WO2007061759A1 - Delayed expression vectors - Google Patents

Abstract

The invention, in certain embodiments, relates to nucleic acid sequences comprising (a) a transcription unit encoding a chimeric protein composed of a composite DNA-binding domain and a transcription activation domain, (b) a transcription unit encoding an immune stimulator expressed under the control of a minimal promoter and an enhancer comprising one or more DNA binding site(s) for the composite DNA-binding domain, and (c) a transcription unit encoding an immunogen, wherein the composite DNA-binding domain comprises a continuous polypeptide chain containing two or more component polypeptide domains, at least two of which are mutually heterologous, and related expression constructs, methods of achieving delayed expression of immune stimulators, methods of inducing an immune response, and methods of immunization.

Description

DELAYED EXPRESSION VECTORS

Related Applications

This application claims the benefit of U.S. Provisional Application No. 60/737,896 filed November 18, 2005 which is hereby incorporated by reference in its entirety.

Field of the Invention The field of the invention is delayed expression vectors.

Description of the Related Art

DNA vaccines elicit both humoral and cell-mediated immunity, but the precise mechanisms and pathways that augment immunogenicity, characterized in part (Donnelly, J. J. et al. 1997 Annu Rev Immunol 15:617-648; Tighe, H. et al. 1998 Immunol Today 19:89-97), are not fully understood. Injected plasmid DNA is taken up either by nonimmune or antigen-presenting cells (APCs). The plasmids taken up by APCs express antigens, which are synthesized and processed by the proteasome and presented through the class I major histocompatibility (MHC) pathway (Gurunathan, S. et al. 2000 Annu Rev Immunol 18:927-974). APCs can also acquire antigens from neighboring cells when they are secreted or released by apoptosis. These processed proteins are presented largely through class II MHC. During this process, APCs are activated to induce cell signaling pathways that lead to the production of cytokines, chemokines and co-stimulatory molecules that activate antigen-specific CD4⁺ or CD8⁺ T cells and B cells (Gurunathan, S. et al. 2000 Annu Rev Immunol 18:927-974). Interestingly, the administration of such molecules after antigen delivery also appears to be important in eliciting optimal responses (Badovinac, V. P. et al. 2005 Nat Med 11:748-756; Barouch, D. H. et al. 1998 J Immunol 161:1875-1882; Kusakabe, K. et al. 2000 J Immunol 164:3102-3111; Sasaki, S. 2001 Nat Biotechnol 19:543-547; Seaman, M. S. et al. 2004 J Virol 78:206-215).

Segue to the Invention

We tested whether different signal transduction activators, including the TLR mediator myeloid differentiation primary response gene 88 (MyD88), tumor necrosis factor receptor-associated factor 6 (TRAF6), IKB kinase 2 (IKK2) and c-Jun N-terminal kinase 2 (JNK2) could alter immune responses induced by DNA vaccines using a dual expression vector that allows for delayed expression of co-stimulatory molecules. Summary of the Invention

The invention, in certain embodiments, relates to nucleic acid sequences comprising

(a) a transcription unit encoding a chimeric protein composed of a composite DNA-binding domain and a transcription activation domain, (b) a transcription unit encoding an immune stimulator expressed under the control of a minimal promoter and an enhancer comprising one or more DNA binding site(s) for the composite DNA-binding domain, and (c) a transcription unit encoding an immunogen, wherein the composite DNA-binding domain comprises a continuous polypeptide chain containing two or more component polypeptide domains, at least two of which are mutually heterologous, and related expression constructs, methods of achieving delayed expression of immune stimulators, methods of inducing an immune response, and methods of immunization.

Brief Description of the Drawings

Figure 1. Toll Like Receptor Signal Transduction Pathway.

Figure 2. Molecules involved in the interaction between T cells and antigen presenting cells.

Figure 3. Map and sequence for Delay-IKK2KA-mPGK-gpl45dCFIdV12 (SEQ ID NO: 1).

Figure 4. Model and schematic representation of the delayed expression vector. Figure 5. Antibody titer to HIV-I Env after DNA immunization with delayed IKK2, JNK2, MyD88 or TRAF6 vectors and characterization of the IKK2 and JNK2 phosphorylation mutants.

Figure 6. CD4+ and CD8+ T cell responses to HIV-I Env after DNA immunization with delayed IKK2 and JNK2 vectors.

Figure 7. Antibody titer to HIV-I Env after DNA immunization with delayed IKK2 and JNK2 vectors.

Figure 8. Schematic representation of delayed vector. Figure 9. Time-delayed expression of eGFP and IKK2.

Figure 10. Antibody titer against HIV-I Env after DNA immunization with Delayed IKK2, JNK2, MyD88, and TRAF6 vectors. Figure 11. Schematic representation of delayed and immediate vector.

Figure 12. The ribbon model of chimeric transcription factor recognition to the specific DNA binding domain. Figure 13. Antibody titer against HIV-I Env after DNA immunization with delayed IKK2, and JNK2 vectors.

Detailed Description of the Preferred Embodiment

Activation of multiple intracellular signaling cascades and the timing of their stimulation are important in defining the character of the adaptive immune response. This precise mechanism regulates the magnitude and duration of gene expression leading to the production of cytokines, chemokines and co-stimulatory molecules. To study the role and exact timing of expression of intracellular signaling molecules, a new plasmid vector, which expresses these molecules in a delayed fashion, was developed for an optimal immune response to DNA vaccines. Time delayed production of intracellular signaling molecules was achieved by regulating expression through specific enhancer elements that bound to a chimeric transcription factor. Dual expression vectors that expressed HIV-I envelope antigen from a constitutive promoter and intracellular signaling molecules,

MyD88, TRAF6, IKK2 and JNK2-in a time delayed fashion were constructed. Intracellular signaling molecule expression after accumulation of antigen enhanced both cell mediated and humoral responses. Delayed production of certain intracellular signaling molecules was particularly effective for production of HIV-I envelope specific antibodies. These data indicate that controlling the stimulation of immune stimulator signaling pathways can be used to improve immune response to DNA vaccines. Definitions

Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. See, e.g., Singleton P and Sainsbury D., in Dictionary of Microbiology and Molecular Biology 3rd ed., J. Wiley & Sons, Chichester, New York, 2001. The transitional term "comprising" is synonymous with "including," "containing," or "characterized by," is inclusive or open-ended and does not exclude additional, unrecited elements or method steps.

The transitional phrase "consisting of excludes any element, step, or ingredient not specified in the claim, but does not exclude additional components or steps that are unrelated to the invention such as impurities ordinarily associated therewith.

The transitional phrase "consisting essentially of limits the scope of a claim to the specified materials or steps and those that do not materially affect the basic and novel characteristic(s) of the claimed invention. The term "gene" broadly refers to any segment of DNA associated with a biological function. Genes include coding sequences and/or regulatory sequences required for their expression. Genes also include non-expressed DNA nucleic acid segments that, e.g., form recognition sequences for other proteins (e.g., promoter, enhancer, or other regulatory regions). Genes can be obtained from a variety of sources, including cloning from a source of interest or synthesizing from known or predicted sequence information, and may include sequences designed to have desired parameters.

A "promoter", as used herein, is a DNA regulatory region that is capable of binding RNA polymerase in a cell (or in vitro transcription system) and initiating transcription of a downstream (3' direction) coding sequence. Often, a promoter is associated with one or more "enhancers" which can provide further regulation of transcription. Enhancers can also be found upstream of the promoter, as well as downstream. A promoter is sometimes bounded at its 3' terminus by the transcription initiation site, but often the promoter/enhancer region includes additional sequences that affect transcription and are found downstream of the transcription initiation site. A promoter extends upstream (5' direction) from the transcription initiation site to include the minimum number of bases or elements necessary to initiate transcription at levels detectable above background. The entire promoter/enhancer region can extend farther upstream to include additional sequences that affect gene expression. Within the promoter/enhancer sequences will be found a transcription initiation site (conveniently defined for example, by mapping with nuclease Sl), as well as protein binding domains (consensus sequences) responsible for the binding of RNA polymerase, transcription factors, and other molecules that are involved in transcription. Eukaryotic class II promoters will often, but not always, contain "TATA" boxes and "CAAT" boxes. The human cytomegalovirus (hCMV) immediate early promoter/enhancer (the "CMV promoter," as used herein), for example, also includes, for example, repeat elements of 19, 18 and 21 base pairs (bp) that include binding sites for CREB/ATF, NF-KB. B/rel, SP-I and YY-I binding sites, respectively.

The terms "open reading frame" and "ORF" refer to a sequence of codons, starting with an initiator codon and ending with a stop codon, which potentially encodes a polypeptide.

"Nucleic acid derived from a gene" refers to a nucleic acid for whose synthesis the gene, or a subsequence thereof, has ultimately served as a template. Thus, an mRNA, a cDNA reverse transcribed from an MRNA, an RNA transcribed from that cDNA, a DNA amplified from the cDNA, an RNA transcribed from the amplified DNA, etc., are all derived from the gene and detection of such derived products is indicative of the presence and/or abundance of the original gene and/or gene transcript in a sample.

The term "nucleic acid" refers to deoxyribonucleotides or ribonucleotides and polymers thereof in either single- or double-stranded form. Unless specifically limited, the term encompasses nucleic acids containing known analogues of natural nucleotides which have similar function and are metabolized in a manner similar to naturally occurring nucleotides. The term "nucleic acid" is used interchangeably with the term "polynucleotide" and encompasses genes, cDNA, and MRNA encoded by a gene. The term "polynucleotide sequence" is a nucleic acid which comprises a polymer of nucleic acid residues or nucleotides (A,C,T,U,G, etc. or naturally occurring or artificial nucleotide analogues), or a character string representing a nucleic acid, depending on context. Either the given nucleic acid or the complementary nucleic acid can be determined from any specified polynucleotide sequence. A nucleic acid, protein, peptide, polypeptide, or other component is "isolated" when it is partially or completely separated from components with which it is normally associated (other peptides, polypeptides, proteins (including complexes, e.g., polymerases and ribosomes which may accompany a native sequence), nucleic acids, cells, synthetic reagents, cellular contaminants, cellular components, etc.), e.g., such as from other components with which it is normally associated in the cell from which it was originally derived. A nucleic acid, polypeptide, or other component is isolated when it is partially or completely recovered or separated from other components of its natural environment such that it is the predominant species present in a composition, mixture, or collection of components {i.e., on a molar basis it is more abundant than any other individual species in the composition). In preferred embodiments, the preparation consists of more than about 70% or 75%, typically more than about 80%, or preferably more than about 90% of the isolated species.

In one aspect, a "substantially pure" or "isolated" nucleic acid (e.g., RNA or DNA), polypeptide, protein, or composition also means where the object species {e.g., nucleic acid or polypeptide) comprises at least about 50, 60, or 70 percent by weight (on a molar basis) of all macromolecular species present. A substantially pure or isolated composition can also comprise at least about 80, 90, or 95 percent by weight of all macromolecular species present in the composition. An isolated object species can also be purified to essential homogeneity (contaminant species cannot be detected in the composition by conventional detection methods) wherein the composition consists essentially of derivatives of a single macromolecular species. The term "purified" generally denotes that a nucleic acid, polypeptide, or protein gives rise to essentially one band in an electrophoretic gel. It typically means that the nucleic acid, polypeptide, or protein is at least about 50% pure, 60% pure, 70% pure, 75% pure, more preferably at least about 85% pure, and most preferably at least about 99% pure.

The term "isolated nucleic acid" may refer to a nucleic acid (e.g., DNA or RNA) that is not immediately contiguous with both of the sequences with which it is immediately contiguous (i.e., one at the 5' and one at the 3' end) in the naturally occurring genome of the organism from which the nucleic acid of the invention is derived. Thus, this term includes, e.g., a cDNA or a genomic DNA fragment produced by polymerase chain reaction (PCR) or restriction endonuclease treatment, whether such cDNA or genomic DNA fragment is incorporated into a vector, integrated into the genome of the same or a different species than the organism, including, e.g., a virus, from which it was originally derived, linked to an additional coding sequence to form a hybrid gene encoding a chimeric polypeptide, or independent of any other DNA sequences. The DNA may be double-stranded or single- stranded, sense or antisense.

