely that expansion of mature islet cells would not yield adequate cell numbers. Thus, a need remains for methods that can be used to generate large number of beta cells.

SUMMARY

Previous methods for culturing islet cells in vitro do not provide sufficient expansion of cells that can form insulin producing cells. It has been estimated that a diabetic patient will need at least 10,000 clusters of implanted cells per kilogram body weight to achieve a measurable increase in insulin production. The methods and cells described herein can be used to produce large numbers of cells that can produce insulin upon transplantation into a recipient.

It is disclosed herein that pancreatic islets of Langerhans, such as human cadaveric islets of Langerhans, can be cultured in vitro in a manner such that epithelial cells from the islets of Langerhans undergo an epithelial to mesenchymal transition to form a population of committed mesenchymal cells. These committed mesenchymal cells have chromosomal deoxyribonucleic acid (DNA) that retains an insulin gene with chromatin structure of an actively transcribed insulin gene. However, the committed mesenchymal cells do not express insulin.

These committed mesenchymal cells can be expanded exponentially in vitro. In this manner, a large number of committed mesenchymal cells can be produced. These committed mesenchymal cells can be harvested and re-plated in vitro such that the committed mesenchymal cells undergo a mesenchymal to epithelial transition and form epithelial cell clusters. These epithelial cell clusters can be induced to form pancreatic endocrine cells, such as insulin-producing cells, such as upon transplantation into a recipient. Although islet cell aggregates can be formed from the epithelial cells in vitro, it is not necessary to form islet cell aggregates from the epithelial cells; the epithelial cell clusters can be directly introduced into a recipient without the formation of islet cell aggregates. Thus, in one example, islet cell aggregates are not produced.

In one embodiment, a method is disclosed for expanding pancreatic epithelial cells that can form pancreatic endocrine cells. The method includes culturing islets of Langerhans in vitro on a tissue culture substrate in a growth medium, wherein epithelial cells migrate out from the islets of Langerhans on the tissue culture substrate and undergo an epithelial to mesenchymal transition to form a population of committed mesenchymal cells on the tissue culture substrate. The committed mesenchymal cells are expanded in vitro. These committed mesenchymal cells can be expanded further in vitro. The chromatin structure of the insulin gene in the population of committed mesenchymal cells is assessed to identify a population of committed mesenchymal cells of interest that retain the chromatin structure of an actively transcribed insulin gene but do not express insulin. The population of committed mesenchymal cells of interest is harvested with an enzyme and re-plated on a tissue culture substrate to differentiate the committed mesenchymal cells to form a population of epithelial cell clusters that can be induced to form pancreatic endocrine cells.

In additional embodiments, methods are provided for transplanting epithelial cell clusters that can be induced to form pancreatic endocrine cells in a subject. Upon transplantation of a therapeutically effective amount of the epithelial cell clusters into a subject, the epithelial cell clusters differentiate into cells that express insulin. In one example, the subject has diabetes. In another example, the subject is immunosuppressed.

In additional embodiments, tissue culture media are disclosed, such as for the expansion of committed mesenchymal cells or the differentiation of committed mesenchymal cells into epithelial cells that can form pancreatic endocrine cells.

In a further embodiment, an isolated population of committed mesenchymal cells is disclosed. The committed mesenchymal cells have a chromosome comprising an insulin promoter that is dimethylated at lysine 4 of histone H3 and is methylated or acetylated at lysine residues of histone H4, but is not methylated or acetylated at lysine 9 of histone H3. The committed mesenchymal cells do not produce insulin and can be expanded in vitro. Under appropriate culture conditions the committed mesenchymal cells can be induced to undergo a mesenchymal-to- epithelial transition and differentiate into insulin-expressing cells.

The foregoing and other features and advantages will become more apparent from the following detailed description of several embodiments, which proceeds with reference to the accompanying figures.

BRIEF DESCRIPTION OF THE FIGURES

FIG. 1 is a digital image of committed mesenchymal cells proliferating in medium with fetal bovine serum (FBS) (left panels) and after 14 days of incubation in serum-free medium (SFM) after they have differentiated into islet-like cell aggregates (ICAs). In medium with FBS, committed mesenchymal cells are morphologically similar to fibroblasts and do not express insulin or glucagons.

After 14 days in SFM, ICAs have formed and cells within ICAs express insulin or glucagons. Nuclei are stained with propidium iodide.

FIG. 2 is a digital image showing that cells that are precursors to committed mesenchymal cells migrate out from an adult human islet of Langerhans. FIG. 3 is a digital image showing cells migrating out from an adult human islet of Langerhans are transitional between endocrine and mesenchymal phenotypes and express both insulin mRNA (bright dots) and vimentin protein (geyscale lines).

FIG. 4 summarizes chromatin modifications retained in committed mesenchymal cells and comparing them to changes found in insulin-expressing beta cells of the islets of Langerhans and to HeLa cells that do not express insulin.

FIG. 5 is a digital image and a diagram showing a procedure to test function of implants in mice (in vivo function of hIPCs). In one embodiment, the epithelial cell clusters, which are formed in vitro, are contained in a clot formed by the blood of the recipient mouse and then implanted under the kidney capsule of the mouse.

FIG. 6 is a digital image of an implant after 5 months under the kidney capsule of a mouse. Left panel - stained by Hematoxylin and Eosin. Right panel - immunohistochemical stain for insulin, glucagon and somatostatin. Even though it was epithelial cell clusters, which do not express insulin, glucagon or somatostatin, that were implanted, after 5 months islet-like cell aggregates (ICAs) formed that express large amounts of these hormones.

FIG. 7 is a graph demonstrating islet-like cell aggregates (ICAs) formed in vivo in NOD/SCID mice correct hyperglycemia induced by streptozotocin (STZ). STZ was administered at day -17. After the mice became hyperglycemic, pellets with porcine insulin were implanted subcutaneously to restore normoglycemia; these pellets release insulin for about 3 weeks. On day 0, epithelial cell clusters induced in vitro from committed mesenchymal cells were implanted under the left kidney capsules and blood sugar levels were followed. Blood sugar levels within the normal range were maintained until on day 48 a left nephrectomy was performed. Thereafter, the blood sugar rose to hyperglycemic levels.

FIG. 8 is a set of graphs showing that human C-peptide (insulin) secreted by islet-like cell aggregates (ICAs) under the left kidney capsule maintained normoglycemia in diabetic NOD/SCID mice. In the diabetic mice described in Figure 7, there was no measurable mouse C-peptide (insulin) at any time. In contrast, there was easily measured human C-peptide (insulin) basally (0 min) that increased in response to a glucose challenge administered intraperitoneally (30 min). After nephrectomy, which removed the implanted ICAs, the mice became hyperglycemic again, and there was no measurable C-peptide. This shows that normoglycemia in these mice was maintained by the implanted ICAs.

FIG. 9 is a set of graphs showing that implanted epithelial cell clusters differentiate and mature into insulin-secreting islet-like cell aggregates (ICAs) - measurement of human C-peptide in mouse blood. These experiments were performed in control (normoglycemic) mice that continue to secrete mouse C- peptide (insulin) from their pancreases. The amount of human C-peptide (insulin) in the blood of these mice increased with time of implantation. Human C-peptide, like mouse C-peptide, increased after glucose challenge.

FIG. 10 is a set of graphs showing the levels of human C-peptide (insulin) attained in mouse blood after implantation of epithelial cell clusters and differentiation into insulin-secreting islet-like cell aggregates (ICAs) in vivo. The levels attained in the mice after implantation of epithelial cell clusters (filled symbols) approximate the levels of human C-peptide (insulin) attained after implantation of adult human islets (unfilled symbols) (see Garber et al.)

FIG. 11 is a set of graphs showing that implanted epithelial cell clusters differentiate and mature into insulin-secreting islet-like cell aggregates (ICAs) - measurement of the levels of insulin, glucagon and somatostatin mRNAs within the ICAs. There is a progressive increase in the levels of all three hormones with time after implantation into the mice.

FIG. 12 is a set of digital images showing cells migrating out from islets of

Langerhans of MIP-GFP mice, which express GFP only in insulin-expressing beta cells. Green fluorescent protein (GFP) is transcribed under the control of the mouse insulin 1 promoter (Hara et al.). These findings add further support to the thesis that committed mesenchymal cells are derived from insulin-expressing cells by epithelial-to-mesenchymal transition (EMT).

FIG. 13 is a digital image showing that committed mesenchymal cells derived from MIP-GFP mice (see FIG. 12) can be induced to differentiate into insulin/GFP-expressing cells.

SEQUENCE LISTING The nucleic and amino acid sequences listed in the accompanying sequence listing are shown using standard letter abbreviations for nucleotide bases, and three letter code for amino acids, as defined in 37 C.F.R.. 1.822. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included by any reference to the displayed strand.

SEQ ID NOs: 1-3 are primer or probe sequences.

DETAILED DESCRIPTION

/. Abbreviations

ACTA2: smooth muscle actin alpha

BMP: bone morphogenic protein

BrdU: bromodeoxyuridine

CDHl: E-cadherin CLDN3: claudin 3

CLDN4: claudin 4

DIC: differential interference contrast

EGF: epithelial growth factor

EMT: eptithelial-to-mesenchymal transition ENG: endoglin (CD105)

GCG: glucagons

GCK; glucokinase GLP: glucagons-like peptide

GFP: green fluorescent protein

H3K4: Lysine-4 of histone H3

H3K9: Lysine-9 of histone H3 ICA: islet cell aggregate

INS: insulin

IPC: islet precursor cell

MMP2: matrix metal loproteinase 2

ND: not determined NES: nesting

OCLN: occludin

P4HA1 : prolyl 4-hydroxylase alpha subunit.

PBS: phosphate buffered saline solution

PDXl : insulin promoter factor 1 PECAMl: platelet/endothelial cell adhesion molecule (CD31) qPCR; quantitative polymerase chain reaction

SCM: serum containing medium

SFM: serum free medium

SNAIl : snail homolog 1 SNAI2; snail homolog 2

THYl: thy-1 cell surface antigent

VEGP: vascular endothelial growth factor

VIM: vimentin

II. Terms

Unless otherwise noted, technical terms are used according to conventional usage. Definitions of common terms in molecular biology may be found in Benjamin Lewin, Genes V, published by Oxford University Press, 1994 (ISBN 0-19- 854287-9); Kendrew et al. (eds.), The Encyclopedia of Molecular Biology, published by Blackwell Science Ltd., 1994 (ISBN 0-632-02182-9); and Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8). In order to facilitate review of the various embodiments of this disclosure, the following explanations of specific terms are provided:

Alpha (α) cells: Mature glucagon producing cells. In vivo, these cells are found in the pancreatic islets of Langerhans. Beta (β) cells: Mature insulin producing cells. In vivo, these cells are found in the pancreatic islets of Langerhans,

Delta (δ) cells: Mature somatostatin producing cells. In vivo, these cells are found in the pancreatic islets of Langerhans.

PP cells: Mature pancreatic polypeptide (PP) producing cells. In vivo, these cells are found in the pancreatic islets of Langerhans.

Animal: Living multi-cellular vertebrate organisms, a category that includes, for example, mammals and birds. The term mammal includes both human and non-human mammals. Similarly, the term "subject" includes both human and veterinary subjects. Antibody: A polypeptide ligand comprising at least a light chain or heavy chain immunoglobulin variable region which specifically recognizes and binds an epitope (e.g., an antigen, such as vimentin, nestin, or insulin). This includes intact immunoglobulins and the variants and portions of them well known in the art, such as Fab¹ fragments, F(ab)*₂ fragments, single chain Fv proteins ("scFv"), and disulfide stabilized Fv proteins ("dsFv"). A scFv protein is a fusion protein in which a light chain variable region of an immunoglobulin and a heavy chain variable region of an immunoglobulin are bound by a linker, while in dsFvs, the chains have been mutated to introduce a disulfide bond to stabilize the association of the chains. The term also includes genetically engineered forms such as chimeric antibodies (e.g., humanized murine antibodies), heteroconjugate antibodies (e.g., bispecific antibodies). See also, Pierce Catalog and Handbook, 1994-1995 (Pierce Chemical Co., Rockford, IL); Kuby, J., Immunology, 3^rd Ed., W.H. Freeman & Co., New York, 1997. A "monoclonal antibody" is an antibody produced by a single clone of B-lymphocytes or by a cell into which the light and heavy chain genes of a single antibody have been transfected. Monoclonal antibodies are produced by methods known to those of skill in the art, for instance by making hybrid antibody-forming cells from a fusion of myeloma cells with immune spleen cells. Monoclonal antibodies include humanized monoclonal antibodies.

Confluence: The state of non-transformed cells are a tissue culture substrate wherein the cells cover a sufficient percentage of the substrate such that the cells will no longer divide on the tissue culture substrate. Generally, non-transformed cells cease dividing in culture when they reach about 95%, 98%, 99% or 100% confluence.

Differentiation: The process whereby relatively unspecialized cells (e.g., embryonic cells) acquire specialized structural and/or functional features characteristic of mature cells. Similarly, "differentiate" refers to this process.

Typically, during differentiation, cellular structure alters and tissue-specific proteins appear. The term "differentiated pancreatic endocrine cell" refers to cells expressing a pancreatic endocrine hormone characteristic of the specific pancreatic endocrine cell type. A differentiated pancreatic endocrine cell includes an <x cell, a β cell, a δ cell, and a PP cell, which express glucagon, insulin, somatostatin, and pancreatic polypeptide, respectively. In one embodiment, a differentiated pancreatic endocrine cell is a cell that produces insulin in response to glucose stimulation.

Differentiation Medium: A synthetic set of culture conditions with the nutrients necessary to support the growth or survival of microorganisms or culture cells, and which allows the differentiation of undifferentiated cells (such as committed mesenchymal cells) into differentiated cells, such as islet cells.

Differentiation media generally include a carbon source, a nitrogen source and a buffer to maintain pH. In one embodiment, a growth medium contains a minimal essential media, supplemented with specific growth factors. Effective amount: An amount sufficient to evoke a desired response from a cell of interest. In one embodiment, an effective amount of an agent is the amount sufficient to affect the proliferation or differentiation of a cell, such as committed mesenchymal cells.

