WO2007062371A2 - Live vector vaccine and uses thereof - Google Patents

Abstract

Methods and agents are disclosed for inducing an immune response to a foreign antigen in a neonate. The invention relates to attenuated Salmonella live vector vaccines expressing foreign antigens that efficiently prime the neonatal immune system and induce potent and balanced antibody and cell-mediated immunity against vaccine antigens in neonatal hosts.

Description

LIVEVECTORVACCINEAND USESTHEREOF

[oooi] INVENTORS

[0002] Marcela Pasetti, Karina Ramirez-Medina, and Alejandra V.E. Capozzo [0003] This application claims the benefit of U.S. provisional patent application no. 60/739,116, filed on November 23, 2005. [0004] FIELD OF THE INVENTION

[0005] The present invention relates to the area of immunotherapy. Specifically, the present invention relates to a live vector vaccine and methods of use thereof. The attenuated Salmonella live vector vaccines of the present invention unexpectedly induce potent antibody and otherwise absent cell-mediated immunity against vaccine antigens in neonatal subjects. The inventors demonstrate herein that attenuated Salmonella strain (as a live vector vaccine) induces maturation of neonatal dendritic cells (DC) and secretion of ThI -type and proinflammatory cytokines (including interferon-gamma (IFN-γ) and interleukin-12 (IL- 12)) known to promote naive T cell stimulation, enhancing overall neonatal immune responses. Thus, the vaccines of the present invention are useful in enhancing, promoting, and/or inducing an immune response, particularly in a subject early in life. The live vector vaccines of the present invention may be used to induce an immune response that is greater than that achieved by alternative means, such as by a subunit vaccine. The Salmonella live vector vaccines of the present invention (expressing a foreign antigen) can be administered to neonates, infants and young children to generate potent antigen-specific antibody and cell- mediated immune responses (which are usually absent early in life) through bacteria-induced DC maturation and T cell activation. [0006] BACKGROUND OF THE INVENTION [0007] Neonates have a limited capacity to elicit protective immunity in response to vaccination. Their responses are usually feeble and Th2-biased, which has been attributed in part to the immaturity of neonatal DC that leads to inadequate antigen presentation and T cell stimulation. Because neonates also fail to elicit T cell immunity, they are at increased risk for infection with intracellular pathogens. This lack of adequate response is attributed mainly to the immaturity of neonatal DC and impaired cytokine production (particularly IL- 12) (see, for example, Marόdi, L (2006), Neonatal innate immunity to infectious agents, Infection and Immunity 74:1999-2006). Neonatal ThI -type responses, however, can be induced using the appropriate antigen/stimulation. [0008] SUMMARY OF THE INVENTION

[0009] Accordingly, one object of the present invention is to provide uses of a Salmonella strain comprising a mutation in a htrA gene and a mutation in at least one gene affecting one of i) aromatic acid biosynthesis or ii) guanine biosynthesis. The inventors demonstrate that the strains of the present invention are particularly useful in enhancing immune responses at very early stages of life (which could include neonates, infants, toddlers, and young adults). [0010] The present invention is directed to uses of a live vector vaccine comprising a Salmonella strain with a mutation in a htrA gene, a mutation in one of i) aromatic acid biosynthesis or ii) guanine biosynthesis, and a recombinant foreign antigen (for example, Fl recombinant protein, LcrV recombinant protein, or B. Anthracis protective antigen (PA) recombinant protein) operably linked to a promoter. The vaccine of the present invention is particularly useful in inducing immune responses against the foreign antigen at very early stages of life.

[0011] In specific embodiments, the Salmonella is S. Typhi or S. Typhimurium. In other specific embodiments, the mutation in aromatic acid biosynthesis of the host comprises a mutation in an aroC gene, an aroD gene, or both an aroC and an aroD gene. In other specific embodiments, the mutation in guanine biosynthesis of the host comprises a mutation in a guaA gene, a guaB gene, or both a guaA gene and a guaB gene. (For additional description of mutations in guanine biosynthesis to attenuate a host strain, see, for example, U.S. Patent No. 6,190,669, which is incorporated herein by reference in its entirety; for additional description of mutations in aromatic acid biosynthesis, see, for example, Gue-fu Su et al. (1992), Extracellular export of Shiga Toxin B-subunit/haemolysin A (C-terminus) fusion protein expressed in Salmonella typhimurium αrøA-mutant and stimulation of B- subunit antibody responses in mice, Microbial Pathogenesis 13:465-476, and U.S. Patent No. 6,413,768, both of which are incorporated herein in their entirety).

[0012] In a further embodiment, the vaccine further comprises a second isolated foreign antigen, wherein the second foreign antigen is immunogenic for the same or a different pathogen. For example, the vaccine strain comprises an htrA mutation, an aroC and/or an aroD mutation(s), and a Fl recombinant protein as a first foreign antigen and an LcrV recombinant protein as a second foreign antigen. In this example, the first and second foreign antigens are antigens directed to the same pathogen, Y. pestis. However, it is contemplated that the first and second antigen may be directed to two different pathogens and/or biological agents. Moreover, each foreign antigen is operably linked to a promoter, which may be the same or different if more than one foreign antigen is included in the vaccine composition. [0013] In certain embodiments, the Salmonella strains of the present invention are used in methods of treating a subject exposed to or at risk for exposure to a weaponized biological agent. Such agents include any of the agents listed in Table I. Thus, the present invention is drawn to use of the Salmonella strain as a vaccine employed to treat a subject at risk for and/or exposed to a pathogen, a biological agent, and/or weaponized biological agent. [0014] In other embodiments, the present invention is directed to methods of inducing cell- mediated immunity in a subject by administering to the subject in need thereof a Salmonella strain carrying a mutation in a htrA gene, a mutation in one of i) aromatic acid biosynthesis or ii) guanine biosynthesis, and a recombinant foreign antigen operably linked to a promoter. In specific embodiments, the induction of cell-mediated immunity (for example, T cell proliferation and IFN-γ production) is an induction of a ThI -type response to the foreign antigen.

[0015] In other embodiments, the present invention is directed to methods of increasing a mucosal and systemic antibody response to a foreign antigen in a subject by administering to the subject in need thereof a Salmonella strain carrying a mutation in a htrA gene, a mutation in one of i) aromatic acid biosynthesis or ii) guanine biosynthesis, and a recombinant foreign antigen operably linked to a promoter.

[0016] In yet other embodiments, the present invention is directed to methods of inducing maturation of a neonatal DC by administering to the subject in need thereof a Salmonella strain carrying a mutation in a htrA gene, a mutation in one of i) aromatic acid biosynthesis or ii) guanine biosynthesis, and a recombinant foreign antigen operably linked to a promoter. [0017] In specific embodiments, the vaccine containing a foreign antigen to which treatment is desired is administered to the subject at risk and/or exposed thereto using homologous prime-boost or, alternatively, heterologous prime-boost. The prime is preferably administered mucosally, such as intranasally or using an aerosol. The boost is preferably administered parenterally, such as intramuscularly or subcutaneously.

[0018] In certain specific embodiments, the vaccine is administered as the prime, and the foreign antigen is administered as the boost. The latter may be achieved using, for example, a subunit vaccine composition having the foreign antigen.

[0019] In certain embodiments, the vaccine is an attenuated S. Typhi strain carrying a mutation in an htrA gene, a mutation in one of i) aromatic acid biosynthesis or ii) guanine biosynthesis, and a recombinant foreign antigen operably linked to a promoter. In specific embodiments, the recombinant foreign antigen is a polynucleotide encoding the foreign antigen under control of a promoter. The recombinant foreign antigen may be provided on a plasmid, vector (such as an expression vector), or incorporated into the Salmonella genome, such as, for example, by homologous recombination.

[0020] These and other objects are achieved in the present invention.

[0021] The present invention overcomes a major shortcoming in the art of childhood vaccination by providing a Salmonella-based live vector vaccine that induces strong, high quality and long lasting immune responses against foreign antigens at very early stages of life.

[0022] There has thus been outlined, rather broadly, the more important features of the invention in order that the detailed description thereof that follows may be better understood, and in order that the present contribution to the art may be better appreciated. There are, of course, additional features of the invention that will be described further hereinafter. Indeed, it is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory and are intended to provide further explanation of the invention as claimed.

[0023] In this respect, before explaining at least one embodiment of the invention in detail, it is to be understood that the invention is not limited in its application to the details of construction and to the arrangements of the components set forth in the following description, figures, or drawings. The invention is capable of other embodiments and of being practiced and carried out in various ways. Also, it is to be understood that the phraseology and terminology employed herein are for the purpose of description and should not be regarded as limiting.

[0024] As such, those skilled in the art will appreciate that the conception upon which this disclosure is based may readily be utilized as a basis for the designing of other structures, methods, and systems for carrying out the several purposes of the present invention. It is important, therefore, that equivalent constructions insofar as they do not depart from the spirit and scope of the present invention, are included in the present invention.

[0025] The accompanying drawings are included to provide a further understanding of the invention and are incorporated in and constitute a part of this specification, illustrate several embodiments of the invention and together with the description serve to explain the principles of the invention.

[0026] TABLE I

[0027] Critical Biological Agent Categories for Public Health Preparedness

[0028] BRIEF DESCRIPTION OF THE DRAWINGS

[0029] FIG. 1 shows the effect of intranasal (i.n.) priming with Salmonella expressing Y. pestis Fl followed by intramuscular (i.m.) boosting with Fl -alum on the production of Fl- specific bone marrow (BM) IgG antibody secreting cells (ASC). These measurements were performed on day 70 after birth.

