WO2007068774A2 - Molecular method for the genetic population analysis and pedigree analysis of gilthead seabream (sparus aurata) and corresponding kit - Google Patents

Molecular method for the genetic population analysis and pedigree analysis of gilthead seabream (sparus aurata) and corresponding kit Download PDF

Info

Publication number
WO2007068774A2
WO2007068774A2 PCT/ES2006/000679 ES2006000679W WO2007068774A2 WO 2007068774 A2 WO2007068774 A2 WO 2007068774A2 ES 2006000679 W ES2006000679 W ES 2006000679W WO 2007068774 A2 WO2007068774 A2 WO 2007068774A2
Authority
WO
WIPO (PCT)
Prior art keywords
sau
sal
pmol
reaction
analysis
Prior art date
Application number
PCT/ES2006/000679
Other languages
Spanish (es)
French (fr)
Other versions
WO2007068774A3 (en
Inventor
Javier Porta Pelayo
José María PORTA PELAYO
María del Carmen ALVAREZ HERRERO
Original Assignee
Universidad De Málaga
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Universidad De Málaga filed Critical Universidad De Málaga
Publication of WO2007068774A2 publication Critical patent/WO2007068774A2/en
Publication of WO2007068774A3 publication Critical patent/WO2007068774A3/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6858—Allele-specific amplification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Definitions

  • the golden (Sparus aurata), is a species widely distributed by the Mediterranean Sea and the Atlantic coast from the British Isles to the Island of Cape Verde and the Canary Islands.
  • sea bream represents one of the most important species in marine aquaculture, especially in the Mediterranean area.
  • the main producers are Greece, Turkey, Spain, Italy and France.
  • Other minor productions are in Portugal, Weg, Cyprus, Israel, Malta, Egypt, Tunisia and Morocco, while there are incipient productions in Bulgaria, Norway and republic.
  • a new molecular tool based on microsatellite markers is presented.
  • This tool consists of co-amplification using the polymerase chain reaction (PCR) technique and analysis of 10 loci together, so that, in a fast and reliable way, sufficient data from an individual or group of individuals is obtained to carry
  • PCR polymerase chain reaction
  • 50 ng which can be obtained from any type of sample containing nucleated cells, without causing damage to the animal, such as eggs, larvae, fin, blood, pieces of dead or awakened and even processed fish tissues - Standardization of Loci employees and possible comparison of results of different works carried out with this tool.
  • loci employees are highly informative and have been tested in the identification of individuals, in pedigree studies and characterization of populations with very satisfactory results. Although genotyping methods developed for other organisms have been described
  • microsatellite molecular markers are repeated DNA sequences that are randomly distributed throughout the genome of organisms and that constitute highly variable areas and therefore, distinct from one individual to another. By studying these regions we can distinguish an individual from the rest of individuals of the same species with the highest precision. This is what the genetic typing or genotyping of an individual means.
  • the proposed tool also allows pedigree studies to identify the biological parents of a specific individual. The more numerous and variable these regions we study, the greater accuracy is obtained.
  • the invention consists of an optimized protocol for the study of 10 of these markers in the sea bream, Sparus aurata (Sparus aurata genotyping and paternity tool).
  • Co-amplification multiplex PCR
  • a and B simultaneous reactions
  • loci microsatellite markers
  • PCR polymerase chain reaction
  • the final objectives of automatic detection are to optimize the conditions for the analysis in automatic sequencers of type AB 310, 3100, 3130 and 3130 Advance (Applied Biosystem).
  • this tool could also be used with other genetic marker analysis equipment.
  • This method can be carried out through a marketable product consisting of a Mt with three possible presentations that allow the standardization and automation of the genotyping technique in a simple and fully reproducible way.
  • This method has been tested with excellent results, in the identification of individuals and determination of the pedigree in individuals born in a gilthead farm, an aspect of singular importance in the cultivation of fish in which it is not possible to track the breeders that really they participate in the laying, unless artificial fertilization is done.
  • this tool has been tested in the genetic characterization of a population of 50 individuals from the natural environment.
  • This method can be used to control the genetic structure of stocks and thus maintain levels of variability consistent with optimal biological efficiency, apply selection methods and / or facilitate accurate monitoring of the processes of reproduction, breeding, marketing and traceability.
  • This control of the cultivated stocks would allow to avoid possible ecological disasters in the natural populations, after possible escapes or repopulation.
  • the conditions are the general ones of any PCR amplification protocol, including the presence of thermostable polymerase, dNTPs (deoxyribonucleoside triphosphate); ionic strength conditions [ClMg + 2] and a pH suitable for enzyme activity.
  • thermostable polymerase deoxyribonucleoside triphosphate
  • ionic strength conditions [ClMg + 2]
  • pH suitable for enzyme activity for the optimal and balanced amplification of the different loci, very specific cycle conditions and proportions of reagents and primers are necessary.
  • the probability of identity represents the inverse of the number of individuals that must be analyzed before finding the same genotype in a randomly selected sample.
  • the power of exclusion refers to the probability that a randomly chosen adult will be excluded as a parent of a descendant.
  • Sparus aurata genotyping and paternity tool kit A + B allows pedigree studies to be carried out using molecular exclusion methods.
  • the direct exclusion of paternity means that when a child has genetic information that neither the mother nor the presumed father has, both should be excluded as biological parents.
  • the exclusion power of these tools can be measured by exclusion estimators (Exclusion Value 1 when neither parent is known and Exclusion Value 2 when at least one parent knows).
  • Sparus aurata genotyping and paternity tool kit provides exclusion values 1 and 2 of 0.999789 and 0.999998, respectively, which evidences. In the same way the following table shows the sensitivity of reactions A, B and A + B.
  • kits developed are based on the methodology described above, with the particularity that the primers are marked with specific fluorescent labels for analysis in automatic sequencers type AB 310, 3100, 3130 and 3130 Advance (Applied Biosystem).
  • the fluorescent labels described above are the following: 1 corresponds to 6- FAM (Applied Biosystem), 2 corresponds to NED (Applied Biosystem), 3 corresponds to PET (Applied Biosystem) and 4 corresponds to VIC (Applied Biosystem).
  • Fig.l Simplified scheme of the method of protection.
  • Fig. 2. Simplified scheme of a preferred embodiment (pedigree determination). Contrast of an individual's DNA footprint with that of their supposed parents (exclusion method). These analyzes allow to determine the paternity of an individual with a practically 100% reliability. Circles indicate exclusive loci.
  • Reaction A Preparation of Reaction A; Add 0.5 ⁇ l of Reaction A, 0.5 ⁇ l of 500 LIZ TM Size Standard (Applied Biosystem) and 10 ⁇ l of deionized formamide. Denature 10 minutes at 94 0 C and put cold until loading in the device.
  • Reaction B Preparation of Reaction B; Add 2 ⁇ l of Reaction B, 0.5 ⁇ l of 500 LIZ TM Size Standard (Applied Biosystem) and 10 ⁇ l of deionized formamide. Denature 10 minutes at 94 0 C and put cold until loading in the device.
  • Matrix Matrix standard set DS 33

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Analytical Chemistry (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention relates to a molecular method for the genetic population analysis and pedigree analysis of gilthead seabream (Sparus aurata) and to the corresponding kit (Sparus aurata genotyping and paternity tool kit). More specifically, the invention relates to a molecular tool which is based on microsatellite markers, consisting of coamplification by polymerase chain reaction and analysis of 10 loci, thereby enabling the rapid and reliable provision of sufficient data relating to an individual or group of individuals in order to perform population studies and establish kinship or pedigree relationships with great precision. Said information can be used to control and even improve the characteristics of gilthead seabream broodstocks. In addition, the above protocol is suitable for the detection and automatic analysis used in applied biosystem (AB) sequencing equipment. The invention also relates to a kit with three possible formats, which can be used to standardise and automate the method in a simple and fully reproducible manner.