The term "recombinant" when used with reference, e.g., to a cell, vector, nucleic acid, or polypeptide typically indicates that the cell, vector, nucleic acid or polypeptide has been modified by the introduction of a heterologous (or foreign) nucleic acid or the alteration of a native nucleic acid, or that the polypeptide has been modified by the introduction of a heterologous amino acid, or that the cell is derived from a cell so modified. Recombinant cells express nucleic acid sequences (e.g., genes) that are not found in the native (non-recombinant) form of the cell or express native nucleic acid sequences (e.g., genes) that would be abnormally expressed, under-expressed, or not expressed at all. The term "recombinant" when used with reference to a cell indicates that the cell replicates a heterologous nucleic acid, or expresses a peptide or protein encoded by a heterologous nucleic acid. Recombinant cells can contain genes that are not found within the native (non-recombinant) form of the cell. Recombinant cells can also contain genes found in the native form of the cell wherein the genes are modified and re-introduced into the cell by artificial means. The term also encompasses cells that contain a nucleic acid endogenous to the cell that has been modified without removing the nucleic acid from the cell; such modifications include those obtained by gene replacement, site-specific mutation, and related techniques.

The terms "recombinant polynucleotide" or a "recombinant polypeptide" encompass a non-naturally occurring polynucleotide or polypeptide that includes nucleic acid or amino acid sequences, respectively, from more than one source nucleic acid or polypeptide, which source nucleic acid or polypeptide can be a naturally occurring nucleic acid or polypeptide, or can itself have been subjected to mutagenesis or other type of modification. A nucleic acid or polypeptide may be deemed "recombinant" when it is artificial or engineered, or derived from an artificial or engineered polypeptide or nucleic acid. A recombinant nucleic acid (e.g., DNA or RNA) can be made by the combination {e.g., artificial combination) of at least two segments of sequence that are not typically included together, not typically associated with one another, or are otherwise typically separated from one another. A recombinant nucleic acid can comprise a nucleic acid molecule formed by the joining together or combination of nucleic acid segments from different sources and/or artificially synthesized. A "recombinant polypeptide" (or "recombinant protein") often refers to a polypeptide (or protein) that results from a cloned or recombinant nucleic acid or gene. The source polynucleotides or polypeptides from which the different nucleic acid or amino acid sequences are derived are sometimes homologous (i.e., have, or encode a polypeptide that encodes, the same or a similar structure and/or function), and are often from different isolates, serotypes, strains, species, of organism or from different disease states, for example.

The term "recombinantly produced" refers to an artificial combination usually accomplished by either chemical synthesis means, recursive sequence recombination of nucleic acid segments or other diversity generation methods (such as, e.g., shuffling) of nucleotides, or manipulation of isolated segments of nucleic acids, e.g., by genetic engineering techniques known to those of ordinary skill in the art. "Recombinantly expressed" typically refers to techniques for the production of a recombinant nucleic acid in vitro and transfer of the recombinant nucleic acid into cells in vivo, in vitro, or ex vivo where it may be expressed or propagated. "Naturally occurring" as applied to an object refers to the fact that the object can be found in nature as distinct from being artificially produced by man. For example, a polypeptide or polynucleotide sequence that is present in an organism (including viruses, bacteria, protozoa, insects, plants or mammalian tissue) that can be isolated from a source in nature and that has not been intentionally modified by man in the laboratory is naturally occurring. A "non-naturally occurring" object is one that is not found in nature or is found in nature in a different form.

A nucleic acid is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence. For instance, a promoter or enhancer is operably linked to a coding sequence if it directs or increases the transcription of the coding sequence. A nucleic acid is said to "promote the expression" of an operably linked coding sequence if the nucleic acid acts as a promoter (i.e., direct transcription) or as an enhancer (i.e., increases transcription). "Operably linked" means that the DNA sequences being linked are typically contiguous and, where necessary to join two protein coding regions, contiguous and in reading frame. However, since enhancers generally function when separated from the promoter by several kilobases and intronic sequences may be of variable lengths, some polynucleotide elements may be operably linked but not contiguous.

A "transcription unit" is a nucleic acid construct, generated recombinantly or synthetically, with operably linked nucleic acid elements that are capable of effecting expression of a structural gene in hosts compatible with such sequences. Transcription units include at least a promoter and optionally, a transcription termination signal. Typically, the transcription unit includes a nucleic acid to be transcribed (e.g., a nucleic acid encoding a desired polypeptide), which is termed a "transgene," and a promoter. Additional factors necessary or helpful in effecting expression may also be used as described herein. For example, a transcription unit can also include nucleotide sequences that encode a signal sequence that directs secretion of an expressed protein from the host cell. Enhancers, and other nucleic acid sequences that influence gene expression, can also be included in a transcription unit. An "exogenous" nucleic acid," "exogenous DNA segment," "heterologous sequence," or "heterologous nucleic acid," as used herein, is one that originates from a source foreign to the particular host cell, or, if from the same source, is modified from its original form. Thus, a heterologous gene in a host cell includes a gene that is endogenous to the particular host cell, but has been modified. The terms refer to a DNA segment which is foreign or heterologous to the cell, or homologous to the cell but in a position within the host cell nucleic acid in which the element is not ordinarily found. Exogenous DNA segments are expressed to yield exogenous polypeptides. A vector is a component or composition for facilitating cell transduction, transfection, or infection by a selected nucleic acid, or expression of the nucleic acid in the cell. Vectors include, e.g., plasmids, cosmids, viruses, YACs, bacteria, etc. An "expression vector" is a nucleic acid construct or sequence, generated recombinantly or synthetically, with a series of specific nucleic acid elements that permit transcription of a particular nucleic acid in a host cell. The expression vector can be part of a plasmid, virus, or nucleic acid fragment. The expression vector typically includes a nucleic acid to be transcribed (i.e., a transgene) operably linked to a promoter. The nucleic acid to be transcribed is typically under the direction or control of the promoter. The term "subject" as used herein includes, but is not limited to, an organism, such as a mammal, including, e.g., a human, non-human primate (e.g., baboon, orangutan, monkey), mouse, pig, cow, goat, cat, rabbit, rat, guinea pig, hamster, horse, monkey, sheep, or other non-human mammal; a non-mammal, including, e.g., a non-mammalian vertebrate, such as a bird (e.g., a chicken or duck) or a fish, and a non-mammalian invertebrate. The term "pharmaceutical composition" means a composition suitable for pharmaceutical use in a subject, including an animal or human. A pharmaceutical composition generally comprises an effective amount of an active agent and a carrier, including, e.g., a pharmaceutically acceptable carrier.

The term "effective amount" means a dosage or amount sufficient to produce a desired result. The desired result may comprise an objective or subjective improvement in the subject receiving the dosage or amount.

A "prophylactic treatment" is a treatment administered to a subject who does not display signs or symptoms of a disease, pathology, or medical disorder, or displays only early signs or symptoms of a disease, pathology, or disorder, such that treatment is administered for the purpose of diminishing, preventing, or decreasing the risk of developing the disease, pathology, or medical disorder. A prophylactic treatment functions as a preventative treatment against a disease or disorder. A "prophylactic activity" is an activity of an agent, such as a nucleic acid, vector, gene, polypeptide, protein, substance, or composition thereof that, when administered to a subject who does not display signs or symptoms of a pathology, disease or disorder, or who displays only early signs or symptoms of a pathology, disease, or disorder, diminishes, prevents, or decreases the risk of the subject developing the pathology, disease, or disorder. This effect is termed a "prophylactic effect. "A "prophylactically useful" agent or compound (e.g., nucleic acid or polypeptide) refers to an agent or compound that is useful in diminishing, preventing, treating, or decreasing development of a pathology, disease or disorder.

A "therapeutic treatment" is a treatment administered to a subject who displays symptoms or signs of a pathology, disease, or disorder, in which treatment is administered to the subject for the purpose of diminishing or eliminating those signs or symptoms of the pathology, disease, or disorder. A "therapeutic activity" is an activity of an agent, such as a nucleic acid, vector, gene, polypeptide, protein, substance, or composition thereof that eliminates or diminishes signs or symptoms of a pathology, disease or disorder, when administered to a subject suffering from such signs or symptoms. This effect is termed a "therapeutic effect." A "therapeutically useful" agent or compound {e.g., nucleic acid or polypeptide) indicates that an agent or compound is useful in diminishing, treating, or eliminating such signs or symptoms of a pathology, disease or disorder.

An "immunogen" refers to a substance capable of provoking an immune response, and includes, e.g., antigens, autoantigens that play a role in induction of autoimmune diseases, and tumor-associated antigens expressed on cancer cells. An immune response of any type to an immunogen is termed an "immunogenic effect."

An "adjuvant" refers to a substance that enhances an antigen's immune-stimulating properties or the pharmacological effect of a drug. For example, "Freund's Complete Adjuvant" is an emulsion of oil and water containing an immunogen, an emulsifying agent and mycobacteria. Another example, "Freund's incomplete adjuvant," is the same but without mycobacteria. Chimeric Proteins

One aspect of the invention pertains to the design, production and use of chimeric proteins containing a composite DNA-binding region, e.g., to obtain delayed expression of a target gene linked to a nucleotide sequence recognized (i.e., specifically bound) by the chimeric DNA-binding protein. The composite DNA-binding region is a continuous polypeptide chain spanning at least two heterologous polypeptide portions representing component DNA-binding domains. The component polypeptide domains comprise polypeptide sequences derived from at least two different proteins, polypeptide sequences from at least two non-adjacent portions of the same protein, or polypeptide sequences which are not found so linked in nature.

The component polypeptide domains may comprise naturally-occurring or non- naturally occurring peptide sequence. The chimeric protein may include more than two DNA-binding domains. It may also include one or more linker regions comprising one or more amino acid residues, or include no linker, as appropriate, to join the selected domains. The nucleic acid sequence recognized by the chimeric DNA-binding protein may include all or a portion of the sequences bound by the component polypeptide domains. However, the chimeric protein displays a binding specificity that is distinct from the binding specificity of its individual polypeptide components.

The invention further involves DNA sequences encoding such chimeric proteins, the recombinant DNA sequences to which the chimeric proteins bind (i.e., which are recognized by the composite DNA-binding region), constructs containing a target gene and a DNA sequence which is recognized by the chimeric DNA-binding protein, and the use of these materials in applications which depend upon specific recognition of a nucleotide sequence. Such composite proteins and DNA sequences which encode them are recombinant in the sense that they contain at least two constituent portions which are not otherwise found directly linked (covalently) together in nature, at least not in the order, orientation or arrangement present in the recombinant material. Desirable properties of these proteins include high affinity for specific nucleotide sequences, low affinity for most other sequences in a complex genome (such as a mammalian genome), low dissociation rates from specific DNA sites, and novel DNA recognition specificities distinct from those of known natural DNA-binding proteins. A basic principle of the design is the assembly of multiple DNA-binding domains into a single protein molecule that recognizes a long (spanning at least 10 bases, preferably at least 11 or more bases) and complex DNA sequence with high affinity presumably through the combined interactions of the individual domains. A further benefit of this design is the potential avidity derived from multiple independent protein-DNA interactions. The practice of this invention generally involves expression of a DNA construct encoding and capable of directing the expression in a cell of the chimeric protein containing the composite DNA-binding region and one or more optional, additional domains, as described below. Some embodiments also make use of an ORF containing a target gene and one or more copies of a DNA sequence to which the chimeric DNA-binding protein is capable of binding, preferably with high affinity and/or specificity. Some embodiments further involve one or more DNA constructs encoding and directing the expression of additional proteins capable of modulating the activity of the DNA-binding protein, e.g., in the case of chimeras containing ligand-binding domains which complex with one another in the presence of a dimerizing ligand.

In one aspect of the invention, the chimeric proteins are transcription factors which may contain one or more regulatory domains in addition to the composite DNA-binding region. The term "transcription factor" is intended to encompass any protein that regulates gene transcription, and includes regulators that have a positive or a negative effect on transcription initiation or progression. Transcription factors may optionally contain one or more regulatory domains. The term "regulatory domain" is defined as any domain which regulates transcription, and includes both activation domains and repression domains. The term "activation domain" denotes a domain in a transcription factor which positively regulates (turns on or increases) the rate of gene transcription. The term "repression domain" denotes a domain in a transcription factor which negatively regulates (turns off, inhibits or decreases) the rate of gene transcription. The nucleic acid sequence bound by a transcription factor is typically DNA outside the coding region, such as within a promoter or regulatory element region. However, sufficiently tight binding to nucleotides at other locations, e.g., within the coding sequence, can also be used to regulate gene expression.