Epithelial Cell Clusters (ECC): Clusters of epithelial cells that are generated in vitro when committed mesenchymal cells are cultured in the absence of serum and/or growth factors. Epithelial cell clusters do not express one or more pancreatic endocrine cell hormones. In one example, ECC do not express insulin. In another example, ECCs do not express insulin or any other pancreatic endocrine hormone. In a further example, ECCs do not express glucagon and/or insulin. ECCs can be induced to express a pancreatic endocrine hormone (such as, but not limited to, insulin) when transplanted into a subject. Epithelial-to-Mesenchymal Transition: The epithelium is the covering of internal and external surfaces of the body, including the lining of vessels and other small cavities that consists of cells joined by biological cementing substances. Generally, fully differentiated epithelial cells express proteins characteristic of a differentiated phenotype, such as insulin, and have a limited capacity to proliferate. The mesenchyme is the meshwork of loosely organized embryonic connective tissue in the mesoderm from which are formed the connective tissues of the body, along with the blood vessels and lymphatic vessels. Vimentin is one marker of mesenchymal cells. Mesenchymal cells generally have a greater capacity to proliferate in vitro than epithelial cells and are not fully differentiated. An "epithelial-to-mesenchymal" transition is a biological process wherein a cell, or a population of cells, from an epithelial phenotype convert to a less differentiated mesenchymal phenotype. A "mesenchymal-to- epithelial" transition is a biological process wherein a cell, or a population of cells, convert from a less differentiated mesenchymal phenotype to a more differentiated epithelial phenotype. Expand: A process by which the number or amount of cells in a cell culture is increased due to cell division. Similarly, the terms "expansion" or "expanded" refers to this process. The terms "proliferate," "proliferation" or "proliferated" may be used interchangeably with the words "expand," "expansion", or "expanded." Typically, during expansion, the cells do not differentiate to form mature cells. Growth factor: A substance that promotes cell growth, survival, and/or differentiation. Growth factors include molecules that function as growth stimulators (mitogens), molecules that function as growth inhibitors (e.g. negative growth factors) factors that stimulate cell migration, factors that function as chemotactic agents or inhibit cell migration or invasion of tumor cells, factors that modulate differentiated functions of cells, factors involved in apoptosis, or factors that promote survival of cells without influencing growth and differentiation. Examples of growth factors are fibroblast growth factor (FGF-2), epidermal growth factor (EGF), bone morphogenic protein (BMP), such as BMP-2 or BMP-4, and vascular endothelial growth factor (VEGF).

Growth medium or expansion medium: A synthetic set of culture conditions with the nutrients necessary to support the growth (expansion) of a specific population of cells, such as islet cells, precursor cells, and/or mesenchymal cells.

Growth media generally include a carbon source, a nitrogen source and a buffer to maintain pH. In one embodiment, a growth medium contains a minimal essential media, such as CBRL- 1066, supplemented with various nutrients to enhance cell growth. In one example, the growth medium. In addition, the minimal can be supplemented with serum, such as human AB serum. In one example, a growth medium for human cells does not contain bovine serum, fetal calf serum, or any serum from a non-human mammal.

Heterologous: A heterologous sequence is a sequence that is not normally (i.e. in the wild-type sequence) found adjacent to a second sequence. In one embodiment, the sequence is from a different genetic source, such as a virus or organism, than the second sequence.

Histones: In eukaryotes, histones H2A, H2B, H3, and H4 are the proteins of the core nucleosomal unit of chromatin. About 146 base pairs of DNA are wrapped around one core nucleosomal unit. The higher order structure of chromatin is dependent upon the spatial organization of the core nucleosomal units with respect to one another. Although this packaging of chromatin is responsible for the efficient storage of genetic material within the nucleus, it also regulates the accessibility of DNA to transcription factors. Covalent histone modifications have an effect in altering higher order chromatin structure, and in altering rates of gene transcription. Several covalent modifications of the basic N-terminal tails of all histones have been described, including acetylation, methylation, phosphorylation, and ubiquitination. Of these, acetylation and methylation of specific lysine residues of H3 and H4 have been studied extensively. These lysine (Lys) residues are generally indicated numerically, such as Lys-4 of H3 or Lys-9 of H4 (see Chakrabarti et al., J. Biol. Chem. 278: 23617-23, 2003, herein incorporated by reference herein). Chromatin immunoprecipitation (ChIP) assays are one method that can be used to assess chromatin structure (see Chakrabarti et al., supra, incoφorated by reference herein). ChIP assays using mammalian and yeast cells have demonstrated that transcriptionally active genes in regions of "open" chromatin ("euchromatin") are correlated with high levels of lysine acetylation, methylation or dimethylation of histones H3 and H4, whereas inactive genes in regions of "closed" chromatin ("heterochromatin") are hypoacetylated at these histones. Lysine acetylation and deacetylation are catalyzed by the action of histone acetyltransferases (HATs) and histone deacetylases, respectively; thus, in addition to serving as a long term epigenetic marker for euchromatin, histone acetylation is also viewed as a dynamic, short term mechanism to control gene transcription. A review of histone is provided, for example, in Luger, et al., Nature 389: 251-260, 1997; Jenuwein, and Allis, Science 293: 1074-1080, 2001; Turner, Bioessays 22: 836-845, 2000.

In insulin-producing pancreatic endocrine cells, an actively transcribed insulin gene includes an insulin promoter acetylated at H4, and dimethylated at Lys- 4 of histone H3. In another example, an actively transcribed insulin gene in an insulin producing pancreatic endocrine cell is not methylated at Lys-9 of histone H3. In a further example, an insulin gene that is not actively transcribed in a non-insulin producing cells (such as in a fibroblast or a HeLa cell, amongst others) includes an insulin promoter that is not acetylated at histone H4, and is not dimethylated at Lys- 4 of histone H3. In another example, an insulin gene that is not actively transcribed is methylated at Lys-9 of histone H3.

Immunosuppression: Depression or prevention of the immune response. In one example, immunosupression results in a delay in the occurrence of the immune response or a decrease in the intensity of an immune response to donor tissue in a transplant recipient as compared to any one of a transplant recipient that has not received an immunosuppresive agent. A delay in the occurrence of an immune response can be a short delay, for example several hours to ten days, such as two hours, twelve hours, two days, five days or ten days. A delay in the occurrence of an immune response can also be an extended delay, for example, two weeks to ten years, such as about 30 days, about 60 days, abut 90 days, about 180 days, about one year, about two years, about five years or about ten years. The intensity of an immune response can be decreased such that it is 5-100%, such as 25-100% and or 75-100% less than the intensity of the immune response of any one of a transplant recipient that has not received an immυnosuppresive agent. In several examples the intensity of an immune response can also be measured by quantitating the amount of a B cell response or a T cell response to the transplanted material.

Various strategies and agents can be utilized for immunosuppression. For example, the proliferation and activity of lymphocytes can be inhibited generally with agents such as, for example, FK-506, or cyclosporine, non-steroidal antiinflammatory agents, antibodies, such as anti-GAD65 monoclonal antibody, anti- CD3, cyclophosphamide, prednisone, dexamethasone, methotrexate, azathioprine, mycophenolate, thalidomide, systemic steroids, as well as a broad range of antibodies, receptor agonists, receptor antagonists, and other such agents as known to one skilled in the art.

Islet-like Cell Aggregate (ICA): An aggregate of cells that is produced in vitro or in vivo that include pancreatic endocrine hormone producing cells. These aggregates of cells can produce insulin following transplantation into a recipient. ICAs resemble the form of islets of Langerhans of the pancreas, as they are approximately 50 μm to 200 μm in diameter (similar to the average diameter of 100 μm for in situ islets) and spheroid in form. Islets of Langerhans: Small discrete clusters of pancreatic endocrine tissue.

In vivo, in an adult mammal, the islets of Langerhans are found in the pancreas as discrete clusters (islands) of pancreatic endocrine tissue surrounded by the pancreatic exocrine (or acinar) tissue. In vivo, the islets of Langerhans consist of the α cells, β cells, δ cells, and PP cells. The islets of Langerhans are sometimes referred to herein as "islets." Islets of Langerhans isolated from a human cadaveric islet include intact islets and identifiable clusters of pancreatic endocrine cells that can be isolated using methods well known in the art.

Isolated: An "isolated" biological component (such as a nucleic acid, peptide or protein) has been substantially separated, produced apart from, or purified away from other biological components in the cell of the organism in which the component naturally occurs, i.e., other chromosomal and extrachromosomal DNA and RNA, and proteins. Nucleic acids, peptides and proteins which have been "isolated" thus include nucleic acids and proteins purified by standard purification methods. The term also embraces nucleic acids, peptides and proteins prepared by recombinant expression in a host cell as well as chemically synthesized nucleic acids. Similarly, an "isolated" cell is a cell that has been separated from other components of a culture or from other cell types in a tissue. An isolated precursor cells, such as a committed mesenchymal cell will be generally free from contamination by other cell types and will generally have the capability of propagation and differentiation to produce mature cells of the tissue from which it was isolated, such as the endocrine pancreas. However, when dealing with a collection of cells, it is understood that it is practically impossible to obtain a collection of cells which is 100% pure. Therefore, an isolated population of cells can include a small fraction of other cell types. Isolated populations of cells will generally be at least about 60%, 70%, 80%, 85%, 90%, 95%, 98%, or about 99% pure.

Marker: A protein, or a gene encoding a protein, for which a system is available to identify cells that produce the protein. In one specific, non-limiting example of a selectable marker is a protein, or a gene encoding a protein, that can be identified in a cell based on its fluorescent or enzymatic properties. Specific, non- limiting examples include, but are not limited to, enhanced green fluorescent protein (EGFP), alkaline phosphatase, or horseradish peroxidase. A marker can also be a polypeptide or antigenic epitope thereof, wherein an antibody that specifically binds the polypeptide can be used to identify cells that express the polypeptide or antigenic epitope. One specific, non-limiting example of a polypeptide of use is human growth hormone (hGH). Additional specific non- limiting examples of a marker include drug resistance markers, such as G 148 or hygromycin. Additionally, a marker can be a protein or a gene encoding a protein for which negative selection can be used to identify the cell expressing the marker. A specific, non-limiting example of a negative selection marker includes, but is not limited to, the HSV-tk gene. This gene will make the cells sensitive to agents such as acyclovir and gancyclovir. Another specific, non-limiting example of a selectable marker is a protein, or a gene encoding a protein, wherein selection can be made by using a cell surface marker, for example, to select over-expression of the marker by fluorescence activated cell sorting (FACS).

Mesenchymal Cell: A cell that proliferates in vitro that is de-differentiated and, under appropriate culture conditions, can differentiate into cells of a defined lineage. In one example, mesenchymal cells can undergo a mesenchymal to epithelial transition and can be differentiated in vitro. "Committed mesenchymal cells" are not totipotent but differentiate into cells of a pre-determined lineage, such as pancreatic endocrine cells. Committed mesenchymal cells retain the chromatin structure of the differentiated cells of the appropriate cell lineage. A committed mesenchymal cell can differentiate into pancreatic endocrine cells under appropriate conditions. In one example, committed mesenchymal cells that differentiate into insulin producing cells proliferate in vitro include an insulin promoter with chromatin dimethylated at Lys-4 of histone H3 in the insulin promoter, and acetylated at H4 of the insulin promoter, and not include an insulin gene that is methylated at Lys-9 of histone H3, but do not express insulin.

Nestin: An intermediate filament protein. It is expressed in stem cells of the central nervous system in the neural tube. Upon terminal neural differentiation, nestin is downregulated and replaced by neurofilaments. The human gene encodes a predicted protein of 1,618 amino acids. The alpha helical domain demonstrates 82% identity to the rat protein, but other regions of the sequence are less well conserved. An exemplary sequence of nestin is disclosed in Genbank Access No. X65964.

Nucleotide: Includes, but is not limited to, a monomer that includes a base linked to a sugar, such as a pyrimidine, purine or synthetic analogs thereof, or a base linked to an amino acid, as in a peptide nucleic acid (PNA). A nucleotide is one monomer in a polynucleotide. A nucleotide sequence refers to the sequence of bases in a polynucleotide.

Operably linked: A first nucleic acid sequence is operably linked with a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence. For instance, a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence. Generally, operably linked DNA sequences are contiguous and, where necessary to join two protein coding regions, in the same reading frame.

Pancreatic ductal cell: A cell that resides in one of the ducts of the pancreas that does not produce any hormone(s) produced by mature cells of the islets of Langerhans. This cell may be a precursor cell that can be propagated in culture. In one embodiment, cells of a pancreatic ductal cell line can be treated with a proliferation inhibiting agent to gives rise to pancreatic endocrine cells, such as the α cells, β cells, δ cells, and PP cells, but does not give rise to other cells such as the pancreatic exocrine cells. Pancreatic endocrine cell: An endocrine cell of pancreatic origin that produces one or more pancreatic hormone, such as insulin, glucagon, somatostatin, or pancreatic polypeptide. In one embodiment, a pancreatic endocrine cell produces more than one pancreatic hormone, such as, but not limited to, a cell that produces both insulin and glucagon, or a cell that produces insulin, glucagon, and somatostatin, or a cell that produces insulin and somatostatin.

Polypeptide: A polymer in which the monomers are amino acid residues which are joined together through amide bonds. When the amino acids are alpha- amino acids, either the L-optical isomer or the D-optical isomer can be used, the L- isomers being preferred. The terms "polypeptide" or "protein" as used herein is intended to encompass any amino acid sequence and include modified sequences such as glycoproteins. The term "polypeptide" is specifically intended to cover naturally occurring proteins, as well as those which are recombinantly or synthetically produced.

The term "polypeptide fragment" refers to a portion of a polypeptide which exhibits at least one useful epitope. The term "functional fragments of a polypeptide" refers to all fragments of a polypeptide that retain an activity of the polypeptide. Biologically functional fragments, for example, can vary in size from a polypeptide fragment as small as an epitope capable of binding an antibody molecule to a large polypeptide capable of participating in the characteristic induction or programming of phenotypic changes within a cell. An "epitope" is a region of a polypeptide capable of binding an immunoglobulin generated in response to contact with an antigen. Thus, smaller peptides containing the biological activity of insulin, or conservative variants of the insulin, are thus included as being of use.

The term "soluble" refers to a form of a polypeptide that is not inserted into a cell membrane. The term "substantially purified polypeptide" as used herein refers to a polypeptide which is substantially free of other proteins, lipids, carbohydrates or other materials with which it is naturally associated. In one embodiment, the polypeptide is at least 50%, for example at least 80% free of other proteins, lipids, carbohydrates or other materials with which it is naturally associated. In another embodiment, the polypeptide is at least 90% free of other proteins, lipids, carbohydrates or other materials with which it is naturally associated. In yet another embodiment, the polypeptide is at least 95% free of other proteins, lipids, carbohydrates or other materials with which it is naturally associated.

Conservative substitutions replace one amino acid with another amino acid that is similar in size, hydrophobicity, etc. Examples of conservative substitutions are shown below. Original Residue Conservative Substitutions

Ala Ser Arg Lys

Asn GIn, His

Asp GIu

Cys Ser

GIn Asn GIu Asp

His Asn; GIn

He Leu, VaI

Leu He; VaI

Lys Arg; GIn; GIu Met Leu; He

Phe Met; Leu; Tyr

Ser Thr

Thr Ser

Variations in the cDNA sequence that result in amino acid changes, whether conservative or not, should be minimized in order to preserve the functional and immunologic identity of the encoded protein. The immunologic identity of the protein may be assessed by determining whether it is recognized by an antibody; a variant that is recognized by such an antibody is immunologically conserved. Any cDNA sequence variant will preferably introduce no more than twenty, and preferably fewer than ten amino acid substitutions into the encoded polypeptide. Variant amino acid sequences may, for example, be 80, 90 or even 95% or 98% identical to the native amino acid sequence.

