WO2007069693A1

WO2007069693A1 - Long-chain chondroitin sugar chain and method for producing the same and method for promoting synthesis of chondroitin

Info

Publication number: WO2007069693A1
Application number: PCT/JP2006/324961
Authority: WO
Inventors: Nobuo Sugiura; Satoshi Shimokata; Koji Kimata
Original assignee: Seikagaku Corporation
Priority date: 2005-12-15
Filing date: 2006-12-14
Publication date: 2007-06-21
Also published as: EP1964924A1; EP1964924B1; US20090263867A1; EP1964924A4; US8067204B2; JPWO2007069693A1; JP5081629B2

Abstract

A method for producing a chondroitin sugar chain comprises at least the following step: a step of allowing “a glucuronic acid donor”, “an N-acetyl galactosamine donor”, “a sugar receptor” and “a bacterial enzyme synthesizing chondroitin” to coexist in a reaction system in the presence of a surfactant. Here, the surfactant is preferably selected from n-nonyl-β-D-thiomaltopyranoside, sucrose monocaproate and sucrose monolaurate. The chondroitin sugar chain has all the following 1) to 3) properties: 1) a weight average molecular weight: 50,000 or more when it is measured by gel filtration chromatography, 2) it is completely degraded to disaccharides with chondroitinase ABC, 3) when the product obtained by degrading the sugar chain with chondroitinase ABC is subjected to a disaccharide analysis, substantially all of them are in agreement with an unsaturated disaccharide unit of chondroitin.

Description

Long chain chondroitin sugar chain, method for producing the same, and method for promoting chondroitin synthesis

Technical field

[0001] The present invention relates to a long-chain chondroitin sugar chain, a method for producing the same, and a method for promoting chondroitin synthesis.

Background art

[0002] First, abbreviations used in the present application documents will be described.

CH: Chondroitin

CS: Chondroitin sulfate

HA: Hyanoleronic acid

Glc: Glucose

GlcUA: Glucuronic acid

GlcNAc: N-Acetyldarcosamine

GalNAc: N Acetylgalatatosamine

GPC: Gel permeation chromatography

HPLC: High performance liquid chromatography

K4CP: Chondroitin polymerase from Escherichia coli K4

MALDI -TOF- MS: Matrix Assisted Laser

Desorption / Ionization Time-of-flight mass spectrometry

UDP: Uridine 5, diphosphoric acid

[0003] CH is a type of glycosaminodarlican in which GlcUA and GalNAc are alternately bonded on a straight line by / 3 1−3 bonds and β 1 4 bonds, respectively. CH is present as CS proteodalycan in soft bones and many connective tissues in the body of animals, and plays an important role in cell adhesion, development, differentiation, nerve cell extension, cartilage 'bone formation, tissue regeneration, etc. Is responsible.

[0004] In addition, CS is a medicine and health food such as tissue adhesion prevention, arthritis treatment, back pain joint pain treatment, neuralgia remedy, shoulder arthritis treatment, eye drops, chronic nephritis treatment, nutrition tonic It is commercially available as a useful substance in the form of cosmetics (humectants). CS is naturally present as a sugar chain having a weight average molecular weight of 20000 to 50,000, and it is known that CS having a weight average molecular weight of 100,000 or more exists. Since these CSs are long-chain structures, they have structural characteristics such as moisture retention and ion retention characteristics, and specific physiological functions such as cell adhesion and signal transduction as an extracellular matrix component. It is also known to have

[0005] The ability of animal-derived CH synthases to be crawled multiple times. Those expressed enzymes alone do not have CH polymerase activity, and if any, their enzyme activity is weak. It is not sufficient to produce chains efficiently. On the other hand, K4CP is also cloned, and this enzyme alone has CH polymerase activity, and it is also known that CH can be produced efficiently (Patent Document 1, Non-Patent Document 1). However, even if the CH synthesis reaction is carried out for a long time using the recombinant purified enzyme, only about 20,000 CH sugar chains are produced.

[0006] CH can also be produced by desulfating CS, but even if the chain length of the raw material CS is long, the side chain causes the sugar chain to be cleaved and is commercially available. Currently, the weight average molecular weight is 10,000 or less.

The technology for synthesizing long-chain CH sugar chains has been known so far. However, the development of long-chain polymer CH sugar chains and production methods thereof are desired from the viewpoint of industrial utility.

[0007] Patent Document 1: Japanese Patent Application Laid-Open No. 2003-199583

Non-Patent Document 1: Ninomiya, T. et al., 2002, Journal of Biological Chemistry, 277, 24, p. 21567-21575

Disclosure of the invention

Problems to be solved by the invention

[0008] An object of the present invention is to provide a long-chain polymer CH sugar chain and a method for producing the same.

Means for solving the problem

[0009] The inventors of the present invention have intensively studied to solve the above problems, and as a result, in a method of synthesizing CH using a G synthetase, a GlcUA donor, a GalNAc donor, and a sugar acceptor. By using an expression strain of E. coli in which CH synthase is forcibly expressed as the CH synthase and performing the synthesis reaction in the presence of a surfactant, the chain length is much longer than that of the purified free enzyme! However, the present invention has been completed.

[0010] The present invention provides a method for producing a CH sugar chain (hereinafter referred to as "method 1 of the present invention" t ヽぅ), which comprises at least the following steps.

Process: “GlcUA donor”, “GalNAc donor”, “sugar acceptor” and “bacterial enzyme that synthesizes CH” coexist in the reaction system in the presence of a surfactant.

[0011] Further, in the method 1 of the present invention, it is preferable that the "bacterial enzyme that synthesizes CH" is a bacterial cell enzyme expressing CH polymerase derived from E. coli. I really like K4CP!

[0012] In the method 1 of the present invention, it is preferable that the host used for the cell enzyme is Escherichia coli, and it is very particularly preferable that the host strain is E. coli TOP10.

[0013] In the method 1 of the present invention, the surfactant power used is Nimin, MEGA-10, sodium cholate, n-octyl-13-D-thiodarcopyranoside, n-nolulu 13-D- Thymaltopyranoside, sucrose monocholic acid, sucrose monocaproic acid, and sucrose monolauryl acid. It is preferable that the group power of caproic acid and sucrose monolauric acid is selected. It is very preferable that the group power of n-noel-β-D-thiomaltopyranoside, sucrose monocaproic acid and sucrose monolauric acid is selected.

[0014] The method 1 of the present invention is preferably performed for 1 hour to 10 days under the condition of "coexistence" force of 10 to 50 ° C, and is performed for 10 to 30 hours under the condition of 20 to 40 ° C. More preferably, it is carried out for 15 to 24 hours under the condition of 20 to 40 ° C. It is particularly preferred that the reaction is carried out for 15 to 24 hours under the condition of 25 to 37 ° C.