[0030] FIG. 2 shows the effect of i.n. priming with Salmonella expressing Y. pestis Fl followed by i.m. boosting with Fl-alum on Fl-specific T cell proliferation in vitro. Measurements were performed after Salmone Ha(Fl) priming and during the true neonatal period (day 15 after birth), and after the boost (day 70 after birth, last time point evaluated) [0031] FIGS. 3 A, 3B and 3C show that mucosal priming of newborn mice with Salmonella expressing Y. pestis Fl enhances antibody responses to a subsequent dose of Fl given parenterally (i.m.). Newborn mice were immunized i.n. with 1 x 10⁹ CFU of S. Typhi expressing Fl (SaIFl), 5. Typhi alone (Sal) or with 5 μg of Fl (Fl) i.m. on days 7 and 21 after birth (arrows) in different prime-boost combinations as indicated in the figures. Analysis of Fl -specific IgG (FIG. 3A), avidity maturation (FIG. 3B) and IgG subclass distribution (FIG. 3C) demonstrate improved quality of Fl responses following S. Typhi priming. Results shown are mean ELISA titers, IgG avidity indices, and IgG2a/IgGl ratios (•) from 8-12 pups per group ± SEM. Data are representative from two independent experiments. *, p <0.05 compared with mice that received two doses of Fl i.m. (referred to below as Fl prime-boost group).

[0032] FIGS. 4A and 4B show that newborn mice primed with SaIFl develop Fl -specific T cell-mediated immunity. Mice were immunized as described in FIG. 3. IFN-γ production (FIG. 4A) and T cell proliferation (FIG. 4B) were measured in spleen cells collected on days 15 and 70 after birth. The frequency of Fl -specific T cells producing IFN-γ was measured by ELISpot in IL-2-expanded cells, upon Fl ex-vivo stimulation (FIG. 4A); results are expressed as Spot Forming Cells (SFC) per 1 x 10⁶ splenocytes ± SEM of replicate cultures. Proliferation of Fl -specific spleen cells upon in vitro stimulation with Fl was measured by [ H] thymidine incorporation (FIG. 4B); results are expressed as mean cpm x 10 ± SEM from replicate wells. *,p <0.05 as compared with the Fl prime-boost group. [0033] FIGS. 5A and 5B show that mucosal immune responses to Fl are only generated through live vector (SaIFl) priming. Newborn mice were immunized as described in FIG. 3. Fl -specific IgG antibody secreting cells (ASC) responses were measured in cells from lungs (FIG. SA) and nasal tissue (FIG. 5B) obtained on days 15 and 70 after birth. Results shown are mean IgG ASC per 1x10 cells ± SEM of replicate wells. *, p <0.04 as compared with the homologous Fl prime-boost group.

[0034] FIGS. 6A and 6B show that neonatal SaIFl priming followed by Fl boost elicits antigen-specific ASC (plasma cells) and memory B-cells. Newborn mice were irnmunized as described in FIG. 3. FIG. 6A shows Fl -specific plasma cells measured in bone marrow on day 70 after birth; results shown are mean IgG ASC per 1 x 10⁶ cells ± SEM. FIG. 6B shows Fl -specific memory B cells measured by ELISpot after 6 days-expansion of spleen cells in the presence of B cell mitogens.

[0035] FIGS. 7 A and 7B show that S. Typhi induces maturation of neonatal DC. FIG. 7A shows the expression of costimulatory molecules (CD80, CD86. CD40, and MHC class II (IAd)) on CDl Ic⁺ BM-derived neonatal DC after S. Typhi stimulation (gray-filled histogram) or mock infection (dark line histogram); isotype control staining is indicated by the dashed line. The right panel shows mean percent of CDl Ic⁺ expressing each marker ± SEM from three independent experiments. FIG. 7B shows pro-inflammatory cytokine production by neonatal BM-derived DC upon S. Typhi stimulation or mock infection measured in culture supernatants by BD CBA kit. Data shown represents mean cytokine concentration ± SEM from two independent experiments. *,p <0.04 as compared with the mock infected cells. [0036] FIGS 8 A, 8B and 8C show that S. Typhi expressing Fl enhances activation and maturation of neonatal BM-derived DC and promotes T cell stimulation. FIG. 8A shows expression of costimulatory molecules (CD80, CD86, CD40, and MHC class II) on CDl Ic⁺ BM-derived DC from newborn mice stimulated with SaIFl (m.o.i.=30) or Fl protein (5 mg/ml). The right panel represents mean percent of CDl Ic positive cells expressing combined activation/maturation markers after SaIFl or Fl stimulation ± SEM from three independent experiments. FIGS. 8B and 8C show enhanced capacity of SaIFl -treated DC to stimulate antigen-specific T cells. BM-derived DC (CDl Ic ) stimulated with SaIFl, Fl or mock stimulated were incubated with Fl specific CD3⁺ Fl -specific T cells. T cell proliferation (FIG. 8B) was measured by [³H] thymidine incorporation. The frequency of IFN-γ secreting cells (FIG. 8C) was measured by ELISpot. Data represent mean cpm and IFN-γ SFC ± SEM of replicate cultures. *, p <0.01 as compared with the T cell stimulation by Fl -treated cells. [0037] FIG. 9 shows the effect of mucosal priming with S. Typhi expressing Fl/LcrV followed by parenteral boost with LcrV and Fl + alum on serum IgG titers to LcrV in adult mice. Antibody titers were measured by ELISA and data represent mean IgG titers for each group measured at different time points after primary immunization. One week after the LcrV boost (day 80), the IgG titers elicited in mice primed with S. Typhi expressing LcrV surpassed by more than 3 logs those elicited by unprimed mice (that received PBS); both groups were boosted Lm. on day 72 with 1 μg of LcrV.

[0038] FIG. 10 shows IFN-γ responses measured by ELISpot in spleen cells from mice immunized as neonates with S. Typhi expressing PA and/or rPA-alum in different prime- boost combinations. Results are expressed as mean Spot Forming Cells (SFC) per IxIO⁶ cells.

[0039] FIGS. HA and HB show PA-specific IgG ASC (plasma cells) and memory B cell measured in bone marrow. Newborn mice were immunized with S. Typhi expressing PA alone or expressing PA with adjuvant CTAl-DD and/or rPA-alum in different prime-boost combinations.

[0040] FIG. 12 shows kinetics of serum IgG antibodies (FIG. 12A) to PA and anthrax toxin neutralization titers (FIG. 12B). Antibodies to PA were measured by ELISA in groups of 8-12 pups. Toxin neutralization titers were measured in tissue culture in pooled sera collected on day 63 after vaccination using a method developed by Dr. C. Quinn at the CDC (Quinn, C.P., P.M. Dull, V. Semenova, H. Li₅ S. Crotty, T.H. Taylor, E. Steward-Clark, K.L. Stamey, D.S. Schmidt, K. W. Stinson, A.E. Freeman, CM. Elie, S.K. Martin, C. Greene, R.D. Aubert, J. Glidewell, B.A. Perkins, R. Ahmed, and D.S. Stephens (2004), Immune responses to Bacillus anthracis protective antigen in patients with bioterrorism-related cutaneous or inhalation anthrax, Journal of Infectious Diseases 190:1228-1236). [0041] FIG. 13 shows anthrax toxin neutralization titers. Toxin neutralization titers were measured in pooled sera collected on day 63 and 140 after birth, from mice vaccinated as neonates with S. Typhi (PA) and/or PA in different prime-boost combinations. [0042] FIG. 14 shows PA-specific IFN-γ responses measured by ELISpot in spleen cells from mice immunized as neonates with S. Typhi expressing PA and rPA in different prime- boost combinations.

[0043] FIGS. 15A and 15B show IgG PA-specific ASC and memory B cells measured in BM. Similar to what was found for serum antibody responses, the highest levels of PA- specific IgG ASC (plasma cells) and memory B cells residing in the BM were observed in mice primed with S. Typhi(PA-CTAl) and boosted with rPA. These results indicate that mucosal live vector prime followed by parenteral subunit vaccine boost is an effective strategy to induce effector and memory B cell responses following neonatal vaccination. [0044] FIGS. 16A and 16B show upregulation of expression of cell surface markers indicative of activation and maturation (FIG. 16A) and production of pro-inflammatory cytokines (FIG. 16B) by DC derived from BM of neonatal mice following infection with attenuated vaccine strain S. Typhi CVD 90%-htrA.

[0045] FIG. 17 shows the effect of S. Typhi live vector vaccine on activation and maturation of neonatal human DC (isolated from umbilical cord blood) as determined by expression of cell surface markers.

[0046] FIG. 18 shows the effect of shows the effect of S. Typhi live vector vaccine on neonatal cord-blood DC activation and maturation as determined by expression of cell surface markers in the CDIa⁺ cord-blood population. [0047] DETAILED DESCRIPTION OF THE INVENTION [0048] Reference will now be made in detail to the embodiments of the invention, examples of which are illustrated in the accompanying drawings. [0049] As described herein, Salmonella live vector vaccines encoding a foreign antigen (such as, for example, Y. pestis Fl capsule) in neonatal mice lead to the induction of Fl- specific high quality and long lasting antibody and cell-mediated immune responses; such responses develop and are readily detected in the true neonatal period. The Salmonella vaccines of the present invention elicited immune responses that surpassed in quality and quantity those elicited by the foreign antigen (subunit vaccine) given parenterally with an adjuvant. The vaccines of the present invention provide the advantage of inducing foreign antigen specific mucosal immunity in a subject early in life.