Description

Método molecular para el estudio genético de poblaciones y el análisis de pedigrí de la dorada (Sparus auratd) y kit correspondiente (Sparus aurata genotyping and paternity tool kit) Molecular method for the genetic study of populations and the pedigree analysis of the sea bream (Sparus auratd) and corresponding kit (Sparus aurata genotyping and paternity tool kit)
SECTOR TÉCNICOTECHNICAL SECTOR
Tipificación genética; Identificación por genotipado, pedigrí y parentesco molecular.Genetic typing; Identification by genotyping, pedigree and molecular kinship.
TÉCNICA ANTERIORPREVIOUS TECHNIQUE
La dorada (Sparus aurata), es una especie ampliamente distribuida por el mar Mediterráneo y la costa Atlántica desde las Islas Británicas hasta la Isla de Cabo Verde e Islas Canarias. Además, la dorada representa una de las especies con mayor importancia en acuicultura marina, sobre todo en área del Mediterráneo. Los principales productores son Grecia, Turquía, España, Italia y Francia. Otras producciones menores se dan en Portugal, Croacia, Chipre, Israel, Malta, Egipto, Túnez y Marruecos, mientras que hay producciones incipientes en Albania, Argelia y Libia. En España, la evolución del consumo aparente de dorada crecerá en el periodo 2003-2006 de un 18% a un 22,1% anualmente, según se den las condiciones de crecimiento de renta y oferta de pescado blanco en un escenario medio u optimista, para superar en 2006 las 37.000 ó 43.000 Tm respectivamente, sin tener en cuenta el efecto positivo que tendría la posible comercialización de transformados y de nuevas presentaciones de las especies. El éxito de la acuicultura moderna se basa en el control sobre la reproducción de las especies, en el mejor conocimiento de su biología, y en las innovaciones tecnológicas. Sin embargo, en el cultivo de Dorada son muchas las dificultades que surgen en el control y manejo de los stocks reproductores, debido fundamentalmente al elevado número de individuos que se manejan, la dificultad para identificar a los padres o de identificar huevos o larvas en los primeros meses de desarrollo. Estos y otros aspectos imposibilitan un control integral de la reproducción de esta especie en cautividad y por tanto, de su domesticación. De la misma forma el control de la trazabilidad supone un reto para garantizar la seguridad alimenticia de los productos derivados de la explotación comercial de esta especie, tanto de su origen cultivado como procedente de la pesca. Llegados a este punto, resulta imprescindible contar con herramientas precisas que nos permitan conocer y evaluar la estructura genética de las poblaciones tanto salvajes como cultivadas y así trascender de una forma objetiva a la conservación genética de sus recursos. En la actualidad se pueden encontrar en distintas bases de datos, abundante información sobre secuencias de ADN descritas para S. aurata. Esta información permite llevar a cabo la tipificación de individuos de formas muy variadas. Sin embargo hasta la actualidad, no se han estandarizado ningún método para llevar a cabo dicha tipificación genética para la dorada.The golden (Sparus aurata), is a species widely distributed by the Mediterranean Sea and the Atlantic coast from the British Isles to the Island of Cape Verde and the Canary Islands. In addition, sea bream represents one of the most important species in marine aquaculture, especially in the Mediterranean area. The main producers are Greece, Turkey, Spain, Italy and France. Other minor productions are in Portugal, Croatia, Cyprus, Israel, Malta, Egypt, Tunisia and Morocco, while there are incipient productions in Albania, Algeria and Libya. In Spain, the evolution of the apparent consumption of sea bream will grow in the 2003-2006 period from 18% to 22.1% annually, depending on the conditions of growth of income and supply of white fish in a medium or optimistic scenario, to exceed 37,000 or 43,000 tonnes in 2006 respectively, without taking into account the positive effect that would have the possible commercialization of transformed and new presentations of the species. The success of modern aquaculture is based on control over the reproduction of species, on the best knowledge of their biology, and on technological innovations. However, in the cultivation of Dorada there are many difficulties that arise in the control and management of breeding stock, mainly due to the high number of individuals that are managed, the difficulty in identifying parents or identifying eggs or larvae in First months of development. These and other aspects preclude an integral control of the reproduction of this species in captivity and therefore, of its domestication. In the same way, traceability control is a challenge to guarantee the food safety of products derived from the commercial exploitation of this species, both from its cultivated origin and from fishing. At this point, it is essential to have precise tools that allow us to know and evaluate the genetic structure of both wild and cultivated populations and thus transcend in an objective way the genetic conservation of their resources. At present, abundant information on DNA sequences described for S. aurata can be found in different databases. This information allows to carry out the typification of individuals of varied forms. However, until now, no method has been standardized to carry out this genetic classification for gilthead sea bream.
Se presenta una nueva herramienta molecular basada en marcadores microsatélites. Esta herramienta consiste en la coamplificación mediante la técnica de reacción en cadena de la polimerasa (PCR) y análisis de 10 loci conjuntamente, de manera que, de una forma rápida y fiable se obtienen suficientes datos de un individuo o grupo de individuos como para llevar a cabo estudios de poblaciones, establecer relaciones de parentesco o de pedigrí con una gran precisión. Además, demostramos la utilidad de esta herramienta en la caracterización genética de poblaciones naturales y cultivadas, así como en la reconstrucción del pedigrí en puestas obtenidas en una empresa del sector. Esta información permite controlar e incluso mejorar las características de los stocks reproductores de dorada.A new molecular tool based on microsatellite markers is presented. This tool consists of co-amplification using the polymerase chain reaction (PCR) technique and analysis of 10 loci together, so that, in a fast and reliable way, sufficient data from an individual or group of individuals is obtained to carry To carry out population studies, establish kinship or pedigree relationships with great precision. In addition, we demonstrate the usefulness of this tool in the genetic characterization of natural and cultivated populations, as well as in the reconstruction of pedigree in positions obtained in a company in the sector. This information allows to control and even improve the characteristics of the breeding stock of gilthead.
La selección de los marcadores empleados, la optimización de las condiciones de 2 reacciones de PCR (Reacción A y reacción B), la caracterización de los loci empleados y su adaptación al análisis automático, suponen el sustrato de la presente solicitud. Además, este protocolo ha sido adecuado para la detección y análisis automático en equipos de secuenciación AB (Applied Biosystem). A partir de estos resultados se presenta un kit con tres posibles formatos comercializables que permite la estandarización y automatización de la técnica de genotipado de una forma sencilla y completamente reproducible.The selection of the markers used, the optimization of the conditions of 2 PCR reactions (Reaction A and reaction B), the characterization of the loci used and their adaptation to the automatic analysis, suppose the substrate of the present application. In addition, this protocol has been suitable for automatic detection and analysis in AB (Applied Biosystem) sequencing equipment. From these results, a kit with three possible marketable formats is presented that allows the standardization and automation of the genotyping technique in a simple and fully reproducible way.