Pharmaceutically acceptable carriers: The pharmaceutically acceptable carriers useful in this invention are conventional. Remington 's Pharmaceutical Sciences, by E. W. Martin, Mack Publishing Co., Easton, PA, 15th Edition (1975), describes compositions and formulations suitable for pharmaceutical delivery of the fusion proteins herein disclosed.

In general, the nature of the carrier will depend on the particular mode of administration being employed. For instance, parenteral formulations usually comprise injectable fluids that include pharmaceutically and physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like as a vehicle. For solid compositions (such as powder, pill, tablet, or capsule forms), conventional non-toxic solid carriers can include, for example, pharmaceutical grades of mannitol, lactose, starch, or magnesium stearate. In addition to biologically-neutral carriers, pharmaceutical compositions to be administered can contain minor amounts of non-toxic auxiliary substances, such as wetting or emulsifying agents, preservatives, and pH buffering agents and the like, for example sodium acetate or sorbitan monolaurate.

Pharmaceutical agent: A chemical compound or composition capable of inducing a desired therapeutic or prophylactic effect when properly administered to a subject or a cell. "Incubating" includes a sufficient amount of time for a drug to interact with a cell. "Contacting" includes incubating a drug in solid or in liquid form with a cell.

Polynucleotide: A nucleic acid sequence (such as a linear sequence) of any length. Therefore, a polynucleotide includes oligonucleotides, and also gene sequences found in chromosomes. An "oligonucleotide" is a plurality of joined nucleotides joined by native phosphodiester bonds. An oligonucleotide is a polynucleotide of between 6 and 300 nucleotides in length. An oligonucleotide analog refers to moieties that function similarly to oligonucleotides but have non- naturally occurring portions. For example, oligonucleotide analogs can contain non- naturally occurring portions, such as altered sugar moieties or inter-sugar linkages, such as a phosphorothioate oligodeoxynucleotide. Functional analogs of naturally occurring polynucleotides can bind to RNA or DNA, and include peptide nucleic acid (PNA) molecules.

Promoter: An array of nucleic acid control sequences which direct transcription of a nucleic acid. In one embodiment, a promoter includes necessary nucleic acid sequences near the start site of transcription, such as, in the case of a polymerase II type promoter, a TATA element. Enhancer and repressor elements can be located adjacent to, or distal to the sequences necessary for the start site of transcription, and can be located as much as several thousand base pairs from the start site of transcription. A "heterologous promoter" is a promoter from one gene operably linked to a control element or a protein coding sequence from another gene or another species of animal. In one specific, non-limiting example, an enhancer is operably linked to a heterologous promoter such as the insulin, glucagons, somatostatin, or other promoter.

Recombinant: A recombinant nucleic acid is one that has a sequence that is not naturally occurring or has a sequence that is made by an artificial combination of two otherwise separated segments of sequence. This artificial combination is often accomplished by chemical synthesis or, more commonly, by the artificial manipulation of isolated segments of nucleic acids, such as by genetic engineering techniques. Similarly, a recombinant protein is one encoded for by a recombinant nucleic acid molecule, that is not native to the host cell.

Rejection: An immune response in a recipient to transplanted material from a donor such that the transplanted material had decreased viability and/or fails to proliferate in the host. A decrease in viability, such as a decrease of 50%, 60% 70%, 80%, 90% or more can be determined by methods well known in the art, including but not limited to trypan blue exclusion staining. Proliferation can be measured by methods known in the art including but not limited to hematoxylin/eosin staining. The occurrence of transplant rejection and/or the speed at which rejection occurs following transplantation will vary depending on factors, including but not limited to the transplanted material (such as the cell type, or the cell number) or the host (such as whether the host has been treated with an immunosuppressive agent, or whether the host and the donor are matched for the Major Histocompatibility Complex). A "graft versus host response" refers to a cell-mediated reaction in which T-cells of the transplanted material react with antigens of the host.

Specific binding: Binding substantially only to a defined target. Thus a vimentin specific binding agent is an agent that binds substantially to vimentin, and not to other molecules. Thus the term "specifically binds" refers, with respect to an antigen, to the preferential association of an antibody, in whole or part, with a cell or tissue bearing that antigen and not to cells or tissues lacking that antigen. It is, of course, recognized that a certain degree of non-specific interaction may occur between a molecule and a non-target cell or tissue; non-specific binding is readily ascertainable. Specific binding may be distinguished as mediated through specific recognition of the antigen. Although selectively reactive antibodies bind antigen, they may do so with low affinity. On the other hand, specific binding results in a much stronger association between the antibody and cells bearing the antigen than between the bound antibody and cells lacking the antigen. Specific binding typically results in greater than 2-fold, such as greater than 5-fold, greater than 10-fold, or greater than 100-fold increase in amount of bound antibody or other ligand (per unit time) to a cell or tissue bearing the antigen of interest, such as insulin, vimentin, or nestin, as compared to a cell or tissue lacking the antigen. A variety of immunoassay formats are of use with antibodies that specifically bind a particular antigen. See Harlow & Lane, Antibodies, A Laboratory Manual, Cold Spring Harbor Publications, New York (1988), for a description of immunoassay formats such as immunohistochemistry and other immunoassays of use.

Therapeutic agent: Used in a generic sense, it includes treating agents, prophylactic agents, and replacement agents.

Therapeutically effective amount: The amount of an agent (including cells) sufficient to inhibit, treat, reduce and/or ameliorate the symptoms and/or underlying causes of any of a disorder or disease, such as diabetes. In one embodiment, a therapeutically "effective amount" is sufficient to reduce or eliminate a symptom of a disease. In another embodiment, a therapeutically effective amount is an amount sufficient to overcome the disease itself.

Transduced and Transformed: A virus or vector "transduces" a cell when it transfers nucleic acid into the cell. A cell is "transformed" or "stably transfected" by a nucleic acid transduced into the cell when the DNA becomes stably replicated by the cell, either by incorporation of the nucleic acid into the cellular genome, or by episomal replication.

Numerous methods of transfection are known to those skilled in the art, such as: chemical methods (such as calcium-phosphate transfection), physical methods (such as electroporation, microinjection, particle bombardment), fusion (e.g., liposomes), receptor-mediated endocytosis (for example, DNA-protein complexes, viral envelope/capsid-DNA complexes) and by biological infection by viruses such as recombinant viruses (Wolff, J. A., ed., Gene Therapeutics, Birkhauser, Boston, USA (1994)). In the case of infection by retroviruses, the infecting retrovirus particles are absorbed by the target cells, resulting in reverse transcription of the retroviral RNA genome and integration of the resulting provirus into the cellular DNA. Methods for the introduction of genes into the pancreatic endocrine cells are known (for example, see U.S. Patent No. 6,1 10,743, herein incorporated by reference). These methods can be used to transduce a pancreatic endocrine cell produced by the methods described herein, or an artificial islet produced by the methods described herein.

Genetic modification of the target cell is an indicium of successful transfection. "Genetically modified cells" refers to cells whose genotypes have been altered as a result of cellular uptakes of exogenous nucleotide sequence by transfection. A reference to a transfected cell or a genetically modified cell includes both the particular cell into which a vector or polynucleotide is introduced and progeny of that cell.

Transgene: An exogenous gene supplied by a vector. A transgene can include a heterologour promoter operably linked to a nucleic acid encoding a marker polypeptide.

Transgenic Animal: An animal, for example, a non-human animal such as a mouse, that has had DNA introduced into one or more of its cells artificially. By way of example, this is commonly done by random integration or by targeted insertion. DNA can be integrated in a random fashion by injecting it into the pronucleus of a fertilized ovum. In this case, the DNA can integrate anywhere in the genome, and multiple copies often integrate in a head-to-tail fashion. There is no need for homology between the injected DNA and the host genome. In most cases, the foreign transgene is transmitted to subsequence generations in a Mendelian fashion (a germ-line transgenic).

Targeted insertion, the other common method of producing transgenic animals, is accomplished by introducing the DNA into embryonic stem (ES) cells and selecting for cells in which the DNA has undergone homologous recombination with matching genomic sequences. For this to occur, there often are several kilobases of homology between the exogenous and genomic DNA, and positive selectable markers are often included. In addition, negative selectable markers are often used to select against cells that have incorporated DNA by non-homologous recombination (random insertion).

Vector: A nucleic acid molecule as introduced into a host cell, thereby producing a transformed host cell. A vector may include nucleic acid sequences that permit it to replicate in the host cell, such as an origin of replication. A vector may also include one or more therapeutic genes and/or selectable marker genes and other genetic elements known in the art. A vector can transduce, transform or infect a cell, thereby causing the cell to express nucleic acids and/or proteins other than those native to the cell. A vector optionally includes materials to aid in achieving entry of the nucleic acid into the cell, such as a viral particle, liposome, protein coating or the like. Vimentin: The most ubiquitous intermediate filament protein and the first intermediate filament protein to be expressed during cell differentiation. Intermediate filaments build up the cytoskeleton of almost all eukaryotic cells. Cytoplasmic intermediate filaments are polypeptide filaments with a diameter of about 10 nm, forming a dense network radiating from the nucleus and extending to the plasma membrane. On the basis of their composition of specific polypeptide subunits, intermediate filaments are divided into five classes; vimentin is included in Class II intermediate filaments. AIl primitive cell types express vimentin but in most non-mesenchymal cells it is replaced by other intermediate filament proteins during differentiation. Vimentin is expressed in a wide variety of mesenchymal cell types including fibroblasts and endothelial cells and is expressed in a number of other cell types derived from mesoderm, such as the mesothelium and ovarian granulosa cells.

Unless otherwise explained, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. The singular terms "a," "an," and "the" include plural referents unless context clearly indicates otherwise. Similarly, the word "or" is intended to include "and" unless the context clearly indicates otherwise. It is further to be understood that all base sizes or amino acid sizes, and all molecular weight or molecular mass values, given for nucleic acids or polypeptides are approximate, and are provided for description. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of this disclosure, suitable methods and materials are described below. The term "comprises" means "includes." All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including explanations of terms, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.

Method of Producing Pancreatic Endocrine Cells

The methods described herein can be used to produce large numbers of cells that differentiate into cells that produce pancreatic hormones. Using the methods disclosed herein, pancreatic islets of Langerhans can be cultured in vitro in a manner such that epithelial cells from the islets of Langerhans undergo an epithelial to mesenchymal transition to form a population of committed mesenchymal cells. These committed mesenchymal cells have chromosomal deoxyribonucleic acid (DNA) that retains an insulin promoter with chromatin structure of an actively transcribed insulin gene. However, the committed mesenchymal cells do not express insulin. These committed mesenchymal cells can be expanded exponentially in vitro. In this manner, a large number of committed mesenchymal cells can be produced. Thus, methods are provided herein for producing large numbers of committed mesenchymal cells that can differentiate into pancreatic endocrine cells, such as insulin producing cells. These cells can be used for treating diabetes, for studying the differentiation of pancreatic endocrine cells, or for identifying agents for the treatment of disorders, such as diabetes.

The methods include culturing epithelial cells of the islets of Langerhans in vitro on a tissue culture substrate. The cells can be from any mammal, including, but not limited to, human, non-human primate, mouse, rat, rabbit, dog, cat, pig, sheep or goat cells. In one specific, non-limiting example, the islets are human. In one example, human cadaveric islets are used in this method. In another specific non-limiting example, islets are from a mouse, such as a transgenic mouse, are used in this method.

Protocols for the isolation of islets are well known in the art, see for example, Kinasiewicz et al., Physiol. Res. 53: 327-333, 2004. The methods disclosed herein are of use for expanding and differentiating cells of human cadaveric islets in vitro.

The islets are isolated and cultured in vitro on a tissue culture substrate in the presence of a growth medium. The epithelial cells migrate out from the islets of Langerhans on the tissue culture substrate and undergo an epithelial to mesenchymal transition to form a population of committed mesenchymal cells. These committed mesenchymal cells do not produce insulin on the tissue culture substrate (see below).

Suitable substrates for culture of islets of Langerhans and expansion of committed mesenchymal cells include, but are not limited to collagen, fibronectin, poly-L-lysine, and glass and plastic tissue culture substrates. In one example, the substrate is tissue culture plastic coated with gelatin, such as about 0.1% to 1% gelatin, for example, 0.2% gelatin. Generally, culturing is performed at a temperature between about 35°C and about 4O⁰C, such as at about 37 ⁰C. In another embodiment, the cells are incubated at 37°C under between about 1 % and 10 % CO₂ atmosphere, or between about 5% and 10% CO₂ or under about 5% CO₂. In this embodiment, the medium is changed every 1 to 2 days. The medium generally includes a carbon and a nitrogen source, as well as a buffer to maintain the pH at a physiological level (such as about 7.0 to 7. 6, for example, a pH of about 7.4). In one example, the medium is CMRL- 1066 or Dulbecco's Modified Eagles Medium (DMEM) but the use of other commercially available media is contemplated. The product information for CMRL- 1066 and DMEM are available through Sigma, and the complete components are available online at the Sigma website. The Product Information is incorporated herein by reference.

In one example, the medium contains the following components:

Components

L-AIanine 0,025 2'-Deoxyguanosine 0.01

L-Arginine 0.05787 2'-Deoxycytidine^»HCl 0.01 16

L-Aspartic Acid 0.03 Flavin Aadenine DinucIeotide^»2Na 0.000106

L-Cysteine»HCl» H₂O 0.26 Folic Acid 0.00001

L-Cystine 0.02 myo-Inositol 0.00005

L-GIutamic Acid 0.075 5-Methyldeoxycytidine 0.0001

L-Glutamine 0.1 β-NAD 0.007

Glycine 0.05 β-NADP^»Na 0.001

L-Histidine HCl* H₂O 0.02 Niacinamide 0.000025

Trans-4-Hydroxy-L-Proline 0.01 Nicotinic Acid 0.000025

L-Isoleucine 0.02 D-Panthothenic Acid [hemicalcium] 0.00001

L-Leucine 0.06 Pyridoxal'HCl 0.000025

L-Lysine'HCl 0.07 PyridoxineΗCI 0.000025

L-Methionine 0.015 Riboflavin 0.00001

L-Phenylalanine 0.025 Thiamine'HCI 0.00001

L-Proline 0.04 Thymidine 0.01

L-Serine 0.025 Uridine-5-Triphosphate-Na 0.001

L-Threonine 0.03 Calcium Chloride [Anhydrous] 0.2

L-Tryptophan 0.01 Magnesium Sulfate [Anhydrous] 0.09769

L-Tryosine 0.04 Potassium Chloride 0.4

L-Valine 0.025 Sodium Acetate [Anhydrous] 0.05

L-Ascorbic Acid 0.05 Sodium Chloride 6.8

PABA 0.00005 Sodium Phosphate Monobasic [Anhydrous] 0.122

D-Biotin 0.00001 D-Glucose 1.0

Choline Chloride 0.0005 Phenol Red'Na 0.02124

Coenzyme A^»Na 0.0025 Glutathione 0.01

Cocarboxylase 0.001 D-Glucuronic Acid'Na 0.00388

2'-Deoxyadenosine 0.01 Cholesterol 0.0002

Tvveen 80 0.005

The medium can include serum, such as about 5% to about 15% serum, such as about 10% serum. In one example, the medium includes about 10% human AB serum, but does not include bovine serum, such as fetal bovine serum. The medium can optionally include antibiotics, such as penicillin and streptomycin. The medium can also include growth factors, such one or more of epidermal growth factor, fibroblast growth factor, and bone morphogenic protein 4. Optionally, the medium can vascular endothelial growth factor. In one example, epidermal growth factor, fibroblast growth factor and bone morphogenic protein 4 are all included in the medium. These growth factors are included at an effective concentration, such as from about 10 to about 200 ng/ml, for example at about 100 ng/ml. Thus, in one embodiment, the medium includes the components set forth in Table 1, 10% human AB serum, and optionally an effective amount of antibiotics. In another embodiment, the medium includes the components set forth in Table 1, 10% human AB serum, about 100 ng/ml epidermal growth factor, about 100 ng/ml fibroblast growth factor, about 100 ng/ml bone morphogenic protein 4, and optionally an effective amount of antibiotics.