[0050] Without being bound by any theory, the superior immune responses are believed to be due to the capacity of the live vector to induce neonatal DC maturation and production of cytokines that would contribute to more efficient antigen presentation and T cell activation. The data herein demonstrate a clear increase in the expression of maturation and activation cell surface markers in neonatal bone-marrow derived CDl Ic⁺ DC infected in vitro with S. Typhi. S. Typhi-induced neonatal DC maturation is accompanied by production of ThI -type and proinflammatory cytokines.

[0051] Recognizing that biodefense vaccines will be needed not only for healthy adults but also for other groups of the population, such as young infants and children, who might be at even higher risk in the event of a bioterrorist attack (see, for example, NIH Strategic Plan for Biodefense Research, U.S. DHHS, NIH publication 03-5306), the vaccine of the present invention was tested by the inventors in a neonatal/infant mouse model that parallels early life immune responses in humans.

[0052] Briefly, and described in more detail herein, S. Typhi(Fl) alone or followed by Fl /alum in a prime-boost regime was given to newborn mice on day 7 and 21 after birth. Neonates that received S. Typhi(Fl) produced high levels of Fl IgG antibodies that surpassed those elicited by Fl given intramuscularly (i.m.) (FIG 3A). S. Typhi(FI)-prime followed by Fl -boost produced the highest antibody responses with production of IgGl and IgG2a, denoting a balanced Thl/Th2 profile; in contrast, Fl alone induced only IgGl, indicating a predominant Th2-type response (FIG. 3C). S. Typhi-based immunization also produced enhanced avidity maturation (FIG. 3B), B cell memory (FIG. 6B), and mucosal Fl-specific antibody responses (FIG. 5), which were absent in neonates that received Fl i.m. Most importantly, cell-mediated immunity (Fl-specific T cell proliferation and IFN-γ secretion) developed after the priming dose, during the true neonatal period (FIG. 4). Such responses could be due to the capacity of Salmonella expressing Fl to activate and enhance maturation of neonatal DC, which can present the encoded foreign antigen (i.e. Fl) more efficiently and activate T cells, as it was demonstrated in vitro. Thus, DC derived from BM of neonatal (7- day-old) mice were infected in vitro with attenuated S. Typhi or were mock-infected (control). Expression of cell surface markers was measured by multicolor flow cytometry. Neonatal CDl Ic⁺ DC displayed a clear up-regulation of maturation markers CD80, CD86, CD40 and MHC class II molecules (IAd) upon S. Typhi infection (FIG. 7 and FIG. 16). This was also observed in S. Typhi-infected BM-derived CDl Ic⁺ from adult mice serving as a control (FIG. 16). Neonatal and adult mice DC maturation was accompanied by secretion of IL-12, TNF-α, IFN-γ, IL-6, and MCP-I. Thus, the Salmonella live vector vaccine of the present invention induces maturation of neonatal DC and produces ThI -type and proinflammatory cytokines that enhance antigen presentation and naive T cell stimulation. Using similar methods and procedures, S. Typhi attenuated strain has been shown to induce maturation of DC derived from human cord blood (FIG. 17 and 18).

[0053] One skilled in the art would understand that a "mammal" of the present invention includes human and non-human animals. The mammal administered the attenuated Salmonella strains of the present invention includes, for example, a neonate, infant, toddler, pre-adolescent, and young adult. In particular, the mammal is a toddler, infant, or neonate. For example, if the mammal is human, the human is less than about 5, 4, 3, 2, or 1 year(s) of age. One skilled in the art would understand that a neonate is no more than about 4 weeks old. An infant is understood to be a child between the ages of about 4 weeks to about 12-24 months (and perhaps as old as about 24 months). If the mammal is a non-human animal, such as a companion animal or food-producing animal, the mammal of the present invention is less than about 1 year of age.

[0054] The mutation in aromatic amino acid and/or guanine biosyntheses of the present invention includes, for example, a mutation in one or more nucleotides of a polynucleotide sequence encoding a target protein (for example, to be compromised and/or deleted), where the mutation can be a point mutation, removal and/or insertion of a segment of nucleotides, modifications to the wild-type genomic polynucleotide sequence or any combination thereof. [0055] The term "recombinant foreign antigen" means an antigen that is not endogenous to the host Salmonella strain and, therefore, is incorporated into the host strain using methods described herein and/or methods well known in the molecular biological, genetic, and/or biochemical arts.

[0056] One skilled in the art would understand that a foreign antigen is any substance that is capable, under appropriate conditions, of inducing a specific immune response and of reacting with the products of that response (that is, with specific antibody or specifically sensitized T cells, or both. Foreign antigens may be soluble substances (for example, foreign proteins) or particulate (for example, bacteria and tissue cells).

[0057] The vaccines of the present invention can be administered to a mammal, either alone or in combination with a pharmaceutically acceptable carrier, in an effective amount to induce an immune response to a foreign antigen. "Effective amount" means a concentration of live vector vaccine capable of inducing humoral immunity, cell-mediated immunity, or a combination of humoral and cell-mediated immunity in a mammal (such as a neonate), which is sufficient to cure or prevent disease caused by the foreign antigen. One skilled in the art would understand the range of immunological responses anticipated by the terms "humoral immunity" and "cell-mediated immunity," such as antibody production and activities, T cell proliferation and activities, and cytokine production and activities. Such effective amount is understood to be amounts not harmful to the mammal or amounts where any harmful side effects are outweighed by the benefits. The useful dosage to be administered will vary depending on the age, weight and animal vaccinated, the mode and route of administration, and the type of pathogen against which vaccination is sought.

[0058] Optionally, one or more compounds having adjuvant activity may be added to the vaccine. Adjuvants are non-specific stimulators of the immune system. They enhance the immune response of the host to the vaccine. Examples of adjuvants known in the art are Freunds Complete and Incomplete adjuvant, vitamin E₅ non-ionic block polymers, muramyldipeptides, ISCOMs (immune stimulating complexes; see, for example, European Patent No. EP 109942), Saponins, mineral oil, vegetable oil, and Carbopol. Adjuvants, specially suitable for mucosal application are, for example, the E. coli heat-labile toxin (LT) or Cholera toxin (CT). Other suitable adjuvants are, for example, aluminum hydroxide, aluminum phosphate or aluminum oxide, oil-emulsions (for example, of Bayol F .sup.(R) or Marcol 52 .sup.(R), saponins or vitamin-E solubilisate.

[0059] Other examples of pharmaceutically acceptable carriers or diluents useful in the present invention include sterile distilled water, saline, and stabilizers such as SPGA₅ carbohydrates (for example, sorbitol, mannitol, starch, sucrose, glucose, dextran), proteins such as albumin or casein, protein containing agents such as bovine serum or skimmed milk and buffers (for example, phosphate buffer). Especially when such stabilizers are added to the vaccine, the vaccine is very suitable for freeze-drying or spray-drying. [0060] For administration to mammals, the vaccine according to the present invention can be given, for example, intranasally, by spraying, intradermally, subcutaneously, orally, by aerosol, or intramuscularly.

[0061] Dosages and routes of administration of the vaccine of the present invention can be determined without undue experimentation by one skilled in the art after consideration of all the criteria and use of best judgment on the subject mammal's behalf.

[0062] The vaccines of the present invention may be administered either alone or in combination with another immune response-inducing therapy to prevent the deleterious effects of the foreign antigen on the subject mammal.

[0063] The following examples are provided for illustration purposes only, and are in no way intended to limit the scope of the present invention.

[0064] EXAMPLE 1

[0065] MATERIALS AND METHODS

[0066] Mice and Immunizations

[0067] BALB/c mice (8-10 weeks old) purchased from Charles River Laboratories

(Wilmington, Mass.) were bred to produce pups as previously described (Capozzo, A. V., L.

Cuberos, M.M. Levine, and M.F. Pasetti (2004), Mucosally delivered Salmonella live vector vaccines elicit potent immune responses against a foreign antigen in neonatal mice born to naive and immune mothers, Infection and Immunity 72:4637-4646). Groups of 8-12 pups (2 litters) were immunized i.m. with 5 μg of purified recombinant Fl (kindly provided by

Porton Down, DSTL) adsorbed to 0.5% Alhydrogel (Accurate Chemical & Scientific Corp,

Westbury, NY) or intranasally (i.n.) with SaIFl or S. Typhi alone (109 CFU) on day 7 and

21±1 after birth. Some groups were primed with <S. Typhi expressing Fl or S. Typhi alone and boosted with Fl -alum at the same time points. Pre- immune serum samples were collected from age-matched pups from cardiac puncture. Further bleedings were performed from the retro-orbital sinus every two weeks, up to day 63 after birth. Sera were stored at — 70⁰C until tested. Animals were euthanized on day 15 or 70 after birth. [0068] Experiments to determine the immunogenicity of live vector constructs expressing anthrax protective antigen were performed in identical manner; newborn mice were immunized i.n. on days 7 after birth with S. Typhi CVD 908-htrA and Ty21a expressing PA (D4 domain or full protein) or PA domain 4 fused with CTAlDD (adjuvant) and boosted on day 21 with 2 μg of recombinant PA r(PA)-alum (List Laboratories). In experiments to evaluate immunogenicity of S. Typhi expressing Y. pestis LcrV, adult female BALB/c mice (~ 8 weeks-old) were primed i.n. with 1x10⁹ CFU of bacterial strains on days 0 and 28 and boosted i.m. on day 72 after primary immunization with 1 μg of LcrV-alum. All studies were approved by the University of Maryland, Institutional Animal Care and Use Committee. [0069] Measurement of Antibodies to Fl, PA, and LcrV