[0015] In the method 1 of the present invention, the GlcUA donor is preferably UDP-GlcUA, and the GalNAc donor is preferably UDP-GalNAc! /.

In this case, UDP-Glc4-epimerase and UDP-GlcNAc, UDP-Glc dehydrogenase and UDP-Glc coexist in the reaction system, and U as a “GalNAc donor” is obtained. DP—GalNAc and UDP—GlcUA as “GlcUA donor” can be supplied.

[0017] Further, the method 1 of the present invention preferably further comprises one or two or more organic solvents selected from the group power consisting of xylene, black mouth form, paraffin and formaldehyde, particularly in particular. It is preferable to coexist with black mouth form and xylene. In addition, the concentration of the organic solvent in the coexistence state is preferably more than 0% and less than 5%, more preferably more than 0.5% and less than 3%, and even more preferably 1%.

[0018] In the method 1 of the present invention, it is preferable that the produced CH sugar chain has all the following properties 1) to 3).

1) Weight average molecular weight: 50,000 or more when measured by gel filtration chromatography

2) It is completely broken down into disaccharides by chondroitinase ABC.

3) When the product obtained by degrading the sugar chain with chondroitinase ABC is subjected to disaccharide analysis, substantially all of them match the CH unsaturated disaccharide.

The molecular weight of the CH sugar chain produced by the method 1 of the present invention is preferably 75,000 or more, more preferably 200,000 or more in terms of weight average molecular weight. Specifically, the preferred molecular weight range is 50,000 or more. ~ 200,000, 50,000 to 500,000, 50,000 to 1,000,000, 75,000 to 200,000, 75,000 to 500,000, 75,000 to 1,000,000, 200,000 to 500,000, 200,000 to 100 For example, a range of 500,000 to 1 million can be exemplified.

[0019] Further, the present invention provides a method for promoting CH synthesis (hereinafter referred to as "Method 2 of the present invention"), characterized in that a surfactant is allowed to coexist during an enzymatic reaction with "a cell enzyme that synthesizes CH". )I will provide a.

[0020] The present invention also provides a CH sugar chain (hereinafter referred to as "the sugar chain of the present invention") having all the following properties 1) to 3).

2) It is completely broken down into disaccharides by chondroitinase ABC.

3) When disaccharide analysis of the product obtained by degrading the sugar chain with chondroitinase ABC, Virtually all are consistent with CH unsaturated disaccharides.

The molecular weight of the sugar chain of the present invention is preferably a weight average molecular weight of 75,000 or more, more preferably 200,000 or more. Specifically, the preferred molecular weight ranges are 50,000 to 200,000, 50,000 to 5 0,000, 50,000 to 1 million, 75,000 to 200,000, 75,000 to 500,000, 75,000 to 1 million, 200,000 to 500,000, 200,000 to 1 million, 500,000 to 100 A range of tens of thousands can be exemplified.

The invention's effect

[0021] The method 1 of the present invention is capable of producing a polymer CH sugar chain having a weight average molecular weight comparable to or higher than that of a polymer CS that exists in nature and is known to have a specific physiological activity. Very useful. The method 2 of the present invention is very useful because it can produce a CH sugar chain very efficiently. The sugar chain of the present invention is a high molecular weight CH that is not usually found in CH extracted from animal tissues, and is expected to have unique physical properties and physiological activities. It can be a material for pharmaceuticals, health foods, cosmetics, etc. Useful.

BEST MODE FOR CARRYING OUT THE INVENTION

[0022] Hereinafter, the present invention will be described in detail in the order of the method 1, the method 2, and the sugar chain of the present invention in the order of the best mode for carrying out the invention.

[0023] <1> Method 1 of the present invention

The method 1 of the present invention is a method for producing a CH sugar chain, comprising at least the following steps.

Process: “GlcUA donor”, “GalNAc donor”, “sugar acceptor” and “bacterial enzyme that synthesizes CH” coexist in the reaction system in the presence of a surfactant. In other words, using a cell enzyme that synthesizes CH as a reaction catalyst, a GlcUA residue from a GlcUA donor and a GalNAc residue from a GalNAc donor are alternately transferred to a sugar acceptor to form a CH sugar chain. It is.

[0024] Here, as long as the “GlcUA donor” is a molecule having an ability to donate a GlcUA residue to a certain sugar chain molecule, a GlcUA nucleotide is preferred. /. Examples of the GlcUA nucleotide include UDP-GlcUA and dTDP (deoxythymidine 5′-diphosphate) GlcUA, and UDP-GlcUA is preferred.

[0025] Here, "GalNAc donor" donates a GalNAc residue to a certain sugar chain molecule. GalNAc nucleotides are preferred as long as the molecule has the ability to: As the GalNAc nucleotide, a force UDP-GalNAc exemplified by UDP-GalNAc and dTDP (deoxythymidine 5, monolysine acid) GalNAc sugar is preferable.

As these sugar nucleotides, commercially available products that may be produced by known methods may be used.

In addition, examples of the “sugar receptor” used in the method 1 of the present invention include sugar chains represented by the following general formulas (1) and (2).

GlcUA-R ¹ (1)

GalNAc -R ² (2)

(In each formula, - the glycosidic bond, R ¹ and R ² are also respectively good any group be different in the same.)

Examples of “1 ^” and “R ² ” include sugar chain residues having a CH skeleton and sugar chain residues having an HA skeleton. For example, here, “residues of sugar chains having a CH skeleton” include CH residues and CS residues. Such sugar chain residues may be bonded with other chemical substances.

[0028] In addition, the size of the sugar chain of the sugar receptor is not particularly limited !, but for example, about 1 to 50 sugars, preferably about 1 to 40 sugars, more preferably about 1 to 30 sugars, still more preferably An oligosaccharide having about 1 to 20 sugars can be exemplified. More specifically, CH disaccharide, 3 sugar, 4 sugar, 5 sugar, 6 sugar, 7 sugar, 8 sugar, 9 sugar, 10 sugar and the like are exemplified. In addition, as “” and “R ² ” in the general formulas (1) and (2), CS oligosaccharides, HA oligosaccharides and the like having such sizes can also be used.

In addition, it is preferable that the non-reducing terminal sugar residue GlcUA of the general formula (1) has a structure of | 8. When the GlcUA residue binds to the R ¹ group GlcNAc or GalNAc, The glycosidic bond is preferably a j81-3 structure. It is preferable that the non-reducing terminal sugar residue GalNAc of the general formula (2) also has a j8 structure. When the GalNAc residue is bound to GlcUA of the R ² group, the glycosidic bond is j8 1— A 4-structure is preferred.