Generally, islets of Langerhans are cultured for about seven days to about three weeks in culture, such as from about 10 days to about fourteen days. Once in culture, epithelial cells grow out from the islets of Langerhans on the tissue culture substrate. The cells undergo an epithelial-to-mesenchymal transition, wherein differentiated epithelial cells of the islets de-differentiate into committed mesenchymal cells. These committed mesenchymal cells can be isolated and expanded in vitro. The committed mesenchymal cells retain the chromatin structure of an actively transcribed insulin gene. In one example, committed mesenchymal cells includes an insulin promoter acetylated at H4, an insulin promoter dimethylated at Lys-4 of histone H3, and/or insulin gene that is not methylated at Lys-9 of histone H3. Methods are well known in the art to determine chromatin structure. One example of such an assay is a quantitative chromatin immunoprecipitation (ChIP) assay. An exemplary assay to determine the chromatin structure of the insulin gene is disclosed in Chakrabarti et al., J. Biol. Chem. 278: 23617-23623, 2003, incorporated herein by reference. In addition, detailed protocols for ChIP are well known in the art (see, for example, "Protocols On-line," accessed December 2, 2005, available on the internet). Thus, an isolated population of committed mesenchymal cells is provided herein, wherein the committed mesenchymal cells comprise a chromosome comprising an insulin promoter that is dimethylated at lysine 4 of histone H3 and is acetylated at lysine residues of histone H4, but is not methylated at lysine 9 of histone H3, wherein the committed mesenchymal cells do not produce insulin and can divide in vitro and can be induced to differentiate into insulin-expressing cells.

In one example, the committed mesenchymal cells produce significantly less insulin mRNA than insulin producing islet cells. Assays to detect mRNA are known in the art, and include reverse transcriptase polymerase chain reaction (RT-PCR), and Northern blot, amongst others. In one example, insulin mRNA cannot be detected. In additional examples, the committed mesenchymal cells produced significantly less insulin, glucokinase, claudin 3, and/or glucagon-like peptide 1 receptor mRNA than islet cells. The committed mesenchymal cells express significantly less insulin and/or glucokinase, claudin 3, and/or glucagons-like peptide 1 receptor mRNA than islet cells isolated from a mammal of the same species, such as, but not limited to, a human.

One of skill in the art can readily determine if a decrease in an mRNA is statistically significant. Without limitation, a decrease of more than about 50%, about 60%, about 70%, about 75%, about 80%, about 90%, about 95%, or even a decrease of about 100% (such that the mRNA cannot be detected by the method) is considered significant. However, an assay is described herein that detects proinsulin mRNA at a level 100 million-fold below that found in human islets of Langerhans. Thus, if no proinsulin mRNA is detectable, as with committed mesenchymal cells, the level of proinsulin mRNA is below 100 million-fold lower than that present in human islets of Langerhans. The committed mesenchymal cells can be cultured until they are confluent on the tissue culture substrate, and then can be passaged to further expand the cells. Passaging techniques, including treatment with trypsin, are well known to one of skill in the art. Generally, "passaging" includes harvesting the cells with an enzyme, such as collagenase or trypsin ("trypsinizing"), diluting and re-plating the cells to expand them. The committed mesenchymal cells are diluted and placed on the tissue culture substrate in the tissue culture medium including serum and/or growth factors. The committed mesenchymal cells are generally re-plated at a ratio of at most 1 :3, such as at about 1 :2. Thus, each passage can allow one doubling, or each passage can allow one and one half doublings of the population of committed mesenchymal cells. In several embodiments, the amount of cells produced following a passage is 2 or 2.5 times the original number of committed mesenchymal cells.

In this manner, committed mesenchymal cells are produced and are expanded in vitro. The cells can be passaged in vitro to increase cell number. In several embodiments, the committed mesenchymal cells are passaged in vitro for about 10 to about 30 passages, such as about 12 to about 25 passages, such as about 15, about 20 or about 25 passages.

Committed mesenchymal cells retain the histone modifications on the insulin promoter that are found in insulin-expressing beta cells but do not express insulin. Actively transcribed genes are typically hyperacetylated at the lysine residues of histones H3 and H4 and hypermethylated at lysine 4 of histone H3 (H3-K4). Chromatin immunoprecipitation assays can be performed using anti -histone antibodies and cell extracts to determine the methylation status of H3 and H4. Specific histone modifications have also been quantitated in the insulin promoter by real-time PCR (Chakrabarti et al., J. Biol. Chem. 278, :23617-23623, 2003, which is incorporated herein by reference). In one example, an assay is performed to determine that the committed mesenchymal cells include chromatin that retains an insulin gene with the chromatin structure of an actively transcribed insulin gene. In several examples, the committed mesenchymal cells have chromatin including an insulin promoter dimethylated at lysine 4 of histone H3 and/or an insulin promoter acetylated at lysine residues of histone H4 and/or an insulin promoter that is not methylated or acetylated at lysine 9 of histone H3. In one example, the committed mesenchymal cells have chromatin including an insulin promoter dimethylated at lysine 4 of histone H3 and an insulin promoter acetylated at lysine residues of histone H4 and an insulin promoter that is not methylated or acetylated at lysine 9 of histone H3. These histone modifications of the insulin promoter are not found in non-insulin producing cells, such as fibroblasts, NIH3T3 cells, or HeLa cells. The committed mesenchymal cells do not express one or more pancreatic endocrine hormone, such as insulin. Thus, in one example, the committed mesenchymal cells do not express insulin. In another example, the committed mesenchymal cells do not express glucagon, somatostatin, and/or pancreatic polypeptide. In a further example, the committed mesenchymal cells do not express any pancreatic hormone. In one example, insulin mRNA is not produced in the committed mesenchymal cells.

To produce epithelial cell clusters, the committed mesenchymal cells can be harvested and re-plated in a differentiation medium. Without being bound by theory, harvesting and plating in a differentiation medium results in the islet precursor cells undergoing a mesenchymal to epithelial transition. In one embodiment, following expansion, the cells are harvested using an enzyme to create a cell suspension. For example, the cells are treated with an enzyme such as collagenase or trypsin to create a cell suspension. In one example, trypsin is utilized.

These committed mesenchymal cells can be harvested and re-plated in vitro such that the committed mesenchymal cells undergo a mesenchymal to epithelial transition and form epithelial cell clusters. These epithelial cell clusters do not produce insulin, but can be induced to form pancreatic endocrine cells, such as insulin-producing cells, in vitro or upon transplantation into a recipient.

Following digestion, the committed mesenchymal cells are put in culture conditions wherein epithelial cell clusters can form. In one example, the culture conditions include resuspension in tissue culture medium, such as, but not limited to, CMRL- 1066 without serum. In another example, the tissue culture medium does not include additional growth factors, such as epidermal growth factor, fibroblast growth factor, and bone morphogenic protein 4. The tissue culture medium can not include serum and can not include additional growth factors. In one example, these islet cell clusters react with an antibody that specifically binds insulin.

Generally, the epithelial cell clusters form as re-plated cells adhere to the tissue culture surface and migrate into clusters that do not produce a pancreatic endocrine hormone, such as insulin. Epithelial cell clusters are produced within about 24 hours to about four days, such as in about 36 hours, about 48 hours, or about 72 hours, of culturing committed mesenchymal cells in the absence of serum and/or growth factors. The epithelial cell clusters can be transplanted into a subject. In one example, the epithelial cell clusters are produced in vitro and are cultured in vitro for at most four days, at most three days or at most two days prior to transplantation into a subject.

Although islet cell aggregates that produce insulin can be formed from the epithelial cell clusters in vitro, it is not necessary to form islet cell aggregates from the epithelial cells; the epithelial cell clusters can be directly introduced into a recipient without the formation of islet cell aggregates. Thus, in one example, islet cell aggregates are not produced.

However, the epithelial cell clusters can form islet-like cell aggregates when cultured in vitro in the absence of serum and/or growth factors. In one example, the epithelial cell clusters are cultured in vitro for about 7 days to about three weeks to produce the islet cell aggregates. These islet cell aggregates are approximately 50 μm to 200 μm in diameter (compared to an average diameter of 100 μm for in situ islets), spheroid in form, and produce a pancreatic endocrine hormone, such as insulin. The islet cell aggregates can also be used directly in a recipient, such as a mouse or a human recipient.

Isolated Committed Mesenchymal Cells

Isolated populations of committed mesenchymal cells are disclosed herein. In one embodiment, the isolated population is produced by culturing epithelial cells of the islets of Langerhans in vitro on a tissue culture substrate, wherein the epithelial cells migrate out from the islets of Langerhans on the tissue culture substrate and undergo an epithelial to mesenchymal transition to form the population of committed mesenchymal cells. These cells can be, for example, human or mouse cells. Generally, committed mesenchymal cells can proliferate in vitro, and can readily be passaged and expanded. Thus, these cells provide a means to generate large numbers of cells that can be induced to differentiate into pancreatic endocrine cells.

In one embodiment isolated committed mesenchymal cells retain the histone modifications on the promoter of a gene encoding a pancreatic endocrine hormone of a pancreatic endocrine cells, but do not produce the endocrine hormone. In one example, committed mesenchymal cells retain the histone modifications of the insulin gene promoter found in insulin-expressing beta cells but do not express insulin. These histone modifications of the insulin gene promoter are not found in HeLa cells or embryonic stem cells that do not express insulin from chromosomal DNA.

In one example, the committed mesenchymal cells include a chromosome comprising an insulin promoter dimethylated at lysine 4 of histone H3 and/or acetylated at lysine residues of histone H4, and/or an insulin promoter that is not methylated or acetylated at lysine 9 of histone H3. Thus, the committed mesenchymal calls can include a chromosome comprising an insulin promoter dimethylated at lysine 4 of histone H3, acetylated at lysine residues of histone H4, and not methylated or acetylated at lysine 9 of histone H3. However, the committed mesenchymal cells do not express insulin. Epithelial cell clusters can be formed from committed mesenchymal cells by culturing the committed mesenchymal cells in vitro on a tissue culture substrate in the absence of serum and/or growth factors. Generally, these epithelial cell clusters do not express a pancreatic hormone, such as insulin. The epithelial cell clusters can be isolated and transferred into a mammalian recipient (see below). As disclosed above, by culturing epithelial cells clusters in vitro, islet-like cell aggregates can be produced. The islet-like cell aggregates also can be transplanted into a recipient.

Isolated committed mesenchymal cells can be further characterized, such as by immunocytochemistry or fluorescence activated cell sorting. Exemplary immunohistochemical methods for characterization of islet precursor cells are disclosed in the examples section below. Suitable antibodies include antibodies that specifically bind nestin, vimentin, smooth muscle actin and antigens of the major histocompatibility complex.

In one embodiment, suspension including committed mesenchymal cells is produced, and antibodies that specifically bind a cell surface antigen is reacted with the cells in suspension. Methods of determining the presence or absence of a cell surface marker, are well known in the art. Typically, labeled antibodies specifically directed to the marker are used to identify the cell population. The antibodies can be conjugated to other compounds including, but not limited to, enzymes, magnetic beads, colloidal magnetic beads, haptens, fluorochromes, metal compounds, radioactive compounds or drugs. The enzymes that can be conjugated to the antibodies include, but are not limited to, alkaline phosphatase, peroxidase, urease and β-galactosidase. The fluorochromes that can be conjugated to the antibodies include, but are not limited to, fluorescein isothiocyanate, tetramethylrhodamine isothiocyanate, phycoerythrin, allophycocyanins and Texas Red. For additional fluorochromes that can be conjugated to antibodies see Haugland, R. P., Molecular Probes: Handbook of Fluorescent Probes and Research Chemicals (1992- 1994). The metal compounds that can be conjugated to the antibodies include, but are not limited to, ferritin, colloidal gold, and particularly, colloidal superparamagnetic beads. The haptens that can be conjugated to the antibodies include, but are not limited to, biotin, digoxigenin, oxazalone, and nitrophenol. The radioactive compounds that can be conjugated or incorporated into the antibodies are known to the art, and include but are not limited to technetium 99m (" Tc), ^l25 1 and amino acids comprising any radionuclides, including, but not limited to, ^H C, ³ H and ³⁵ S.

Fluorescence activated cell sorting (FACS) can be used to sort cells that express the cell surface antigen of interest, by contacting the cells with an appropriately labeled antibody. In one embodiment, additional antibodies and

FACS sorting can further be used to produce substantially purified populations of cells. A FACS employs a plurality of color channels, low angle and obtuse light- scattering detection channels, and impedance channels, among other more sophisticated levels of detection, to separate or sort cells. Any FACS technique may be employed as long as it is not detrimental to the viability of the desired cells. (For exemplary methods of FACS see U.S. Patent No. 5, 061,620, herein incorporated by reference).

However, other techniques of differing efficacy may be employed to purify and isolate desired populations of cells. The separation techniques employed should maximize the retention of viability of the fraction of the cells to be collected. The particular technique employed will, of course, depend upon the efficiency of separation, cytotoxicity of the method, the ease and speed of separation, and what equipment and/or technical skill is required. Separation procedures may include magnetic separation, using antibody-coated magnetic beads, affinity chromatography, cytotoxic agents, either joined to a monoclonal antibody or used in conjunction with complement, and "panning," which utilizes a monoclonal antibody attached to a solid matrix, or another convenient technique. Antibodies attached to magnetic beads and other solid matrices, such as agarose beads, polystyrene beads, hollow fiber membranes and plastic petri dishes, allow for direct separation. Cells that are bound by the antibody can be removed from the cell suspension by simply physically separating the solid support from the cell suspension. The exact conditions and duration of incubation of the cells with the solid phase-linked antibodies will depend upon several factors specific to the system employed. The selection of appropriate conditions, however, is well within the skill in the art.