[0070] Antibody titers against Fl were measured by ELISA using a technique previously described by the inventors (Pasetti, M.F, Barry, E.M., Losonsky, G.A., Singh, M., Medina- Moreno, S.M., Polo, J.M., Ulmer, J.B., Robinson, H.L., Sztein, M.B, and Levine, M.M (2003), Attenuated Salmonella enterica serovar Typhi and Shigella flexneri 2A strains mucosally deliver DNA vaccines encoding measles virus hemagglutinin, inducing specific immune responses and protection in cotton rats, Journal of Virology 77:5209-5217) with modifications. ELISA plates were coated with Fl (Porton Down, DSTL) at 0.5 μg/ml in PBS. Fl-specific IgG₅ IgGl and IgG2a were detected with goat anti-mouse HRP-conjugates (Roche Applied Science, Indianapolis, IN) diluted 1:1000 in 10% dried milk (Nestle USA Inc., Glendale, Calif.) in PBS containing 0.05% Tween 20 (PBSTM). End-point titers were calculated through linear regression equation parameters as the inverse of the serum dilution that produces an Absorbance value of 0.2 above the blank (ELISA units per ml). ELISAs to measure PA and LcrV antibodies were performed in identical manner but using as coating antigens rPA at 2 μg/ml and LcrV at 0.5 μg/ml. [0071] Avidity of Fl -Specific IgG Antibodies

[0072] Avidity of IgG antibodies was measured using an ELISA procedure (as described above) with an additional 10 min washing step with 6 M urea (Sigma Chemical, St. Louis) immediately after incubation with test sera using a technique previously described by the inventors (Capozzo, V.E., Ramirez, C, Polo, J.M., Ulmer, J., Barry, E.M., Levine, M.M., Pasetti, M.F. (2006), Neonatal immunization with a Sindbis-virus DNA measles vaccine induce adult-like neutralizing antibodies and cell-mediated immunity in the presence of maternal antibodies, The Journal of Immunology 176:5671-5681). Samples were run in parallel with the regular ELISA and avidity ELISA. Results are expressed in avidity index, calculated as percentage of residual activity (end-point titer) after treatment with urea. [0073] Antibody secreting cells ( ASO

[0074] The frequency of Fl -specific ASC was measured in mucosal lymphoid tissues from NALT and lung, collected on day 15 or 70 after birth and in cells from BM collected on day 70 after birth, as previously described (Capozzo, A.V., L. Cuberos, M.M. Levine, and M.F. Pasetti (2004), Mucosally delivered Salmonella live vector vaccines elicit potent immune responses against a foreign antigen in neonatal mice born to naive and immune mothers, Infection and Immunity 72:4637-4646, and Capozzo, A.V., K. Ramirez, J.M. Polo, J. Ulmer, E.M. Barry, M.M. Levine, and M.F. Pasetti (2006), Neonatal immunization with a Sindbis virus-DNA measles vaccine induces adult-like neutralizing antibodies and cell-mediated immunity in the presence of maternal antibodies, The Journal of Immunology 176:5671- 5681). Microtiter plates were coated with 5 μg/ml of Fl, washed with PBS₃ and blocked with complete medium (RPMI 1640 containing 10% FCS₅ 200 mM glutamine, and penicillin- streptomycin, all from Invitrogen Life Technologies). Fresh cells were added to coated and uncoated wells (controls) in serial two-fold dilutions starting at 5 x 10⁵ cells/well. Fl- specific Abs were revealed with HRP-labeled goat anti-mouse IgG (Roche) diluted 1:500 in PBS/BSA 1% was used as conjugate followed by True Blue substrate (KPL, Gaithersburg, MD) in agarose overlay. Results are expressed as mean IgG ASC spot forming cells per 10⁶ cells from replicate wells. Spots from control wells were subtracted. PA IgG ASC were measured in BM cells by means of an ELISpot assay, as described above, but using PA as coating antigen at 5 μg/ml in PBS. [0075] IFN-γ ELISPOT Assay

[0076] Cryopreserved splenocytes (1 x 10⁶ cells/well in 24-well plates) were stimulated with complete medium supplemented with 5 IU/ml of IL-2 (Preprotech, Rocky Hill, NJ) at 37⁰C, 5% CO₂ for 9 days (supernatants were replaced with fresh medium on days 3 and 7). Stimulated cells were washed, seeded into nitrocellulose plates (1.25 x 10⁵/well) previously coated with anti-mouse IFN-γ mAb (BD Pharmingen, San Diego, Calif.) and further incubated with Fl (10 μg/ml) for 36 h₅ followed by biotin-labeled anti-mouse IFN-γ (2 μg/ml, BD Pharmingen,), streptavidin-HRP (Sigma) and True Blue (BCPL) substrate as described previously (Capozzo, A.V., K. Ramirez, J.M. Polo, J. Ulmer, E.M. Barry, M.M. Levine, and M.F. Pasetti (2006), Neonatal immunization with a Sindbis virus-DNA measles vaccine induces adult-like neutralizing antibodies and cell-mediated immunity in the presence of maternal antibodies, The Journal of Immunology 176:5671-5681). Cells incubated with complete medium or PHA (2 μg/ml, Sigma) were included as controls. Results are expressed as mean IFN-γ spot forming cell (SFC) per 10⁶ splenocytes from replicate cultures. ELISpot assays to measure IFN-γ responses to PA_were performed in similar manner, using fresh cells (without IL-2 expansion) and PA as coating antigen at 5 μg/ml in PBS. [0077] T Cell Proliferation Assays [0078] Spleen cells were (2 x 10⁵ cells/well in 96-well plates) were incubated with Fl (5 μg/ml) for 6 days at 37°C, 5% CO₂. Cell proliferation was measured by [³H] incorporation. Results are expressed as cpm produced by cells incubated with Fl minus the cpm of cells incubated with medium alone. Each cell population was also cultured for 2 days with 2 μg/ml of Con A (Sigma) under the same conditions. An identical assay was used to measure T cell proliferation in response to PA; the concentration of PA for in vitro cell stimulation was also 5 μg/ml [0079] Memory B Cell Assay

[0080] Fl -specific IgG memory B cells were measured in the spleen as described (Crotty, S., P. Feigner, H. Davies, J. Glidewell, L. Villarreal, and R. Ahmed (2003), Cutting edge: long-term B cell memory in humans after smallpox vaccination, The Journal of Immunology 171 :4969-4973) with modifications. Briefly, cells were cultured for 6 days (5 x 10⁵ cells/well, in 24 well plates) in the presence of polyclonal mitogens: 0.002% (20 μg/ml) of Lectin from Phytolacca Americana (Pokeweed SIGMA), 50 μg/ml of LPS from Escherichia coli O55:B5 (Sigma) and 0.3 μg/ml of CpG ODN 1826 5' tccatgacgttcctgacgtt 3'. Expanded cells were washed and transferred to microliter plates (in serial dilutions containing 5 χlθ ⁵ - 3.25 x 10⁴ cells/well) previously coated with Fl (5 μg/ml) or with rabbit anti-mouse IgG (Zymed) (10 μg/ml in PBS overnight). Cells plated in uncoated wells or in well coated with an unrelated antigen) were included as negative controls. Following overnight incubation, total and Fl -specific IgG were revealed with HRP-labeled goat anti-mouse IgG (5 μg/ml, Roche) followed by True Blue substrate (KPL) in agarose overlay. Results are expressed as the percent of cells secreting Fl -specific IgG per total IgG-secreting cells. Memory B cells specific for PA were measured in BM cells using a similar technique. [0081] Neonatal DC Maturation [0082] BM cells from one week newborn mice were seeded at 1-3 x 10⁷ cells in 25 cm² tissue culture flasks in 6 ml of complete medium supplemented with 10 ng/ml of mouse rGM-CSF (BD Pharmingen) and 10 ng/ml of IL-4 (BD Pharmingen) and incubated overnight at 37°C, 5% CO2. The next day, non-adherent cells were transferred to a new tissue culture flask and added equal volume of fresh IL-4 and GM-CSF-supplemented medium. Additional medium was added on day 6 and cells were harvested on day 8. BM-derived DC were stimulated with SaIFl (m.o.i.=30), S. Typhi alone (m.o.i.=30), purified Fl protein (5 μg/ml) or mock stimulated (control) for 2 h. Cells were then washed with PBS containing 100 μg/ml of gentamicin and allowed to recover overnight in complete medium at 37°C, 5% CO2. [0083] Flow Cytometry

[0084] Before staining, neonatal and adult BM-derived DC were washed in PBS containing 0.1% BSA and 0.01% NaN₃ and incubated with mouse BD Fc-Block (anti-mouse CD16/32; BD Pharmingen). The following mAbs were used: CDl Ic-APC (HL3), CD40-PE (3/23), CD80-FITC (16-10A1). and IAd-FITC (AMS32.1) (all from Pharmingen). Isotype-matched mAbs served as controls. Cytometric analysis was performed on a MoFlow (BD Pharmingen) flow cytometer using five-parameter acquisition (forward scatter, side scatter, and three fluorescence channels). Data were collected from 10,000 to 30,000 cells and analyzed by WinList 6.0 software, (Verity Software House). [0085] Proinflammatory Cytokines

[0086] Production of IL-12p70, TNF-α, IL-10, IL-6 and MCP-I by Salmonella or mock infected BM-derived DC cultures from neonatal and adult mice were quantified in culture supernatants by BD Cytometric Bead Array (CBA) Mouse Inflammation kit (BD Pharmingen) following manufacturer's instructions. A flow cytometer (FACSCalibur; BD Pharmingen) was calibrated with setup beads, and 3,000 events were acquired for each sample. Individual cytokine concentrations were determined by measuring fluorescence intensities of individual samples and extrapolating in the standard reference curve (CellQuest

Pro and CBA software; BD Pharmingen). Data analysis was performed using BD CBA software.