El empleo del protocolo desarrollado o de los productos derivados de este {kit) presentan entre otras las siguientes ventajas:The use of the protocol developed or the products derived from this {kit) have among others the following advantages:
-El método implementado de PCR múltiplex reduce el tiempo y coste de la técnica, minimizando el riesgo de errores de manejo, ya que reduce considerablemente la manipulación. -Metodología sencilla, sólida y reproducible que asegura unos resultados precisos.-The implemented method of multiplex PCR reduces the time and cost of the technique, minimizing the risk of handling errors, since it considerably reduces handling. -Simple, solid and reproducible methodology that ensures precise results.
-Para realizar estos análisis tan solo es necesario una pequeña cantidad de ADN (aprox.-To perform these analyzes, only a small amount of DNA is required (approx.
50 ng), que puede obtenerse de cualquier tipo de muestra que contenga células nucleadas, sin causar daño al animal, tales como huevos, larvas, trozo de aleta, sangre, trozos de tejidos de peces muertos o despiezados e incluso procesados -Estandarización de los loci empleados y posible comparación de resultados de distintos trabajos realizados con esta herramienta.50 ng), which can be obtained from any type of sample containing nucleated cells, without causing damage to the animal, such as eggs, larvae, fin, blood, pieces of dead or awakened and even processed fish tissues - Standardization of Loci employees and possible comparison of results of different works carried out with this tool.
-Los loci empleados son altamente informativos y han sido probados en la identificación de individuos, en estudios de pedigrí y caracterización de poblaciones con resultados muy satisfactorios. Si bien se han descrito métodos de genotipado desarrollados para otros organismos-The loci employees are highly informative and have been tested in the identification of individuals, in pedigree studies and characterization of populations with very satisfactory results. Although genotyping methods developed for other organisms have been described
(humanos y otras especies domésticas de animales como caballos, perros, vacas, etc.), no existe antecedente alguno para peces y en concreto para el caso de la dorada. Por otra parte, para realizar análisis similares a los que se pueden llevar a cabo con esta herramienta, se podrían usar otros de los muchos loci existentes en la bibliografía, bien mediante la estrategia de PCR sencilla o de múltiplex. No obstante, ello conllevaría un importante esfuerzo adicional consistente en: a) elegir en cada caso loci con un alto polimorfismo y que presenten patrones amplificables bien definidos; b) ajustar las condiciones de la PCR; c) investigar la posible ocurrencia de alelos nulos; d) probar su utilidad con muestras reales.(humans and other domestic species of animals such as horses, dogs, cows, etc.), there is no antecedent for fish and specifically for the case of sea bream. On the other hand, to perform analyzes similar to those that can be carried out with this tool, other of the many existing loci in the literature could be used, either by means of the simple or multiplex PCR strategy. However, this would entail an important additional effort consisting of: a) choosing in each case loci with a high polymorphism and presenting well-defined amplifiable patterns; b) adjust the PCR conditions; c) investigate the possible occurrence of null alleles; d) test its usefulness with real samples.
DIVULGACIÓN DE LA INVENCIÓNDISCLOSURE OF THE INVENTION
Los marcadores moleculares tipo microsatélite son secuencias de ADN repetido que se distribuyen aleatoriamente a lo largo del genoma de los organismos y que constituyen zonas muy variables y por tanto, distintas de unos individuos a otros. Estudiando estas regiones podemos distinguir a un individuo del resto de individuos de la misma especie con una altísima precisión. Esto es lo que significa la tipificación genética o genotipado de un individuo. La herramienta propuesta permite también realizar estudios de pedigrí para identificar los padres biológicos de un individuo concreto. Cuanto más numerosas y variables son estas regiones que estudiamos, mayor precisión se obtiene.The microsatellite molecular markers are repeated DNA sequences that are randomly distributed throughout the genome of organisms and that constitute highly variable areas and therefore, distinct from one individual to another. By studying these regions we can distinguish an individual from the rest of individuals of the same species with the highest precision. This is what the genetic typing or genotyping of an individual means. The proposed tool also allows pedigree studies to identify the biological parents of a specific individual. The more numerous and variable these regions we study, the greater accuracy is obtained.
La invención consiste en un protocolo optimizado para el estudio de 10 de estos marcadores en la dorada, Sparus aurata (Sparus aurata genotyping and paternity tool). Se describe la coamplificación (PCR múltiplex), mediante 2 reacciones simultáneas (denominables como A y B) de 10 marcadores microsatélites (loci) mediante la técnica de reacción en cadena de la polimerasa (PCR), usando para ello cebadores específicos de cada microsatélite. Se incluye la selección de loci, la composición de cada una de las reacciones (A amplifica 6 loci y la B, 4 loci), las condiciones bajo las que se llevan a cabo, así como su adaptación para el análisis automático mediante fluorescencia. Ambas reacciones pueden emplearse bien de forma individual o conjunta. Los objetivos finales de la detección automática consisten en optimizar las condiciones para hacer el análisis en secuenciadores automáticos del tipo AB 310, 3100, 3130 y 3130 Avance (Applied Biosystem). No obstante, cambiando el mareaje con fluorocromos, esta herramienta podría igualmente ser empleada con otros equipos de análisis de marcadores genéticos. Esta método se puede llevar a cabo mediante un producto comercializable consistente en un Mt con tres presentaciones posibles que permiten la estandarización y automatización de la técnica de genotipado de una forma sencilla y completamente reproducible.The invention consists of an optimized protocol for the study of 10 of these markers in the sea bream, Sparus aurata (Sparus aurata genotyping and paternity tool). Co-amplification (multiplex PCR) is described, by means of 2 simultaneous reactions (denominable as A and B) of 10 microsatellite markers (loci) by the polymerase chain reaction (PCR) technique, using specific primers of each microsatellite. It includes the selection of loci, the composition of each of the reactions (A amplifies 6 loci and the B, 4 loci), the conditions under which they are carried out, as well as their adaptation for automatic fluorescence analysis. Both reactions can be used either individually or together. The final objectives of automatic detection are to optimize the conditions for the analysis in automatic sequencers of type AB 310, 3100, 3130 and 3130 Advance (Applied Biosystem). However, by changing the fluorochrome marking, this tool could also be used with other genetic marker analysis equipment. This method can be carried out through a marketable product consisting of a Mt with three possible presentations that allow the standardization and automation of the genotyping technique in a simple and fully reproducible way.