Preferably the chimeric DNA binding protein binds to a corresponding DNA sequence selectively, i.e., observably binds to that DNA sequence despite the presence of numerous alternative candidate DNA sequences. Preferably, binding of the chimeric DNA binding protein to the selected DNA sequence is at least two, more preferably three and even more preferably more than four orders of magnitude greater than binding to any one alternative DNA sequence, as may be measured by relative Kd values or by relative rates or levels of transcription of genes associated with the selected and any alternative DNA sequences. It is also preferred that the selected DNA sequence be recognized to a substantially greater degree by the chimeric protein containing the composite DNA-binding region than by a protein containing only some of the individual polypeptide components thereof. Thus, for example, target gene expression is preferably two, more preferably three, and even more preferably more than four orders of magnitude greater in the presence of a chimeric transcription factor containing a composite DNA-binding region than in the presence of a protein containing only some of the components of that composite DNA- binding region. Composite DNA-bmding Regions

Each composite DNA-binding region consists of a continuous polypeptide region containing two or more component heterologous polypeptide portions which are individually capable of recognizing {i.e., binding to) specific nucleotide sequences. The individual component portions may be separated by a linker comprising one or more amino acid residues intended to permit the simultaneous contact of each component polypeptide portion with the DNA target. The combined action of the composite DNA-binding region formed by the component DNA-binding modules is thought to result in the addition of the free energy decrement of each set of interactions. The effect is to achieve a DNA-protein interaction of very high affinity, preferably with dissociation constant below 10^~9 M, more preferably below 10^"10 M, even more preferably below 10^"11 M. This goal is often best achieved by combining component polypeptide regions that bind DNA poorly on their own, that is, with low affinity, insufficient for functional recognition of DNA under typical conditions in a mammalian cell. Because the hybrid protein exhibits affinity for the composite site several orders of magnitude higher than the affinities of the individual sub- domains for their subsites, the protein preferentially (preferably exclusively) occupies the "composite" site which typically comprises a nucleotide sequence spanning the individual DNA sequence recognized by the individual component polypeptide portions of the composite DNA-binding region. Suitable component DNA-binding polypeptides for incorporation into a composite region have one or more, preferably more, of the following properties. They bind DNA as monomers, although dimers can be accommodated. They should have modest affinities for DNA, with dissociation constants preferably in the range of 10^"6 to 10^"9 M. They should optimally belong to a class of DNA-binding domains whose structure and interaction with DNA are well understood and therefore amenable to manipulation.

A structure-based strategy of fusing known DNA-binding modules has been used to design transcription factors with novel DNA-binding specificities. In order to visualize how certain DNA-binding domains might be fused to other DNA-binding domains, computer modeling studies have been used to superimpose and align various protein-DNA complexes. Alternatively, non- computer modeling may also be used.

Two criteria suggest which alignments of DNA-binding domains have potential for combination into a composite DNA-binding region (1) lack of collision between domains, and (2) consistent positioning of the carboxyl- and amino-terminal regions of the domains, i.e., the domains must be oriented such that the carboxyl-terminal region of one polypeptide can be joined to the amino-terminal region of the next polypeptide, either directly or by a linker (indirectly). When detailed structural information about the protein-DNA complexes is not available, it may be necessary to experiment with various endpoints, and more biochemical work may be necessary to characterize the DNA-binding properties of the chimeric proteins. This optimization can be performed using known techniques. Virtually any domains satisfying the above-described criteria are candidates for inclusion in the chimeric transcription factor. Component DNA-binding domains DNA-binding domains with appropriate DNA binding properties may be selected from several different types of natural DNA-binding proteins. One class comprises proteins that normally bind DNA only in conjunction with auxiliary DNA-binding proteins, usually in a cooperative fashion, where both proteins contact DNA and each protein contacts the other. Examples of this class include the homeodomain proteins, many of which bind DNA with low affinity and poor specificity, but act with high levels of specificity in vivo due to interactions with partner DNA-binding proteins. One well-characterized example is the yeast alpha2 protein, which binds DNA only in cooperation with another yeast protein Mcml. Another example is the human homeodomain protein Phoxl, which interacts cooperatively with the human transcription factor, serum response factor (SRF). The homeodomain is a highly conserved DNA-binding domain which has been found in hundreds of transcription factors. The regulatory function of a homeodomain protein derives from the specificity of its interactions with DNA and presumably with components of the basic transcriptional machinery, such as RNA polymerase or accessory transcription factors. A typical homeodomain comprises an approximately 61 -amino acid residue polypeptide chain, folded into three alpha helices, that binds to DNA.

A second class comprises proteins in which the DNA-binding domain is comprised of multiple reiterated modules that cooperate to achieve high-affinity binding of DNA. An example is the C2H2 class of zinc-finger proteins, which typically contain a tandem array of from two or three to dozens of zinc-finger modules. Each module contains an alpha- helix capable of contacting a three base-pair stretch of DNA. Typically, at least three zinc- fingers are required for high-affinity DNA binding. Therefore, one or two zinc-fingers constitute a low affinity DNA-binding domain with suitable properties for use as a component in this invention. Examples of proteins of the C2H2 class include TFIIIA, Zif268, GIi, and SRE-ZBP. (These and other proteins and DNA sequences referred to herein are well known in the art. Their sources and sequences are known.) The zinc finger motif, of the type first discovered in transcription factor IIIA, offers an attractive framework for studies of transcription factors with novel DNA-binding specificities. The zinc finger is one of the most common eukaryotic DNA- binding motifs, and this family of proteins can recognize a diverse set of DNA sequences. Crystallographic studies of the Zif268-DNA complex and other zinc finger-DNA complexes show that residues at four positions within each finger make most of the base contacts, and there has been some discussion about rules that may explain zinc finger-DNA recognition. However, studies have also shown that zinc fingers can dock against DNA in a variety of ways.

A third general class comprises proteins that themselves contain multiple independent DNA-binding domains. Often, any one of these domains is insufficient to mediate high-affinity DNA recognition, and cooperation with a covalently linked partner domain is required. Examples include the POU class, such as Oct-1, Oct-2 and Pit- 1 , which contain both a homeodomain and a POU-specific domain; HNFl , which is organized similarly to the POU proteins; certain Pax proteins (examples: Pax-3, Pax-6), which contain both a homeodomain and a paired box/domain; and proteins that contain a homeodomain and multiple zinc-fingers of the C2H2 class.

From a structural perspective, DNA-binding proteins containing domains suitable for use as polypeptide components of a composite DNA-binding region may be classified as DNA-binding proteins with a helix-turn-helix structural design, including, but not limited to, MAT αl, MAT α2, Antennapedia, Ultrabithorax, Engrailed, Paired, Fushi tarazu, HOX, Unc86, and the previously noted Octl, Oct2 and Pitl; zinc finger proteins, such as Zif268, SWI5, Kriippel and Hunchback; steroid receptors; DNA-binding proteins with the helix- loop-helix structural design, such as Daughterless, Achaete-scute (T3), MyoD, El 2 and E47; and other helical motifs like the leucine-zipper, which includes GCN4, C/EBP, c- Fos/c-Jun and JunB. The amino acid sequences of the component DNA-binding domains may be naturally-occurring or non-naturally occurring (or modified).

The choice of component DNA-binding domains may be influenced by a number of considerations, including the species, system and cell type which is targeted; the feasibility of incorporation into a chimeric protein, as may be shown by modeling; and the desired application or utility. The choice of DNA-binding domains may also be influenced by the individual DNA sequence specificity of the domain and the ability of the domain to interact with other proteins or to be influenced by a particular cellular regulatory pathway. Preferably, the distance between domain termini is relatively short to facilitate use of the shortest possible linker or no linker. The DNA-binding domains can be isolated from a naturally-occurring protein, or may be a synthetic molecule based in whole or in part on a naturally-occurring domain.

An additional strategy for obtaining component DNA-binding domains with properties suitable for this invention is to modify an existing DNA- binding domain to reduce its affinity for DNA into the appropriate range. For example, a homeodomain such as that derived from the human transcription factor Phoxl, may be modified by substitution of the glutamine residue at position 50 of the homeodomain. Substitutions at this position remove or change an important point of contact between the protein and one or two base pairs of the 6-bp DNA sequence recognized by the protein. Thus, such substitutions reduce the free energy of binding and the affinity of the interaction with this sequence and may or may not simultaneously increase the affinity for other sequences. Such a reduction in affinity is sufficient to effectively eliminate occupancy of the natural target site by this protein when produced at typical levels in mammalian cells. But it would allow this domain to contribute binding energy to and therefore cooperate with a second linked DNA- binding domain. Other domains that are amenable to this type of manipulation include the paired box, the zinc-finger class represented by steroid hormone receptors, the myb domain, and the ets domain.

Linker sequence for covalently linked composite DNA-Binding Domains

The continuous polypeptide span of the composite DNA-binding domain may contain the component polypeptide modules linked directly end-to-end or linked indirectly via an intervening amino acid or peptide linker. A linker moiety may be designed or selected empirically to permit the independent interaction of each component DNA-binding domain with DNA without steric interference. A linker may also be selected or designed so as to impose specific spacing and orientation on the DNA-binding domains. The linker amino acids may be derived from endogenous flanking peptide sequence of the component domains or may comprise one or more heterologous amino acids. Linkers may be designed by modeling or identified by experimental trial.

The linker maybe any amino acid sequence that results in linkage of the component domains such that they retain the ability to bind their respective nucleotide sequences. In some embodiments it is preferable that the design involve an arrangement of domains which requires the linker to span a relatively short distance, preferably less than about 10 A. However, in certain embodiments, depending upon the selected DNA-binding domains and the configuration, the linker may span a distance of up to about 50 A. For instance, the ZFHDl protein contains a glycine-glycine-arginine-arginine linker which joins the carboxyl -terminal region of zinc finger 2 to the amino- terminal region of the Oct-1 homeodomain.

Within the linker, the amino acid sequence may be varied based on the preferred characteristics of the linker as determined empirically or as revealed by modeling. For instance, in addition to a desired length, modeling studies may show that side groups of certain nucleotides or amino acids may interfere with binding of the protein. The primary criterion is that the linker joins the DNA-binding domains in such a manner that they retain their ability to bind their respective DNA sequences, and thus a linker that interferes with this ability is undesirable. A desirable linker should also be able to constrain the relative three-dimensional positioning of the domains so that only certain composite sites are recognized by the chimeric protein. Other considerations in choosing the linker include flexibility of the linker, charge of the linker and selected binding domains, and presence of some amino acids of the linker in the naturally-occurring domains. The linker can also be designed such that residues in the linker contact DNA, thereby influencing binding affinity or specificity, or to interact with other proteins. For example, a linker may contain an amino acid sequence which can be recognized by a protease so that the activity of the chimeric protein could be regulated by cleavage. In some cases, particularly when it is necessary to span a longer distance between the two DNA-binding domains or when the domains must be held in a particular configuration, the linker may optionally contain an additional folded domain. Additional Domains

Additional domains may be included in the various chimeric proteins of this invention, e.g., A nuclear localization sequence, a transcription regulatory domain, a ligand binding domain, a protein- binding domain, etc.

For example, in some embodiments the chimeric proteins will contain a cellular targeting sequence which provides for the protein to be translocated to the nucleus. Typically a nuclear localization sequence has a plurality of basic amino acids, referred to as a bipartite basic repeat. This sequence can appear in any portion of the molecule internal or proximal to the N- or C-terminus and results in the chimeric protein being localized inside the nucleus.

The chimeric proteins may include domains that facilitate their purification, e.g., "histidine tags" or a glutathione-S-transferase domain. They may include "epitope tags" encoding peptides recognized by known monoclonal antibodies for the detection of proteins within cells or the capture of proteins by antibodies in vitro.