[0087] T Cell Activation Assays

[0088] CD3⁺ T cells from spleens of naive or Fl immune mice and CDl Ic⁺ BM-derived

DC stimulated with SaIFl, Fl or non-stimulated were purified by negative magnetic sorting following the manufacturer's recommendations (Dynal Biothech, Oslo, Norway and BD

Pharmingen, respectively). The purity of the populations resulted 85-95%. CDl Ic⁺ previously stimulated with SaIFl or Fl were cocultured with 100,000 Fl -specific CD3⁺ T cells in increasing DC:T cell ratios. T cell responses (IFN-γ production and cell proliferation) were measured following presentation as described above. Negative controls included CD3⁺

T cells and BM-derived CDl Ic⁺ DC incubated separately or together with complete medium.

T cells incubated with Con A (2 μg/ml, Sigma) or with Fl (5 μg/ml) served as positive controls. There was no significant proliferation by DC or T cells alone, therefore, irradiation was unnecessary; we also observed less debris using non-irradiated cells. Results from negative control wells were subtracted from experimental tests.

[0089] Statistical Analysis

[0090] Data were analyzed using SigmaStat software (SPSS Inc. Chicago, IL). The statistical significance of differences between groups was calculated using Mann- Whitney U test for two groups, or the one way ANOVA, followed by Dunnett's posttest comparison. A p value of <0.05 was considered significant at 95% confidence interval.

[0091] EXAMPLE 2 [0092] MUCOSAL PRIMING WITH S. TYPHI EXPRESSING Y. PESTIS Fl

FOLLOWED BY PARENTERAL BOOST WITH Fl/ALUM IN NEONATAL MICE

[0093] The inventors have shown that neonatal mice primed intranasally (i.n.) with S. Typhi CVD 908-htrA (also called, interchangeably, strain ACAM948CVD; for further description see U.S. Patent Nos. 5,589,380 and 5,783,196, each of which are herein incorporated by reference in their entirety) expressing Y. pestis Fl and boosted intramuscularly (i.m.) with 5 μg of Fl plus alum elicited remarkable antibody responses to Fl that surpassed in magnitude and quality those elicited by Fl given i.m. as a subunit vaccine (FIG. 3A). Neonates also responded to Fl with 1) serum IgG antibodies of stronger avidity (with faster kinetics of avidity maturation) than those induced by Fl i.m. (FIG. 3B), 2) higher levels of IgG2a (consistent with a more balanced ThI -Th2 type profile, FIG. 3C), 3) mucosal IgG antibody secreting cells (ASC), which were absent in neonates vaccinated with Fl i.m. (FIG. 5), 4) the highest percentage of Fl -specific memory B cells (FIG. 6B) and 5) strong cell-mediated immunity (CMI) shown by IFN-γ secretion in response to Fl (FIG. 4). Additional data demonstrate a) the presence of Fl -specific IgG ASC in the BM and memory cells in the spleen (FIG. 6) and b) the induction of potent CMI, measured by T cell proliferation upon in vitro Fl stimulation (FIG. 2 and 4). [0094] 2.A. Fl -Specific IgG Memory B Cells

[0095] Fl -specific IgG ASC were observed in the BM of mice primed as neonates (day 7 after birth) with S. Typhi expressing Fl and boosted with Fl i.m. (day 21 after birth) (FIGS. 1 and 6A). Similar frequencies of BM IgG secreting cells were seen in neonates that received 2 doses of S. Typhi(Fl) given i.n. or Fl i.m. Measurements were performed on day 70 after birth (FIG. 1 and FIG. 6A). No responses were observed in control mice that received S. Typhi followed by Fl or S. Typhi alone (negative control). Fl-specific IgG⁺ B cells residing in the bone marrow after immunization are regarded as pools of systemic memory cells that upon antigen exposure will migrate to the spleen to become effector cells that will produce specific antibodies. [0096] 2.B. Fl-Specific T Cell Proliferation

[0097] Neonates primed with S. Typhi(Fl) also developed strong CMI. After the first dose, the highest levels of in vitro T cell proliferation in response to Fl were observed in neonates primed with S. Typhi (Fl), whereas those primed with Fl Lm. displayed lower responses (FIG. 2 and FIG. 4B). All groups exhibited similar levels of T cell proliferation after the boost (FIG. 2). Similar results were obtained in a repeat experiment investigating the same groups and time points; in this experiment a higher lymphoproliferative response was observed in mice that had been primed with Sal alone and boosted with Fl (FIG 4B). As observed with Fl antibodies, mice primed with S. Typhi alone and boosted with Fl i.m. showed higher levels of T cell proliferation than those receiving one or two doses of Fl i.m., indicating that the live vector priming can enhance not only antibodies but also T cell responses to an antigen given later in life. An important conclusion from these data is that Fl -specific CMI (IFN-γ secretion and T cell proliferation) developed after the first vaccination (day 15 after birth), during the true neonatal period. The capacity of Salmonella- based live vectors followed by subunit vaccines to induce such a strong CMI in mice immunized as neonates (whose responses are usually limited to antibodies) is a major advantage that can have a broader application to prevent infectious diseases early in life. [0098] 2.C. Prime-Boost Immunization of Neonatal Mice Using an Attenuated S. Typhi Live Vector Vaccine Expressing Y pestis Fl Followed by Fl -Alum Given Parenterallv Induces High Levels of Fl-Specific Serum Antibodies [0099] The inventors examined the capacity of attenuated S. Typhi CVD 90S-htrA (also called, interchangeably, strain ACAM948CVD) to mucosally deliver Y. pestis Fl capsular antigen and to elicit antibody responses early in life (FIG. 3). Newborn BALB/c mice received two consecutive doses of S. Typhi alone (Sal) or S. Typhi expressing Fl (SaIFl) intranasally (i.n.), on days 7 and 21 after birth (vaccination regimen known as homologous prime boost), or one dose of S. Typhi alone or S. Typhi expressing Fl (SaIFl) followed by a boost with 5 μg of Fl adsorbed to alum, given intramuscularly (i.m.; heterologous prime- boost). A positive control group received two doses of Fl -alum i.m. Mice immunized as newborns with two doses of SaIFl or SaIFl -priming followed by Fl -boost, elicited remarkable Fl -specific serum IgG antibody responses that surpassed those of newborn mice immunized with two doses of Fl-alum (p <0.04) (FIG. 3A). Effective priming by the live vector was evidenced by the prompt rise in antibody titers after the boost (day 28 after birth) (FIG. 3A). The highest Fl antibody responses were observed in mice primed as neonates with SaIFl and boosted with Fl (11,439.1 EU/ml, on day 63 after birth). [00100] An unexpected but critical observation supporting the immunostimulatory properties of the live vector vaccines was that newborn mice primed with Salmonella alone and boosted with a single dose of Fl i.m. on day 21, developed higher Fl IgG titers than mice who received two doses (prime and boost) of Fl-alum. Mice immunized with two doses of Fl- alum exhibited the lowest antibody responses (FIG. 3A).

[00101] 2.D. Neonatal Priming with Salmonella Live Vector Vaccines Improves the Quality of Humoral Responses

[00102] Neonates are less capable than adults in achieving avidity maturation following conventional vaccination (see, for example, Schallert, N., M. Pihlgren, J. Kovarik, C. Roduit, C. Tougne, P. Bozzotti, G. Del Giudice, CA. Siegrist, and P.H. Lambert (2002), Generation of adult-like antibody avidity profiles after early-life immunization with protein vaccines, European Journal of Immunology 32:752-760). The inventors investigated the avidity of the antibodies elicited in newborn mice that received SaIFl or Fl-alum in different mucosal prime-parenteral boost combinations. Serum IgG antibodies produced by newborns primed with Sal alone or with SaIFl and boosted with Fl-alum had higher avidity (p <0.05) and faster kinetics of avidity maturation than those produced by two doses of Fl-alum (FIG. 3B). Salmonella serving as a neonatal priming vaccine also enhanced the IgG subclass profile. Neonates immunized with Fl-alum produced exclusively IgGl₃ whereas neonates primed with Sal or SaIFl and boosted with Fl produced IgG 1 and IgG2a, denoting a more balanced Thl/Th2 type immunity (FIG. 3C). Newborn mice that received two doses of SaIFl had the highest IgG2a/IgGl ratio, while mice that received two doses of Fl-alum had the lowest IgG2a/IgGl ratio, indicating the contribution of the live vector in the production of IgG2a (associated with a ThI -type cell-mediated immunity).