Estas tres presentaciones o formatos consisten en reacciones de PCR de varios loci, cuyas disoluciones principales se suministran preparadas en proporciones óptimas. A partir de estas soluciones y del ADN del individuo se llevan a cabo las reacciones siguiendo un protocolo detallado. Se contempla también la posibilidad de presentaciones comercializables adicionales en las que los componentes del Mt se proporcionen liofilizados y sólo se requiera añadir la muestra e hidratar la mezcla para que se puedan desarrollar las reacciones. Las principales presentaciones del kit, independientemente de que comprendan reactivos en una u otra forma, son: Sparus aurata genotyping and paternity tool Mt sixplex, en la que se amplifican conjuntamente 6 loci (anteriormente nos hemos referido a ella como Reacción A y lo seguiremos haciendo a fin de simplificar su lectura). Sparus aurata genotyping and paternity tool kit fourplex (a la que nos referiremos como Reacción B), en la que se amplifican conjuntamente 4 loci y Sparus aurata genotyping and paternity tool Mt six+fourplex (como Reacción A+B) en la que se comercializan ambas reacciones. El modo de empleo irá descrito en un protocolo detalladoThese three presentations or formats consist of PCR reactions of various loci, whose main solutions are supplied prepared in optimal proportions. From these solutions and the individual's DNA, the reactions are carried out following a detailed protocol. The possibility of additional marketable presentations is also contemplated in which the components of Mt are provided lyophilized and it is only necessary to add the sample and hydrate the mixture so that the reactions can develop. The main presentations of the kit, regardless of whether they include reagents in one way or another, are: Sparus aurata genotyping and paternity tool Mt sixplex, in which 6 loci are jointly amplified (previously we have referred to it as Reaction A and we will continue doing so in order to simplify your reading). Sparus aurata genotyping and paternity tool kit fourplex (which we will refer to as Reaction B), in which 4 loci and Sparus aurata genotyping and paternity tool Mt six + fourplex (as Reaction A + B) in which they are marketed are jointly amplified Both reactions. The way of use will be described in a detailed protocol
Este método se ha probado con excelentes resultados, en la identificación de individuos y determinación del pedigrí en individuos nacidos en una granja de doradas, aspecto de singular importancia en el cultivo de peces en los que no es posible hacer un seguimiento de los reproductores que realmente participan en las puestas, a menos que se haga fecundación artificial. Además esta herramienta se ha probado en la caracterización genética de una población de 50 individuos procedentes del medio natural.This method has been tested with excellent results, in the identification of individuals and determination of the pedigree in individuals born in a gilthead farm, an aspect of singular importance in the cultivation of fish in which it is not possible to track the breeders that really they participate in the laying, unless artificial fertilization is done. In addition, this tool has been tested in the genetic characterization of a population of 50 individuals from the natural environment.
Este método se puede emplear para controlar la estructura genética de los stocks y así mantener niveles de variabilidad acordes con una óptima eficiencia biológica, aplicar métodos de selección y/o facilitar un seguimiento preciso de los procesos de reproducción, cría, comercialización y trazabilidad. Este control de los stocks cultivados permitiría evitar posibles desastres ecológicos en las poblaciones naturales, tras posibles escapes o repoblación.This method can be used to control the genetic structure of stocks and thus maintain levels of variability consistent with optimal biological efficiency, apply selection methods and / or facilitate accurate monitoring of the processes of reproduction, breeding, marketing and traceability. This control of the cultivated stocks would allow to avoid possible ecological disasters in the natural populations, after possible escapes or repopulation.
El desarrollo de la metodología y el empleo de los productos se detallan a continuación:The development of the methodology and the use of the products are detailed below:
Selección de los loci y sus correspondientes cebadoresSelection of the loci and their corresponding primers
- Condiciones de las PCR tipos A y B.- Conditions of PCR types A and B.
- Caracterización de los loci empleados el las PCR A y B.- Characterization of the loci used in PCR A and B.
- Condiciones requeridas para su análisis automático mediante fluorescencia Desarrollo de un producto kit comercializable Sensibilidad del método- Conditions required for automatic fluorescence analysis Development of a marketable kit product Sensitivity of the method
Selección de los loci y cebadoresSelection of loci and primers
De un total de 20 loci probados, se seleccionaron 10 loci, por sus características de amplificación y tamaño. Finalmente, se emplean 20 cebadores (2/locus), 12 para la reacción A, donde se amplifican 6 loci y 8 para la reacción B donde se amplifican 4 loci. En la siguiente tabla se muestra el nombre del los 10 loci del conjunto, el número de acceso a la base de datos Genebank, reacción en la que se incluye la secuencia de los cebadores (Forward y Reverse), así como los autores que los describieron.From a total of 20 loci tested, 10 loci were selected, due to their amplification and size characteristics. Finally, 20 primers (2 / locus), 12 are used for reaction A, where 6 loci are amplified and 8 for reaction B where 4 loci are amplified. The following table shows the name of the 10 loci of the set, the access number to the Genebank database, reaction in which the sequence of the primers (Forward and Reverse) is included, as well as the authors who described them .
N°N °
Locus Reacción Secuencia 5'- 3' SEQLocus Reaction Sequence 5'- 3 'SEQ
Acceso ID NO AutoresAccess ID NO Authors
Forward- ATTGGGTGGCAGTTTAGTAGG 1 Launey et al.,Forward- ATTGGGTGGCAGTTTAGTAGG 1 Launey et al.,
Sau E82 AY 173035 A Rcvcrsc-CACTGCG ATGAGTGACCC 2 2003 Forward-ACGGTATGGAGTCAACTGC 3 Brown et al.,Sau E82 AY 173035 A Rcvcrsc-CACTGCG ATGAGTGACCC 2 2003 Forward-ACGGTATGGAGTCAACTGC 3 Brown et al.,
Sal 12 AY322108 A Rc\ crsc-CCCCTTTTGGTA CATCATAG 4 No publicado Forward- TTTCACTGAGCTGGAGACTTG 5 Launey et al., Sau K140 AY 173042 A Rcv crsc-AGAGTTGAGTCTGTTGCATGC 6 2003 Forward- ACACTGTCTTTCTGTCCCTCACACExit 12 AY322108 A Rc \ crsc-CCCCTTTTGGTA CATCATAG 4 Unpublished Forward- TTTCACTGAGCTGGAGACTTG 5 Launey et al., Sau K140 AY 173042 A Rcv crsc-AGAGTTGAGTCTGTTGCATGC 6 2003TCTACTTCTTCTACTACC
7 Brown et al.,7 Brown et al.,
Sal 15 AY322110 Revcrsc-Exit 15 AY322110 Revcrsc-
8 No publicado8 Not published
GAGTAACΛCAUCO rCAGTTGAAUC Forward- TGTTGGAGCTTGTTGGTACAC 9 Launey et al.,GAGTAACΛCAUCO rCAGTTGAAUC Forward- TGTTGGAGCTTGTTGGTACAC 9 Launey et al.,
Sau AN AY 173032 A ReVCrSC-(TA(KTrCTTAAAC(XiCr(1A(Ki 10 2003 Forward- ACAGTACCCCACTGTCTCC 11 Launey et al.,Sau AN AY 173032 A ReVCrSC- (TA (KTrCTTAAAC (XiCr ( 1 A (Ki 10 2003 Forward- ACAGTACCCCACTGTCTCC 11 Launey et al.,
Sau 147 AY 173041 A Rcvcrsc-ÍVATATCATTACACTGTGGC 12 2003 Forward- GCCTCTCAACCGTATGTAG 13 Batargias et pSAGT26 Y 17266 B Reversc-TGGTGATA'πTATGCATCTAG 14 al., 1999 Forward- ATTCTTCACAGGCCCAACACAAA 15 Brown et al.,Sau 147 AY 173041 A Rcvcrsc-ÍVATATCATTACACTGTGGC 12 2003 Forward- GCCTCTCAACCGTATGTAG 13 Batargias et pSAGT26 Y 17266 B Reversc-TGGTGATA'πTATGCATCTAG 14 al., 1999 Forward- ATTCTTCACAGA CCAACACACCA.
Sal 19 AY322111 B Rcvcrsc-GAAAACACCGGCCCAGTACGA 16 No publicado Forward- TCACGGGGGACCAAGACTG 17 Brown et al.,Salt 19 AY322111 B Rcvcrsc-GAAAACACCGGCCCAGTACGA 16 Unpublished Forward- TCACGGGGGACCAAGACTG 17 Brown et al.,
Sal 10 AY322107 B Rcversc-CTCACACT(iCCTAATTAGCACAGA 18 No publicado Forward- ACATTCATGTGTAAAATCGG 19 Launey et al.,Salt 10 AY322107 B Rcversc-CTCACACT (iCCTAATTAGCACAGA 18 Unpublished Forward- ACATTCATGTGTAAAATCGG 19 Launey et al.,
Sau E97 AY 173036 B Rcverse-TTGGAAGAACAGAAATCTAATG 20 2003Sau E97 AY 173036 B Rcverse-TTGGAAGAACAGAAATCTAATG 20 2003
Condiciones de las PCR tipos A y B.Conditions of PCR types A and B.
Las condiciones son las generales de cualquier protocolo de amplificación por PCR, entre las que figuran la presencia de polimerasa termoestable, dNTPs (desoxirribonucleosido trifosfato); condiciones de fuerza iónica [ClMg+2] y un pH adecuados para la actividad de la enzima. Sin embargo, para la amplificación óptima y equilibrada de los distintos loci son necesarios unas condiciones de ciclo y proporciones de reactivos y cebadores muy específicas.The conditions are the general ones of any PCR amplification protocol, including the presence of thermostable polymerase, dNTPs (deoxyribonucleoside triphosphate); ionic strength conditions [ClMg + 2] and a pH suitable for enzyme activity. However, for the optimal and balanced amplification of the different loci, very specific cycle conditions and proportions of reagents and primers are necessary.