[0029] Such a sugar receptor can be produced by a known method, or a commercially available one can be used.

In addition, the “bacterial enzyme that synthesizes CH” used in the method 1 of the present invention synthesizes CH. As long as it is a microbial enzyme having the activity to do so, it is not particularly limited.

[0030] In this application document, "/ cell enzyme" means a cell itself that can exhibit a specific enzyme activity while maintaining the form of the cell. That is, “a cell enzyme that synthesizes CH” means a cell that can exhibit the enzymatic activity to synthesize CH while maintaining the form of the bacterium.

[0031] The "bacterial enzyme that synthesizes CH" is preferably a bacterial enzyme that incorporates an E. coli-derived CH polymerase gene (a bacterial enzyme that expresses E. coli-derived CH polymerase). . In particular, those incorporating a gene obtained from Escherichia coli having a gene involved in the production of capsular polysaccharides are preferred, and those expressing K4CP are particularly preferred. As the host, it is preferable to use Escherichia coli, and Escherichia coli TOP10 strain is very preferable.

[0032] As used herein, "K4CP" means that when CH is used as an acceptor substrate and GalNAc nucleotides (UDP—GalNAc etc.) and GlcUA nucleotides (UDP-GlcUA etc.) are reacted as donor substrates, the acceptor substrate is used. When the non-reducing end of GlcUA is a GlcUA residue, GalNAc is bonded to the corresponding end, and when the non-reducing end is a GalN Ac residue, GalNAc and GlcUA are bound alternately by binding GlcUA to the end, It is a polymerase that extends CH (Non-patent Document 1, Patent Document 1).

[0033] The method and origin of the DNA introduced for expressing CH polymerase activity in Escherichia coli in the method 1 of the present invention are not particularly limited. For example, K4CP was originally obtained from E. coli having the K4 antigen, but it may be obtained from other transformed species, or DNA produced by chemical synthesis or the like.

[0034] In addition, K4 antigen-specific synthesis-related gene cluster Region 2 (R-Π) of Escherichia coli K4 strain has a useful gene involved in CH synthesis in addition to K4CP, and the first ORF, Kfo A, is , Identified as a UDP-Glc4-epimerase gene that has the activity of converting UDP-GlcNAc to UDP-GalNAc, and the seventh ORF, KfoF, has the activity of converting UDP—Glc to UDP—GlcUA, UDP— It was identified as the gene for Glc dehydrogenase.

[0035] Therefore, the epimerase activity encoded by KfoA and the dehydrogenase encoded by KfoF By utilizing this activity, CH polymers can be synthesized using UDP-GlcNAc and UDP-Glc, which are cheaper materials than UDP GalNAc and UDP-GlcUA, as substrates. That is, in Method 1 of the present invention, UDP-Glc4 epimerase and UDP-GlcN Ac, and UDP-Glc dehydrogenase and UDP-Glc are allowed to coexist in the reaction system, and UDP-GalNAc and “GlcUA donation” as “GalNAc donor” are present. By supplying UDP-GlcUA as a “body”, a CH sugar chain can be produced (see Examples 7 to 9 below).

[0036] UDP-GlcNAc and UDP-Glc are known to be able to synthesize monosaccharides such as Glc by known bacterial cell reactions, and it is possible to industrially produce CH sugar chains with less expensive materials. Be expected.

[0037] The form of the UDP-Glc4 epimerase and UDP-Glc dehydrogenase is not particularly limited, but it is preferable to use a cell enzyme similar to K4CP. Therefore, in addition to the K4CP expression system, KfoA and KfoF E. coli It is possible to synthesize long-chain CH from UDP-GlcNAc and UDP-Glc using the bacterial reactor of the recombinant enzyme prepared by the expression system. An industrially very advantageous method for mass synthesis of long-chain CH that can save labor and cost required for enzyme purification is provided.

[0038] As a vector for introducing these DNAs, for example, an appropriate vector (such as a phage vector or a plasmid vector) capable of expressing the introduced DNA can be used, and the vector of the present invention is incorporated. It can select suitably according to a host cell. Such host vector systems include mammalian cells such as COS cells and 3LL-HK46 cells, p GIR201 (Kitagawa, H "and Paulson, JC (1994) J. Biol. Chem. 269, 1394-1401), pE F-BOS (mizushima, S., and Nagata, S. (1990) Nucleic Acid Res. 18, 5322), pCXN2 (Niwa, H., Yamamura, K. and Miyazaki, J. (1991) Gene 108, 193— 200) Mammals such as pCMV-2 (made by Eastman Kodak), pCEV18, pME18S (Maruyama et al., Med. Immun ol., 20, 27 (1990)) or pSVL (manufactured by Pharmacia Biotech) Combination of expression vectors for cells, E. coli), pTrcHis (Invitrogen), pGEX, p Trc99, pKK233-3, pEZZZ18, pCH110, (Falmacia Biotech), pET (Strataji) For prokaryotic cells such as pBAD, pRSET, and pSE420 (Invitrogen) In addition to these expression vectors, examples of host cells include insect cells, yeast, Bacillus subtilis, and various vectors corresponding thereto. Of the host vector systems described above, the combination of E. coli and pTrcHis is particularly preferred.

[0039] Furthermore, these DNAs and expression vectors exist in secretory and intracellular retention types, but intracellular retention types in which enzyme molecules expressed in the cells remain are preferred.

[0040] The promoter of the expression vector can be appropriately selected, but the lac promoter capable of inducing expression with j8-isopropylthiogalatatoside is preferred. In addition, in order to maintain the enzyme activity structure in the cell, it is difficult to produce inclusion bodies in the form of denaturing precipitates, and the expression efficiency is relatively low, and the trc promoter is also preferred!

The bacterial cell enzyme used in the method 1 of the present invention can be prepared by appropriately selecting a known method by those skilled in the art. For specific methods, see Example 1 below.

[0041] In addition, the method 1 of the present invention is based on the surfactant power used, Naimine, MEGA-10, sodium cholate, n-octyl-1-β-D-thiodarcopyranoside, η-Noel-13-D- Thymaltopyranoside, sucrose monocholic acid, sucrose monocaproic acid, and sucrose monolauryl acid. Acid and sucrose monolauric acid power are preferably selected and more preferably selected from the group consisting of η-Noel β-D-thiomaltoviranoside, sucrose monocaproic acid and sucrose monolauric acid.