The chimeric protein may also include one or more transcriptional activation domains, such as the well-characterized domain from the viral protein VP 16 or novel activation domains of different designs. For instance, one may use one or multiple copies of transcriptional activating motifs from human proteins, including e.g., the 18 amino acid (NFLQLPQQTQGALLTSQP) (SEQ ID NO: 2) glutamine rich region of Oct-2, the N- terminal 72 amino acids of p53, the SYGQQS (SEQ ID NO: 3) repeat in Ewing sarcoma gene or an 11 amino acid (535-545) acidic rich region of ReI A protein. Chimeric transcription factors that contain both a composite DNA-binding domain and a transcriptional activating domain thus comprise composite transcription factors capable of actuating transcription of a target gene linked to a DNA sequence recognized by the chimeric protein. The chimeric proteins may include regulatory domains that place the function of the DNA-binding domain under the control of an external ligand; one example would be the ligand-binding domain of steroid receptors. The chimeric proteins may also include a ligand-binding domain to provide for regulatable interaction of the protein with a second polypeptide chain. In such cases, the presence of a ligand-binding domain permits association of the chimeric DNA-binding protein, in the presence of a dimerizing ligand, with a second chimeric protein containing a transcriptional regulatory domain (activator or repressor) and another ligand-binding domain. Upon dimerization of the chimeras a composite DNA-binding protein complex is formed which further contains the transcriptional regulatory domain and any other optional domains.

Multimerizing ligands useful in practicing this invention are multivalent, i.e., capable of binding to, and thus multimerizing, two or more of the chimeric protein molecules. The multimerizing ligand may bind to the chimeras containing such ligand- binding domains, in either order or simultaneously, preferably with a Kd value below about 10^" , more preferably below about 10^" , even more preferably below about 10^" , and in some embodiments below about 10^"9 M. The ligand preferably is not a protein or polypeptide and has a molecular weight of less than about 5 kDa, preferably below 2 kDa. The ligand- binding domains of the chimeric proteins so multimerized may be the same or different. Ligand binding domains include among others, various immunophilin domains. One example is the FKBP domain which is capable of binding to dimerizing ligands incorporating FK506 moieties or other FKBP-binding moieties.

Illustrating the class of chimeric proteins of this invention that contain a composite DNA-binding domain comprising at least one homeodomain and at least one zinc finger domain are a set of chimeric proteins in which the composite DNA-binding region comprises an Oct-1 homeodomain and zinc fingers 1 and 2 of Zif268, referred to herein as "ZFHDl ". Proteins comprising the ZFHDl composite DNA-binding region have been produced and shown to bind a composite DNA sequence (TAATGATGGGCG, SEQ ID NO: 4) which includes the nucleic acid sequences bound by the relevant portion of the two component DNA-binding proteins.

Illustrating the class of chimeric DNA-binding proteins of this invention which further contain at least one transcription activation domain are chimeric proteins containing the ZFHDl composite DNA-binding region and the Herpes Simplex Virus VP 16 activation domain, which has been produced and shown to activate transcription selectively in vivo of a gene (the luciferase gene) linked to an iterated ZFHDl binding site. Another chimeric protein containing ZFHDl and a NF-κB p65 activation domain has also been produced and shown to activate transcription in vivo of a gene linked to iterated ZFHDl binding sites.

Transcription factors can be tested for activity in vivo using a simple assay (F.M. Ausubel et al., Eds., Current Protocols in Molecular Biology , John Wiley & Sons, New York, 1994). The in vivo assay requires a plasmid containing and capable of directing the expression of a recombinant DNA sequence encoding the transcription factor. The assay also requires a plasmid containing a reporter gene, e.g., the enhanced green fluorescent protein (eGFP), the luciferase gene, the chloramphenicol acetyl transferase (CAT) gene, secreted alkaline phosphatase or the human growth hormone (hGH) gene, linked to a binding site for the transcription factor. The two plasmids are introduced into host cells which normally do not produce interfering levels of the reporter gene product. A second group of cells, which also lack both the gene encoding the transcription factor and the reporter gene, serves as the control group and receives a plasmid containing the gene encoding the transcription factor and a plasmid containing the test gene without the binding site for the transcription factor. The production of mRNA or protein encoded by the reporter gene is measured. An increase in reporter gene expression not seen in the controls indicates that the transcription factor is a positive regulator of transcription. If reporter gene expression is less than that of the control, the transcription factor is a negative regulator of transcription. Optionally, the assay may include a transfection efficiency control plasmid. This plasmid expresses a gene product independent of the test gene, and the amount of this gene product indicates roughly how many cells are taking up the plasmids and how efficiently the DNA is being introduced into the cells. Additional guidance on evaluating chimeric proteins of this invention is provided below. Design and assembly of constructs

DNA sequences encoding individual DNA-binding sub-domains and linkers, if any, are joined such that they constitute a single open reading frame encoding a chimeric protein containing the composite DNA-binding region and capable of being translated in cells or cell lysates into a single polypeptide harboring all component domains. This protein- encoding DNA sequence is then placed into a conventional plasmid vector that directs the expression of the protein in the appropriate cell type. For testing of proteins and determination of binding specificity and affinity, it may be desirable to construct plasmids that direct the expression of the protein in bacteria or in reticulocyte-lysate systems. For use in the production of proteins in mammalian cells, the protein-encoding sequence is introduced into an expression vector that directs expression in these cells. Expression vectors suitable for such uses are well known in the art. Various sorts of such vectors are commercially available.

In embodiments involving composite DNA-binding proteins or accessory chimeric proteins which contain multiple domains, e.g., proteins containing a ligand binding domain and/or a transcription regulatory domain, DNA sequences encoding the constituent domains, with any introduced sequence alterations may be ligated or otherwise joined together such that they constitute a single open reading frame that can be translated in cells into a single polypeptide harboring all constituent domains. The order and arrangement of the domains within the polypeptide can vary as desired. Target DNA sequence

The DNA sequences recognized by a chimeric protein containing a composite DNA-binding domain can be determined experimentally, as described below, or the proteins can be manipulated to direct their specificity toward a desired sequence. A desirable nucleic acid recognition sequence consists of a nucleotide sequence spanning at least ten, preferably eleven, and more preferably twelve or more bases. The component binding portions (putative or demonstrated) within the nucleotide sequence need not be fully contiguous; they may be interspersed with "spacer" base pairs that need not be directly contacted by the chimeric protein but rather impose proper spacing between the nucleic acid subsites recognized by each module. These sequences should not impart expression to linked genes when introduced into cells in the absence of the engineered DNA-binding protein.

To identify a nucleotide sequence that is recognized by a chimeric protein containing the composite DNA-binding region, preferably recognized with high affinity (dissociation constant 10^"11 M or lower are especially preferred), several methods can be used. If high-affinity binding sites for individual subdomains of the composite DNA- binding region are already known, then these sequences can be joined with various spacing and orientation and the optimum configuration determined experimentally (see below for methods for determining affinities). Alternatively, high-affinity binding sites for the protein or protein complex can be selected from a large pool of random DNA sequences by adaptation of published methods. Bound sequences are cloned into a plasmid and their precise sequence and affinity for the proteins are determined. From this collection of sequences, individual sequences with desirable characteristics (i.e., maximal affinity for composite protein, minimal affinity for individual subdomains) are selected for use. Alternatively, the collection of sequences is used to derive a consensus sequence that carries the favored base pairs at each position. Such a consensus sequence is synthesized and tested (see below) to confirm that it has an appropriate level of affinity and specificity. Design of target gene constructs A DNA construct that enables the target gene to be regulated, etc. by DNA-binding proteins of this invention is a fragment, plasmid, or other nucleic acid vector carrying a synthetic transcription unit typically consisting of: (1) one copy or multiple copies of a DNA sequence recognized with high-affinity by the composite DNA-binding protein; (2) a promoter sequence consisting minimally of a TATA box and initiator sequence but optionally including other transcription factor binding sites; (3) sequence encoding the desired product (protein or RNA), including sequences that promote the initiation and termination of translation, if appropriate; (4) an optional sequence consisting of a splice donor, splice acceptor, and intervening intron DNA; and (5) a sequence directing cleavage and polyadenylation of the resulting RNA transcript. Determination of binding affinity

A number of well-characterized assays are available for determining the binding affinity, usually expressed as dissociation constant, for DNA-binding proteins and the cognate DNA sequences to which they bind. These assays usually require the preparation of purified protein and binding site (usually a synthetic oligonucleotide) of known concentration and specific activity. Examples include electrophoretic mobility-shift assays, DNaseI protection or "footprinting", and filter-binding. These assays can also be used to get rough estimates of association and dissociation rate constants. These values may be determined with greater precision using a BIAcore instrument. In this assay, the synthetic oligonucleotide is bound to the assay "chip," and purified DNA-binding protein is passed through the flow-cell. Binding of the protein to the DNA immobilized on the chip is measured as an increase in refractive index. Once protein is bound at equilibrium, buffer without protein is passed over the chip, and the dissociation of the protein results in a return of the refractive index to baseline value. The rates of association and dissociation are calculated from these curves, and the affinity or dissociation constant is calculated from these rates. Binding rates and affinities for the high affinity composite site may be compared with the values obtained for subsites recognized by each subdomain of the protein. As noted above, the difference in these dissociation constants should be at least two orders of magnitude and preferably three or greater. Testing for function in vivo

Several tests of increasing stringency may be used to confirm the satisfactory performance of a DNA-binding protein designed according to this invention. AU share essentially the same components: (1) (a) an ORP directing the production of a chimeric protein comprising the composite DNA-binding region and a potent transcriptional activation domain or (b) one or more ORFs directing the production of a pair of chimeric proteins of this invention which are capable of dimerizing in the presence of a corresponding dimerizing agent, and thus forming a protein complex containing a composite DNA-binding region on one protein and a transcription activation domain on the other; and (2) an ORF directing the expression of a reporter gene, preferably identical in design to the target gene described above (i.e., multiple binding sites for the DNA-binding domain, a minimal promoter element, and a target gene) but encoding any conveniently measured protein.

In a transient transfection assay, the above-mentioned plasmid(s) are introduced into tissue culture cells by any conventional transfection procedure, including for example calcium phosphate coprecipitation, electroporation, and lipofection. After an appropriate time period, usually 24-48 hr, the cells are harvested and assayed for production of the reporter protein. In embodiments requiring dimerization of chimeric proteins for activation of transcription, the assay is conducted in the presence of the dimerizing agent, hi an appropriately designed system, the reporter gene should exhibit little activity above background (or in the absence of dimerizing agent in embodiments under dimerizer control). In contrast, reporter gene expression should be elevated in a dose-dependent fashion by the inclusion of the ORF encoding the composite transcription factor (or ORFs encoding the multimerizable chimeras, following addition of rnultimerizing agent). This result indicates that there are few natural transcription factors in the recipient cell with the potential to recognize the tested binding site and activate transcription and that the engineered DNA-binding domain is capable of binding to this site inside living cells.

The transient transfection assay is not an extremely stringent test in most cases, because the high concentrations of plasmid DNA in the transfected cells lead to unusually high concentrations of the DNA- binding protein and its recognition site, allowing functional recognition even with relative low affinity interactions. A more stringent test of the system is a transfection that results in the integration of the introduced DNAs at near single-copy. Thus, both the protein concentration and the ratio of specific to non-specific DNA sites would be very low; only very high affinity interactions would be expected to be productive. This scenario is most readily achieved by stable transfection in which the plasmid(s) are transfected together with another DNA encoding an unrelated selectable marker (e.g., G418-resistance). Transfected cell clones selected for drug resistance typically contain copy numbers of the nonselected plasmid(s) ranging from zero to a few dozen. A set of clones covering that range of copy numbers can be used to obtain a reasonably dear estimate of the efficiency of the system. Perhaps the most stringent test involves the use of a viral vector, typically a retrovirus, that incorporates both the reporter gene and the gene encoding the composite transcription factor or multimerizable components thereof. Virus stocks derived from such a construction will generally lead to single-copy transduction of the genes. ZFHDl

Illustrating one design approach, computer modeling studies were used to determine the orientation and linkage of potentially useful DNA-binding domains (Pomerantz J. L. et al. 1995 Science 267:93-96). Computer modeling studies allowed manipulation and superimposition of the crystal structures of Zif268 and Oct-1 protein-DNA complexes. The study yielded two arrangements of the domains which appeared to be suitable for use in a chimeric protein. In one alignment, the carboxyl-terminal region of zinc finger 2 was 8.8 A away from the amino-terminal region of the homeodomain, suggesting that a short polypeptide could connect these domains. Ia this model, the chimeric protein would bind a hybrid DNA site with the sequence 5ΑAATNNTGGGCG-3' (SEQ ID NO: 5). The Oct-1 homeodomain would recognize the AAAT subsite, zinc finger 2 would recognize the TGG subsite, and zinc finger 1 would recognize the GCG subsite. No risk of steric interference between the domains was apparent in the model.