Transfection of Committed Mesenchymal Cells In Vitro Exogenous nucleic acids can be introduced into committed mesenchymal cells and epithelial cell clusters. A variety of methods are available for transferring nucleic acids into cells. Calcium phosphate precipitated DNA has been used but generally provides a low efficiency of transformation, especially for non-adherent cells. The use of cationic lipids, such as in the form of liposomes, is an effective method of packaging DNA for transfecting eukaryotic cells, and several commercial preparations of cationic lipids are available. Electroporation can also be used to introduce nucleic acids into cells. Direct microinjection of DNA into the nucleus of cells is yet another method of gene transfer. It has been shown to provide efficiencies of nearly 100% for short-term transfection, and 20% for stable DNA integration. The protocol requires small volumes of materials. It allows for the introduction of known amounts of DNA per cell.

Retroviruses can also be used to provide a random, single-copy, single-site insert at very high transfection efficiencies. Transfection methods are known to one skilled in the art. Protocols for pancreatic cells can involve retroviral vectors as the "helper virus" (for example, encapsidation-defective viral genomes which carry the foreign gene of interest but is unable to form complete viral particles). Other carriers such as DNA-mediated transfer, adenovirus, SV40, adeno-associated virus, and herpes simplex virus vectors can also be employed. Several factors should be considered when selecting the appropriate vector for infection. It is sometimes preferable to use a viral long terminal repeat or a strong internal promoter to express the foreign gene rather than rely on spliced subgenomic RNA. The two primary methods of transformation of precursor cells are co-culture and supernatant infection. Supernatant infection involves repeated exposure of stem cells to the viral supernatant. Co-culture involves the commingling of stem cells and an infected "packaging cell line" (see below) for periods of 24 to 48 hours. Co- culture is typically more efficient than supernatant infection for stem cell transformation. After co-culture, infected stem cells are often further cultured to establish a long term culture (LTC).

The cell line containing the helper virus is referred to as the packaging cell line. A variety of packaging cell lines are currently available. An important feature of the packaging cell line is that it does not produce replication-competent helper virus.

In one embodiment animals or patients from whom stem cells are harvested may be treated with 5-fluorouracil (5-FU) prior to extraction. 5-FU treated precursor cells are more susceptible to retroviral infection than untreated cells. However, 5-FU treatment of cells can dramatically reduce the number of clonogenic progenitors.

The ex vivo transduction of mammalian pancreatic stem cells and subsequent transplantation into recipients sufficient to obtain significant engraftment and gene expression has been shown in mice. Generally, the target pancreatic cells are cultured for two to four days in the presence of a suitable vector containing the gene of interest, before being injected in to the recipient. Cell transduction and engraftment of pancreatic cells in a recipient can be determined through, for example, PCR analysis, immunocytochemical staining, Southern, Northern or Western blotting, or by other such techniques known to one skilled in the art.

Methods of Treatment

In another embodiment, a method is provided for treating a subject suffering from a disease or disorder, such as a pancreatic endocrine system disorder, or alleviating the symptoms of such a disorder, by administering to the subject a therapeutically effective amount of epithelial cell clusters produced using the methods disclosed herein. Examples of endocrine disorders include autoimmune disorders of the pancreatic endocrine system. In one specific non-limiting example, a method is provided for treating a subject with type I or type II diabetes. In another specific, non-limiting example, the recipient of the epithelial cell clusters is human.

Epithelial cell clusters can be transplanted that are isogenic, allogeneic, or xenogeneic. In one example, the cells do not express class I and class II MHC antigens, and thus are not rejected by the recipient. In a further example, the cells express both human specific class I and class II MHC antigens, but are recognized by an immunocompetent recipient as self, and are not rejected by the recipient. In another example, the cells express both human specific class I and class II MHC antigens, and are not recognized by an immunocompetent recipient as self. Thus, a therapeutically effective amount of an immunosuppressive agent can be administered to prevent rejection, such as cyclosporine, anti-CD4 antibodies, or FK506.

Generally the epithelial cell clusters are suspended in a pharmacologically acceptable carrier. Specific, non-limiting examples of suitable carriers include cell culture medium (such as Eagle's minimal essential media), phosphate buffered saline, Krebs-Ringer buffer, and Hank's balanced salt solution +/- glucose (HBSS). The volume administered to a subject will vary depending on a number of parameters including the size of the subject, the severity of the disease or disorder, and the site of implantation and amount of cells in solution. Typically the amount of cells administered to a subject will be a therapeutically effective amount. It is estimated that a diabetic subject will need at least about 10,000, or between 5,000 and 25,000, or between 1,000 and 30,000 or about 12,000 epithelial cell clusters per kilogram body weight per transplantation to have a substantial beneficial effect from the transplantation. The epithelial cell clusters can be administered by any method known to one of skill in the art. In one specific, non- limiting example the cells are administered by sub-cutaneous injection, or by implantation under the kidney capsule, through the portal vein of the liver, or into the spleen. If, based on the method of administration, cell survival after transplantation in general is low (5 — 10%) additional epithelial cell clusters, such as up to 100,000 epithelial cell clusters per kilogram body weight, are transplanted. In one embodiment, transplantation is made by injection. Injections can generally be made with a sterilized syringe having an 18-23 gauge needle. Although the exact size needle will depend on the species being treated, and whether a cell suspension or artificial islets is transplanted, the needle should not be bigger than 1 mm diameter in any species. The injection can be made via any means known to one of skill in the art. Specific, non-limiting examples include subcutaneous injection, intra-peritoneal injection, injection under the kidney capsule, injection through the portal vein, and injection into the spleen.

In one embodiment, the epithelial cell clusters are directly administered to a subject. In another embodiment, the cells are encapsulated prior to administration, such as by co-incubation with a biocompatible matrix known in the art. A variety of encapsulation technologies have been developed (e.g., Lacy et al., Science 254:1782-84, 1991; Sullivan et al., Science 252:7180712, 1991; WO 91/10470; WO 91/10425; U.S. Patent No. 5,837,234; U.S. Patent No. 5,011,472; U.S. Patent No. 4,892,538, each herein incorporated by reference).

The cells can be implanted using an alginate-polylysine encapsulation technique (O'Shea and Sun, Diabetes 35:943-946, 1986; Frischy et al., Diabetes 40:37, 1991). In this method, the cells are suspended in 1.3% sodium alginate and encapsulated by extrusion of drops of the cell/alginate suspension through a syringe into CaCl ₂- After several washing steps, the droplets are suspended in polylysine and rewashed. The alginate within the capsules is then reliquified by suspension in 1 mM EGTA and then rewashed with Krebs balanced salt buffer. Each capsule is designed to contain several hundred cells and have a diameter of approximately 1 mm. Capsules containing cells are implanted (approximately 1, 000-10,000/animal) intraperitoneally and blood samples taken daily for monitoring of blood glucose and insulin.

In another embodiment, a therapeutically effective amount of epithelial cell clusters are suspended in an aqueous solution of collagen. In one embodiment, the collagen is atellocollagen, such as an about 0.5%-2% atellocollagen solution. Atellocollagen is obtained by treating collagen with pepsin, which removes antigenic telopeptides, responsible for intermolecular cross linkage of collagen. About 0.5%-5% of agarose, such as about 1%, is then added to the epithelial cell clusters such that the epithelial cell clusters are suspended in a mixture of collagen and agarose. The mixture containing the epithelial cell clusters is then transformed into a semisolid bead using techniques well known in the art, preferably by dropping the mixture onto mineral oil or a TEFLON® sheet. The semisolid bead is then transferred to an antibiotic medium, washed, and then incubated under standard conditions to polymerize the collagen, preferably at 37°C in a humidified 5% CO₂ atmosphere, whereby a solid collagen-agarose macrobead is formed. In another embodiment a therapeutically effective amount of epithelial cell clusters are spread onto the surface (3-5 cm) of a gelatin sponge. The gelatin sponge is then rolled into a sphere. Agarose, 3%-5%, is poured onto the sphere to form a bead.

In yet another embodiment of the invention, a therapeutically effective amount of epithelial cell clusters are placed in an agarose solution ranging from about 0.5%-5% agarose, preferably about 1% agarose. The mixture is then transformed into a macrobead by contacting the mixture to mineral oil or TEFLON®. The bead is then transferred to an antibiotic medium, washed, and incubated overnight, preferably at 37°C in a humidified 5% CO₂ atmosphere. In these embodiments, the macrobeads are uniformly coated with agarose, preferably by rolling the bead 3-4 times in a TEFLON® spoon containing about 500-2,000 μl of 5%-10% agarose (see U.S. Patent No. 5,643,569).

Other methods for implanting islet tissue into mammals have been described and can be utilized with epithelial cell clusters (Lacy et al., supra, 1991; Sullivan et al., supra, 1991 ; U.S. Patent No. 5,993,799, each incorporated herein by reference). In one specific, non-limiting example, a therapeutically effective amount of epithelial cell clusters are encapsulated in hollow acrylic fibers and immobilized in a biocompatible alginate hydrogel. Thus, the cells are immobilized by encapsulation in a biocompatible hydrogel that is hardened by the addition of an aqueous solution of salt, such as a calcium salt. The cells are then placed in tubular acrylic membranes or fibers which are permeable to molecules with a molecular weight of less than 50,000 Da, or less than 80,000 Da. These fibers are then transplanted intraperitoneal^ or subcutaneously implants.

In another embodiment, epithelial cell clusters produced using the methods disclosed herein can be administered as part of a biohybrid perfused "artificial pancreas," which encapsulates islet tissue in a selectively permeable membrane (Sullivan et al., Science 252: 718-721, 1991). In this method, a tubular semipermeable membrane is coiled inside a protective housing to provide a compartment for the epithelial cell clusters. Each end of the membrane is then connected to an arterial polytetrafluoroethylene (PTFE) graft that extends beyond the housing and the device is joined to the vascular system as an arteriovenous shunt. Other suitable methods are known to those of skill in the art.

The epithelial cell clusters are transplanted into a subject in an amount sufficient to treat the condition, such as type I or type II diabetes. An amount adequate to accomplish this is defined as a "therapeutically effective amount." One of skill in the art can readily determine this amount. Amounts effective for this use will depend upon the severity of the condition, the general state of the patient, the route of administration, the placement of the cells, and whether the cells are being administered in combination with other drugs. The cells can be used combination with additional therapeutic agents, such as immunosuppressive agents or insulin. In one embodiment, insulin is administered such that the subject is normo-glycemic at the time of transplant.

Identification of Agents that Affect Islets and/or the Secretion of Pancreatic

Endocrine Hormones Another aspect of this disclosure provides an assay for evaluating the effect of substances on the differentiation and function of pancreatic endocrine cells. The assay can be used to test agents capable of regulating the survival, proliferation, or genesis of pancreatic endocrine cells. According to this aspect of the invention, a population of committed mesenchymal cells is produced as described above. The population of committed mesenchymal cells is contacted with a substance of interest and the effect on the cell population is then assayed. In one embodiment, a method is provided for identifying an agent of use in treating diabetes. The method includes isolating islets of Langerhans from a mammal, such as a human, mouse, rat, rabbit, or pig. The islets of Langerhans are cultured in vitro on a tissue culture substrate such that epithelial cells migrate out from the islets of Langerhans on the tissue culture substrate and undergo an epithelial to mesenchymal transition to form a population of committed mesenchymal cells. The population of committed mesenchymal cells is expanded in vitro, and contacted with an agent of interest. The committed mesenchymal cells are then enzymatically digested and re-plated using the methods disclosed herein such that epithelial cell clusters are formed. An increase in expression of the insulin or C- peptide by the epithelial cell clusters as compared to a control identifies the agent as of use in treating diabetes.

In one embodiment, the islets of Langerhans are isolated from a transgenic animal that expresses a marker polypeptide in insulin producing cells. Thus, a method is provided for identifying an agent of use in treating diabetes. The method includes isolating islets of Langerhans from a transgenic animal whose genome comprises a transgene, wherein the transgene comprises an insulin promoter operably linked to a nucleic acid encoding a marker polypeptide. The islets of Langerhans from the transgenic animal are cultured in vitro on a tissue culture substrate, such that epithelial cells migrate out from the islets of Langerhans on the tissue culture substrate such that they undergo an epithelial to mesenchymal transition to form a population of committed mesenchymal cells. The committed mesenchymal cells include a chromosome comprising an insulin promoter dimethylated at lysine 4 of histone H3 and/or acetylated at lysine residues of histone H4, and/or an insulin promoter that is not methylated or acetylated at lysine 9 of histone H3. Thus, the committed mesenchymal calls can include a chromosome comprising an insulin promoter dimethylated at lysine 4 of histone H3, acetylated at lysine residues of histone H4, and not methylated or acetylated at lysine 9 of histone H3. However, these committed mesenchymal cells do not produce insulin and do not express the transgene.

The population of committed mesenchymal cells is contacted with an agent of interest. The population of committed mesenchymal cells is harvested and epithelial cell clusters are formed. Optionally, the epithelial cell clusters are transplanted into a non-transgenic animal. An increase in expression of the transgene by the epithelial clusters (or islet-like cell aggregates formed therefrom) as compared to a control identifies the agent as of use in treating diabetes. Transgenic animals of use have a genome including a transgene comprising an insulin promoter operably linked to a marker polypeptide. Any animal can be of use in the methods disclosed herein, provided the animal is any non-human animal. A "non-human animal" includes, but is not limited to, a non-human primate, a farm animal such as swine, cattle, and poultry, a sport animal or pet such as dogs, cats, horses, hamsters, rodents, or a zoo animal such as lions, tigers, or bears. In one specific, non-limiting example, the non-human animal is a transgenic animal, such as, but not limited to, a transgenic mouse, cow, sheep, or goat. In one specific, non- limiting example, the transgenic animal is a mouse.

A transgenic animal contains cells that bear genetic information received, directly or indirectly, by deliberate genetic manipulation at the subcellular level, such as by microinjection or infection with recombinant virus, such that a recombinant DNA is included in the cells of the animal. This molecule can be integrated within the animal's chromosomes, or can be included as an extrachromosomally replicating DNA sequences, such as might be engineered into yeast artificial chromosomes. A transgenic animal can be a "germ cell line" transgenic animal, such that the genetic information has been taken up and incorporated into a germ line cell, therefore conferring the ability to transfer the information to offspring. If such offspring in fact possess some or all of that information, then they, too, are transgenic animals. Transgenic animals can readily be produced by one of skill in the art. For example, transgenic animals can be produced by introducing into single cell embryos DNA encoding a marker, in a manner such that the polynucleotides are stably integrated into the DNA of germ line cells of the mature animal and inherited in normal Mendelian fashion. Advances in technologies for embryo micromanipulation permit introduction of heterologous DNA into fertilized mammalian ova. For instance, totipotent or pluripotent stem cells can be transformed by microinjection, calcium phosphate mediated precipitation, liposome fusion, retroviral infection or other means, the transformed cells are then introduced into the embryo, and the embryo then develops into a transgenic animal. In one non- limiting method, developing embryos are infected with a retrovirus containing the desired DNA, and transgenic animals produced from the infected embryo. In another, specific, non-limiting example, the appropriate DNA(s) are injected into the pronucleus or cytoplasm of embryos, preferably at the single cell stage, and the embryos allowed to develop into mature transgenic animals. These techniques are well known. For instance, reviews of standard laboratory procedures for microinjection of heterologous DNAs into mammalian (mouse, pig, rabbit, sheep, goat, cow) fertilized ova include: Hogan et al., Manipulating the Mouse

Embryo, Cold Spring Harbor Press, 1986; Krimpenfort et al., Bio/Technology 9:86, 1991; Palmiter et al., Cell 41 :343, 1985; Kraemer et al., Genetic Manipulation of the Early Mammalian Embryo, Cold Spring Harbor Laboratory Press, 1985; Hammer et al., Nature 315:680, 1985; Purcel et al., Science 244:1281, 1986; Wagner et al., U.S. Patent No. 5,175,385; Krimpenfort et al., U.S. Patent No. 5,175,384.