[00103] 2.E. Neonatal Mice Primed with Salmonella Expressing Fl Induce Robust Cell- Mediated Immunity to Y. pestis

[00104] Cell-mediated immunity (CMI)₅ including IFN-γ production, is essential in protection against plague (see, for example, Williamson, E.D., H.C. Flick-Smith, C. Lebutt, CA. Rowland, S.M. Jones, EX. Waters, RJ. Gwyther, J. Miller, P.J. Packer, and M. Irving (2005), Human immune response to a plague vaccine comprising recombinant Fl and V antigens, Infection and Immunity, 73:3598-3608) and such responses are feeble or absent during the neonatal period (see, for example, Marchant, A. and Goldman M. (2005), T cell- mediated immune responses in human newborns: ready to learn?, Clinical and Experimental Immunology 141:10-18, and Adkins, B. Leclerc C. and Marshall-Clarke S. (2004), Neonatal adaptive immunity comes of age, Nature Reviews 4:553-564). The inventors investigated the capacity of S. Typhi expressing Y. pestis Fl to enhance neonatal T cell responses by measuring the frequency of IFN-γ producing cells and T cell proliferation during the true neonatal period (day 15 after birth) in neonatal mice immunized with SaIFl and Fl-alum in different prime-boost combinations. The inventors also examined the persistence of these responses in mice as they became adults (day 70 after birth). [00105] IFN-Y Production

[00106] Neonatal mice primed with a single dose of SaIFl developed Fl -specific IFN-γ responses, during the true neonatal period, that markedly surpassed (p <0.05) those induced by one dose of Fl (FIG. 4A). IFN-γ responses were also observed after the Fl boost, on day 70 after birth. Again, the highest responders were mice primed as neonates with SaIFl; mice that had received either two doses or SaIFl or SaIFl -prime followed by Fl -boost had higher responses compared with mice that received two doses of Fl -alum. Interestingly, even mice primed with Salmonella alone appeared to have better responses (although not reaching statistically significance) than those that were primed and boosted with Fl -alum. No responses were observed in control mice that received Salmonella alone or PBS (data not shown).

[00107] T cell Proliferation

[00108] Mice primed as neonates with SaIFl also exhibited strong Fl-specific T cell proliferative responses during the neonatal period (FIG. 4B), which surpassed those of mice that received one dose of Fl -alum (the pattern of proliferative responses was very similar to that of IFN-γ production on day 15 after birth). Significant levels of T cell proliferation were observed in SaIFl -primed mice after the Fl boost (day 70 after birth). As observed with Fl antibodies, mice primed with S. Typhi alone and boosted with Fl Lm. showed higher levels of proliferative responses than mice that received two doses of Fl -alum (p <0.05). These results indicate that live vector priming not only enhances antibody production but also T cell responses to an antigen given later in life. Another important conclusion from these data is that cell-mediated immunity to Fl (IFN-γ secretion and T cell proliferation) was readily detected after a single priming dose of S. Typhi expressing Fl (day 15 after birth, true neonatal period). The capacity of Salmonella live vector vaccine-prime followed by subunit vaccine boost to induce strong CMI in neonates (whose responses are usually limited to antibodies) is a major advantage that can have a broader application to prevent infectious diseases early in life.

[00109] 2.F. Mucosal Immune Responses

[00110] One of the advantages of bacterial vectors over subunit parenteral vaccines, is their capacity to deliver a foreign antigen through a mucosal route inducing mucosal immunity that can protect against exposure to aerosolized pathogens. The inventors investigated the presence of B cells capable of secreting antibodies specific for Fl in mucosal tissues of newborn mice immunized with Salmonella live vectors or Fl as subunit antigen in different prime-boost combinations. Fl -specific IgG secreting cells were found in nasal tissue and in lungs from neonatal mice primed intranasally with SaIFl; these responses were present during the true neonatal period (day 15) and remained for up to 7 weeks after the boost (FIG. 5). An interesting observation was that in both mucosal tissues, the frequency of Fl specific ASC developed after SaIFl priming was higher on day 15 than on day 70 after birth. These results confirm that the live vector vaccine is responsible for eliciting the observed mucosal responses, which can be boosted by parenteral immunization with Fl -alum and maintained for long time thereafter. Mice immunized i.m. with Fl failed to elicit mucosal ASC. [00111] 2.G. Effector and Memory IgG Antibody Secreting Cells (ASC) [00112] The inventors investigated the induction of Fl -specific effector and memory B cell responses in neonatal mice that received live vector or subunit antigen in different prime- boost combinations. The frequency of vaccine-induced B lymphocytes that can secrete antibodies specific to Fl upon antigen stimulation were measured in the bone marrow (BM) on day 70 after birth (FIG. 1 and FIG 6A). Fl -specific IgG ASC were observed in mice that received two doses of SaIFl or Fl -alum (homologous prime-boost) and in those primed with SaIFl and boosted with Fl -alum. Neonates that received two doses of Fl -alum exhibited a somewhat lower frequency of IgG ASC compared with SaIFl -primed mice. Fl -specific IgG+ B cells residing in the BM after vaccination are regarded as pools of systemic memory cells that upon antigen exposure will migrate to the spleen to become effector cells that will produce specific antibodies.

[00113] Memory B cells were also measured in the spleen using a technique described previously (Crotty, S., R.D. Aubert, J. Glidewell, and R. Ahmed (2004), Tracking human antigen-specific memory B cells: a sensitive and generalized ELISPOT system, The Journal of Immunological Methods 286:111-122), in which memory B cells are differentiated into ASC by in vitro mitogenic stimulation (FIG. 6B). The highest frequency of Fl-specific memory B cells was observed in mice primed with SaIFl and boosted with Fl -alum (12% of the total IgG positive memory B-cells). Mice immunized with two doses of Fl i.m. had the lowest responses.

[00114] 2.H. S. Typhi Promotes Activation and Maturation of Neonatal DC [001 15] The inventors considered whether the capacity of Salmonella to prime such a strong ThI -type immunity during the neonatal period could be due to the potential capacity of the bacteria to promote activation and maturation of neonatal DC; lack of DC maturation and inadequate antigen presentation have been singled out as a possible causes for the lack of responses of neonates to vaccines (see, for example, Marchant, A. and Goldman M. (2005), T Cell-mediated immune responses in human newborns: ready to learn?, Clinical and Experimental Immunology 141:10-18, and Adkins, B. Leclerc C. and Marshall-Clarke S. (2004), Neonatal adaptive immunity comes of age, Nature Reviews 4:553-564). The inventors investigated whether attenuated S. Typhi live vector strain CVD 908-htrA could promote maturation of neonatal DC by measuring surface expression of MHC and costimulatory molecules in CDl lc+ DC cells derived from BM precursors of newborn mice. The results demonstrate for the first time that S. Typhi induces an up-regulation of CD 80, CD86, CD40 and MHC class II on CDl Ic⁺ murine DC cells (FIG. 7A and FIG. 16). The same pattern of up-regulation of surface molecules was observed in adult BM-derived DC. [00116] 2.1. S. Typhi Induces Secretion of Pro-Inflammatory Cytokines by Activated/ Mature Neonatal DC

[00117] Supernatants from S. Typhi-infected neonatal BM-derived DC were evaluated for the presence of secreted pro-inflammatory cytokines IL-12p70, IL-10, TNF-α, ΪL-6, and MCP-I (FIG. 7B). When no stimulation was applied to neonatal and adult BM-derived DC, similar concentrations of IL- 12 (5 pg/ml) and IL-10 (53.1 pg/ml) were detected. Interestingly, adult DC secreted higher baseline levels of TNF-α, IL-6 and MCP-I (1074.8, 2655.3, and 2912 pg/ml, respectively). Following Salmonella infection, cultures of neonatal DC had increased levels of IL- 12, TNF-α, IL-6 and MCP-I. These levels of these cytokines rose from almost undetectable values before stimulation to the same concentrations produced by adult-derived DC after Salmonella infection (data not shown).

[00118] 2.J. Neonatal DC Stimulated with Salmonella Expressing Y. pestis Fl Efficiently Presents Fl Antigen to T Cells and Induces Fl -Specific T Cell Activation [00119] As previously seen with S. Typhi alone, the inventors confirmed that S. Typhi expressing 7. pestis Fl induces the same up-regulation of DC surface markers indicative of cell activation and maturation. A very interesting observation was that the degree of activation/maturation of DC treated with either Salmonella strain (that is, percentage of cells expressing activation/maturation cell surface markers) was higher (p <0.02) than the level of activation of DC stimulated with purified Fl (FIG. 8A). Notably, SaIFl -stimulated neonatal BM-derived DC exhibited a remarkably higher percentage (p <0.001) of double positive cells bearing DC maturation markers (CD86 and CD40 or CD80 and MHC II) compared with DC stimulated with Fl alone, confirming the unique ability of the live vector for stimulation of immature neonatal immune cells. To demonstrate the capacity of SaIFl -stimulated DC to present Fl as a foreign antigen and to initiate a cellular response, these cells were co-cultured with Fl -specific murine T lymphocytes (isolated from Fl -immunized mice). Cell proliferation was evaluated 6 days later by thymidine incorporation (FIG. 8B). DC treated with SaIFl induced a proliferative response of Fl -specific T cells that was significantly higher compared with that induced by DC stimulated with Fl (p <0.008). Cell proliferation increased with higher DC:T cell ratios, indicating that the T cell response observed was specific to Fl presented by vaccine-treated DC. In addition, T cells incubated with DC pre- treated with SaIFl had increased capacity to produce IFN-γ compared to T cells stimulated with Fl -pre treated DC (p O.001) (FIG. 8C). These results indicate that neonatal murine DC stimulated with live vector vaccines have enhanced capacity for antigen presentation and T cell stimulation compared with DC pre-treated with purified antigen. [00120] EXAMPLE 3

[00121] S. TYPHI EXPRESSING Fl AND LCRV IN ADULT MICE

[00122] It is contemplated that S. Typhi expressing both Fl and LcrV is useful as a biodefense vaccine. LcrV serum IgG responses are shown in FIG. 9. Adult mice were primed with 2 doses of S. Typhi(Fl/LcrV) and boosted on day 72 with 1 μg of LcrV and Fl plus alum. Control groups were primed with S. Typhi or PBS. IgG titers to LcrV after priming were modest, yet mice seroconverted prior to the boost. LcrV IgG titers increased significantly in all groups after the boost, yet responses rose faster and achieved higher levels in mice primed with S. Typhi(Fl/LcrV) live vectors. The priming effect can be clearly appreciated looking at the serum IgG levels measured on day 80 after immunization; while remarkable high LcrV titers were produced after LcrV boost in S. Typhi(LcrV)-primed mice, no responses were evident in the unprimed groups (PBS and S. Typhi alone), that responded after day 90, and with significantly lower titers. S. Typhi(Fl/LcrV) also primed Fl IgG responses that significantly increased after Fl boost. These data alone are not suggestive of use in a pediatric population, of use to increased T cell proliferation, or to increase a mucosal and/or systemic antibody response; such utility is realized in light of the data and unexpected results provided herein.