The second plausible arrangement would also have a short polypeptide linker spanning the distance from zinc finger 2 to the homeodomain (less than 10 A); however, the subsites are arranged so that the predicted binding sequence is 5'-CGCCCANNAAAT- 3' (SEQ ID NO: 6). This arrangement was not explicitly used in the work described herein, although the flexibility of the linker region may also allow ZFHDl to recognize this site. After selecting a suitable arrangement, construction of the corresponding molecule was carried out. Generally, sequences may be added to the chimeric protein to facilitate expression, detection, purification or assays of the product by standard methods. A glutathione S-transferase domain (GST) may be attached to ZFHDl for these purposes.

The consensus binding sequence of the chimeric protein ZFHDl was determined by selective binding studies from a random pool of oligonucleotides. The oligonucleotide sequences bound by the chimeric protein were sequenced and compared to determine the consensus binding sequence for the chimeric protein.

Binding studies were performed in order to determine the ability of the chimeric protein ZFHDl to distinguish the consensus sequence from the sequences recognized by the component polypeptides of the composite DNA- binding region. ZFHDl, the Oct-1 POU domain (containing a homeodomain and a POU-specific domain), and the three zinc fingers of Zif268 were compared for their abilities to distinguish among the Oct-1 site 5'- ATGCAAATGA-3' (SEQ ID NO: 7), the Zif268 site 5'-GCGTGGGCG-S¹ (SEQ ID NO: 8) and the hybrid binding site 5'-TAATGATGGGCG-S¹ (SEQ ID NO: 4). The chimeric protein ZFHDl preferred the optimal hybrid site to the octamer site by a factor of 240 and did not bind to the Zif site. The POU domain of Oct-1 bound to the octamer site with a dissociation constant of 1.8 x 10^"10 M under the assay conditions used, preferring this site to the hybrid sequences by factors of 10 and 30, and did not bind to the Zif site. The three zinc fingers of Zif268 bound to the Zif site with a dissociation constant of 3.3 x 10^~10 M, and did not bind to the other three sites. These experiments showed that ZFHDl binds tightly and specifically to the hybrid site and displayed DNA-binding specificity that was clearly distinct from that of either of the original proteins. In order to determine whether the novel DNA-binding protein could function in vivo, ZFHDl was fosed to a transcriptional activation domain to generate a transcription factor, and transfection experiments were performed. An expression plasmid encoding ZFHDl fused to the carboxyl-terminal 81 amino acids of the Herpes Simplex Virus VP 16 protein (ZFHDl -VP 16) was co-transfected into 293 cells with reporter constructs containing the SV40 promoter and the firefly luciferase gene. To determine whether the chimeric protein could specifically regulate gene expression, reporter constructs containing two tandem copies of either the ZFHDl site 5'-TAATGATGGGCG-S¹ (SEQ ID NO: 4), the octamer site 5' ATGC AAATG A-3' (SEQ ID NO: 9) or the Zif site 5'- GCGTGGGCG-3' (SEQ ID NO: 10) inserted upstream of the SV40 promoter were tested. When the reporter contained two copies of the ZFHDl site, the ZFHDl -VP 16 protein stimulated the activity of the promoter in a dose-dependent manner. Furthermore, the stimulatory activity was specific for the promoter containing the ZFHDl binding sites. At levels of protein which stimulated this promoter by 44-fold, no stimulation above background was observed for promoters containing the octamer or Zif sites. Thus, ZFHDl efficiently and specifically recognized its target site in vivo.

Utilizing the above-described procedures and known DNA-binding domains, other novel chimeric transcription factor proteins can be constructed. These chimeric proteins can be studied as disclosed herein to determine the consensus binding sequence of the chimeric protein. The binding specificity, as well as the in vivo activity, of the chimeric protein can also be determined using the procedures illustrated herein. Thus, the methods of this invention can be utilized to create various chimeric proteins from the domains of DNA-binding proteins. Optimization and Engineering of composite DNA-binding regions

The useful range of composite DNA binding regions is not limited to the specificities that can be obtained by linking two naturally occurring DNA binding subdomains. A variety of mutagenesis methods can be used to alter the binding specificity. These include use of the crystal or NMR structures (3D) of complexes of a DNA-binding domain (DBD) with DNA to rationally predict (an) amino acid substitution(s) that will alter the nucleotide sequence specificity of DNA binding, in combination with computational modeling approaches. Candidate mutants can then be engineered and expressed and their DNA binding specificity identified using oligonucleotide site selection and DNA sequencing, as described earlier.

An alternative approach to generating novel sequence specificities is to use databases of known homologs of the DBD to predict amino acid substitutions that will alter binding. For example, analysis of databases of zinc finger sequences has been used to alter the binding specificity of a zinc finger. A further and powerful approach is random mutagenesis of amino acid residues which may contact the DNA, followed by screening or selection for the desired novel specificity. Preferably, the libraries are surveyed using phage display so that mutants can be directly selected. For example, phage display of the three fingers of Zif268 (including the two incorporated into ZFHDl) has been described in the scientific literature, and random mutagenesis and selection has been used to alter the specificity and affinity of the fingers. These mutants can be incorporated into ZFHDl to provide new composite DNA binding regions with novel nucleotide sequence specificities. Other DBDs may be similarly altered. If structural information is not available, general mutagenesis strategies can be used to scan the entire domain for desirable mutations: for example alanine- scanning mutagenesis, PCR misincorporation mutagenesis, and "DNA shuffling". These techniques produce libraries of random mutants, or sets of single mutants, that can then be readily searched by screening or selection approaches such as phage display.

In all these approaches, mutagenesis can be carried out directly on the composite DNA binding region, or on the individual subdomain of interest in its natural or other protein context. In the latter case, the engineered component domain with new nucleotide sequence specificity may be subsequently incorporated into the composite DNA binding region in place of the starting component. The new DNA binding specificity may be wholly or partially different from that of the initial protein: for example, if the desired binding specificity contains (a) subsite(s) for known DNA binding subdomains, other subdomains can be mutated to recognize adjacent sequences and then combined with the natural domain to yield a composite DNA binding region with the desired specificity.

Randomization and selection strategies may be used to incorporate other desirable properties into the composite DNA binding regions in addition to altered nucleotide recognition specificity, by imposing an appropriate in vitro selective pressure. These include improved affinity, improved stability and improved resistance to proteolytic degradation. Applications Genetic immunization often requires controlled high-level expression of an immune stimulator gene. By supplying saturating amounts of an activating transcription factor of this invention to the immune stimulator gene, temporally controlled, considerably higher levels of gene expression can be obtained relative to natural promoters or enhancers, which are dependent on endogenous transcription factors, or constitutive promoters. Thus, one application of this invention to genetic immunization is the delivery of a three- transcription-unit cassette (which resides on one fragment, plasmid, or nucleic acid vector) entailing (1) a transcription unit encoding a chimeric protein composed of a composite DNA-binding region of this invention and a strong transcription activation domain (e.g., derived from the VP 16 protein, p65 protein, etc), (2) a transcription unit encoding the immune stimulator gene expressed under the control of a minimal promoter carrying one, and preferably several, binding sites for the composite DNA-binding domain and (3) a transcription unit encoding an immunogen. Introduction of the three transcription unit- fragment, plasmid or other nucleic acid vector into a cell results in the production of the hybrid transcription factor which in turn activates the immune stimulator gene to temporally controlled, high levels. This strategy essentially incorporates a delayed expression step, because the promoter that would be used to produce the immune stimulator gene product in conventional genetic immunization is used instead to produce the activating transcription factor. Each transcription factor has the potential to direct the delayed production of multiple copies of the immune stimulator protein. This method may be employed to increase the efficacy of many genetic immunization strategies by substantially delaying the expression of the immune stimulator gene, allowing expression to reach temporally controlled, high levels. Examples of immune stimulator genes that would benefit from this strategy are genes that encode cytokines, chemokines, co-stimulatory molecules, or signal transduction activators that increase expression of a co-stimulator.

Cytokines

Of the different ways to modulate the immune response to DNA immunization, the most promising may be through the co-administration of "biological" adjuvants such as cytokines. Cytokines are molecules secreted mainly by bone marrow-derived cells that act in an autocrine or paracrine manner to induce a specific response in cells expressing a particular cytokine receptor. The major cytokines, their sources, targets and principal effects are listed in Table 1.

Table 1. The Major Cytokines

Chemokines

Chemokines are a large group of chemotactic cytokines that direct the movement of leukocytes around the body, from the blood stream into the tissues and to the appropriate location within each tissue. Some chemokines also activate cells to carry out particular functions. Chemokines fall into four families, of which the main families are the CC and

CXC group. Chemokines are designated as ligands belonging to a particular family (e.g.,

CCL2). Many chemokines have older descriptive names, for example CCL2 is monocyte chemotactic protein-1 (MCP-I). They act on G protein-linked, seven-transmembrane pass receptors and have a variety of chemotactic and cell-activating properties. Table 2 lists the major human chemokines.

Table 2. Human Chemokines

Co-stimulatory Molecules

The process of activating T cells generally takes place in the lymph node nearest to the infection. The T cell receptor (TCR) recognizes a specific peptide lodged in the peptide binding groove of the MHC molecule. This interaction dictates immunological specificity because a peptide associated with an MHC molecule forms a unique structure to be recognized by the TCR. Other molecules have a complementary role in this interaction.

The initial encounter of T cells with antigen presenting cells (APCs) is by nonspecific binding through adhesion molecules. This transient binding by adhesion molecules permits the T cell to encounter a large number of different MHC molecule- peptide combinations on different APCs. hi the absence of a specific interaction, the APC and T cell rapidly dissociate.

Co-stimulatory molecules act together with the antigen-specific signals before the T cell is sanctioned for proliferation. Co-stimulatory and antigen-specific signals must be present simultaneously on the same cell. Overall, antigen presentation through MHC class I or class II molecules can be split into four stages (adhesion, antigen-specific activation, co-stimulation, and cytokine signaling).

Intercellular adhesion molecules (ICAMs), particularly ICAM-I (CD54), interact with the integrin, lymphocyte functional antigen-1 (LFA-I or CDl la/CD 18), present on all immune cells. If mouse cells are transfected with both human MHC and human ICAM-I, their capacity to act as human APCs is augmented.

When the T cell encounters the appropriate MHC molecule-peptide, which happens rarely except during an ongoing infection, a conformational change in LFA-I on the T cell, signaled via the TCR, results in tighter binding to ICAM-I , which results in prolonged cell- cell contact. The joined cells can exist as a pair for long periods, allowing time for the T cell to proliferate and differentiate.

The specific MHC molecule-peptide-TCR interaction, though necessary, is not sufficient to fully activate the T cell. A second signal is required or the T cell will become unresponsive. This second signal is also referred to as co-stimulation.

Some co-stimulatory molecules that interact with ligands on the T cell's surface are shown in Fig. 2.

The most potent co-stimulatory molecules known are B7s, which are members of the immunoglobulin superfamily molecules; they include B7-1 (CD80) and B7-2 (CD86).

Several other B7-related molecules are beginning to emerge. B7s exist as homodimers on the cell surface. These proteins are constitutively expressed on dendritic cells (DCs), but can be upregulated on monocytes, B cells, and probably other APCs.

Upregulation of co-receptors is stimulated by inflammation and by interaction with Toll-like receptors on antigen presenting cells. Co-receptors are the ligands for other immunoglobulin superfamily molecules (e.g., CD28 and its homolog CTLA-4 (CD 152)), which is expressed after T cell activation. CD28 is the main co-stimulatory ligand expressed on naive T cells. CD28 stimulation has been shown to prolong and augment the production of IL-2 and other cytokines. Although the CD28-B7 interaction is extremely important, CD28 knockout mice do respond to antigen, but require higher doses, so CD28 triggering is not obligatory, even for naive T cells. In CD28 knockout mice other co-stimulatory signals probably replace that delivered by CD28-B7.

CTLA-4, the alternative ligand for B7, is an inhibitory receptor limiting T cell activation, resulting in less IL-2 production. Thus CD28, constitutively expressed, initially interacts with B7, leading to T cell activation. Once this has peaked, the upregulation of

CTLA-4 with its higher affinity limits the degree of activation because available B7 will interact with CTLA-4.