In one example, the insulin promoter is utilized. The insulin promoter has been cloned from many species, including mice and rats. Transgenic mice harboring a transgene including an insulin promoter have been generated (see for example, Hara et al., Am J Physiol Endocrinol Metab 284: E177-E183, 2003; Hanahan, Science 246:1265-1275, 1989; Eftat et al., MoI Cell. Biol. 10:1779-1783, 1990; Roman et al., Cell 61 :383-396, 1990). In several specific, non-limiting examples, the mouse insulin promoter is utilized, or the rat insulin II promoter is utilized. The insulin promoter is operably linked to a nucleic acid encoding a marker polypeptide. Suitable promoters also include the glucagon, somatostatin, GLP-I receptor, and glucokinase promoter.

The marker polypeptide can be any detectable protein. Suitable marker polypeptides include, but are not limited to green fluorescent protein, human growth hormone, SV40 T antigen, influenza hemagglutinin (HA), and ras protein. The analyses of transgene expression can include detection of the level of the marker protein, and/or RNA encoding the marker in the cells, or can include detection of the biological activity of the maker polypeptide. Any substance of interest can be screened using the disclosed methods. Substances of interest include extracts from tissues or cells, conditioned media from primary cells or cell lines, polypeptides whether naturally occurring or recombinant, nucleotides (DNA or RNA) and non-protein molecules whether naturally occurring or chemically synthesized such as pharmaceutical agents. Agents that can be tested using the methods disclosed herein include polypeptides, chemical compounds; biological agents such as, but not limited to polypeptides, cytokines, and small molecules, peptidomimetics; antibodies; and synthetic ligands, amongst others. Receptor agonists and antagonists can be screened. "Incubating" includes conditions that allow contact between the test compound and the histological section. "Contacting" includes in solution and solid phase. The test compound may also be a combinatorial library for screening a plurality of compounds. Compounds that are polypeptides that are identified in the method of the invention can be further evaluated, detected, cloned, sequenced, and the like, either in solution of after binding to a solid support, by any method usually applied to the detection of a specific DNA sequence, such as PCR, oligomer restriction (Saiki et al., Bio/Technology 3 : 1008- 1012, 1985), allele-specific oligonucleotide (ASO) probe analysis (Conner et al., Proc. Natl. Acad. Sd. U.S.A. 80:278, 1983), oligonucleotide ligation assays (OLAs) (Landegren et al., Science 241:1077, 1988), and the like. Molecular techniques for DNA analysis have been reviewed (Landegren et al., Science 242:229-237, 1988).

The role of various genes in differentiated pancreatic endocrine cells can also be examined. According to this embodiment, cells are cultured in vitro as described herein and an exogenous nucleic acid is introduced into the cells by any method • known to one of skill in the art, for example, by transfection or electroporation. The transfected cultured cells can then be studied in vitro or can be administered to a subject (see below). Methods for the introduction of nucleic acid sequences into cells are known in the art (for example see above and see U.S. Patent No. 6,110,743). The disclosure is illustrated by the following non-limiting Examples. EXAMPLES

It is demonstrated herein that insulin-expressing beta cells, found in pancreatic islets, can undergo an epithelial-to-mesenchymal transition to produce committed mesenchymal cells under appropriate culture conditions. These committed mesenchymal cells can be expanded in vitro. The committed mesenchymal cells can be induced to undergo a mesenchymal-to-epithelial transition to produce epithelial cells clusters, which can differentiate into pancreatic endocrine cells. In one example, transplantation of epithelial cell clusters into a recipient results in the expression of a pancreatic hormone, such as insulin. Thus, a therapeutically effective amount of epithelial cell clusters can be introduced into a subject, such as to treat diabetes.

Epithelial-to-mesenchymal transition (EMT) has been documented in vitro and in vivo during development and carcinogenesis ( Hay, Acta Anat (Basel) 154, 8, 1995; Thiery, Curr Opin Cell Biol 15, 740, 2003; Thiery, Nat Rev Cancer 2, 442, 2002; Kalluri and Neilson, J CHn Invest 112, 1776, 2003). It is demonstrated herein that cells from adult human islets undergo reversible epithelial-to-mesenchymal transition (EMT) to produce proliferating precursors of islet-like cell aggregates (ICAs). The unexpected plasticity of human islet-derived committed mesenchymal cells can be used to generate cells for replacement therapy, or can be used to generate an assay to screen for agents of use in treating diabetes.

Example 1

Materials and Methods

Cell culture: Human pancreatic islet isolations were performed according to the procedure of Ricordi et al. (Diabetes 38 Suppl. 1, 140, 1989). Preparations are composed of 60% to 90% mature islets with residual duct and exocrine tissue. Islet preparations from twelve donors, ages 3 to 58 years, were used. Samples were enriched for islets and depleted of debris and single cells by retention in a 40 μm filter. Approximately 2,000 islet equivalents were seeded onto 100 mm tissue culture-treated dishes in 10 ml CMRL-1066 medium containing 5.5 mM glucose

(Gibco) supplemented with 2mM L-glutamine and 10% fetal bovine serum (serum- containing medium, SCM). The majority of islets attached to the dish within one to two days. Cultures were re-fed on day 2 and thereafter as needed to replenish nutrients and remove debris. They were sub-cultured (1 :2) when nearly confluent or when the outgrowth extended beyond one diameter from the original islet (usually once or twice between days 3-14). During the first several days in culture, adherent cells migrated out from the islets until there were virtually no islets remaining and a monolayer of cells comprised mostly of "fibroblast-like" cells with a few cobblestone-appearing cells was established. As used herein "passage 0" is defined as 14 days after the islets are received and placed in tissue culture-treated dishes. Beginning at passage 0, cells were harvested with trypsin and sub-cultured every 3-4 days for at least 3 months. During this period, angular "fibroblast-like" cells dominate the culture. At each passage, a portion of the cells was cryopreserved in 90% FBS / 10% DMSO for subsequent study. To measure the cell doubling rate, one million committed mesenchymal cells were seeded at each passage in a 10-cm dish in SCM and harvested for counting and re-seeding every three days.

To generate islet-like cell aggregates (ICAs), committed mesenchymal cells at various passages were monodispersed with trypsin on "day 0" and 0.2 to 1x10⁶ cells were added to each well of 6-well tissue culture-treated plates in serum-free CMRL- 1066 medium supplemented with 1% BSA, insulin (10 μg/ml), transferrin (5.5 μg/ml) and sodium selenite (6.7 ng/ml) (SFM). The medium was replaced every other day, using unit gravity to retain ICAs that had become detached from the culture dish and separate ICAs from single or dead cells and debris that were in suspension.

Realtime quantitative RT-PCR. Total RNA was purified using Trizol (Invitrogen). For RNA preparation from single cells, 10 μg of glycogen was added to 150 μl of Trizol. First strand cDNA was prepared using a High Capacity cDNA Archive Kit (Applied Biosystems). PCR was performed in 25 μl reactions in 96- well plates using cDNA prepared from 100 ng of total RNA and Universal PCR Master Mix (Applied Biosystems). Primers and probes were Assay-on-Demand (Applied Biosystems) or for cytokeratin-19 (Ck-19) were custom designed with 5' to 3' sequences: forward CCCGCGACTACAGCCACTAC (SEQ ID NO: 1), reverse TGGTGGCACCAAGAATCTTG (SEQ ID NO: 2), probe CACGACCATCCAGGACCTGCGG (SEQ ID NO: 3). Linear amplification of proinsulin and glucagon transcripts by qRT-PCR was confirmed on samples containing varying proportions of total RNA from human islets and HeLa cells. Thus, for each 2-fold reduction in the fraction of human islet RNA in a 100 ng sample of combined total RNA, the fluorescence cycle threshold (Ct) value for proinsulin or proglucagon mRNA increased by one cycle. This linear relationship continued until the Ct values were 38, and we therefore consider Ct values greater than 38 to be undetectable. For quantitative expression of fold-changes by qRT- PCR when the initial transcript levels were undetectable, the initial Ct value was assigned to be 38, which would lead to a possible underestimation of the actual fold- change. qRT-PCR results were normalized to GAPDH₅ β-actin or 18S RNA levels to correct for differences in RNA input.

For single cell measurements, cells were monodispersed with trypsin, washed 3 times with buffer and 10⁴ cells were seeded in 15 ml SCM into 10-cm tissue culture-treated dishes. After 5 to 10 min, individual cells were handpicked under microscopic visualization from cells that had settled to the surface of the dish and become loosely adherent. Thus, proinsulin mRNA was measured in single cells that were selected to be part of the proliferating committed mesenchymal cell cultures. Proinsulin transcript was detected in single cells with fluorescence Ct values of 23 or more and comparable aliquots of medium not containing a cell gave Ct values of 38 or higher, presumably from leakage of mRNA from damaged cells. Therefore, single cells were scored positive for proinsulin transcript if Ct values were between 23 and 37. This 2^37'23 = 2¹⁴ ~ 16,000-fold range for detectable insulin expression in single human islet-derived cells is consistent with the estimate for proinsulin II mRNA of 10⁵ copies per mouse beta cell (Wang et ah, Proc. Natl. Acad. Sci. U. S. A. 94, 4360, 1997).

Antibodies, immunostaining and in situ hybridization: Rabbit polyclonal antibody to human C-peptide (Linco Research Inc, MO) and mouse monoclonal anti-vimentin (Immunotech, France) antibodies were used at 1:100 dilution. Mouse monoclonal anti-cytokeratins-7 and -19 antibodies (Dako) and anti-smooth muscle actin (Sigma) were used at 1 :200 dilution. Rabbit polyclonal antibody to human nestin was a generous gift from Dr. Eugene Major (NINDS₅ NIH) and was used at 1 :200 dilution. Antibody against C-peptide was used in this study to avoid detection of the insulin supplement in SFM during immunostaining procedures (Rajagopal et al, Science 299, 363, 2003). Alexa-Fluor 488 and 633 F(ab'>2 secondary antibodies (Molecular Probes, OR) were used at 1 :200 dilution. Propidium iodide was used to visualize nuclei. For immunostaining of islet or ICA outgrowths, cells were washed with DPBS. In some cases, cell monolayers or clusters were dispersed with 0.05% Trypsin/EDTA (Cellgro) and cytospun for 5 min at 700 rpm onto glass slides. Cells were then fixed in 4% fresh paraformaldehyde, permeabilized with chilled 50% methanol, blocked with 4% donkey serum and then incubated with antisera. Primary antibodies were incubated overnight at 4°C, washed with PBS and then incubated with the secondary antibodies at 37°C for lhour. Slides were then washed extensively in PBS and mounted in Mowiol. Double in situ hybridization and antibody labeling were performed as described (Rulifson et al, Science 10, 1118 (2002), Knirr et al, Development 126, 4525 (1999). Briefly, cells were fixed in fresh paraformaldehyde and first processed for hybridization by standard procedures but without proteinase treatment. Proinsulin Greenstar™ oligonucleotide anti-sense probe (Gene Detect,. FL) was hybridized overnight at 37°C. Controls for hybridization included a sense probe (negative control) as well as poly(dT) (positive control) and each hybridization experiment included a positive sample (fresh human islets) and a negative sample (passage 9 committed mesenchymal cells). Following hybridization, slides were washed with PBS and then processed for immunostaining as described above. Confocal images were captured with a Zeiss LSM 510 Meta laser scanning inverted microscope using a 100X/1.3 oil objective with optical slices less than 0.7 μm. Magnification, laser and detector gains were identical across samples. Results presented are representative fields confirmed from at least three different experiments using cells derived from at least two islet preparations.

Example 2 Cells from Adult Human Islets Can Proliferate and Produce Islet-Cell Aggregates (ICAs)

Committed mesenchymal cells are proliferative cells that can be induced by serum deprivation to differentiate into hormone-expressing ICAs (see below). Committed mesenchymal cells were from a heterogeneous population of adherent cells that emerge from islets (FIG. 2). After 2 days in culture, over 40% were positive for C-peptide and 3% were positive for vimentin; cells expressing both proteins were not observed. By day 7, 28% were positive for vimentin, C-peptide positive cells decreased to 36% and, importantly, 3% were positive for both proteins. The trend of increasing vimentin and decreasing C-peptide expression continued through day 14. Interestingly, cells positive for both proteins were not observed at this later time, suggesting that double-positive cells could reflect a transient state as C-peptide positive cells transition to vimentin-positive committed mesenchymal cells.

In situ hybridization showed that some adherent cells emerging from islets were positive for proinsulin mRNA and for vimentin protein (Fig. 3) even though most cells at this time were vimentin negative. Vimentin staining was filamentous as in mesenchymal cells ( Hay, ActaAnat (Basel) 154, 8, 1995). Similarly, cells emerging from islets after four days express filamentous arrays of nestin, smooth muscle actin and vimentin. Thus, these data suggest that committed mesenchymal cells are derived from insulin-expressing cells by EMT.

To test this hypothesis, proinsulin transcript was measured in randomly selected, adherent single cells during the first 17 days of culture. During days 2 through 8, when the number of viable cells remained constant, most cells were positive for proinsulin, although transcript levels were distributed over three orders of magnitude. This suggests that the culture conditions select for proinsulin mRNA- positive cells. From day 11 to 17, the level of proinsulin transcript declined in individual cells. Most importantly, as the cell number doubled from day 11 to 14 and increased again by one-half from day 14 to 17, the percentages of proinsulin- positive cells were 95% (day 14) and 100% (day 17). If proliferative committed mesenchymal cells had arisen from proinsulin transcript-negative cells, such as a "stem cell, a doubling of cell number would have decreased proinsulin transcript- expressing cells to 50% and a further increase in cell number by one-half would have decreased proinsulin-expressing cells to 33%. This did not occur. In three additional islet preparations, proinsulin mRNA remained detectable in the majority of cells after 14 days in culture. These findings are most consistent with the conclusion that proliferating committed mesenchymal cells originate by EMT from cells initially expressing proinsulin mRNA.

After 2 weeks in culture, islets had flattened to generate a monolayer of cells; residual "islets" were comprised of granular, dead cells. Harvested and re-seeded cells displayed a nearly homogeneous, fibroblast-like morphology (FIG. 1).