Los resultados de la optimización de las reacciones A y B se describen a continuación (entre paréntesis se presentan las concentraciones de partida de las soluciones stock de cada reactivo):The results of the optimization of reactions A and B are described below (in brackets the starting concentrations of the stock solutions of each reagent are presented):
Reacción A:Reaction to:
- Condiciones de ciclo: 5 minutos a 95 °C, 20 ciclos de (30 segundos 95 0C, 30 segundos a 58 0C y 30 segundos a 720C, seguido de 7 minutos 72 0C.- Cycle conditions: 5 minutes at 95 ° C, 20 cycles of (30 seconds 95 0 C, 30 seconds at 58 0 C and 30 seconds at 72 0 C, followed by 7 minutes 72 0 C.
- Proporción de reactivos: 1 μl de ADN (50 - 500 ng), 1 μl de Buffer (10X), 1 μl de ClMg2 (15 mM), 1 μl de dNTPs (2mM), 3 μl de primer mix A (5 pmol/μl), 3 μl de H2O bidestilada estéril, 0.2 μl de Taq GoId (5 O/μl; Applied Biosystem).- Proportion of reagents: 1 μl of DNA (50 - 500 ng), 1 μl of Buffer (10X), 1 μl of ClMg 2 (15 mM), 1 μl of dNTPs (2mM), 3 μl of first mix A (5 pmol / μl), 3 μl of sterile double-distilled H 2 O, 0.2 μl of Taq GoId (5 O / μl; Applied Biosystem).
- Proporciones de cebadores (primer mix A): 6 de Sal 15 (5 pmol/μl), 2 de Sal 12 (5 pmol//d), 2.5 de Sal 147 (5 pmollμl), 4 de Sau K140 (5 pmol//fl), 6 de Sau AN (5 pmol/μl) y 3 de Sau E82 (5 pmol/μl).- Proportion of primers (first mix A): 6 from Salt 15 (5 pmol / μl), 2 from Sal 12 (5 pmol // d), 2.5 from Sal 147 (5 pmollμl), 4 from Sau K140 (5 pmol / / fl), 6 of Sau AN (5 pmol / μl) and 3 of Sau E82 (5 pmol / μl).
Reacción B:Reaction B:
- Condiciones de ciclo: 5 minutos a 95 0C, 25 ciclos de (30 segundos 95°C, 30 segundos a 58 0C y 30 segundos a 720C), seguido de 7 minutos 72 0C.- Cycle conditions: 5 minutes at 95 0 C, 25 cycles of (30 seconds 95 ° C, 30 seconds at 58 0 C and 30 seconds at 72 0 C), followed by 7 minutes 72 0 C.
- Proporción de reactivos: 1 μl de ADN (50 - 500 ng), 1 μl de Buffer (10X), 1 μl de ClMg2 (15 mM), 1 μl de dNTPs (2mM), 3 μl de primer mix B (5 pmol/μl), 3 μl de H2O bidestilada estéril, 0,2/íl de Taq GoId (5 U/μl; Applied Biosystem).- Proportion of reagents: 1 μl of DNA (50 - 500 ng), 1 μl of Buffer (10X), 1 μl of ClMg 2 (15 mM), 1 μl of dNTPs (2mM), 3 μl of first mix B (5 pmol / μl), 3 μl of sterile double-distilled H 2 O, 0.2 / l of Taq GoId (5 U / μl; Applied Biosystem).
- Proporción de cebadores (primer mix B): 8 de Sau E97 (5 pmol//íl), 4 de Sal 10 (5 pmol//d), 8 de pSAGT26 (5 ρmol//íl) y 1.5 de Sal 19 (5 pmol//d).- Proportion of primers (first mix B): 8 from Sau E97 (5 pmol // íl), 4 from Sal 10 (5 pmol // d), 8 from pSAGT26 (5 ρmol // íl) and 1.5 from Sal 19 ( 5 pmol // d).
Caracterización de los loci empleados el las Reacciones A y B. Para la caracterización de los 10 loci se realizó un estudio en muestras de DNA de 50 doradas obtenidas del medio natural. Los resultados se detallan a continuación. La probabilidad de identidad representa la inversa del número de individuos que deben ser analizados antes de encontrar el mismo genotipo en una muestra seleccionada al azar. El poder de exclusión se refiere a la probabilidad de que un adulto escogido al azar sea excluido como parental de un descendiente.Characterization of the loci used in Reactions A and B. For the characterization of the 10 loci a study was carried out on DNA samples of 50 gilded obtained from the natural environment. The results are detailed below. The probability of identity represents the inverse of the number of individuals that must be analyzed before finding the same genotype in a randomly selected sample. The power of exclusion refers to the probability that a randomly chosen adult will be excluded as a parent of a descendant.
Prob. Alelos Poder de Probabilidad deProb. Alleles Probability Power of
Locus Repetición N° alelos Rango de alelos nulos exclusión identidad pSAGT26 GT 18 200-258 -0.0407 0.656 0.0033Locus Repeat No. alleles Range of null alleles exclusion identity pSAGT26 GT 18 200-258 -0.0407 0.656 0.0033
Sau E82 GT 10 154-182 0.0062 0.669 0.0034Sau E82 GT 10 154-182 0.0062 0.669 0.0034
Sal 12 GT 23 104-152 0.0197 0.702 0.0033Sal 12 GT 23 104-152 0.0197 0.702 0.0033
Sal 19 GT 19 226-282 -0.0084 0.766 0.0017Sal 19 GT 19 226-282 -0.0084 0.766 0.0017
SaI lO GT 17 194-224 -0.0539 0.744 0.002SaI 10 GT 17 194-224 -0.0539 0.744 0.002
Sau K140 GT 14 127-161 -0.0123 0.660 0.0028Sau K140 GT 14 127-161 -0.0123 0.660 0.0028
Sau E97 GT 21 161-203 0.0274 0.723 0.0022Sau E97 GT 21 161-203 0.0274 0.723 0.0022
Sal 15 GT 29 96-160 0.0031 0.892 0.0007Sal 15 GT 29 96-160 0.0031 0.892 0.0007
Sau AN GT 9 145-165 -0.0016 0.403 0.013Sau AN GT 9 145-165 -0.0016 0.403 0.013
Sau 147 GT 10 117-137 -0.0232 0.360 0.012Sau 147 GT 10 117-137 -0.0232 0.360 0.012
Reacción A 95 96-224 0.998612 2.37 x lO-11 Reaction A 95 96-224 0.998612 2.37 x 10- 11
Reacción B 75 161-282 0.994304 3.16 x lO 15 Reaction B 75 161-282 0.994304 3.16 x 10 15
Reacción A+B 170 96-282 0.999992 2.13 x 1031 Reaction A + B 170 96-282 0.999992 2.13 x 10 31
Sensibilidad del métodoMethod sensitivity
El alto poder de exclusión de esta herramienta permite que en muchos estudios no sea necesario el empleo de los diez loci. Por ello, el método se divide en dos reacciones A (de 6 loci) y B (de 4 loci) que además pueden ser empleadas conjuntamente A+B (6+4 loci) para conseguir el mayor poder discriminatorio.The high power of exclusion of this tool allows the use of the ten loci in many studies. Therefore, the method is divided into two reactions A (of 6 loci) and B (of 4 loci) that can also be used jointly A + B (6 + 4 loci) to achieve the highest discriminatory power.
Mediante Sparus aurata genotyping and paternity tool kit A+B se consigue un valor Mp de 2.13048 e"31, lo que indica que la probabilidad de que dos individuos presenten la misma huella de identidad es prácticamente ceroWith Sparus aurata genotyping and paternity tool kit A + B, an Mp value of 2,13048 and "31 is achieved, indicating that the probability of two individuals presenting the same identity footprint is practically zero
Además, Sparus aurata genotyping and paternity tool kit A+B permite realizar estudios de pedigrí mediante métodos de exclusión molecular. La exclusión directa de la paternidad significa que cuando un hijo tiene una información genética que no tiene ni la madre ni el presunto padre, ambos deben ser excluidos como padres biológicos. El poder de exclusión de estas herramientas se puede medir mediante estimadores de exclusión (Valor de Exclusión 1 cuando ninguno de los parentales es conocido y Valor de Exclusión 2 cuando al menos conocemos uno de los padres). Sparus aurata genotyping and paternity tool kit proporciona valores de exclusión 1 y 2 de 0.999789 y 0.999998, respectivamente, lo que evidencia. De la misma forma la siguiente tabla muestra la sensibilidad de las reacciones A, B y A+B.In addition, Sparus aurata genotyping and paternity tool kit A + B allows pedigree studies to be carried out using molecular exclusion methods. The direct exclusion of paternity means that when a child has genetic information that neither the mother nor the presumed father has, both should be excluded as biological parents. The exclusion power of these tools can be measured by exclusion estimators (Exclusion Value 1 when neither parent is known and Exclusion Value 2 when at least one parent knows). Sparus aurata genotyping and paternity tool kit provides exclusion values 1 and 2 of 0.999789 and 0.999998, respectively, which evidences. In the same way the following table shows the sensitivity of reactions A, B and A + B.
Figure imgf000009_0001
Figure imgf000009_0001
Condiciones requeridas para su análisis automático mediante fluorescenciaConditions required for automatic fluorescence analysis
Para el análisis automático de las muestras mediante fluorescencia es necesario marcar uno de los cebadores de cada pareja con una molécula fluorescente. Existen varias empresas que suministran cebadores marcados hasta con 5 rangos de fluorescencia , lo cual permite discernir moléculas de loci distintos aunque tengan el mismo tamaño.For the automatic analysis of the samples by fluorescence it is necessary to label one of the primers of each pair with a fluorescent molecule. There are several companies that supply primers labeled with up to 5 fluorescence ranges, which allows different loci molecules to be discerned even if they are the same size.