The CD2 molecule on T cells is also involved in T cell activation, in conjunction with the TCR. CD2 is a receptor for LFA-3 (CD58), which is widely distributed on cells and is present on all APCs. In rodents CD48 binds to CD2 and appears to be functionally equivalent to LF A3 in humans. Both CD2 and LFA-3 are members of the immunoglobulin superfamily. Signal transduction activators that increase expression of co-stimulators

IL-IRI has been recognized as part of an interleukin-1 receptor/Toll-like receptor

(IL-1R/TLR) superfaraily, whose members comprise the various receptors involved in host defense and inflammation (Fig. 1). These include the receptors for the cytokine IL-18, bacterial products such as Gram-negative-derived lipopolysaccharide (LPS), and lipoproteins derived from all bacteria, including gram-positive bacteria. These receptors also appear to engage signaling pathways similar to those activated by IL-I, which is expected because all of these receptors share sequence similarity in their cytosolic regions.

The defining motif of the IL-1R/TLR superfamily is a cytosolic domain termed the Toll IL-IR (TIR) domain. This domain was named because of the sequence similarity between IL-IRI and the Drosophila melanogaster protein Toll.

Members of the IL-IR/TLR superfamily can be divided into three subgroups. The members of subgroup 1 , the Ig subgroup, all contain extracellular Ig domains and include receptors and accessory proteins for IL-I, IL-18, and the orphan receptor T1/ST2. Subgroup 2, the LRR subgroup, includes the signaling receptors for LPS (TLR4) and molecules from Gram-positive bacteria such as peptidoglycan and lipoproteins (TLR-2). The adaptor subgroup contains MyD88, MaI, and TRIF, which are exclusively cytosolic. MyD88 is a signaling adaptor for IL-IRI, IL-18R, TLR-2, and TLR-4, whereas MaI acts as an adaptor for TLR-2 and TLR-4. Two of the key signaling molecules activated by IL-I are the transcription factor

NF-KB and p38 MAPK. Both are also activated by IL-18 (acting through IL-18R) and LPS (acting through TLR-4). All of these receptors possess a TIR domain, indicating the conserved nature of the signaling pathways elicited by the TIR domain. IL-I actually activates four protein kinase cascades. The best characterized involves NF-κB, and the three others activate the MAPKs p38, p42 and p44 [p42/p44; also known as extracellular signal-regulated kinase (ERK) 1 and ERK2 (ERKl/2)], and JNK, respectively. The activation of NF-κB leads to increased transcription of target genes. The ERKl /2 MAPK also appears to regulate transcription, whereas p38 and JNK promote the stabilization of induced mRNA. Activation of NF-κB by IL-I begins with formation of a complex containing

MyD88, IRAK, and IRAK-2. A key function of MyD88 in TLR and IL-I signaling is to recruit members of the IRAK family. The role of IRAK-I is to recruit TRAF-6, a member of the RING-finger family of proteins. TRAF-6 interacts with TAB-2, and this complex activates TGF-β-activated kinase (TAK)-I. TAK-I then serves as a branch point, leading to activation of the IKB kinase complex and NF-κB, and the upstream kinases that activate p38 and JNK. TAK-I activation culminates in the assembly of a high molecular weight complex known as the signalosome. IKKα and IKKβ are components of this complex, which also contains the scaffold protein IKKγ (also known as NF-κB essential modulator (NEMO)). The function of the signalosome is to phosphorylate a group of NF-KB- inhibitory proteins collectively termed IKBS. Phosphorylation of the IKBS results in their ubiquitination and subsequent degradation. IKKα and IKKβ each can phosphorylate IκBα leading to the release of the NF-κB heterodimer, which can enter the nucleus and activate gene transcription. Antigen

Antigens that can be expressed by the nucleic acids of the invention include, but are not limited to, influenza A virus N2 neuraminidase; Dengue virus envelope (E) and premembrane (prM) antigens; HIV antigens Gag, Pol, Vif and Nef; HIV antigens gpl20, gpl45 and gplόO; gp41 epitope of human immunodeficiency virus; rotavirus antigen VP4; the rotavirus protein VP7 or VP7sc; herpes simplex virus (HSV) glycoproteins gB, gC, gD, gE, gG, gH, and gl; immediate-early protein ICP47 of herpes simplex virus-type 1 (HSV- 1); immediate-early (E) proteins ICP27, ICPO, and ICP4 of herpes simplex virus; influenza virus nucleoprotein and hemagglutinin, B19 parvovirus capsid proteins VPl or VP2; Hepatitis B virus core and e antigen; hepatitis B surface antigen; hepatitis B surface antigen fused to the core antigen of the virus; Hepatitis B virus core-preS2 particles; HBV preS2-S protein; VZV glycoprotein I; rabies virus glycoproteins or ribonucleocapsid; human cytomegalovirus (HCMV) glycoprotein B (UL55); the hepatitis C virus (HCV) nucleocapsid protein in a secreted or a nonsecreted form, or as a fusion protein with the middle (pre-S2 and S) or major (S) surface antigens of hepatitis B virus (HBV); the hepatitis C virus antigens: the core protein (pC); El (pEl) and E2 (pE2) alone or as fusion proteins; the gene encoding respiratory syncytial virus fusion protein (PFP-2), the VP6 and VP7 genes of rotaviruses; the El, E2, E3, E4, E5, E6 and E7 proteins of human papillomavirus; a human T- lymphotropic virus type I gag protein; Epstein-Barr virus (EBV) gp340; the Epstein-Barr virus (EBV) latent membrane protein LM:P2; Epstein-Barr virus nuclear antigens 1 and 2; the measles virus nucleoprotein (N); and cytomegalovirus glycoprotein gB or glycoprotein gH; an antigen of Japanese encephalitis virus; an antigen of arthropod-borne, encephalitic alphaviruses Venezuelan (VEEV), eastern (EEEV), and Western (WEEV) equine encephalitis viruses; or a variant, chimeric polypeptide, or derivative of any such viral antigen described herein.

Nucleotide sequences encoding one or more antigens from parasites can also be incorporated into a nucleic acid or vector of the invention. These include, but are not limited to, the schistosome gut-associated antigens CAA (circulating anodic antigen) and CCA (circulating cathodic antigen) in Schistosoma mansoni, S. haematobium or S. japonicum; a multiple antigen peptide (MAP) composed of two distinct protective antigens derived from the parasite Schistosoma mansoni; Leishmania parasite surface molecules; third-stage larval (L3) antigens of L. loa; the genes, Tamsl-1 and Tamsl-2, encoding the 30- and 32-kDa major merozoite surface antigens of Theileria annulata (Ta); Plasmodium falciparum merozoite surface antigen 1 or 2; circumsporozoite (CS) protein-based B- epitopes from Plasmodium berghei, and Plasmodium yoelii, along with a P. berghei T- helper epitope; NYVAC-Pf7 encoded Plasmodium falciparum antigens derived from the sporozoite (circumsporozoite protein and sporozoite surface protein 2), liver (liver stage antigen 1), blood (merozoite surface protein 1, serine repeat antigen, and apical membrane antigen 1), and sexual (25-kDa sexual-stage antigen) stages of the parasite life cycle were inserted into a single NYVAC genome to generate NYVAC-Pf7; Plasmodium falciparum antigen Pfs230; Plasmodium falciparum apical membrane antigen (AMA-I); Plasmodium falciparum proteins Pfs28 and Pfs25; Plasmodium falciparum merozoite surface protein, MSPl; the malaria antigen Pf332; Plasmodium falciparum erythrocyte membrane protein and antigenic fragments thereof; Plasmodium falciparum merozoite surface antigen, PfMSP-I; Plasmodium falciparum antigens SERA, EBA-175, RAPl and RAP2; Schistosoma japonicum paramyosin (Sj97) or fragments thereof; and Hsp70 in parasites; or a variant, chimeric, or derivative of any such antigen described herein. Among the tumor-specific antigens that can be used in vectors, nucleic acids and methods of the invention are: bullous pemphigoid antigen 2, prostate mucin antigen (PMA), tumor associated Thomsen-Friedenreich antigen, prostate-specific antigen (PSA), luminal epithelial antigen (LEA.135) of breast carcinoma and bladder transitional cell carcinoma (TCC), cancer-associated serum antigen (CASA) and cancer antigen 125 (CA 125), the epithelial glycoprotein 40 (EGP40), squamous cell carcinoma antigen (SCC), cathepsin E, tyrosinase in melanoma, cell nuclear antigen (PCNA) of cerebral cavernomas, DF3/MUC1 breast cancer antigen, carcinoembryonic antigen, tumor-associated antigen CA 19-9, human melanoma antigens MART-l/Melan-A27-35 and gplOO, the T and Tn pancarcinoma (CA) glycopeptide epitopes, a 35 kD tumor associated autoantigen in papillary thyroid carcinoma, KH-I adenocarcinoma antigen, the A60 mycobacterial antigen, heat shock proteins (HSPs), and MAGE, tyrosinase, melan-A and gp75 and mutant oncogene products (e.g., p53, ras, and HER-2/neu, EpCAM/KSA, prostate specific membrane antigen (PSMA), and TAG-72. Additional examples of cancer antigens whose polynucleotide sequences can be incorporated into nucleic acids or vectors of the invention for expression, administration, and/or delivery of such antigens to a subject and used in methods of the invention described herein include, e.g., and variants, derivatives, and mutated, and recombinant forms (e.g., shuffled forms) thereof of these antigens. Cancers that can be treated by using nucleic acids and vectors of the invention that further comprise one or more polynucleotide sequences encoding one or more cancer antigens include, but are not limited to, e.g., colorectal cancer, breast cancer, pancreatic cancer, lung cancer, prostate cancer, naso-pharyngeal cancer, brain cancer, leukemia, melanoma, head- and neck cancer, stomach cancer, cervical cancer, ovarian cancer, and lymphomas. Introduction of Constructs into Cells

Constructs encoding the chimeras containing a composite DNA-binding region, constructs encoding related chimeric proteins (e.g., in the case of ligand-dependent applications) and constructs directing the expression of target genes, all as described herein, can be introduced into cells as DNA molecules or constructs, in many cases in association with one or more markers to allow for selection of host cells which contain the construct(s). The constructs can be prepared in conventional ways, where the coding sequences and regulatory regions may be isolated, as appropriate, ligated, cloned in an appropriate cloning host, analyzed by restriction or sequencing, or other convenient means. Particularly, using PCR, individual fragments including all or portions of a functional unit may be isolated, where one or more mutations may be introduced using "primer repair", ligation, in vitro mutagenesis, etc. as appropriate. The construct(s) once completed and demonstrated to have the appropriate sequences may then be introduced into a host cell by any convenient means. The expression constructs may be integrated and packaged into non-replicating, defective viral genomes like adenovirus, pox virus or others, including retroviral vectors, for infection or transduction into cells. The constructs may include viral sequences for transfection, if desired. Alternatively, the construct may be introduced by fusion, electroporation, biolistics, transfection, lipofection, or the like. The host cells will in some cases be grown and expanded in culture before introduction of the construct(s), followed by the appropriate treatment for introduction of the construct(s). The cells will then be expanded and screened by virtue of a marker present in the construct. Various markers which may be used successfully include hprt, neomycin resistance, thymidine kinase, hygromycin resistance, kanamycin resistance, etc. Vectors containing useful elements such as bacterial or yeast origins of replication, selectable and/or amplifϊable markers, promoter/enhancer elements for expression in procaryotes or eukaryotes, etc. which may be used to prepare stocks of construct DNAs and for carrying out transfections are well known in the art, and many are commercially available. Genetic Immunization

The delayed expression vectors of the invention are useful for purposes of genetic vaccination, hi such applications, a suitable nucleic acid or vector of the invention can be introduced into cells in culture, followed by introduction of the cells subsequently into the subject, i.e., ex vivo administration of the nucleic acid or vector. Alternatively, the nucleic acid or vector can be introduced into the cells of the subject by administering the nucleic acid or vector directly to the subject. The choice of vector (if used), formulation of the nucleic acid or vector, and mode of administration will vary depending on the particular application. Vectors Vectors used in genetic vaccination can be viral or nonviral. A vector may or may not have an origin of replication. For example, it is useful to include an origin of replication in a vector for propagation of the vector prior to administration to a patient. Viral vectors are usually introduced into a patient as components of a virus. Illustrative vectors include, for example, adenovirus-based vectors, pox virus vectors and retroviral vectors.