Committed mesenchymal cells at this stage, about 14 days after islets were placed into culture, were defined as passage 0. In 3 to 4 days, the culture reached confluence. During the transition from cells within islets to committed mesenchymal cells, markers for epithelial cells including E-cadherin, claudins 3 and 4, occludin and platelet/endothelial cell adhesion molecule, and those specific for endocrine cells including proinsulin, proglucagon, glucokinase and glucagon-like peptide- 1 receptor, decreased whereas markers of mesenchymal cells including vimentin, nestin, smooth muscle actins alpha 2 and gamma 2, endoglin, matrix metalloproteinase 2, snail homologs 1 and 2, thy-1 cell surface antigen and prolyl 4- hydroxylase increased (see Table 1, below).

qRT-PCR Cycle Threshold Human Islets hlPCs

Single Pooled A, p8 B, p16 C, p1l

Epithelial

INS 14 14 27 >38 >38

GCG 19 20 33 35 39

GCK 23 24 >38 >38 ND

PDX1 23 24 34 >38 ND

GLP1 R 24 25 >38 >38 ND

CDH1 20 21 30 30 30

CLDN3 23 24 31 31 34

CLDN4 18 18 27 28 30

OCLN 20 21 26 26 27

PECAM 1 24 24 34 31 35

Mesenchymal

VIM 18 19 14 15 16

NES 26 27 24 24 23

ACTA2 24 25 17 18 16

ACTG2 33 31 23 21 23

ENG 25 25 21 22 22

MMP2 23 22 17 17 17

SNAH 26 26 24 26 24

SNAI2 25 ^'25 21 22 22

THY1 25 26 18 18 19

P4HA1 22 24 20 20 21

Table 1. Expression of representative epithelial and mesenchymal markers in human islets and committed mesenchymal cells.

For the results presented in this table, quantitative RT-PCR (qRT-PCR) cycle threshold values for each sample were normalized to 18S RNA content. Total RNA was prepared from human islets within 3 days of organ donation from a single donor (Single) or pooled from 3 donors (Pooled). Total RNA was prepared from committed mesenchymal cells derived from 3 individual donors (A, B or C) at passages 8 (p8), 10 (plO) or 16 (pl6). INS, insulin; GCG, glucagon; GCK, glucokinase; PDXl , insulin promoter factor 1 ; GLPl R, glucagon-like peptide 1 receptor; CDHl , E-cadherin; CLDN3, claudin 3; CLDN4, claudin 4; OCLN, occludin; PECAMl , platelet/endothelial cell adhesion molecule (CD31); VIM, vimentin; NES, nestin; ACTA2, smooth muscle actin alpha 2; smooth muscle actin gamma 2; ENG, endoglin (CDl 05); MMP2, matrix metalloproteinase 2; SNAIl, snail homolog 1 ; SNAI2, snail homolog 2; THYl , thy-1 cell surface antigen; P4HA1 , prolyl 4- hydroxylase alpha subunit. ND = not determined.

Unlike many other primary cell populations derived from human or rodent islets (Bonner-Weir etal, Proc Natl Acad Sci US A 97, 7999, 2000; Beattie et al, Diabetes 48, 1013 (1999), committed mesenchymal cells exhibit substantial proliferative potential for about 90 days (doubling time of 60 hours. Cryopreserved cells resumed growth after a brief lag period at rates similar to cells never frozen. During the initial three months in culture, committed mesenchymal cells expanded by almost 10¹²-fold. As a primary culture, committed mesenchymal cell proliferation slowed at later passages. Committed mesenchymal cells from three different islet preparations at passages 4 to 14 exhibited normal karyotypes. At early passages, committed mesenchymal cell populations are positive for proinsulin mRNA, but the level decreased continuously and became undetectable by passage 10. The gradual loss of proinsulin transcript may reflect the long half-life of proinsulin mRNA, estimated to be about 30 hours in rodents ( Welsh et al, J Biol Chem 260, 13590 (1985). Other endocrine-specific transcripts, including proglucagon, glucagon-like peptide 1 receptor and glucokinase, also decreased and were undetectable by passage 10 (Table 1 ).

Up to passage 30, committed mesenchymal cells could differentiate into ICAs upon serum deprivation. Before differentiation, committed mesenchymal cells immunostained for vimentin (94% of cells), nestin (75%) and smooth muscle actin (98%) in prominent filaments like mesenchymal cells ( Hay, Acta Anat (Basel) 154, 8 (1995, Kalluri and Neilson, J Clin Invest 112, 1776, 2003) and were negative for C-peptide. In contrast, cells within ICAs expressed C-peptide and glucagon. C- peptide staining was used to exclude detection of insulin in SFM ( Rajagopal et al., Science 299 ', 363 (2003). Immunostaining for C-peptide and glucagon on 7-d ICAs from passages 10, 12 or 14 showed that 27±4% of cells stained positively for C- peptide and 17±2% for glucagon. The transition of committed mesenchymal cells into ICAs increased proinsulin mRNA at least 1000-fold over initially undetectable levels and proglucagon mRNA over 100-fold. Transcripts for glucagon-like peptide 1 receptor and glucokinase also increased more than 10-fold. Thus, endocrine- specific transcripts increased when mesenchymal committed mesenchymal cells transitioned into epithelial ICAs. Expression of claudin 3 and 4 mRNAs ( Tsukita, M. Furuse, Ann N YAcadSci 915, 129, 2000) increased whereas expression of smooth muscle actin alpha2 and gamma2 mRNAs ( Kalluri and Neilson, J Clin Invest 112, 1776, 2003) decreased in ICAs, further supporting an epithelial transition. Transcripts of insulin, glucagons and somatostatin increase even further, to levels approaching those in adult human islets, after transplantation into mice (Fig. 11).

Proinsulin transcript induction was compared at different passages. At passages 3, 4 or 6, proinsulin transcript increased about 10-fold over initially detectable levels whereas at passages 10 through 18, it increased at least 100- to 1, 000-fold over initially undetectable levels. At passages later than 27, smaller increases in proinsulin transcript were observed. Induction of proinsulin transcript by 100- fold or more occurred consistently in ICAs generated from mid-passage committed mesenchymal cells from six separate donor islets. Although committed mesenchymal cells ICAs reproducibly exhibited marked induction of proinsulin mRJSfA expression , the level of proinsulin mRNA attained was less than 0.02% that of human islets. Thus, committed mesenchymal cells ICAs are not comparable to islets in the levels of insulin (or glucagon) expression. However, cells within committed mesenchymal cells ICAs exhibit the following features of islets: insulin C-peptide is detected by immunostaining; ICAs secreted C-peptide under basal and stimulated conditions in vitro, and human C-peptide was measured in blood from 3 of 6 NOD/SCID mice implanted with ICAs under their kidney capsules and after 14 days implants from these 3 mice immunostained for human C-peptide.

In most previous attempts to generate β-cells in culture from adult islets, maintenance of insulin expression during culture was attempted ( Lechner and

Habener, Am J Physiol Endocrinol Metab 284, E259, 2003). The cells obtained in these experiments did not expand well nor did they exhibit marked induction of insulin expression.

It is demonstrated herein that committed mesenchymal cells are "true" endocrine pancreas precursor cells that exhibit a mesenchymal phenotype prior to transition into epithelial clusters containing cells expressing insulin or glucagon. Of most importance, committed mesenchymal cells are highly proliferative and can be expanded over 10¹²-fold and, therefore, could serve as cells for replacement therapy for diabetes if their insulin output, in particular, that in response to glucose, could be optimized and they could be shown to be safe and effective upon implantation.

The origin of committed mesenchymal cells is important because it informs on the potential plasticity of insulin-expressing cells, and perhaps of other epithelial cell types, at least after culture in vitro. In contrast to the prevailing view that the source of pancreas-derived precursor cells is adult stem cells, strong evidence that committed mesenchymal cells are derived from insulin-expressing cells by EMT is provided herein.

Example 3 Evaluation of Histone Modifications in Committed Mesenchymal Cells

The covalent histone modifications of islet cells and committed mesenchymal cells were analyzed using the methods disclosed in Chakrabarti et al., J. Biol. Chem. 278: 23617-23622, 2003, incorporated herein by reference. The results are summarized in FIG. 4.

Briefly, the quantitative ChIP assays were performed as described (Chakrabarti et al., supra, 2003). Cells were removed by trypsinizing cells from 10-cm plates and replating on fresh 10-cm tissue culture dishes. Approximately 30 min later, medium was aspirated and replated. This process was repeated, after which the medium was processed for ChIP. Co-immunoprecipitated promoter fragments were quantitated by real-time PCR using continuous SYBR Green I monitoring. Prior to ChIP, 1 μg of a plasmid containing the firefly luciferase coding sequence (pFoxLuc) was added to each cellular extract and was used to correct for differences in DNA recovery between samples after the ChIP procedure. This was accomplished by determining the quantity of recovered luciferase DNA in each sample by realtime PCR, and using this value to correct the recovery of the Ins promoter fragments. Data were expressed relative to control conditions, in which normal rabbit serum was used instead of specific antibody in the ChIP. In practice, DNA fragments are nonspecifically and reproducibly recovered after ChIP in the absence of antibody, but are often amplified 0-6 cycles later than specifically recovered fragments. Thus, data expressed relative to these control conditions allow for (a) correction in the variation of background DNA precipitation from different populations of cells, and φ) assessment of the absolute enrichment of specific DNA fragments after ChIP in any given cell cell population. Example 4

Use of Transgenic Mice Expressing a Mouse Insulin Promoter (MIP)-Green

Fluorescent Protein (GFP)

Mice Expressing MIP-GFP: These mice were described in Hara et al., Am J Physiol Endocrinol Metab 284: E177-E183, 2003. Briefly, the mouse insulin I gene promoter (MIP)-GFP-transgenic construct was assembled using an 8.5-kb fragment of the MIP that includes a region from —8.5 to +12 bp (relative to the transcriptional start site), the coding region of enhanced GFP (EGFP) (0.76 kb; Clontech, Palo Alto, CA), and a 2.1-kb fragment of the human growth hormone (hGH) cassette gene for high-level expression. The 1 1.2-kb MIP-EGFP-hGH fragment was isolated from the vector by digestion of the plasmid construct with Sfil and HmdIII and agarose gel electrophoresis. The fragment was further purified using an Elutip-D column (Schleicher & Schuell, Keene, NH). The purified transgene DNA was microinjected into the pronuclei of CD-I mice by the Transgenic Mouse/ES Core Facility of the University of Chicago Diabetes Research and Training Center (DRTC). Tail DNA from potential founder mice was screened for the presence of the transgene by PCR. The MIP-GFP mice developed normally. At 6 wk of age, there were no significant differences in body weight, fasting blood glucose, and pancreatic insulin content between transgenic and nontransgenic CD-I male mice. Isolation of pancreatic islets of Langerhans. Pancreatic islets were isolated using a modification of the procedure originally described by Lacy and Kostianovsky {Diabetes 16: 35-39, 1967). Briefly, the pancreas was inflated with a solution containing 0.3 mg/ml collagenase (Type XI; Sigma, St. Louis, MO) in Hanks' balanced salt solution, injected via the pancreatic duct. The inflated pancreas was removed, incubated at 37°C for 10 min, and shaken vigorously to disrupt the tissue. After differential centrifugation through a Ficoll gradient to separate islets from acinar tissue, the islets were washed and then hand picked. They were plated on 12- or 35-mm coverslips to facilitate adherence for subsequent measurement of intracellular calcium or confocal microscopic visualization. The islets were cultured in RPMI 1640 supplemented with 10% (vol/vol) fetal bovine serum (FBS), 100 U/ml penicillin, and 100 μg/ml streptomycin in a humidified incubator at 37°C in 95% air and 5% CO₂. Production of committed mesenchymal cells: Islets were culture as disclosed above. After 2 days in culture, over 40% were positive for C-peptide and GFP and 3% were positive for vimentin; cells expressing both proteins were not observed. By day 7, 28% were positive for vimentin, C-peptide positive cells decreased to 36% and, importantly, 3% were positive for both proteins. The trend of increasing vimentin and decreasing C-peptide expression continued through day 14. After 2 weeks in culture, islets had flattened to generate a monolayer of cells; residual "islets" were comprised of granular, dead cells. Harvested and re-seeded cells displayed a nearly homogeneous, fibroblast-like morphology. At this stage, about 14 days after islets were placed into culture, were defined as passage 0. In 3 to 4 days, the culture reached confluence. During the transition to committed mesenchymal cells, GFP was not expressed.

Up to passage 30, committed mesenchymal cells could differentiate into epithelial cell clusters upon serum deprivation. Before differentiation, committed mesenchymal cells immunostained for vimentin (94% of cells), nestin (75%) and smooth muscle actin (98%) in prominent filaments and were negative for C-peptide. In contrast, cells within epithelial cell clusters expressed C-peptide, GFP and glucagon. The transition of mesenchymal cells into islet cell aggregates increased GFP over initially undetectable levels (FIG. 12); GFP expression is an easily- monitored surrogate for insulin expression.

Example 5 Bioartificial Pancreas

There is a need to provide a biocompatible and implantable device containing islets of Langerhans, or the insulin producing cells, that can supply the hormone insulin for the purpose of controlling blood glucose levels in people with diabetes mellitus requiring insulin. Insufficient regulation of blood glucose levels in people with diabetes has been associated with the development of long-term health problems such as kidney disease, blindness, coronary artery disease, stroke, and gangrene resulting in amputation. Therefore, there is a need to replace conventional insulin injections with a device that can provide more precise control of blood glucose levels. Many modalities are currently available to replace the impaired pancreatic beta cell function in diabetes mellitus patients. The electromechanical modality utilizes insulin delivery systems that release insulin in response to blood glucose levels that are continuously measured via a glucose sensor. Difficulties with the sensors led to the development of programmed insulin delivery via a continuous perfusion pump. This approach however also falls short of the in vivo regulation, namely the regulation of insulin secretion by glucose and its modulation by several hormonal and neuronal factors. Pancreas transplants are another approach (for example see Shapiro et al., N Engl. J. Med. 343(4):230-8, 2000). Unfortunately, this approach suffers from limited availability of transplantable tissue and immune rejection.

To overcome these problems, bioartificial pancreases have been developed. These systems separate the transplanted tissue from the diabetic recipient by an artificial barrier, which diminishes immune rejection, yet allows the transfer of the glycemic signal from the blood to the islet cells and the transfer of the pancreatic hormones from the islet cells to the blood. An artificial pancreas accomplishes this by having a selectively permeable barrier, which is permeable to glucose and insulin, but not to immunoglobulins and immunocytes. Artificial pancreas devices work based on the transfer through the membrane of a glycemic signal from blood to the pancreatic endocrine cells, and insulin from the pancreatic endocrine cells to the recipient. In one embodiment, the pancreatic endocrine cells are in the form of islets.

In general, the transfer of a substance from one compartment to the other across a membrane can be achieved either by diffusion, dialysis, or by convection, ultrafiltration or a combination of these methods. Artificial pancreases are generally divided among those that utilize diffusion mechanisms, those that utilize convection mechanisms, or those that utilize a combination of both mechanisms. Diffusion represents the transfer of the substance itself without transfer of the solvent. Convection, in contrast, involves the transfer of the solvent and any molecules dissolved therein as long as they are smaller than the pores of the membrane.