[00123] EXAMPLE 4

[00124] MUCOSAL PRIMING WITH S. TYPHI EXPRESSING B. ANTHRACIS

PROTECTIVE ANTIGEN (P A) FOLLOWED BY PARENTERAL BOOST WITH rP A IN NEONATAL MICE

[00125] The inventors showed that neonates primed (day 7 after birth) with S. Typhi expressing domain 4 (D4) of B. anthracis PA (PA-D4, abbreviated PA) or PA-D4 fused to adjuvant CTAlDD (abbreviated PA-CTAl) and boosted (day 21) with 2 μg of rPA/alum i.m. elicited high levels of PA-specific serum IgG. The inventors investigated the kinetics of serum. IgG antibody responses (FIG. 12) up to day 63 after birth and they observed that while PA titers elicited by S. Typhi (P A-CTA l)-priming followed by rPA-boost continued to rise steadily, the PA titers in response to 2 doses of rPA given i.m. had already reached a plateau on day 49. PA serum IgG produced by both groups reached similar levels by day 63. [00126] 4.A. PA-Specific IFN-v Responses

[00127] The IFN-γ responses to PA were also evaluated after prime and boost with & Typhi expressing PA and/or rPA in different combinations. The inventors demonstrated that newborn mice developed high frequency of IFN-γ spot forming cells (SFC) specific to rPA after mucosal priming (day 15 after birth) with S. Typhi(PA) or (PA-CTAl), while very low responses, if any, were induced by rPA given i.m. (FIG. 10). Mice primed with S. Typhi(PA) or (PA-CTAl) showed the highest levels of IFN-γ SFC after rPA boost (day 70 after birth), followed by those that received a second dose of the live vectors. Mice primed and boosted with rPA failed again to mount significant PA-specific IFN-γ responses (FIGS. 10 and 14). These results show that S. Typhi expressing B. anthracis PA was highly effective at inducing strong and long-lasting T cell responses following neonatal immunization, whereas rPA plus alum (as a subunit vaccine), albeit eliciting antibodies, failed to generate the much desired ThI- type immunity in neonates. [00128] 4.B. Induction of PA-Specific IgG B Memory Cells

[00129] Neonatal mice primed with S. Typhi(PA-CTAl) and boosted with rPA showed the highest frequency of BM-derived PA-specific IgG ASC (FIG. HA), which as indicated above are believed to represent a pool of memory B cells that will migrate to the spleen to serve as effector cells. The next best responders were mice neonatally primed with S. Typhi(PA), followed by those that only received rPA i.m. Lower ASC responses were seen in mice primed and boosted with S. Typhi(PA) or (PA-CTAl) (FIG. HA). An unexpected observation was the higher ASC responses in mice primed with Salmonella alone and boosted with rPA compared with those unprimed after rPA boost; this finding is in agreement with previous observations showing the immunoestimulatory properties of Salmonella alone to enhance antibody and T cell responses to a subsequent boost of Y. pestis Fl. The inventors also measured PA-specific memory B cells per total IgG memory cells in spleen cells (FIG. HB) using a 6-day in vitro stimulation with B cell mitogens. As observed with BM ASC, the highest percentage of PA-specific memory B cells was observed in mice primed with S. Typhi(PA-CTAl) and boosted with rPA. These results indicate that mucosal live vector prime followed by parenteral subunit vaccine boost is an effective immunization strategy to induce memory B cell responses following neonatal vaccination.

[00130] 4.C. Neonatal Priming with S. Typhi Expressing PA Enhances Antibody Responses to a Subsequent Dose of rPA Given Parenterally [00131] The inventors showed that neonatal mice primed on day 7 after birth with S. Typhi

CVD 908-htrA expressing domain 4 (D4) of B. anthracis PA (PA-D4. abbreviated PA) or PA-D4 fused to adjuvant CTAlDD (abbreviated PA-CTAl) and boosted on day 21 with 2 μg of rPA-alum i.m. elicited high levels of PA-specific serum IgG (FIG. 12A). A novel observation is that the presence of the adjuvant CTAlDD enhanced the responses to PA (expressed by the live vector) in neonatally immunized mice. Newborn mice primed with either S. Typhi strain expressing PA responded more vigorously to a booster dose of rPA- alum, compared with unprimed mice (PBS).

[00132] Examining the kinetics of PA responses, the inventors observed that while PA titers elicited by S. Typhi(PA-CTAl)-priming followed by rPA-boost showed a steady rise over time, the PA titers in response to two doses of rPA had already reached a plateau on day 49. By day 63, the PA serum IgG produced by both groups reached similar levels. [00133] Most importantly, antibodies elicited by S. Typhi expressing PA followed by rPA boost had the capacity to neutralize anthrax toxin in vitro (FIG. 12B). This is a critical observation since in a variety of model systems the effects of anthrax lethal toxin replicate the fatal pathophysiology of the disease (see, for example, Hashimoto, M., J.L. Boyer, N.R. Hackett, J.M. Wilson, and R.G. Crystal (2005), Induction of protective immunity to anthrax lethal toxin with a nonhuman primate adeno virus-based vaccine in the presence of preexisting anti-human adenovirus immunity, Infection and Immunity, 73:6885-6891) and antibodies to PA correlate with protection (see, for example, Leppla, S.H., J.B. Robbins, R. Schneerson, and J. Shiloach, (2002), Development of an improved vaccine for anthrax, Journal of Clinical Investigation 110: 141-144). Very low neutralization titers were elicited in the absence of priming with live vector expressing PA (newborn mice that received S. Typhi alone or PBS). [00134] The inventors performed similar prime-boost experiments but using S. Typhi strain Ty21a, the only licensed live attenuated typhoid vaccine as live vector expressing PA. Newborn mice were primed with Ty21a on day 7 after birth and boosted with rPA as described above. Anthrax toxin neutralization titers were measured on day 63 and 140 after birth in pooled serum samples from selected groups that received S. Typhi strains CVD 908- htrA or Ty21a expressing PA and/or rPA alone in different prime-boost combinations (FIG. 13). Mice primed as neonates with Ty2 Ia(PA) developed a PA-specific toxin neutralizing antibody level that surpassed the level achieved by SaI(PA-CTAlD), on day 63 after rPA boost. In both live vector-primed groups, TNA titers were significantly higher than those measured in unprimed mice (PBS), confirming that priming with S. Typhi enhances protective antibody responses to a single dose or rPA. The antibody responses induced by Ty21a expressing PA were maintained an over time (day 140 after birth). In contrast, antibody responses elicited by 5". Typhi CVD 908-htrA expressing PA reached a maximum on day 63 and appeared to decrease by day 140. An unexpected observation was that newborn mice primed with Ty21a alone responded to a booster dose of PA with levels of antibodies that were significantly higher than those of unprimed mice or mice primed with CVD 908- htrA, and these antibodies persisted, which may have implications for long-term protection. A similar non-specific adjuvant and immunostimulatory effect of the live vector over a subsequent dose of subunit antigen was observed in experiments with S. Typhi expressing Fl. [00135] 4.D. Further Evaluation of PA-Specific IFN-γ Responses

[00136] The inventors evaluated the IFN-γ responses to PA during the true neonatal period (day 15 after birth) and after the boost (day 70). Newborn mice displayed high frequency of IFN-γ SFC after priming with S. Typhi(PA) or S. Typhi(PA-CTAl), while very low responses, if any, were induced by rPA given i.m. (FIG. 14). Mice primed with S. Typhi(PA) or S. Typhi(P A-CTAl) and boosted with rPA showed the highest levels of IFN-γ SFC after the boost, followed by those that received a second dose of the live vectors. Mice primed and boosted with rPA failed again to mount significant PA-specific IFN-γ responses (FIG. 14). These results indicate that S. Typhi expressing B. anthracis PA was highly effective at inducing strong neonatal T cell responses that increased after the boost and were long-lasting, whereas rPA-alum given to neonates (as a subunit vaccine), albeit eliciting antibodies, failed to generate the much needed ThI type immunity in neonates. [00137] 4.E. Induction of PA-Specific IgG ASC and Memory B Cells in the BM [00138] Neonatal mice primed with S. Typhi(P A-CTAl) and boosted with rPA showed the highest frequency of BM-derived PA-specific IgG ASC (FIG. 15A), which as indicated above are believed to represent a pool of memory B cells that will migrate to the spleen to serve as effector cells. The next best responders were mice neonatally primed with S. Typhi(PA), followed by those that only received rPA i.m. Lower IgG ASC responses were seen in mice primed and boosted with S. Typhi(PA) or (PA-CTAl) (FIG. 15A). Mice primed with S. Typhi alone responded with higher IgG ASC levels than mice unprimed (that received PBS) after rPA boost, confirming the neonatally-imprinted adjuvant properties of the live vector alone. We also measured PA-specific memory B cells per total IgG memory cells in the spleen cells using a 6-day in vitro stimulation with B cell mitogens (FIG. 15B) [00139] EXAMPLE 5