Nonviral vectors, typically dsDNA, can be transferred as naked DNA or associated with a transfer-enhancing vehicle, such as a receptor-recognition protein, liposome, lipoamine, or cationic lipid. This DNA can be transferred into a cell using a variety of techniques well known in the art. For example, naked DNA can be delivered by the use of liposomes which fuse with the cellular membrane or are endocytosed, i.e., by employing ligands attached to the liposome, or attached directly to the DNA, that bind to surface membrane protein receptors of the cell resulting in endocytosis. Alternatively, the cells may be permeabilized to enhance transport of the DNA into the cell, without injuring the host cells. One can use a DNA binding protein, e.g., HBGF-I, known to transport DNA into a cell. These procedures for delivering naked DNA to cells are useful in vivo. For example, by using liposomes, particularly where the liposome surface carries ligands specific for target cells, or are otherwise preferentially directed to a specific organ, one may provide for the introduction of the DNA into the target cells/organs in vivo.

The choice of vector and each of its components, including, e.g., the chimeric proteins employed in the vector, one or more antigens, and one or more co-stimulatory sequences, and the like, can be optimized. The choice of vector components and format can be based on a particular functional activity, such as the degree of expression desired of a vector component (e.g., a high-, low-, or intermediate-activity promoter), the type of tissue in which the promoter is to operate (tissue-specific promoter), or a cell-specific regulated promoter that optimally drives transcription in a desired cell type(s). Pharmaceutical Compositions and Methods of Administration

The genetic vaccine vectors of the invention are useful for treating and/or preventing various diseases and other conditions. Vectors can be delivered to a subject to induce an immune response. Suitable subjects include, but are not limited to, a mammal, including, e.g., a human, primate, monkey, orangutan, baboon, mouse, pig, cow, cat, goat, rabbit, rat, guinea pig, hamster, horse, sheep; or a non-mammalian vertebrate such as a bird (e.g., a chicken or duck) or a fish, or invertebrate. Vectors can be delivered in vivo by administration to an individual patient, typically by local (direct) administration or by systemic administration (e.g., intravenous, intraperitoneal, intramuscular, subdermal, intracranial, anal, vaginal, oral, buccal route or they can be inhaled) or they can be administered by topical application. Alternatively, vectors can be delivered to cells ex vivo, such as cells explanted from an individual patient (e.g., lymphocytes, bone marrow aspirates, tissue biopsy) or universal donor hematopoietic stem cells, followed by reimplantation of the cells into a patient, usually after selection for cells which have incorporated the vector.

In local (direct) administration formats, the nucleic acid or vector is typically administered or transferred directly to the cells to be treated or to the tissue site of interest (e.g., tumor cells, tumor tissue sample, organ cells, blood cells, cells of the skin, lung, heart, muscle, brain, mucosae, liver, intestine, spleen, stomach, lymphatic system, cervix, vagina, prostate, mouth, tongue, etc.) by any of a variety of formats, including topical administration, injection (e.g., by using a needle or syringe), or vaccine or gene gun delivery, pushing into a tissue, organ, or skin site. For standard gene gun administration, the vector or nucleic acid of interest is precipitated onto the surface of microscopic metal beads. The microprojectiles are accelerated with a shock wave or expanding helium gas, and penetrate tissues to a depth of several cell layers. The nucleic acid or vector can be delivered, for example, intramuscularly, intradeππally, subdermally, subcutaneously, orally, intraperitoneally, intrathecally, intravenously, or placed within a cavity of the body (including, e.g., during surgery), or by inhalation or vaginal or rectal administration.

In in vivo indirect contact/administration formats, the nucleic acid or vector is typically administered or transferred indirectly to the cells to be treated or to the tissue site of interest, including those described above (such as, e.g., skin cells, organ systems, lymphatic system, or blood cell system, etc.), by contacting or administering the nucleic acid or vector of the invention directly to one or more cells or population of cells from which treatment can be facilitated. For example, tumor cells within the body of the subject can be treated by contacting cells of the blood or lymphatic system, skin, or an organ with a sufficient amount of the polypeptide such that delivery of the nucleic acid or vector to the site of interest (e.g., tissue, organ, or cells of interest or blood or lymphatic system within the body) occurs and effective prophylactic or therapeutic treatment results. Such contact, administration, or transfer is typically made by using one or more of the routes or modes of administration described above. A large number of delivery methods are well known to those of skill in the art.

Such methods include, for example, liposome-based gene delivery as well as use of viral vectors (e.g., adenoviral, retroviral, adenovirus-associated viral vectors, pox viral vectors, and the like).

"Naked" DNA and/or RNA that comprises a genetic vaccine can be introduced directly into a tissue, such as muscle, by injection using a needle or other similar device. Other methods such as "biolistic" or particle-mediated transformation are also suitable for introduction of genetic vaccines into cells of a mammal according to the invention. These methods are useful not only for in vivo introduction of DNA into a subject, such as a mammal, but also for ex vivo modification of cells for reintroduction into a mammal. DNA is conveniently introduced directly into the cells of a mammal or other subject using, e.g., injection, such as via a needle, or a "gene gun". As for other methods of delivering genetic vaccines, if necessary, vaccine administration is repeated in order to maintain the desired level of immune response, such as the level of T cell activation. Alternatively, nucleotides can be impressed into the skin of the subject.

Gene therapy and genetic vaccine vectors (e.g., adenoviruses, liposomes, pox viruses, retroviruses, etc.) can be administered directly to the subject (usually a mammal) for transduction of cells in vivo. The vectors can be formulated as pharmaceutical compositions for administration in any suitable manner, including parenteral (e.g., subcutaneous, intramuscular, intradermal_^ or intravenous), topical, oral, rectal, vaginal, intrathecal, buccal (e.g., sublingual), or local administration, such as by aerosol or transdermally, for immunotherapeutic or other prophylactic and/or therapeutic treatment. Pretreatment of skin, for example, by use of hair-removing agents, may be useful in transdermal delivery. Suitable methods of administering such as packaged nucleic acids are available and well known to those of skill in the art, and, although more than one route can be used to administer a particular composition, a particular route can often provide a more immediate and more effective reaction than another route. Pharmaceutical compositions of the invention can, but need not, include a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers are determined in part by the particular composition being administered, as well as by the particular method used to administer the composition. Accordingly, there are a wide variety of suitable formulations of pharmaceutical compositions of the present invention. A variety of aqueous carriers can be used, e.g., buffered saline and the like. These solutions are sterile and generally free of undesirable matter. These compositions may be sterilized by conventional, well known sterilization techniques. The compositions may contain pharmaceutically acceptable auxiliary substances as required to approximate physiological conditions such as pH adjusting and buffering agents, toxicity adjusting agents and the like, for example, sodium acetate, sodium chloride, potassium chloride, calcium chloride, sodium lactate and the like. The concentration of genetic vaccine vector in these formulations can vary widely, and will be selected primarily based on fluid volumes, viscosities, body weight and the like in accordance with the particular mode of administration selected and the patient's needs. Formulations suitable for oral administration can consist of (a) liquid solutions, such as an effective amount of the packaged nucleic acid suspended in diluents, such as water, saline or PEG 400; (b) capsules, sachets or tablets, each containing a predetermined amount of the active ingredient, as liquids, solids, granules or gelatin; (c) suspensions in an appropriate liquid; and (d) suitable emulsions. Tablet forms can include one or more of lactose, sucrose, mannitol, sorbitol, calcium phosphates, corn starch, potato starch, tragacanth, microcrystalline cellulose, acacia, gelatin, colloidal silicon dioxide, croscarmellose sodium, talc, magnesium stearate, stearic acid, and other excipients, colorants, fillers, binders, diluents, buffering agents, moistening agents, preservatives, flavoring agents, dyes, disintegrating agents, and pharmaceutically compatible carriers. Lozenge forms can comprise the active ingredient in a flavor, usually sucrose and acacia or tragacanth, as well as pastilles comprising the active ingredient in an inert base, such as gelatin and glycerin or sucrose and acacia emulsions, gels, and the like containing, in addition to the active ingredient, carriers known in the art. It is recognized that the genetic vaccines, when administered orally, must be protected from digestion. This is typically accomplished either by complexing the vector with a composition to render it resistant to acidic and enzymatic hydrolysis or by packaging the vector in an appropriately resistant carrier such as a liposome. Means of protecting vectors from digestion are well known in the art. The pharmaceutical compositions can be encapsulated, e.g., in liposomes, or in a formulation that provides for slow release of the active ingredient.

The packaged nucleic acids, alone or in combination with other suitable components, can be made into aerosol formulations (e.g., they can be "nebulized") to be administered via inhalation. Aerosol formulations can be placed into pressurized acceptable propellants, such as dichlorodifluoromethane, propane, nitrogen, and the like.

Suitable formulations for rectal administration include, for example, suppositories, which consist of the packaged nucleic acid with a suppository base. Suitable suppository bases include natural or synthetic triglycerides or paraffin hydrocarbons. In addition, it is also possible to use gelatin rectal capsules which consist of a combination of the packaged nucleic acid with a base, including, for example, liquid triglycerides, polyethylene glycols, and paraffin hydrocarbons.

Formulations suitable for parenteral administration, such as, for example, by intraarticular (in the joints), intravenous, intramuscular, intradermal, subdermal, intraperitoneal, and subcutaneous routes, include aqueous and non-aqueous, isotonic sterile injection solutions, which can contain one or more antioxidants, buffers, bacteriostats, and solutes that render the formulation isotonic with the blood of the intended recipient, and aqueous and non-aqueous sterile suspensions that can include suspending agents, solubilizers, thickening agents, stabilizers, and preservatives, hi the practice of this invention, compositions can be administered, for example, by intravenous infusion, orally, topically, intraperitoneally, intravesically or intrathecally. Parenteral administration administration is the preferred method of administration. The formulations of packaged nucleic acid can be presented in unit-dose or multi-dose sealed containers, such as ampoules and vials.

Injection solutions and suspensions can be prepared from sterile powders, granules, and tablets of the kind previously described. Cells transduced by the packaged nucleic acid can also be administered intravenously or parenterally.

The dose administered to a patient, in the context of the present invention should be sufficient to affect a beneficial effect, such as an immune or other prophylactic or therapeutic response in the patient over time. The dose will be determined by the efficacy of the particular vector employed and the condition of the patient, as well as the body weight or vascular surface area of the patient to be treated. The size of the dose also will be determined by the existence, nature, and extent of any adverse side-effects that accompany the administration of a particular vector, or transduced cell type in a particular patient.

In determining the effective amount of the vector to be administered in the treatment or prophylaxis of an infection or other condition, the physician evaluates vector toxicities, progression of the disease, and the production of anti-vector antibodies, if any. hi general, the dose equivalent of a naked nucleic acid from a vector for a typical 70 kilogram patient can range from about 10 ng to about 1 g, about 100 ng to about 100 mg, about 1 μg to about 10 mg, about 10 μg to about 1 mg, or from about 30 to 300 μg. Doses of vectors used to deliver the nucleic acid are calculated to yield an equivalent amount of therapeutic nucleic acid. Administration can be accomplished via single or divided doses.

In therapeutic applications, compositions are administered to a patient suffering from a disease (e.g., an infectious disease or autoimmune disorder) in an amount sufficient to cure or at least partially arrest or ameliorate the disease or at least one of its complications. An amount adequate to accomplish this is defined as a "therapeutically effective dose." Amounts effective for this use will depend upon the severity of the disease and the general state of the patient's health. Single or multiple administrations of the compositions may be administered depending on the dosage and frequency as required and tolerated by the patient. In any event, the composition should provide a sufficient quantity of protein to effectively treat the patient. In prophylactic applications, compositions are administered to a human or other mammal to induce an immune or other prophylactic response that can help protect against the establishment of an infectious disease or other condition.

The toxicity and therapeutic efficacy of the vectors provided by the invention are determined using standard pharmaceutical procedures in cell cultures or experimental animals. One can determine the LD₅₀ (the dose lethal to 50% of the population) and the

ED₅₀ (the dose therapeutically effective in 50% of the population) using procedures presented herein and those otherwise known to those of skill in the art.

Actual methods for preparing parenterally administrable compositions will be known or apparent to those skilled in the art and are described in more detail in such publications as Remington's Pharmaceutical Sciences, 18th ed., Mack Publishing Company, Easton, Pennsylvania (1990).

The vectors or nucleic acids of the invention can be packaged in packs, dispenser devices, and kits for administering the vectors to a mammal. For example, packs or dispenser devices that contain one or more unit dosage forms are provided. Typically, instructions for administration of the compounds will be provided with the packaging, along with a suitable indication on the label that the compound is suitable for treatment of an indicated condition. For example, the label may state that the active compound within the packaging is useful for treating a particular infectious disease, autoimmune disorder, tumor, or for preventing or treating other diseases or conditions that are mediated by, or potentially susceptible to, a mammalian immune response.