En las reacciones A y B, los distintos cebadores deben presentar diferentes señales de fluorescencia. En el siguiente cuadro y de forma general, se muestran como 1, 2, 3, y 4 los diferentes mareajes. El tipo de moléculas para el mareaje depende del tipo de aparato secuenciador empleado.In reactions A and B, different primers must have different fluorescence signals. In the following table and in general, the different tides are shown as 1, 2, 3, and 4. The type of molecules for marking depends on the type of sequencing device used.
Locus Etiquetas ReacciónLocus Tags Reaction
Sau E82 4 ASau E82 4 A
Sal 12 4 ASalt 12 4 A
Sau K140 1 ASau K140 1 A
Sal 15 3 ASalt 15 3 A
Sau AN 2 ASau AN 2 A
Sau 147 2 A pSAGT26 4 BSau 147 2 A pSAGT26 4 B
Sal 19 1 BSalt 19 1 B
SaI lO 1 BSaI lO 1 B
Sau E97 3 BSau E97 3 B
Desarrollo de un producto (kit) comercializareDevelopment of a product (kit) commercialize
Este protocolo permite la estandarización y automatización de la técnica de tipificación o genotipado de forma sencilla y completamente reproducible. Los kits desarrollados se basan en la metodología descrita con anterioridad, con la particularidad de que los cebadores están marcados con etiquetas fluorescentes específicas para el análisis en secuenciadores automáticos tipo AB 310, 3100, 3130 y 3130 Avance (Applied Biosystem).This protocol allows the standardization and automation of the typing or genotyping technique in a simple and fully reproducible way. The kits developed are based on the methodology described above, with the particularity that the primers are marked with specific fluorescent labels for analysis in automatic sequencers type AB 310, 3100, 3130 and 3130 Advance (Applied Biosystem).
Las etiquetas fluorescentes descritas anteriormente son las siguientes: 1 corresponde a 6- FAM (Applied Biosystem), 2 corresponde a NED (Applied Biosystem), 3 corresponde a PET (Applied Biosystem) y la 4 corresponde a VIC (Applied Biosystem).The fluorescent labels described above are the following: 1 corresponds to 6- FAM (Applied Biosystem), 2 corresponds to NED (Applied Biosystem), 3 corresponds to PET (Applied Biosystem) and 4 corresponds to VIC (Applied Biosystem).
BREVE DESCRIPCIÓN DE LOS DIBUJOSBRIEF DESCRIPTION OF THE DRAWINGS
Fig.l. Esquema simplificado del método objeto de protección. Fig.2. Esquema simplificado de un modo de realización preferido (determinación del pedigrí). Contrastación de la huella de ADN de un individuo con la de sus supuestos progenitores (método de exclusión). Estos análisis permiten determinar la paternidad de un individuo con una fiabilidad prácticamente del 100 %. Los círculos indican loci excluyentes.Fig.l. Simplified scheme of the method of protection. Fig. 2. Simplified scheme of a preferred embodiment (pedigree determination). Contrast of an individual's DNA footprint with that of their supposed parents (exclusion method). These analyzes allow to determine the paternity of an individual with a practically 100% reliability. Circles indicate exclusive loci.
MANERA(S) DE REALIZAR LA INVENCIÓNWAY (S) OF CARRYING OUT THE INVENTION
Para el caso de un modo o ejemplo de realización consistente en el tipificado o genotipado de una muestra se describe el siguiente protocolo. La exposición que sigue no pretende ser limitativa en su alcance.In the case of a mode or exemplary embodiment consisting of the typing or genotyping of a sample, the following protocol is described. The following exhibition is not intended to be limiting in scope.
Muestras y obtención de ADN genómicoSamples and obtaining genomic DNA
Para llevar a cabo la tipificación de un individuo es necesaria una pequeña cantidad de ADN genómico, en un rango de 50 a 500 ng. Este protocolo se ha ensayado con distintos métodos de extracción: mediante precipitación salina y resinas de Chelex®, así como con distintos tipos de muestras: huevos (24 horas o más), larvas, sangre, músculo y aleta caudal. Todos estos métodos proporcionan ADN cualitativa y cuantitativamente idóneo para la obtención resultados altamente fiables, si bien combinando muestras y estrategias alternativas, es posible optimizar los resultados. PCi? de las reaccionesTo carry out the typing of an individual a small amount of genomic DNA is necessary, in a range of 50 to 500 ng. This protocol has been tested with different extraction methods: by saline precipitation and Chelex® resins, as well as with different types of samples: eggs (24 hours or more), larvae, blood, muscle and caudal fin. All these methods provide qualitatively and quantitatively suitable DNA for obtaining highly reliable results, although combining samples and alternative strategies, it is possible to optimize the results. PCi? of the reactions
Reacción A;Reaction to;
Reactivo Concentración VolumenReagent Concentration Volume
Temperatura TiempoTemperature Time
DNA 50-500 nglμ\ \ μ\DNA 50-500 nglμ \ \ μ \
95 0C 5 min Buffer 10 X l μ\95 0 C 5 min Buffer 10 X l μ \
95 0C 30 seg I ClMg 15 mM l μ\95 0 C 30 sec I ClMg 15 mM l μ \
58 0C 30 seg >-20 ciclos dNTP 2 mM í μl58 0 C 30 sec> -20 dNTP cycles 2 mM í μl
720C 30 seg Primer mix 5 pmol//íl 3 μ\72 0 C 30 sec First mix 5 pmol // íl 3 μ \
720C 7 min H2O 3 /<l72 0 C 7 min H2O 3 / <l
Taq 5 U//<1 0,2 μ\Taq 5 U // <1 0.2 μ \
Total 10 μlTotal 10 μl
Reacción B;Reaction B;
Reactivo Concentración VolumenReagent Concentration Volume
Temperatura TiempoTemperature Time
DNA 50-500 ng/μl l μ\DNA 50-500 ng / μl l μ \
95 0C 5 min _ Buffer 10 X 1 /<195 0 C 5 min _ Buffer 10 X 1 / <1
95 0C 30 seg I ClMg 15 mM l μ\95 0 C 30 sec I ClMg 15 mM l μ \
58 0C 30 seg >-25 ciclos dNTP 2 mM l μ\58 0 C 30 sec> -25 dNTP cycles 2 mM l μ \
720C 30 seg I Primer mix 5 pmol//tl 3 /ti72 0 C 30 sec I First mix 5 pmol // tl 3 / ti
720C 7 min H2O 3 μ\72 0 C 7 min H2O 3 μ \
Taq 5 Wμl 0,2 /ilTaq 5 Wμl 0.2 / il
Total 10 μ\Total 10 μ \
Preparación de los productos de la Reacción A, B y A+B para su carga en el secuenciadorPreparation of the products of Reaction A, B and A + B for loading in the sequencer
Preparación de la Reacción A; Añadir 0.5 μl de la Reacción A, 0.5 μl de 500 LIZ™ Size Standard (Applied Biosystem) y 10 μl de formamida desionizada. Desnaturalizar 10 minutos a 940C y poner en frió hasta su carga en el aparato.Preparation of Reaction A; Add 0.5 μl of Reaction A, 0.5 μl of 500 LIZ ™ Size Standard (Applied Biosystem) and 10 μl of deionized formamide. Denature 10 minutes at 94 0 C and put cold until loading in the device.
Preparación de la Reacción B; Añadir 2 μl de la Reacción B, 0.5 μl de 500 LIZ™ Size Standard (Applied Biosystem) y 10 μl de formamida desionizada. Desnaturalizar 10 minutos a 94 0C y poner en frió hasta su carga en el aparato. Preparación de la mezcla de reacciones A y B; Añadir 0.5 μ\ de la reacción A, 2 μ\ de la reacción B, 0.5 μ\ de 500 LIZ™ Size Standard (Applied Biosystem) y 10 μl de formamida desionizada. Desnaturalizar 10 minutos a 940C y poner en frió hasta su carga en el aparato.Preparation of Reaction B; Add 2 μl of Reaction B, 0.5 μl of 500 LIZ ™ Size Standard (Applied Biosystem) and 10 μl of deionized formamide. Denature 10 minutes at 94 0 C and put cold until loading in the device. Preparation of the mixture of reactions A and B; Add 0.5 μ \ of reaction A, 2 μ \ of reaction B, 0.5 μ \ of 500 LIZ ™ Size Standard (Applied Biosystem) and 10 μl of deionized formamide. Denature 10 minutes at 94 0 C and put cold until loading in the device.
Parámetros de separación electroforética y obtención automática de los datosElectrophoretic separation parameters and automatic data collection
Módulo: GS STR POP4 (1 mi) G5.md5Module: GS STR POP4 (1 mi) G5.md5
Matriz: Matrix standard set DS 33Matrix: Matrix standard set DS 33
Parámetros: GS500Analisys.gsp Voltaje de carrera: 15000 voltiosParameters: GS500Analisys.gsp Stroke voltage: 15000 volts
Voltaje de inyección: 15000 voltiosInjection voltage: 15000 volts
Duración de inyección: 7 segundosInjection duration: 7 seconds
Temperatura: 600CTemperature: 60 0 C
Poder del láser: 9 mWatios Laser power: 9 mWatios