[0042] The term "coexistence" used in the method 1 of the present invention refers to a state in which these donor molecule, sugar acceptor molecule and bacterial enzyme come into contact with each other and an enzymatic reaction by the bacterial enzyme is induced. There is no particular limitation as long as a reaction system is formed. For example, bacterial enzymes that can coexist in a solution are fixed to an appropriate solid phase (beads, ultrafiltration membrane, dialysis membrane, etc.), and contain the donor and acceptor described above. The solutions may be allowed to coexist by contacting them continuously. Therefore, for example, a column type reactor or a membrane type reactor can be employed. In addition, as in the method described in PCT International Publication Pamphlet WO00Z27437, the receptor can be immobilized on a solid phase and subjected to an enzymatic reaction. In addition, bioreactors that regenerate (synthesize) donors may be combined. [0043] In addition, the "coexistence" in the method 1 of the present invention is preferably performed for 1 hour to 10 days under the condition of 10 to 50 ° C, and for 10 to 30 hours under the condition of 20 to 40 ° C. More preferably, it is more preferably performed for 15 to 24 hours under the condition of 20 to 40 ° C, and particularly preferably for 15 to 24 hours under the condition of 25 to 37 ° C.

[0044] This coexistence is preferably carried out while maintaining the temperature and pH constant. In order to keep the pH constant, this reaction is preferably performed in a buffer solution having a buffering action over the pH range. The pH range suitable for “coexistence” in the method 1 of the present invention is 5-9, preferably pH 6-8, and very close to neutrality.

Note that “GlcUA” and “GalNAc” in Method 1 of the present invention are preferably D-GlcUA and D-GalNAc, respectively. In addition, it is preferable that the glycosidic bond (GlcUA—GalNAc) between GlcUA and GalNAc represented by the general formula of the method 1 of the present invention is a j8 1-3 bond. The glycosidic bond between GalNAc and GlcUA ( GalNAc—GlcUA) is preferably a β 1-4 bond.

[0046] Further, when coexisting, an organic solvent can be further coexisted, and it is particularly preferable to coexist with one or more organic solvents selected from the group power of xylene, chloroform, paraffin and formaldehyde power. It is preferable that black mouth form or “black mouth form and xylene” coexist. In addition, the concentration of the organic solvent in the coexistence state is preferably more than 0% and less than 5%, more preferably more than 0.5% and less than 3%, and even more preferably 1%.

[0047] Further, by using a sugar chain derivative having a GlcUA β β-3 structure or a GalNAc j8 1-4 structure at the non-reducing end as a sugar acceptor, a CH derivative having a polymer chain length according to the method 1 of the present invention is used. Can also be manufactured. The sugar chain derivatives mentioned here are, for example, sugar receptors of the formulas (1) and (2), and R ¹ and R ² have a sugar chain other than CH, an arbitrary organic group that is not a sugar chain, etc. The term “CH derivative having a polymer chain length” refers to a CH derivative in which an organic group other than a sugar chain or sugar chain other than CH is bonded to CH having a polymer chain length.

[0048] In the method 1 of the present invention, the CH sugar chain to be produced preferably has all the following properties 1) to 3). 1) Weight average molecular weight: 50,000 or more when measured by gel filtration chromatography. For the conditions for gel filtration chromatography, see the Examples.

2) It is completely broken down into disaccharides by chondroitinase ABC.

[0049] In this case, the sugar receptor to be used must be a sugar chain in which "" and "R2J" have only a CH skeleton in the following general formula (1) or (2).

GlcUA-R ¹ (1)

GalNAc-R ² (2)

[0050] Here! /, “Chondroitinase ABC” is a kind of glycosaminodarlican-degrading enzyme that acts on CH and HA, and is completely unsaturated disaccharide having hexosamine at the reducing end. It is an enzyme that degrades.

In addition, “substantially all” used in the present invention means that when the degradation product is subjected to disaccharide analysis, peaks other than CH unsaturated disaccharide cannot be detected by ordinary HPLC! /. means

[0051] The molecular weight of the CH sugar chain produced by the method 1 of the present invention is not particularly limited, but the method 1 of the present invention can be used for the production of a CH sugar chain having a weight average molecular weight of 50,000 or more. It is preferred to be used when producing CH sugar chains having an average molecular weight of 75,000 or more. It is particularly preferred to be used when producing CH sugar chains having a weight average molecular weight of 200,000 or more. The upper limit of the molecular weight is not particularly limited. For example, CH sugar chains having a weight average molecular weight of about 500,000 or 1 million can be produced. Therefore, it is preferable that the molecular weight ranges are 50,000 to 200,000, 50,000 to 500,000, 50,000 to 1,000,000, 75,000 to 200,000, 75,000 to 500,000, 70,000. Examples include 5,000 to 1,000,000, 200,000 to 500,000, 200,000 to 1,000,000, and 500,000 to 1,000,000.

[0052] <2> Method 2 of the present invention

In the method 2 of the present invention, a surfactant is added at the time of an enzymatic reaction by “a cell enzyme that synthesizes CH” It is a method for promoting CH synthesis, characterized by coexistence.

The method 2 of the present invention is a method for synthesizing CH, for example, by performing an enzymatic reaction with a “bacterial enzyme that synthesizes CH” in the presence of a surfactant in the “method for producing a CH sugar chain” like the method 1 of the present invention The meanings of the terms “bacterial enzyme that synthesizes CH”, “surfactant”, and “coexistence” in method 2 of the present invention are all in the method 1 of the present invention. It is the same as described above.

[0053] Further, when the method 2 of the present invention is carried out in the same steps as the method 1 of the present invention, explanations on "GlcUA donor", "GalNAc donor", and "sugar acceptor" to be used are to be made. The explanation of the CH sugar chain and other explanations are the same as in Method 1 of the present invention.

[0054] <3> Sugar chain of the present invention

The sugar chain of the present invention is a CH sugar chain having all the following properties 1) to 3).

1) Weight average molecular weight: 50,000 or more when measured by gel filtration chromatography. For the conditions of gel filtration chromatography, see the examples.

2) It is completely broken down into disaccharides by chondroitinase ABC.

[0055] The molecular weight of the sugar chain of the present invention is not particularly limited, but is usually 50,000 or more in terms of weight average molecular weight, preferably 75,000 or more, more preferably 200,000 or more. . The upper limit of the molecular weight of the sugar chain of the present invention is not particularly limited, and may have a molecular weight of about 500,000 or 1 million in terms of weight average molecular weight. Therefore, the molecular weight ranges of the sugar chains of the present invention are specifically shown as follows: 50,000 to 200,000, 50,000 to 500,000, 50,000 to 1,000,000, 75,000 to 200,000, 75,000 to 50 10,000, 75,000 to 1,000,000, 200,000 to 500,000, 200,000 to 1,000,000, 500,000 to 1,000,000 range power S.