Suitable devices for use with insulin-producing cells include an artificial pancreas. Specific, non-limiting examples devices of use are disclosed in U.S. Patent No. 5,741,334; U.S. Patent No. 5,702,444; U.S. Patent No 5,855,616; U.S.

Patent No. 5,913,998; U.S. Patent No. 6,023,009; and 6,165,225, all of which are incorporated by reference herein.

Thus, the methods disclosed herein can be used to generate epithelial cell clusters and islet-like cells aggregates. These cells are then included in a device as a bioartificial pancreas, and the bioartifϊcial pancreas is then implanted into a subject.

The implantation of the bioartificial pancreas results in the treatment of a disorder.

In embodiment, the implantation of the bioartificial pancreas results in the treatment of diabetes.

It will be apparent that the precise details of the methods or compositions described may be varied or modified without departing from the spirit of the described invention. We claim all such modifications and variations that fall within the scope and spirit of the claims below.

Claims

1. A method for expanding pancreatic epithelial cells, comprising culturing islets of Langerhans in vitro on a tissue culture substrate in a growth medium, wherein epithelial cells migrate out from the islets of Langerhans on the tissue culture substrate and undergo an epithelial to mesenchymal transition to form a population of committed mesenchymal cells on the tissue culture substrate, wherein the committed mesenchymal cells comprise chromosomal deoxyribonucleic acid (DNA) that retains an insulin gene with chromatin structure of an actively transcribed insulin gene, and wherein the committed mesenchymal cells do not express insulin; expanding the population of committed mesenchymal cells in vitro', harvesting the population of committed mesenchymal cells with an enzyme and re-plating the committed mesenchymal cells on a tissue culture substrate to differentiate the committed mesenchymal cells to form epithelial cell clusters that do not express insulin and that can be induced to form pancreatic endocrine cells; and transplanting the epithelial cells into a recipient.

2. The method of claim 1, wherein the islets of Langerhans are human islets of Langerhans.

3. The method of claim 1, wherein the tissue culture substrate comprises 0.2% gelatin.

4. The method of claim 1, wherein harvesting the committed mesenchymal cells comprises monodispersing the cells in serum-free medium.

5. The method of claim 1, wherein the growth medium comprises 10% human AB serum in the absence of bovine serum.

6. The method of claim 5, wherein the growth medium further comprises about 100 ng/ml epidermal growth factor, fibroblast growth factor, and bone morphogenic protein 4.

7. The method of claim 1, wherein the committed mesenchymal cells comprise a chromosome comprising an insulin promoter dimethylated at lysine 4 of hi stone H3.

8. The method of claim 1, wherein the committed mesenchymal cells comprise a chromosome comprising an insulin promoter acetylated at lysine residues of histone H4.

9. The method of claim 1, wherein the committed mesenchymal cells comprise a chromosome comprising an insulin promoter that is not methylated at lysine 9 of histone H3.

10. The method of claim I₃ wherein re-plating the cells on a tissue culture substrate comprises culturing the committed mesenchymal cells in the absence of serum.

11. The method of claim 1 , wherein re-plating the committed mesenchymal cells comprises culturing the committed mesenchymal cells in the absence of serum and in the absence of epidermal growth factor, fibroblast growth factor, and bone morphogenic protein 4.

12. The method of claim 1, wherein the recipient is a human.

13. The method of claim 1, wherein the recipient has diabetes mellitus.

14. The method of claim 12, wherein the recipient is immunosuppressed.

15. The method of claim 1, wherein the enzyme is trypsin.

16. The method of claim 1, wherein expanding the committed mesenchymal cells comprises harvesting the committed mesenchymal cells and diluting the cells in growth medium such that the committed mesenchymal cells are re-plated on a tissue culture substrate at no less than about one-third of the original density.

17. A method for expanding pancreatic epithelial cells that can form pancreatic endocrine cells, comprising culturing islets of Langerhans in vitro on a tissue culture substrate in a growth medium, wherein epithelial cells migrate out from the islets of Langerhans on the tissue culture substrate and undergo an epithelial to mesenchymal transition to form a population of committed mesenchymal cells on the tissue culture substrate; expanding the population of committed mesenchymal cells in vitro; assessing the chromatin structure of the insulin gene in the population of mesenchymal cells to identify a population of committed mesenchymal cells of interest, wherein the population of committed mesenchymal cells of interest retain the chromatin structure of an actively transcribed insulin gene and do not express insulin; and harvesting the population of committed mesenchymal cells of interest with an enzyme and re-plating the cells on a tissue culture substrate to differentiate the committed mesenchymal cells to form a population of epithelial cells clusters that can be induced to form pancreatic endocrine cells that do not express insulin, thereby expanding pancreatic epithelial cells that can form pancreatic endocrine cells.

18. The method of claim 18, wherein the pancreatic endocrine hormone is insulin.

19. The method of claim 18, wherein the islets of Langerhans are human islets of Langerhans.

20. The method of claim 20, wherein the islets of Langerhans are human cadaveric islets of Langerhans.

21. The method of claim 17, wherein the tissue culture substrate comprises 0.2% gelatin.

22. The method of claim 17, wherein harvesting the population of committed mesenchymal cells comprises monodispersing the cells in serum-free medium.

23. The method of claim 17, wherein the growth medium comprises 10% human AB serum in the absence of bovine serum.

24. The method of claim 24, wherein the growth medium further comprises about 100 ng/ml epidermal growth factor, fibroblast growth factor, and bone morphogenic protein 4.

25. The method of claim 17, wherein re-plating the committed mesenchymal cells comprises culturing the committed mesenchymal cells in the absence of serum.

26. The method of claim 9, wherein re-plating the committed mesenchymal cells comprises culturing the committed mesenchymal cells in the absence of serum and in the absence of epidermal growth factor, fibroblast growth factor, and bone morphogenic protein 4.

27. The method of claim 17, wherein the epithelial cells are human epithelial cells.

28. The method of claim 17, wherein the enzyme is trypsin.

29. The method of claim 17, wherein expanding the committed mesenchymal cells comprises harvesting the islet precursor cells and diluting the cells in growth medium such that the islet precursor cells are re-plated on a tissue culture substrate at no less than about one-third of the original density.

30. The method of claim 17, wherein the committed mesenchymal cells comprise a chromosome comprising an insulin promoter dimethyl ated at lysine 4 of histone H3.

31. The method of claim 17, wherein the committed mesenchymal cells comprise a chromosome comprising an insulin promoter methylated or acetylated at lysine residues of histone H4.

32. The method of claim 17, wherein the committed mesenchymal cells comprise a chromosome comprising an insulin promoter that is not methylated or acetylated at lysine 9 of histone H3.

33. A method of transplanting insulin producing cells into a mammalian recipient, comprising culturing islets of Langerhans in vitro on a tissue culture substrate in a growth medium, wherein epithelial cells migrate out from the islets of Langerhans on the tissue culture substrate and undergo an epithelial to mesenchymal transition to form a population of committed mesenchymal cells on the tissue culture substrate, wherein the committed mesenchymal cells comprise chromosomal deoxyribonucleic acid (DNA) that retains an insulin gene with chromatin structure of an actively transcribed insulin gene, and wherein the committed mesenchymal cells do not express insulin; expanding the population of committed mesenchymal cells in vitro; harvesting the population of committed mesenchymal cells with an enzyme and re-plating the cells on a tissue culture substrate to differentiate the committed mesenchymal cells to form a population of epithelial cell clusters that do not express ^■ insulin and can be induced to form pancreatic endocrine cells; and transplanting the population of epithelial cells into a recipient.

34. The method of claim 33, wherein the donor and the recipient are from the same species.

35. The method of clam 33, wherein the donor and the recipient are human.

36. The method of claim 33, wherein the recipient is immunosuppressed.

37. The method of claim 33, wherein recipient has diabetes mellitus.

38. The method of claim 37, wherein the recipient has type I diabetes mellitus.

39. The method of claim 33, wherein the islets of Langerhans are human cadaveric islets of Langerhans.

40. The method of claim 33, wherein the tissue culture substrate comprises 0.1% gelatin.

41. The method of claim 33, wherein harvesting the committed mesenchymal cells comprises monodispersϊng the cells in serum-free medium.

42. The method of claim 33, wherein the growth medium comprises 10% human AB serum in the absence of bovine serum.

43. The method of claim 33, wherein the growth medium further comprises about 100 ng/ml epidermal growth factor, fibroblast growth factor, and bone morphogenic protein 4.

44. The method of claim 33, wherein the committed mesenchymal cells comprise a chromosome comprising an insulin promoter dimethylated at lysine 4 of histone H3.

45. The method of claim 33, wherein the committed mesenchymal cells comprise a chromosome comprising an insulin promoter methylated or acetylated at lysine residues of histone H4.

46. The method of claim 33, wherein the committed mesenchymal cells comprise a chromosome comprising an insulin promoter that is not methylated or acetylated at lysine 9 of histone H3.

47. The method of claim 33, wherein the enzyme is trypsin.

48. The method of claim 33, wherein expanding the committed mesenchymal cells comprises harvesting the committed mesenchymal cells and diluting the cells in growth medium such that the committed mesenchymal cells are re-plated on a tissue culture substrate at no less than about one-third of the original density.

49. An isolated population of committed mesenchymal cells, wherein the committed mesenchymal cells comprise a chromosome comprising an insulin promoter that is dimethylated at lysine 4 of histone H3 and is acetylated at lysine residues of histone H4, but is not methylated at lysine 9 of histone H3, wherein the committed mesenchymal cells do not produce insulin and can divide in vitro and can be induced to differentiate into insulin-expressing cells.

50. The isolated population of committed mesenchymal cells of claim 35, wherein the committed mesenchymal cells are human cells.

51. The isolated population of committed mesenchymal cells of claim 35, wherein the cells are mouse cells.

52. The isolated population of committed mesenchymal cells of claim 51, wherein the mouse is a transgenic mouse whose genome comprises a transgene, wherein the transgene comprises an insulin promoter operably linked to a nucleic acid encoding green fluorescent protein, and wherein green fluorescent protein is expressed in insulin-producing cells of the transgenic mouse.

53. An isolated epithelial cell cluster or islet cell aggregate produced from the isolated population of islet cells of claim 49.

54. A method of treating a subject with diabetes, comprising administering to the subject a therapeutically effective amount of the epithelial cell clusters or islet cell aggregates of claim 53, thereby treating the subject with diabetes.

55. A method for identifying an agent of use in treating diabetes, comprising isolating islets of Langerhans from a transgenic mouse of a transgenic mouse line whose genome comprises a transgene, wherein the transgene comprises an insulin promoter operably linked to a nucleic acid encoding a marker polypeptide, and wherein the marker polypeptide is expressed in the islets of the transgenic mouse; culturing the islets of Langerhans in vitro on a tissue culture substrate in a growth medium, wherein epithelial cells migrate out from the islets of Langerhans on the tissue culture substrate and undergo an epithelial to mesenchymal transition to form a population of committed mesenchymal cells on the tissue culture substrate, wherein the committed mesenchymal cells comprise chromosomal deoxyribonucleic acid (DNA) that retains an insulin gene with chromatin structure of an actively transcribed insulin gene, and wherein the committed mesenchymal cells do not express insulin, wherein an antibody that specifically binds the marker polypeptide does not bind the committed mesenchymal cells; expanding the population of committed mesenchymal cells in vitro; contacting the population of committed mesenchymal cells with an agent of interest; harvesting the population of committed mesenchymal cells with an enzyme and re-plating the committed mesenchymal cells on a tissue culture substrate to differentiate the committed mesenchymal cells to form epithelial cell clusters; differentiating the epithelial cell clusters into insulin-producing cells; and assessing the ability of the antibody that specifically binds the marker polypeptide to bind the insulin-producing cells. wherein an increase in the number cells bound by an antibody that specifically binds cells that express the marker as compared to a control identifies the agent as of use in treating diabetes.

56. The method of claim 55, wherein the insulin promoter is a mouse insulin promoter.

57. The method of claim 55, wherein the marker polypeptide is green fluorescent protein.

58. The method of claim 55, wherein the tissue culture substrate comprises 0.2% gelatin.

59. The method of claim 55, wherein harvesting the committed mesenchymal cells comprises dispersing the cells with trypsin and re-plating the cells in serum-free medium.

60. The method of claim 55, wherein the control is insulin-producing cells differentiated from a second population of committed mesenchymal cells produced from a transgenic mouse from the transgenic mouse line, wherein the second population of committed mesenchymal cells is not contacted with an agent.

61. A tissue culture media comprising a balanced salt solution, about 10% human AB serum, about 100ng/ml of epidermal growth factor, about lOOng/ml of fibroblast growth factor-2, about 100 ng/ml of bone morphogenic protein 4, and about 100 ng/ml of vascular endothelial growth factor.

62. The tissue culture media of claim 50, wherein the balanced salt solution comprises:

Components

L- Alanine 0.025 2'-Deoxyguanosine 0.01

L-Arginine 0.05787 2'-Deoxycytidine-HCl 0.01 16

L-Aspartic Acid 0.03 Flavin Aadenine Dinucleotide^»2Na 0.000106

L-Cysteine^»HCl- H₂O 0.26 Folic Acid 0.00001

L-Cystine 0.02 myo-Inositol 0.00005

L-Glutamic Acid 0.075 5-Methyldeoxycytidine 0.0001

L-Glutamine 0.1 β-N AD 0.007

Glycine 0.05 β-NADP^»Na 0.001

L-Histidine HCl* H₂O 0.02 Niacinamide 0.000025

Trans-4-Hydroxy-L-Proline 0.01 Nicotinic Acid 0.000025

L-lsoleucine 0.02 D-Panthothenic Acid [hemicalcium] 0.00001

L-Leucine 0.06 Pyridoxal'HCl 0.000025

L-Lysine^»HCl 0.07 Pyridoxine-HCl 0.000025

L-Methionine 0.015 Riboflavin 0.00001

L-Phenylalanine 0.025 Thiamine'HCl 0.00001

L-Proline 0.04 Thymidine 0.01

L-Serine 0.025 Uridine-5-Triphosphate^»Na 0.001

L-Threonine 0.03 Calcium Chloride [Anhydrous] 0.2

L-Tryptophan 0.01 Magnesium Sulfate [Anhydrous] 0.09769

L-Tryosine 0.04 Potassium Chloride 0.4

L-Valine 0.025 Sodium Acetate [Anhydrous] 0.05

L-Ascorbic Acid 0.05 Sodium Chloride 6.8

PABA 0.00005 Sodium Phosphate Monobasic [Anhydrous] 0.122

D-Biotin 0.00001 D-Glucose 1.0

Choline Chloride 0.0005 Phenol Red'Na 0.02124

Coenzyme A"Na 0.0025 Glutathione 0.01

Cocarboxylase 0.001 D-Glucuronic Acid^»Na 0.00388

2'-Deoxyadenosine 0.01 Cholesterol 0.0002

Tween 80 0.005

63. The medium of claim 50, further comprising an effective amount of an antibiotic.