Claims

REIVINDICACIONES
1. Método molecular para el estudio genético de poblaciones y el análisis de pedigrí de la dorada (Sparus aurata) caracterizado porque consiste en el análisis de 10 marcadores microsatélites o loci (con los oligonucleótidos correspondientes) a través de su coamplificación mediante la técnica de reacción en cadena de la polimerasa (PCR).1. Molecular method for the genetic study of populations and the pedigree analysis of the sea bream (Sparus aurata) characterized in that it consists of the analysis of 10 microsatellite markers or loci (with the corresponding oligonucleotides) through their coamplification by the reaction technique polymerase chain (PCR).
2. Método molecular para el estudio genético de poblaciones y el análisis de pedigrí de la dorada (Sparus aurata) según la reivindicación anterior que consiste en la coamplificación de 10 loci (Sau E82, Sal 12, Sau K140, Sal 15, Sau AN, Sau 147, pSAGT26, Sal 19, Sal 10 y Sau E97), usando cebadores específicos para cada uno de ellos (SEQ ID NO 1 a 20), marcados con "etiquetas fluorescentes" que permitan el análisis automática de las muestras mediante fluorescencia.2. Molecular method for the genetic study of populations and the pedigree analysis of the sea bream (Sparus aurata) according to the previous claim consisting in the co-amplification of 10 loci (Sau E82, Sal 12, Sau K140, Sal 15, Sau AN, Sau 147, pSAGT26, Sal 19, Sal 10 and Sau E97), using specific primers for each of them (SEQ ID NO 1 to 20), marked with "fluorescent labels" that allow the automatic analysis of the samples by fluorescence.
3. Método molecular para el estudio genético de poblaciones y el análisis de pedigrí de la dorada (Sparus aurata) según la reivindicación anterior en la que dicha coamplificación comprende 2 reacciones, denominables como "reacción A" y "reacción B", en las que se amplifican separadamente 6 (Sau E82, Sal 12, Sau K140, Sal 15, Sau AN y Sau 147) y 4 loci (pSAGT26, Sal 19, Sal 10 y Sau E97), respectivamente, pudiendo emplearse ambas reacciones de forma individual o conjunta. 4. Método molecular para el estudio genético de poblaciones y el análisis de pedigrí de la dorada (Sparus aurata) según la reivindicación anterior caracterizado porque la denominable "reacción A" comprende las siguientes características técnicas:3. Molecular method for the genetic study of populations and the pedigree analysis of the sea bream (Sparus aurata) according to the preceding claim wherein said coamplification comprises 2 reactions, denominable as "reaction A" and "reaction B", in which 6 are amplified separately (Sau E82, Sal 12, Sau K140, Sal 15, Sau AN and Sau 147) and 4 loci (pSAGT26, Sal 19, Sal 10 and Sau E97), respectively, both reactions being used individually or together . 4. Molecular method for the genetic study of populations and the pedigree analysis of the sea bream (Sparus aurata) according to the preceding claim characterized in that the denominable "reaction A" comprises the following technical characteristics:
- Condiciones de ciclo: 5 minutos a 95 0C, 20 ciclos de (30 segundos 95 0C, 30 segundos a 58 0C y 30 segundos a 72 0C, seguido de 7 minutos 72 0C. - Proporción de reactivos: 1 μl de ADN (50 - 500 ng), 1 μl de tampón (10X), 1 μ\ de- Cycle conditions: 5 minutes at 95 0 C, 20 cycles of (30 seconds 95 0 C, 30 seconds at 58 0 C and 30 seconds at 72 0 C, followed by 7 minutes 72 0 C. - Reagent ratio: 1 μl of DNA (50-500 ng), 1 μl of buffer (10X), 1 μ \ of
ClMg2 (15 mM), 1 μl de dNTPs (2mM), 3 μl de "primer mix A" (5 pmol//<l), 3 μl de H2O bidestilada estéril, 0.2 μl de Taq GoId (5 U/μl; Applied Biosystem).ClMg 2 (15 mM), 1 μl of dNTPs (2mM), 3 μl of "first mix A" (5 pmol // <l), 3 μl of sterile double-distilled H 2 O, 0.2 μl of Taq GoId (5 U / μl; Applied Biosystem).
- Proporciones de cebadores (primer mix A): 6 de Sal 15 (5 pmol/μl), 2 de Sal 12 (5 pmol/μl), 2.5 de Sau 147 (5 pmol//íl), - Proportion of primers (first mix A): 6 of Salt 15 (5 pmol / μl), 2 of Sal 12 (5 pmol / μl), 2.5 of Sau 147 (5 pmol // ı),
4 de Sau K140 (5 pmol//íl), 6 de Sau AN (5 pmol/μl) y 3 de Sau E82 (5 pmol/μl).4 of Sau K140 (5 pmol // ı), 6 of Sau AN (5 pmol / μl) and 3 of Sau E82 (5 pmol / μl).
5. Método molecular para el estudio genético de poblaciones y el análisis de pedigrí de la dorada (Sparus aurata) según la reivindicación 3 caracterizado porque la denominable "reacción B" comprende las siguientes características técnicas: - Condiciones de ciclo: 5 minutos a 95 °C, 25 ciclos de (30 segundos 950C, 30 segundos a 58 0C y 30 segundos a 720C), seguido de 7 minutos 720C.5. Molecular method for the genetic study of populations and the pedigree analysis of the sea bream (Sparus aurata) according to claim 3 characterized in that the denominable "reaction B" comprises the following technical characteristics: - Cycle conditions: 5 minutes at 95 ° C, 25 cycles of (30 seconds 95 0 C, 30 seconds at 58 0 C and 30 seconds at 72 0 C), followed by 7 minutes 72 0 C.
- Proporción de reactivos: 1 μl de ADN (50 - 500 ng), 1 μl de tampón (10X), 1 μl de ClMg2 (15 mM), 1 μl de dNTPs (2mM), 3 μl de "primer mix B" (5 pmol/μl), 3 μl de H2O bidestilada estéril, 0,2 μl de Taq GoId (5 JJ/ μl; Applied Biosystem).- Proportion of reagents: 1 μl of DNA (50 - 500 ng), 1 μl of buffer (10X), 1 μl of ClMg 2 (15 mM), 1 μl of dNTPs (2mM), 3 μl of "first mix B" (5 pmol / μl), 3 μl of sterile double-distilled H 2 O, 0.2 μl of Taq GoId (5 JJ / μl; Applied Biosystem).
- Proporción de cebadores (primer mix B): 8 de Sau E97 (5 pmol//d), 4 de Sal 10 (5 pmol//d), 8 de pSAGT26 (5 pmol//íl) y 1.5 de Sal 19 (5 pmol/μl).- Proportion of primers (first mix B): 8 from Sau E97 (5 pmol // d), 4 from Sal 10 (5 pmol // d), 8 from pSAGT26 (5 pmol // íl) and 1.5 from Sal 19 ( 5 pmol / μl).
6. Método molecular para el estudio genético de poblaciones y el análisis de pedigrí de la dorada (Sparus aurata) según cualquiera de las reivindicaciones 2 a 5 en el que los cebadores específicos están marcados con las siguientes "etiquetas fluorescentes": 6-6. Molecular method for the genetic study of populations and the pedigree analysis of the sea bream (Sparus aurata) according to any of claims 2 to 5 in which the specific primers are labeled with the following "fluorescent labels": 6-
FAM (loci Sau K140, Sal 19 y Sal 10), NED (loci Sau AN y Sau 147), PET (loci Sal 15 y Sau E97) y VIC (loci Sau E82, Sal 12 y pSAGT26).FAM (Sau K140 loci, Sal 19 and Sal 10), NED (Sau AN and Sau 147 loci), PET (Sal 15 and Sau E97 loci) and VIC (Sau E82 loci, Sal 12 and pSAGT26).
7. Kit desarrollado para llevar a cabo el método molecular para el estudio genético de poblaciones y el análisis de pedigrí de la dorada (Sparus aurata) descrito en las reivindicaciones anteriores caracterizado porque comprende set de cebadores, tampón de reacción, mezcla de dNTPs, muestra de ADN control, y enzima ADN polimerasa.7. Kit developed to carry out the molecular method for the genetic study of populations and the pedigree analysis of the sea bream (Sparus aurata) described in the preceding claims, characterized in that it comprises set of primers, reaction buffer, mixture of dNTPs, sample of control DNA, and DNA polymerase enzyme.
8. Kit desarrollado para llevar a cabo el método molecular para el estudio genético de poblaciones y el análisis de pedigrí de la dorada (Sparus aurata) según la reivindicación anterior que comprende la presentación de los componentes del mismo en estado liofilizado.8. Kit developed to carry out the molecular method for the genetic study of populations and the pedigree analysis of the gilthead seabream (Sparus aurata) according to the preceding claim comprising the presentation of the components thereof in lyophilized state.
9. Kit desarrollado para llevar a cabo el método molecular para el estudio genético de poblaciones y el análisis de pedigrí de la dorada (Sparus aurata) según cualquiera de las reivindicaciones 7 a 8 que comprende tres presentaciones o formatos comercializables caracterizadas por permitir desarrollar las reacciones de amplificación de forma individual o conjunta [Sparus aurata genotyping and paternity tool kit sixplex ("reacción9. Kit developed to carry out the molecular method for the genetic study of populations and the pedigree analysis of gilthead seabream (Sparus aurata) according to any of claims 7 to 8 comprising three presentations or marketable formats characterized by allowing the reactions to develop amplification individually or together [Sparus aurata genotyping and paternity tool kit sixplex ("reaction
A"), Sparus aurata genotyping and paternity tool kit fourplex ("reacción B"), y Sparus aurata genotyping and paternity tool kit six+fourplex ("reacción A" + "reacción B")]. A "), Sparus aurata genotyping and paternity tool kit fourplex (" reaction B "), and Sparus aurata genotyping and paternity tool kit six + fourplex (" reaction A "+" reaction B ")].
PCT/ES2006/000679 2005-12-13 2006-12-12 Molecular method for the genetic population analysis and pedigree analysis of gilthead seabream (sparus aurata) and corresponding kit WO2007068774A2 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
ES200502458A ES2277536B1 (en) 2005-12-13 2005-12-13 MOLECULAR METHOD FOR THE GENETIC STUDY OF POPULATIONS AND ANALYSIS OF PEDIGRI DE LA DORADA (SPARUS AURATA) AND CORRESPONDING KIT (SPARUS AURATA GENOTYPING AND PATERNITY TOOL KIT).
ESP200502458 2005-12-13