[0056] The state of the sugar chain of the present invention is not particularly limited, and may be in a solution state or in a solid state (powder or the like, a state in which the solution is frozen, or the like).

Further, the meaning of the term “chondroitinase ABC” used in the sugar chain of the present invention is the same as that described in Method 1 of the present invention. The sugar chain of the present invention can be produced, for example, by using the method 1 of the present invention. Example

[0057] The present invention will be specifically described below with reference to examples. However, these do not limit the technical scope of the present invention.

Example 1 Preparation of Cell Enzyme

According to the method disclosed in Japanese Patent Application No. 2003-199583, a gene and an expression vector of an E. coli-derived CH polymerase (K4CP) enzyme were produced. PTrcHis plasmid (Invitrogen) was used as an expression vector. Escherichia coli into which the expression vector obtained by this method was introduced was cultured at 37 ° C in an LB medium containing ampicillin at a wavelength of 600 nm until the absorbance of the culture solution reached about 0.6, and the expression-inducing molecule, j8-isopropyl. Thiogalactoside (IPTG) was added to a final concentration of ImM, and further cultured at 37 ° C. for 3 hours to induce enzyme expression. 1 ml of the culture solution was taken, transferred to a centrifuge tube, and centrifuged at 10,000 rpm for 1 minute. The supernatant was discarded, and the remaining cell precipitate was used as a cell enzyme. In addition, the cell precipitate can maintain enzyme activity for at least one year by storing at -80 ° C.

Example 2 Preparation of CH6 sugar (CH6)

Hydrate testase-derived hyaluronan-dase (Sigma) was added to CH (Seikagaku Corporation), which was chemically desulfurized with CS, in a sodium acetate buffer containing NaCl. By subjecting to limited digestion, an even-numbered CH oligosaccharide having a non-reducing end-strength SGlcUA residue was obtained. The resulting oligosaccharide was purified by gel filtration and an ion exchange column, and fractions corresponding to CH6 were collected and lyophilized. The resulting fraction was analyzed for uronic acid content (force rubazole method), HPLC (GPC), MALDI-TOF-MS, chondroitinase-treated disaccharide analysis, etc. It was confirmed that the non-reducing end was a hexasaccharide with a G1 cUA residue.

[0060] Example 3 Examination of Surfactant Concentration

The fungal enzyme obtained in Example 1 was added to the surfactant Nimin S-215 (Nyme _en S-215) at a final concentration of 0, 0.1, 0.2, 0.4, 1.0 or 2.0%. ; 50 mM Tris—HCl (pH 7.2) buffer solution (20 mM MnCl, 150 mM NaCl, 0.1 nmole CH)

2

6, 3 nmol UDP— GalNAc, 0.2 ^ Ci UDP— [ ³ H] GalNAc and 3 nmol UDP— G (containing lcUA) was added and suspended, and the mixture was shaken at 30 ° C for 15 hours. After the reaction, the mixture was heat-treated in boiling water for 10 minutes, centrifuged at 15,000 rpm for 5 minutes to remove the precipitate, and the supernatant was subjected to gel filtration using a Superdex peptide HR10 / 30 column (Amersham). The sugar chain in the eluate was detected by absorption at 225 nm.

[0061] The elution fraction corresponding to the absorption peak present in the polymer region was collected, and [] GalNAc uptake was detected. Uptake was expressed as a ratio (%) of the incorporated radioactivity when the total radioactivity of [] GalNAc used was 100%. The results are shown in Figure 1

[0062] As a result, it was shown that about 37% of [ ³ H] GalNAc was incorporated into the polymer fraction when the concentration of the surfactant during the enzyme reaction was 0.4% or more. It was. On the other hand, the use of bacterial cell enzyme without adding a surfactant Nymeen S- 215, such observed little incorporation of ^[3 H] GalNAc ChikaraTsuta (Figure 1).

Example 4 Synthesis of Long-chain CH Sugar Chain Using Cell Enzyme and Analysis of Molecular Weight

As a result of synthesizing CH sugar chains in the same manner as in Example 3 with the final concentration of the surfactant Naimine S-215 being 0.4%, about 37% of the [] GalNAc used was incorporated into the polymer fraction. Was reconfirmed. This polymer fraction was treated in the same manner as in Example 3, and then the supernatant was subjected to gel filtration using a Superdex peptide HR10 / 30 column (Amersham) and detected in the same manner as in Example 3. Further, as a result of treating this fraction with chondroitinase ABC (manufactured by Seikagaku Corporation), the molecular weight was completely reduced. In addition, as a result of disaccharide digestion of the degradation products produced by this, it was confirmed that all degradation products were consistent with CH unsaturated disaccharides. Therefore, it was confirmed that the polymer fraction was CH, and the polymer CH was very efficiently produced by setting the concentration of the surfactant during the enzyme reaction to 0.4% or more. This was shown.

[0064] Fig. 2 shows the elution state of the obtained polymer fraction on the Superdex peptide HR10 / 30 column. The peak of the obtained polymer fraction was eluted at the void volume position of the Superdex Peptide HR10 / 30 column (black circle in FIG. 2). The exclusion limit of this column was a weight average molecular weight of 20,000 when measured using a HA standard product, so the obtained polymer fraction (CH polymer) was estimated to have a weight average molecular weight of 20,000 or more. [0065] On the other hand, when purified free recombinant K4CP (manufactured by the method described in Patent Document 1 and Non-Patent Document 1) is reacted in the same manner, CH having a weight average molecular weight of 5,000 is synthesized. (White circle in Fig. 2).

Example 5 Synthesis of Long-chain CH Sugar Chain Using Cell Enzymes and Analysis of Molecular Weight

In order to examine the molecular weight of the CH polymer synthesized by the method of the present invention in more detail, synthesis and molecular weight analysis were performed as follows.

That is, the CH polymer obtained using the bacterial cell enzyme in the same manner as in Example 4 and the same conditions as in Example 4 were synthesized by changing the UDP-GlcUA and UDP-GalNAc concentrations to 30 nmol. When attached to a Sephacryl S500 HR 10/30 column and Superose 6 HR 10/30 column with CH polymers connected in series, the former was positioned at a weight average molecular weight of 75,000 using the HA standard as a guideline (Fig. The latter was eluted at the position where the weight average molecular weight was 200,000 (black square in Fig. 3).

[0067] Example 6 Examination of type of surfactant during enzyme reaction

Using various surfactants with a final concentration of 0.4%, the effect on the uptake of [ ³ H] GalNAc by the type of surfactant was examined by performing the same test as in Example 3. As the enzyme, the cell enzyme produced in Example 1 was used. The surfactants used are as follows.