[00140] S. TYPHI INDUCES MATURATION OF NEONATAL DC

[00141] Additional experiments were performed to evaluate the capacity of S. Typhi to induce maturation of neonatal DC. DC derived from BM of neonatal (7-day-old) mice were infected in vitro with attenuated vaccine strain S. Typhi CVD 908-htrA or mock-infected (control). The level of expression of cell surface markers was measured in CDl Ic⁺ gated cells (CDl Ic⁺ is the marker for murine DC) by multicolor flow cytometry (FIG. 16A). The upper panel shows histograms for isotype controls; the middle and lower panels show cell markers expression in adult and neonatal S. Typhi infected- or mock-infected DC (control). Neonatal CDlIc⁺ DC displayed an up-regulation of maturation markers CD80, CD86, CD40 and MHC class II molecules (IAd) upon S. Typhi infection. An increase in expression of activation/maturation markers was also observed in S. Typhi-infected BM-derived DC (CDl Ic⁺) from adult mice.

[00142] The inventors also measured cytokines secreted to the supernatants by infected and mock-infected neonatal and adult DC using BD Cytometric Bead Array (CBA) kit. Increase in neonatal and adult DC activation and maturation was accompanied by secretion of IL- 12 (hallmark of mature DC), TNF-α, IFN-γ, IL-6 and MCP-I (FIG. 16B). Therefore, the_j£ Typhi live vector vaccine of the present invention activates and induces maturation of neonatal DC, and/or cytokines that enhance antigen presentation and naϊve T-cell stimulation in neonates. These findings could explain the remarkable immune responses observed following neonatal vaccination with S. Typhi live vector vaccines that include high levels of mucosal and systemic antibodies (with high IgG2a -usually absent in neonates), avidity maturation, induction of memory B cells and strong ThI- type CMI (T cell proliferation and IFN-γ secretion) against the foreign antigens. [00143] EXAMPLE 6 [00144] S. TYPHI LIVE VECTOR VACCINE INDUCES NEONATAL CORD-BLOOD

DENDRITIC CELL (DC) ACTIVATION AND MATURATION

[00145] DC were derived from human umbilical cord blood (neonatal human DC) by incubation of purified mononuclear cells for 7 days in the presence of the cytokines GM-CSF (100 ng/ml) and IL-4 (10 ng/ml). Differentiated DC were infected in vitro with S. Typhi (30:1 m.o.i) or non-infected (mock-infected controls) as described herein. Infected and non- infected cells were stained with MAbs that recognize human DC cell surface molecules associated with cellular activation and maturation: MHC class II (HLA-DR), CD40, CD83, CDIa, CD80 and CD86. Cells were analyzed by multi-color flow cytometry. The first analysis was performed gating on the large granular cells region (upper right quadrant in the

SSC, FSC flow diagram). Infection of neonatal DC with S. Typhi led to a clear increase in the percentage of cells expressing HLA-DR, CD40, CD83 and CD86 molecules in as shown in FIG. 17, in comparison with non-infected cells.

[00146] The expression of cell surface/activation markers upon bacterial infection was also examined in the CDIa⁺ cord-blood DC population (CDIa⁺ is a marker associated with human DC). Increases in the percentage of CDIa⁺ cells expressing HLA-DR, CD40 and CD86 were observed upon S. Typhi infection. There was also an increase in the Mean Fluorescence Channel (indicative of density of cell surface molecules) for the expression of CD80 in CDIa⁺ cord-blood DC (FIG. 18).

[00147] Collectively, these data demonstrate for the first time that the attenuated Salmonella strains described herein induces activation and maturation of cord blood-derived human DC. Because DC activation and maturation is an essential requirement to generate potent immune responses to vaccine antigens in early life stages, the unexpected findings described herein have significant implications in the design of new vaccine strategies.

[00148] Each reference referred to within this disclosure is herein incorporated in its respective entirety.

[00149] Having now described a few embodiments of the invention, it should be apparent to those skilled in the art that the foregoing is merely illustrative and not limiting, having been presented by way of example only. Numerous modifications and other embodiments are within the scope of one of ordinary skill in the art and are contemplated as falling within the scope of the invention and any equivalent thereto. It can be appreciated that variations to the present invention would be readily apparent to those skilled in the art, and the present invention is intended to include those alternatives. Further, because numerous modifications will readily occur to those skilled in the art, it is not desired to limit the invention to the exact construction and operation illustrated and described, and accordingly, all suitable modifications and equivalents may be resorted to, falling within the scope of the invention.

Claims

CLAIMS WHAT IS CLAIMED IS:

1. A method of inducing an immune response to a foreign antigen in a mammal, comprising administering to a mammal in need of such immune response an effective amount of a live vector vaccine comprising a Salmonella strain comprising a mutation in a htrA gene, a mutation in at least one gene affecting one of i) aromatic acid biosynthesis or ii) guanine biosynthesis, and a recombinant foreign antigen operably linked to a promoter, wherein said live vector vaccine is administered using homologous or heterologous prime-boost.

2. The method of claim 1, wherein said mammal is selected from the group consisting of neonates and infants.

3. The method of claim 1, wherein a. said mutation in aromatic acid biosynthesis is selected from the group consisting of mutation in an aroC gene, mutation in an aroD gene, and mutation in an aroC and aroD gene, and b. said mutation in guanine biosynthesis is selected from the group consisting of mutation in a guaA gene, mutation in a guaB gene, and mutation in a guaA and guaB gene.

4. The method of claim 1, wherein said recombinant foreign antigen is derived from a pathogen selected from the group consisting of Variola major, Bacillus anthracis, Yersinia pestis, Clostridium botulinum, Francisella tularensis, Filoviruses and Arenaviruses, Coxiella burnetii, Brucella spp., Burkholderia mallei, Burkholderia pseudomallei, Alphaviruses, Rickettsia prowazekii, Ricin, Staphylococcal enterotoxin B, Chlamydia psittaci, Salmonella spp., Escherichia coli O157:H7, Vibrio cholerae, Cryptosporidium parvum, Nipah virus, Hantavirus, Venezuelan equine (VEE)₅ eastern equine (EEE), and western equine encephalomyelitis (WEE) viruses.

5. The method of claim 1, wherein said recombinant foreign antigen is selected from the group consisting of Fl recombinant protein, LcrV recombinant protein, and B. Anthracis protective antigen recombinant protein.

6. The method of claim 1, wherein said live vector vaccine further comprises a second foreign antigen that is immunogenic for the same or different pathogen as the first recombinant foreign antigen.

7. The method of claim 1, wherein said live vector vaccine further comprises a second recombinant foreign antigen that is immunogenic for the same pathogen as the first recombinant foreign antigen.

8. The method of claim 1, wherein said mammal is exposed to or at risk of exposure to a weaponized biological agent.

9. The method of claim 1, wherein said immune response is selected from the group consisting of cell-mediated immunity and humoral immunity.

10. The method of claim 1, wherein said immune response is T cell proliferation.

11. The method of claim 1 , wherein said immune response is a ThI response.

12. The method of claim 1, wherein said immune response is maturation of neonatal dendritic cells.

13. The method of claim 1, wherein said immune response is a mucosal and/or systemic antibody response.

14. A live vector vaccine comprising a Salmonella strain comprising a mutation in a htrA gene, a mutation in guanine biosynthesis, and a recombinant foreign antigen operably linked to a promoter.

15. The live vector vaccine of claim 14, wherein said mutation in guanine biosynthesis is selected from the group consisting of mutation in a guaA gene, mutation in a guaB gene, and mutation in a guaA and guaB gene.

16. The live vector vaccine of claim 14, wherein said recombinant foreign antigen is derived from a pathogen selected from the group consisting of Variola major, Bacillus anthracis, Yersinia pestis, Clostridium botulinum, Francisella tularensis, Filoviruses and Arenaviruses, Coxiella burnetii, Brucella spp., Burkholderia mallei, Burkholderia pseudomallei, Alphaviruses, Rickettsia prowazekii, Ricin, Staphylococcal enterotoxin B, Chlamydia psittaci, Salmonella spp., Escherichia coli O157:H7, Vibrio cholerae, Cryptosporidium parvum, Nipah virus, Hantavirus, Venezuelan equine (VEE), eastern equine (EEE), and western equine encephalomyelitis (WEE) viruses.

17. The live vector vaccine of claim 14, wherein said recombinant foreign antigen is selected from the group consisting of Fl recombinant protein, LcrV recombinant protein, and B. Anthracis protective antigen recombinant protein.

18. The live vector vaccine of claim 14, wherein said live vector vaccine further comprises a second foreign antigen that is immunogenic for the same or different pathogen as the first recombinant foreign antigen.

19. The live vector vaccine of claim 14, wherein said live vector vaccine further comprises a second recombinant foreign antigen that is immunogenic for the same pathogen as the first recombinant foreign antigen.

20. A composition comprising the live vector vaccine of claim 14 and a pharmaceutically acceptable carrier.