Publications (2)

Publication Number Publication Date
WO2007068774A2 true WO2007068774A2 (en) 2007-06-21
WO2007068774A3 WO2007068774A3 (en) 2007-08-02

Family

ID=38163274

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/ES2006/000679 WO2007068774A2 (en) 2005-12-13 2006-12-12 Molecular method for the genetic population analysis and pedigree analysis of gilthead seabream (sparus aurata) and corresponding kit

Country Status (2)

Country Link
ES (1) ES2277536B1 (en)
WO (1) WO2007068774A2 (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104263840A (en) * 2014-10-13 2015-01-07 青岛农业大学 Primer and method for identifying bradysia odoriphaga Yang et Zhang and bradysia difformis by EST (expressed sequence tag) microsatellite markers
CN106520939A (en) * 2016-11-04 2017-03-22 中国水产科学研究院淡水渔业研究中心 Snapper germplasm identification method and application thereof
CN106947816A (en) * 2016-10-28 2017-07-14 中山大学 A kind of method of Epinephelus coioides paternity test microsatellite Multiplex fluorescent PCR
CN113186302A (en) * 2021-06-04 2021-07-30 华中农业大学 Sex specific molecular marker of Megalobrama amblycephala hybrid Pioneer No. 2 and application

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003060160A2 (en) * 2002-01-18 2003-07-24 Genomar Asa Verification of fish origin based on nucleic acid pattern recognition

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003060160A2 (en) * 2002-01-18 2003-07-24 Genomar Asa Verification of fish origin based on nucleic acid pattern recognition

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
BROWN R.C.: 'Additional microsatellites for Sparus aurata and cross-species amplification within the Sparidae family' MOLECULAR ECOLOGY NOTES vol. 5, no. 3, September 2005, pages 605 - 607, XP003016139 *
BROWN R.C.: 'Factors influencing effective population size in commercial populations of gilthead seabream, Sparus aurata' AQUACULTURE vol. 247, no. 1-4, June 2005, pages 219 - 225, XP004912492 *
CHISTIAKOV D. ET AL.: 'Microsatellites and their genomic distribution, evolution, function and applications: A review with special reference to fish genetics' AQUACULTURE vol. 255, no. 1-4, June 2006, pages 1 - 29, XP005464119 *
DE INNOCENTIIS S. ET AL.: 'Microsatellite markers reveal population structure in gilthead sea bream Spartus auratus from the Atlantic Ocean and Mediterranean Sea' FISHERIES SCIENCE vol. 70, no. 5, October 2004, pages 852 - 859, XP003016138 *
LAUNEY S. ET AL.: 'Twelve new microsatellite markers for gilted seabream (Sparus aurata L.): Characterization, polymorphism and linkage' MOLECULAR ECOLOGY NOTES vol. 3, no. 3, September 2003, pages 457 - 459, XP003016137 *

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104263840A (en) * 2014-10-13 2015-01-07 青岛农业大学 Primer and method for identifying bradysia odoriphaga Yang et Zhang and bradysia difformis by EST (expressed sequence tag) microsatellite markers
CN106947816A (en) * 2016-10-28 2017-07-14 中山大学 A kind of method of Epinephelus coioides paternity test microsatellite Multiplex fluorescent PCR
CN106947816B (en) * 2016-10-28 2020-08-04 中山大学 Microsatellite fluorescent multiplex PCR (polymerase chain reaction) method for parent-child identification of epinephelus coioides
CN106520939A (en) * 2016-11-04 2017-03-22 中国水产科学研究院淡水渔业研究中心 Snapper germplasm identification method and application thereof
CN106520939B (en) * 2016-11-04 2019-09-13 中国水产科学研究院淡水渔业研究中心 A kind of method and its application of madai Germplasm Identification
CN113186302A (en) * 2021-06-04 2021-07-30 华中农业大学 Sex specific molecular marker of Megalobrama amblycephala hybrid Pioneer No. 2 and application
CN113186302B (en) * 2021-06-04 2022-02-01 华中农业大学 Sex specific molecular marker of Megalobrama amblycephala hybrid Pioneer No. 2 and application

Also Published As

Publication number Publication date
ES2277536A1 (en) 2007-07-01
WO2007068774A3 (en) 2007-08-02
ES2277536B1 (en) 2008-06-16

Similar Documents

Publication Publication Date Title
Norris et al. Parentage and relatedness determination in farmed Atlantic salmon (Salmo salar) using microsatellite markers
Yeates et al. Cryptic choice of conspecific sperm controlled by the impact of ovarian fluid on sperm swimming behavior
Beaumont et al. Biotechnology and genetics in fisheries and aquaculture
Kovach et al. Fine-scale spatial and temporal genetic structure of Atlantic cod off the Atlantic coast of the USA
US20110229886A1 (en) Methods for detecting aneuploidy using microparticle multiplex detection
Joseph et al. Multiple paternity in egg clutches of hawksbill turtles (Eretmochelys imbricata)
Pujolar et al. Signatures of natural selection between life cycle stages separated by metamorphosis in European eel
Campbell et al. Development and application of single‐nucleotide polymorphism (SNP) genetic markers for conservation monitoring of Burbot populations
ES2277536B1 (en) MOLECULAR METHOD FOR THE GENETIC STUDY OF POPULATIONS AND ANALYSIS OF PEDIGRI DE LA DORADA (SPARUS AURATA) AND CORRESPONDING KIT (SPARUS AURATA GENOTYPING AND PATERNITY TOOL KIT).
Johnson et al. Development and evaluation of a new microsatellite multiplex system for parental allocation and management of rainbow trout (Oncorhynchus mykiss) broodstocks
Piferrer Epigenetics in aquaculture: knowledge gaps, challenges, and future prospects
CN105671170B (en) It is a kind of for identify chicken crawl character primer combination and its application
EP3931353A1 (en) Systems and methods for separating decoded arrays
Aslam et al. Effect of storage temperature and duration on direct PCR amplification of various feather types and DBS matrices
ES2647134B1 (en) METHOD OF MOLECULAR DETERMINATION OF BIRD SEX BY ISOTHERMAL AMPLIFICATION BY LOOP
CN109136384A (en) The fluorescence detection reagent kit of DNA16 locus of cow genome group is analyzed simultaneously
Hampton Multidisciplinary investigation into stock structure of small pelagic fishes in southern Africa
Kaplan et al. The development of a rapid and sensitive, high-through-put protocol for RNA: DNA ratio analysis
Kadarmideen The use of genetic and genomic technologies to improve reproductive performance in cattle
WO2008022020A2 (en) Association of single nucleotide polymorphisms, dairy form and productive life
de la Herrán et al. A highly accurate, single PCR reaction for parentage assignment in Senegal sole based on eight informative microsatellite loci
WO2005059174A1 (en) Method and kit for the genotypification of hla-drb based on real time pcr
Janečka et al. Rapid whole genome amplification of DNA from felids: applications for conservation genetics
ES2330177B2 (en) GENETIC TYPICAL PROCEDURE FOR DICENTRARCHUS LABRAX.
KR101754502B1 (en) Method for individualization and Parentage test in pig using microsatellite marker

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application
DPE2 Request for preliminary examination filed before expiration of 19th month from priority date (pct application filed from 20040101)
NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 06841731

Country of ref document: EP

Kind code of ref document: A2

DPE2 Request for preliminary examination filed before expiration of 19th month from priority date (pct application filed from 20040101)