[0068] Nymeen S-215 (polyoxyethylene octadecylamine, manufactured by NOF Corporation)

Triton X-100 (Polyethylene glycol mono-p-isooctyl phenol ether, manufactured by Naoki Light Tester Co., Ltd.)

Tween 20 (Polyoxyethylene sorbitan monolaurate, manufactured by Nacalai Testa Co., Ltd.) Tween 80 (Polyoxyethylene sorbitan monooleate, manufactured by Nacalai Testa Co., Ltd.)

Brij 35 (Polyoxyethylene lauryl ether, manufactured by Nacalai Testa Co., Ltd.)

Brij 58 (Polyoxyethylene hexadecyl ether, manufactured by Nacalai Testa Co., Ltd.)

Nonidet P-40 (No-Det P-40, manufactured by Nakarai Tester Co., Ltd.)

Tergitol NP-40 (Tajitol NP-40, manufactured by Nacalai Testa Co., Ltd.)

CHAPS (3-[(3 Choleamidopropyl) dimethylammo] 1 propanesulfur Honate, made by Dojindo)

Octyl-thioglucoside (n-octyloo-D-thiodarcopyranoside, manufactured by Kishida Chemical)

Dodecyl-maltoside (n-dodecinole — β — Ό—maltopyranoside, manufactured by Kishida Chemical)

MEGA-9 (η—Nonanoyl-Methyldarcamide, manufactured by Kishida Chemical)

MEGA-10 (n—decanol—N-methyldarcamide, manufactured by Kishida Chemical)

CHAPSO (3-[(3-Choleamidopropyl) dimethylammo-]] 2-hydroxy-1-

1-Propanesulfonate, manufactured by Kishida Chemical)

[0069] Sodium cholate (Sodium cholate, manufactured by Kishida Chemical)

LDS (lithium lauryl sulfate, manufactured by Kishida Chemical)

SDS (Sodium dodecyl sulfate, manufactured by Kishida Chemical)

Octyl-glucoside (n—octylol / 3 1 D—darcopyranoside, manufactured by Kishida Chemical)

Heptyl-thioglucoside (n—Heptylu β-D-thiodarcopyranoside, manufactured by Kishida Chemical)

Nonyl-thiomaltoside (n-nonyl-β-D-thiomaltopyranoside, manufactured by Kishida Chemical) Sucrose monocholate (sucrose cholic acid monoester, manufactured by Kishida Chemical)

Sucrose monocaprate (Sucrose monocapric acid monoester, manufactured by Kishida Chemical)

Sucrose monolaurate (sucrose lauric acid monoester, manufactured by Kishida Chemical)

[0070] Uptake was expressed as a ratio (%) of the radioactivity incorporated when the total radioactivity of [] GalNAc used was defined as 100%. The results are shown in Fig. 4. Note that the “purified enzyme” in FIG. 4 represents “reacted free recombinant K4CPJ reacted in the absence of a surfactant used in Example 4 instead of the bacterial enzyme,” “No activator” means a product obtained by reacting bacterial enzymes in the absence of a surfactant.

[0071] As shown in FIG. 4, when the cell enzyme is used, sucrose monocaproic acid, n-nonyl-

It was shown that [3H] GalNAc was incorporated particularly efficiently when β-D-thiomaltoviranoside or sucrose monolauric acid was used.

Example 7 Examination of influence of organic solvent during enzyme reaction

The effect on the uptake of [ ³ H] GalNAc by the type of the organic solvent was examined by conducting tests in the same manner as in Example 3 using various organic solvents having a final concentration of 1%. As an enzyme, The cell enzyme produced in Example 1 was used. The organic solvents used are as follows.

[0073] Xylene

Paraformaldehyde

Honoramarine

Glutaraldehyde

Black mouth Holm

Paraffin

Chlorohonole / ethanolanol mixture

Chlorophorome xylene mixture

Paraffin xylene mixture

[0074] Uptake was expressed as the ratio (%) of the incorporated radioactivity when the total radioactivity of [ ³ H] GalNAc used was defined as 100%. The results are shown in FIG. “No organic solvent” in FIG. 5 means a product obtained by reacting bacterial enzymes in the absence of an organic solvent.

[0075] As shown in FIG. 5, it is shown that, when a cell enzyme is used, the use of black mouth form or “mixture of black mouth form and xylene” promotes the uptake of [] GalNAc. It was. In addition, in order to examine the dependence of concentration when using Kuroguchi Form as an organic solvent, the concentration of Kuroguchi Form in the enzyme reaction solution is used. The amount of [ ³ H] GalNAc incorporated into the polymer fraction was examined by conducting the same test as in Example 3 at 0.5, 1.0, 2.0, 5.0, or 10.0%. It was. The result is shown in FIG.

[0076] As shown in FIG. 6, in the case of using bacterial enzymes, the incorporation of [ ³ H] GalNAc may be promoted when the concentration of chloroform in the enzyme reaction solution is more than 0% and less than 5%. Indicated.

Example 8 Construction of kfoA and kfoF subcloning and expression vector

E. coli-derived UDP—Glc4 epimerase gene (kfoA) and E. coli-derived UDP—using the DNA sequence region 2 (R-II) DNA sequence of E. coli K4 strain shown in JP-A-2003-199583 as a template. A cDNA for the Glc dehydrogenase gene (kfoF) was obtained. The obtained DNA was used as a saddle type, and PCR was performed as follows using the following primers.

[0078] kfoA-SP: CGGGATCCCGATGAATATATTAGTTACAGG (underlined part is BamHI site, (SEQ ID NO: 5)

kfoA-AS: CCCAAGCTTGGGTAGAAGTTATCGTAAAAT (underlined part is Hindlll site, SEQ ID NO: 6)

kfoF-SP: CGGGATCCCGATGAAAATTGCAGTTGCTGG (underlined part is BamHI site, SEQ ID NO: 7)

kfoF-AS: CCCMGCIIGGGTCTTTAATAGCCATAAAA (underlined part is Hindlll site, SEQ ID NO: 8)

[0079] To 100 ng of template, TakaRa Ex Taq 2.5 Unit (manufactured by Takara Bio Inc.), 10 X Ex Taq Buffer 10 2.5 mM dNTP Mixture 8 1, 100 pmol each of sense primer and antisense primer, The total amount was adjusted to 100 μ1 with milli-Q water. Ρ CR condition is 94 ° C for 5 minutes, then repeats 30 cycles of 94 ° C for 30 seconds, 55 ° C for 1 minute, 72 ° C for 90 minutes, and then 72 The reaction was carried out at ° C for 7 minutes.

[0080] The target fragment was gel-extracted from the reaction solution with QIA quick (Qiagen) and subjected to limited digestion overnight with BamH I and Hindlll. Then, the target fragment was purified by gel extraction again. About 100 ng of pTric-HisC vector (manufactured by Invitrogen) that has been restricted with the same restriction enzyme, about 300 ng of purified cDNA fragment, T4 ligase (manufactured by NEB) 0.5 μ1, 10 X T4 ligase Buffer 1 1 was added, and the total amount was adjusted to 101 with milli-Q water, and ligation was performed in a 16 ° C water bath for 1 hour. Subsequently, TOP10 competent cell 1001 was transformed with reaction mixture 51, and applied to LB agar medium (LB / Amp plate) containing ampicillin, and allowed to stand overnight at 37 ° C.

[0081] Any five colonies were selected from the colonies on the plate, the plasmid was extracted by the alkali prep method, and insert check was performed using BamHI and Hindlll. The sequence was confirmed for the plasmid in which the insert was correctly incorporated, and it was confirmed that there was no difference from the gene sequence in the database (GeneBank accession No. AB079602). The confirmed DNA sequences of the UDP-Glc4-epimerase gene (kfoA) and UDP-Glc dehydrogenase gene (kfoF) derived from Escherichia coli K4 strain are encoded by these genes together with coding amino acids in SEQ ID NOs: 1 and 3. UDP-Glc4-epimelase and UDP The amino acid sequences of Glc dehydrogenase are shown in SEQ ID NOs: 2 and 4, respectively.

Example 9 Production of KfoA and KfoF recombinants and confirmation of activity

Transform KfoA and KfoF expression vectors into E. coli TOP10, respectively, in 100 ml of ampicillin-containing LB liquid medium, culture at 37 ° C until OD600 = 0.5, and add IPTG to a final concentration of ImM. Expression induction was performed for 3 hours. Thereafter, the soluble fraction obtained by sonication was passed through an N-to-NTA Agarose (Qiagen) column to obtain purified enzymes of KfoA and KfoF. The obtained enzyme fraction was dialyzed overnight in 1 L of 20% Glycerol-containing PBS solution, and the solution was exchanged, and dialysis for 6 hours was repeated twice.

[0083] Enzymatic reaction of KfoA was performed by heating a solution of enzyme 2.5 1, 1 mM UDP—GlcNAc51, 1 M Tris—HC1 5 μ 1 and water 37.5 1 in a 30 ° C. bath for 1 hour. It was. Thereafter, UDP-GlcNAc and UDP-GalNAc were separated using a Hydrosphere C18 column (manufactured by YMC), and the enzyme activity (amount of UDP-GalNAc produced per unit time) was estimated from the area ratio.

[0084] The reaction of KfoF is a mixture of enzyme 51, 1 mM UDP-Glc 51, 1 M Tris—HC1 or Glycine—NaOH 51, 5 mM β-NAD + 10 μ1, and water 25 μ1. It was heated in a 30 ° C bath for 1 hour. Subsequently, UDP-Glc and UDP-GlcU were separated on a Hydrosphere C18 column, and the enzyme activity (the amount of UDP-GlcUA produced per unit time) was also estimated.

[0085] Recombinant enzymes of KfoA and KfoF produced by the E. coli expression system were purified with a Ni-NTA Agarose column, and the collected fractions were separated by SDS PAGE. Expression of the recombinant enzyme was confirmed by Western blotting using mouse Tetra His tag antibody (Qiagen) as the primary antibody and Goat Anti Mouse HRP antibody (Gibco) as the secondary antibody. As a result, specific staining was detected as the main band for KfoA at a position of 42 kDa including the molecular weight of His tag, and for KfoF at a position of 48 kDa. In addition, when the gel after SDS PAGE was stained with CBB, bands that were strongly stained in addition to these bands were strong. The collected enzyme was dialyzed 3 times with PBS solution containing 20% Glycerol and stored at -80 ° C.

[0086] Optimal reaction conditions were examined using the prepared KfoA and KfoF recombinant enzymes. Kf oA 2.5 1, UDP— GlcNAc 5 nmol, final concentration 1 M Tris-HCl (pH 7.0-10.0) The reaction solution (50 1) thus prepared was heated in a 30 ° C water bath for 1 hour. Subsequently, the prepared UDP-GalNAc and unreacted UDP-GlcNAc were separated using a Hydrosphere C18 reversed-phase column, and the area ratio of the two peaks also represented the ratio of UDP-GalNAc to the total amount of sugar nucleotides. Quantified. As a result, since UDP-GalNAc was most produced at pH 8.5, Tris-HCl pH 8.5 was determined as the optimum buffer for KfoA.

[0087] For KfoF, KfoF 51, UDP—Glc 5 nmol, β—NAD + 50 nmol, 0.1 M

The reaction solution (501) prepared to be Tris-HCl (pH 7.0 to 10.0) or 0.1 M Glycine-NaOH (pH 9.0 to 10.0) was heated in a 30 ° C water bath for 1 hour. Thereafter, the absorbance at 340 nm was measured with an absorptiometer, and the enzyme activities at each pH were relatively compared. This absorbance at 340 nm is derived from the jS-NADH 2 molecule produced when one UDP-Glc molecule is oxidized, and is proportional to the enzyme activity of KfoF. As a result, the absorbance at the time of reaction with Glycine-NaOH pH 9.4 was the maximum, so this was determined to be the optimum buffer for KfoF.

Example 10 CH Polymer Synthesis Using Three Kinds of Cell Enzyme Reactors

In the same manner as in Example 1, the KfoA and KfoF expression vectors were each transformed into E. coli TOP10, cultured in 37 ml of ampicillin-containing LB liquid medium until OD600 = 0.5, and the final concentration was 1 mM. After adding IPTG, expression induction was performed for 3 hours. The culture solution was dispensed into 1 ml each, centrifuged at 15,000 X g for 1 minute, the supernatant was removed, and stored at -80 ° C to obtain KfoA and KfoF cell enzymes. These two cell reactors and the K4CP cells obtained in Example 1 were mixed together, and CH6 0.1 nmol, UDP- [ ³ H] GlcNAc 3 nmol (0.1 μ Ci), UD P-Glc 3 nmol, β-NAD + 30 Add nmol, 150 mM NaCl, 0.2 mM MnCl, 50 mM Tris

2

-HC1 (pH 8.5), 0.4% Nymeen S-215 (surfactant) was prepared to a total volume of 100 μ1, and the synthesis reaction was carried out overnight at 30 ° C with vigorous stirring. The reaction solution was boiled for 10 minutes, centrifuged at 15,00 00 g for 1 minute, and the supernatant was filtered through a 0.45 μm pore size filter (Millipore). After each sample was size fractionated with Superdex Peptide 10/300 GL (Amersham), the ³ H content of each fraction was measured with a scintillation counter to confirm the synthesis of the CH polymer. The elution curve of the product on the Superdex Peptide column is shown in FIG. 7 (C-ABC (−)). Further, the product was treated with chondroitinase ABC, and the ³ H content of each fraction was measured with a scintillation counter in the same manner as described above. Chondroitinase ABC treatment FIG. 7 shows an elution curve of the obtained product on a Superdex Peptide column (C-ABC (+)). The polymer peak disappeared by treatment of the product with chondroitinase ABC, which revealed that the resulting polymer was a CH polysaccharide chain (Figure 7).

[0089] Further, the same CH synthesis as described above was carried out without adding CH6. The elution curves of the product with and without CH6 added on the Superose 6 10/300 GL column are shown in FIG. 8 (CH6 (+) and CH6 (-)). Even if the same procedure was followed without adding CH6, a chondroitinase-degradable polymer could not be obtained. Thus, it was revealed that CH6 is essential for CH sugar chain elongation (Fig. 8). ).

Based on the above, the synthesis system using these three enzyme reactors showed that the acceptor substrate CH6 was elongated and the ultra-high molecular weight CH polymer was synthesized using UDP-Glc and UDP-GlcNAc as donor substrates. confirmed.

Industrial applicability

[0090] The method of the present invention can be used for the production of polymer CH sugar chains, and the produced polymer CH is useful as a functional molecule for pharmaceuticals, foods, cosmetics and the like.

Brief Description of Drawings

[0091] FIG. 1 is a graph showing the surfactant concentration dependence of CH synthesis.

FIG. 2 is a graph showing a SuperdexPeptide column elution curve of the reaction supernatant obtained in Example 4.

FIG. 3 is a diagram showing an elution curve of a reaction supernatant using a serial column of Sephacryl S500 and Superose 6;

FIG. 4 is a graph showing the influence of various surfactants having a final concentration of 0.4% on CH synthesis.

FIG. 5 is a diagram showing the influence of an organic solvent on CH synthesis.

FIG. 6 is a graph showing the dependence of organic solvent concentration on CH synthesis.

FIG. 7 is a diagram showing elution curves of the product obtained in Example 10 and the same product treated with chondroitinase ABC in a Superdex Peptide column.

FIG. 8 shows elution curves of a product obtained by adding CH6 in the CH synthesis of Example 10 and a product obtained without addition in a Superose column.

Claims

The scope of the claims

[I] A method for producing a chondroitin sugar chain, comprising at least the following steps.

Process: In the reaction system, "Dalcronate Donor", "N-acetylylgalatatosamine donor", "Sugar acceptor" and "Bacterial enzyme that synthesizes chondroitin" in the presence of surfactant. To coexist.

[2] The production method according to claim 1, wherein the “bacterial enzyme that synthesizes chondroitin” is a cell enzyme that expresses chondroitin polymerase derived from E. coli.

[3] The production method according to claim 2, wherein the chondroitin polymerase derived from E. coli is K4CP.

[4] The production method according to any one of claims 1 to 3, wherein the host used as the cell enzyme is Escherichia coli.

[5] The production method according to claim 4, wherein the E. coli is E. coli TOP10 strain.

[6] Surfactant power Naimine, MEGA-10, sodium cholate, n-octyl-13-

Claims selected from the group consisting of D-thiodarcopyranoside, n-norulu 13-D-thiomaltopyranoside, sucrose monocholic acid, sucrose monocaproic acid and sucrose monolauric acid Item 6. The production method according to any one of Items 1 to 5.

[7] Surfactant power Naimine, n-Noel 1 β-D-thiomaltopyranoside, sucrose monocaproic acid and sucrose monolauryl acid power are also selected. 2. The manufacturing method according to item 1.

[8] Surfactant power η-Noel 1 β-D-thiomaltopyranoside, sucrose monocaproic acid and sucrose monolauryl acid group power is also selected. The manufacturing method according to claim 1.

[9] The production method according to any one of claims 1 to 8, wherein the "coexistence" force is carried out under conditions of 10 to 50 ° C for 1 hour to 10 days.

[10] The "coexistence" force is carried out under conditions of 20 to 40 ° C for 10 to 30 hours.

The manufacturing method according to claim 1, wherein the deviation is from 1 to 9.

[II] “Coexistence” force The method according to any one of claims 1 to: LO, which is carried out under conditions of 20 to 40 ° C. for 15 to 24 hours.

[12] “Coexistence” force is performed for 15 to 24 hours under a condition of 25 to 37 ° C. 1

~: The production method according to any one of L 1.

13. The glucuronic acid donor is UDP glucuronic acid, and the “N-acetylethyl latatosamine donor” is UDP-N-acetyl galatatosamine! The manufacturing method according to item 1.

[14] UDP glucose 4-epimerase and UDP-N-acetyltilcosamine, and UDP-Dalcoose dehydrogenase and UDP darcose coexist in the reaction system, and UDP-N-acetylyl as an “N-acetylylgalatatosamine donor” 14. The production method according to claim 13, wherein galatatosamine and UDP glucuronic acid as “glucuronic acid donor” are supplied.

[15] The production according to any one of claims 1 to 14, further comprising the coexistence of one or two or more organic solvents selected from the group force of xylene, black mouth form, paraffin and formaldehyde force Method.

16. The production method according to claim 15, wherein the coexisting organic solvent is black mouth form or “black mouth form and xylene”.

17. The production method according to claim 15 or 16, wherein the concentration of the organic solvent in the coexistence state is more than 0% and less than 5%.

[18] The production method according to any one of [1] to [17], wherein the produced chondroitin sugar chain has all of the following properties 1) to 3):

2) It is completely broken down into disaccharides by chondroitinase ABC.

3) When the product obtained by degrading the sugar chain with chondroitinase ABC is subjected to disaccharide analysis, substantially all of them match the chondroitin unsaturated disaccharide.

19. The production method according to claim 18, wherein the weight average molecular weight is 75,000 or more.

20. The production method according to claim 19, wherein the weight average molecular weight is 200,000 or more.

[21] A method for promoting chondroitin synthesis, comprising causing a surfactant to coexist during an enzyme reaction by a “bacterial enzyme that synthesizes chondroitin”.

[22] A chondroitin sugar chain having all the following properties 1) to 3).

2) It is completely broken down into disaccharides by chondroitinase ABC.

23. The chondroitin sugar chain according to claim 22, having a weight average molecular weight of 50,000 to 500,000.

24. The chondroitin sugar chain according to claim 23, having a weight average molecular weight of 75,000 to 200,000.