Expression of intracellular signaling molecules enhances immunity in response to

DNA vaccination

Dual plasmid expression vectors encoding HIV-I envelope antigen and intracellular signaling molecules were developed to determine whether signal transduction pathways could influence the response to DNA vaccination. Co-stimulatory molecules were expressed constitutively or in a delayed fashion using an artificial transcription factor that interacts with regulatory sequences found only in the plasmid. IKK2 and JNK2 improved the immune response, indicating that their downstream effectors regulate the response to DNA vaccination, and delayed IKK2 expression enhanced immunity more than constitutive, in contrast to JNK2. These data indicate that DNA vaccination can be modulated by regulated expression of relevant signal transduction proteins. A single plasmld DNA vaccine vector that incorporated certain elements was developed. This vector expressed the HIV-I envelope (Env) antigen and a chimeric transcription factor from constitutive promoters. The chimeric transcription factor (Pomerantz, J. L. et al. 1995 Science 267:93-96) contained two DNA binding domains, the zinc finger motifs from Zif268 (aa. 333-362) and Oct-1 homeodomain (aa. 378-439) linked by a glycine hinge, fused to the RelA/p65 (GenBank M62399; aa. 290-551) transcriptional activation domain (ZFHDl -T Ap65) (Fig. 4A). This chimeric transcriptional factor recognized a specific unique DNA enhancer sequence, 5' TAATGATGGGCG 3' (SEQ ID NO: 4) (Pomerantz, J. L. et al. 1995 Science 267:93-96), found only in the vector, that regulated the expression of a reporter gene or the intracellular signaling molecules inserted downstream, including MyD88 (GenBank BC013589), TRAF6 (GenBank AL570377), JNK2 (GenBank NM_002752) and IKK2 (Ganesh, L. et al. MoI Cell Biol, 26:3864-3874) (Fig. 4B, left). Because mammalian genomes do not contain the enhancer binding sequence for the chimeric transcription factor, production of this transcription factor was intended to stimulate gene expression from the plasmid vector without activation of endogenous mammalian genes. A control vector with constitutive expression of the co-stimulator was also prepared (Fig. 4B, right).

To test whether the ZFHDl -T Aρ65 chimeric transcriptional factor could regulate gene expression in a delayed fashion from the vector, a reporter gene, enhanced green fluorescent protein (eGFP), was inserted downstream of the EIb minimal promoter from adenovirus type 5 (Spector, D. J. et al 1993 Virology 194:128-136) regulated by either two or five synthetic enhancer DNA binding sites that recognized the chimeric transcription factor. This plasmid was transfected into 293T human embryonic kidney cells, and expression of eGFP was confirmed by immunoblotting. A similar vector containing either two or five mutated enhancer DNA binding sites (GGGGCGTGGGCG) (SEQ ID NO: 11) that no longer recognized ZFHDl -T Ap65 and a constitutively expressing eGFP vector were used as controls. The control with the mutated transcription factor binding sites failed to produce eGFP (Fig. 4C, lanes 1 and 2) while the vector with wild-type transcription factor binding sites expressed eGFP (Fig. 4C, lanes 3 and 4), suggesting that expression of eGFP was specifically regulated by ZFHDl -T Ap65. The vector with five enhancer binding sites showed higher levels of eGFP, and expression was proportional to the number of enhancer binding sites (Fig. 4C, compare lanes 3 and 4). A time course experiment was performed using immunoblotting to detect eGFP expression from the plasmid vector containing five ZFHDl -T Ap65 binding sites compared to the constitutive eGFP expressing vector. Expression from the vector was delayed by -24 hours and reduced in magnitude ~2- to 3-fold (Fig. 4D, left). To test whether expression of IKK2 could be similarly modulated, a similar plasmid expressing IKK2 instead of eGFP was transfected with an NF-κB reporter. NF-κB activity was compared to a plasmid that expressed IKK2 under control of the constitutive Rous Sarcoma Virus (RSV) promoter. The NF-κB reporter was transactivated with a time delay compared to constitutive IKK2 expression vector (Fig. 4D, right). Refering to Fig. 4, a model and schematic representation of the delayed expression vector is shown. The model of the chimeric transcription factor recognition to the specific DNA binding domain is shown in Fig. 4A. The chimeric transcription factor, ZFHDl- TAp65, consists of two zinc finger DNA binding domains from Zif268 and Oct-1 homeodomain DNA binding domain and the p65 transactivation domain. Zinc (represented by two balls) is shown associated with the Zif268 domain. ZFHDl -T Ap65 recognizes the chimeric binding sequence upstream of the EIb minimal promoter and controls the expression of a reporter gene or immune stimulatory molecules. As shown in Fig. 4B, the chimeric transcription factor ZFHDl -T Ap65 expresses from a constitutive RSV promoter. ZFHDl -T Ap65 in turn stimulates the expression of intracellular signaling molecules (co- stimulator). In the constitutive vector, the co-stimulatory molecule is under the control of the RSV promoter (right). The antigen HIV-I Env in both vectors is expressed from the CMV or mPGK promoter. As shown in Fig. 4C, the vector containing the enhancer DNA binding sequence (TAATGATGGGCG, SEQ ID NO: 4) with two tandem (delayed 2x), five tandem (delayed 5x), mutant DNA binding sequence (GGGGCGTGGGCG, SEQ ID NO: 11) two tandem (delayed mutant 2x), five tandem (delayed mutant 5x) or a CMV promoter/enhancer (constitutive) upstream of the eGFP gene was transfected in 293T cells as previously described (Akahata, W. et al. 2005 J Virol 79:626-631). The expression of eGFP and ZFHDl -T Aρ65 were analyzed at 48 hours after transfection by SDS-PAGE followed by immunoblotting with BD living colors GFP and p65 antibody, respectively. The immunoblotting and immunoprecipitation assays were performed as previously described (Akahata, W. et al. 2005 J Virol 79:626-631; Ganesh, L. et al. 2003 Nature 426:853-857). Antibodies against enhanced green fluorescent protein (BD Biosciences, living colors a.v. peptide antibody, #8367), ZFHDl -TAp65 (p65 antibody, Santa Cruz Biotechnology, sc-8008), and goat anti-rabbit or mouse IgG-HRP (Santa Cruz Biotechnology, sc-2054 and sc-2005, respectively) as the 2nd antibody were used according to the manufacturer's instructions. Endogenous p65 was used as an internal control and is indicated by an arrow. Delayed expression of eGFP or IKK2 (IKB kinase 2) by ZFHDl- TAp65 is shown in Fig. 4D. The eGFP gene was inserted downstream of a CMV promoter/enhancer (constitutive vector), synthetic wild type (TAATGATGGGCG, SEQ ID NO: 4; delayed vector or mutant (GGGGCGTGGGCG, SEQ ID NO: 11; delayed mutant vector) DNA binding sequence for ZFHDl -T Ap65. Each of these plasmids was transfected into NIH3T3 cells, and the expression was analyzed by SDS-PAGE followed by immunoblotting with BD living colors GFP at the indicated times (left). IKK2 was inserted downstream of the ZFHDl -T Ap65 enhancer/promoter (delayed IKK2) or a constitutive RSV promoter (constitutive IKK2). 293 T cells were co-transfected with the indicated plasmids and an NF-κB luciferase reporter. Luciferase activity was measured at the indicated times (right). 10 ng of the 2κB binding site containing plasmid for the NF-κB assay (Ganesh, L. et al. 2003 Nature 426:853-857) (see Fig. 5) was co-transfected with 1 μg of the respective plasmids: delayed IKK2, constitutive IKK2. 48 hours later, luciferase activity was measured as per the manufacturer's instructions (Promega) using a Top Count luminometer (Packard).

We have previously described a modified form of the HIV-I Env glycoprotein, gpl45ΔCFIΔV12, that elicits increased humoral responses to DNA vaccines without compromising cellular immunity (Yang, Z.-Y. et al. 2004 J Virol 78:4029-4036). Dual expression vectors that express constitutive HIV-I Env under regulation of the human cytomegalovirus (CMV) enhancer/promoter and alternative intracellular signal transduction molecules, IKK2, JNK2, MyD88 or TRAF6, regulated by the delayed artificial transcription factor, ZFHDl -T Ap65, were prepared. After three DNA immunizations, sera from mice (n=5 per group) were tested for antibody responses to HIV-I Env protein in a lectin-capture ELISA (Akahata, W. et al. 2005 J Virol 79:626-631). Compared to mice immunized with HIV-I Env vector alone, sera from mice immunized with dual expression vectors that expressed the IKK2 and JNK2 intracellular signaling molecules with a time delay showed a significant increase in HIV-I Env specific antibodies (Fig. 5 A; p = 0.05 and p= 0.01, respectively, Student's t-test). To confirm the specificity of the effect for IKK2 and JNK2, dual expression vectors expressing IKK2 or JNK2 inactive forms (IKK2ΔP (Suh, J. et al. 2002 Prostate 52:183-200), JNK2ΔP (Derijard, B. et al. 1994 Cell 76:1025-1037)) under the control of ZFHDl -T Ap65 were prepared. Functional inactivation was confirmed by co- transfection of the IKK2ΔP plasmid with the NF-κB reporter (Ganesh, L. et al. 2003 Nature 426:853-857) (Fig. 5B, left panel) or by immunoprecipitation with a V5 epitope tag antibody followed by immunoblotting (Akahata, W. et al. 2005 J Virol 79:626-631; Ganesh, L. et al. 2003 Nature 426:853-857) with JNK2 or JNK2 phospho-specific antibody in transfected cells (Fig. 5B, right panel). Animal experiments were conducted in compliance with all relevant federal guidelines and NIH policies.

Referring to Fig. 5, antibody titer was measured to HIV-I Env after DNA immunization with delayed IKK2, JNK2, MyD88 or TRAF6 vectors and characterization of the IKK2 and JNK2 phosphorylation mutants. Mice (n=5) were immunized three times with total 10 μg of the indicated plasmids (Fig. 5A). The groups included mice injected with a mixture of 5 μg of plasmid expressing Env from the CMV promoter with 5 μg of RSV vector with no insert (control) or 10 μg of IKK2, JNK2, MyD88 or TRAF6 delayed expression vector (delayed IKK2, delayed JNK2, delayed MyD88, delayed TRAF6, respectively). In the delayed expression vectors, the antigen HIV-I Env was expressed from a CMV promoter and indicated signaling molecules were expressed under the control of ZFHDl-TAp65. ELISA against HIV-I Env was performed on sera from indicated mice, collected 10 days after the third DNA immunization. For all groups, female 6- to 8-week- old BALB/c mice were injected in the right and left quadriceps muscles with purified plasmid DNA suspended in 200 μl of normal saline. Each group of mice was injected three times at intervals of 3 weeks. 10 days after the last injection, sera and spleen were collected. In Fig. 5B, 1 μg of the RSV vector (control) and each of the indicated delayed vectors were transfected with NF-κB luciferase reporter in the 293T cells, and luciferase activity was measured at 72 h (left). The RSV vector (control), C terminal tagged V5 JNK2 and JNK2 phosphorylation mutant (JNK2 and JNK2ΔP respectively) were transfected into 293T cells. After 48 hours, the cell lysates were immunoprecipitated with V5 antibody and immunoblotted with JNK and phospho-JNK antibodies (right). Immunoprecipitation and immunoblotting was performed as before with antibodies to JNK (Cell Signaling, #9252), phosphorylation JNK (Cell Signaling, #9251), or V5 antibody (Invitrogen, 46-0705) with the same secondary antibodies.

To compare the immunogenicity between delayed vectors and constitutive vectors, mice were immunized with these plasmids. In these plasmids, HIV-I Env was expressed from a weak constitutive murine phosphoglycerate kinase (mPGK) promoter (McBurney, M. W. et al. 1991 Nucleic Acids Res 19:5755-5761), rather than a stronger CMV promoter, in order to compare the potency of immune stimulation between the groups at limiting antigen levels. Each group of mice (n=10) was immunized three times with the delayed IKK2, delayed IKK2ΔP, constitutive IKK2, delayed JNK2, delayed JNK2ΔP, or constitutive JNK2. T cell responses were analyzed by intracellular staining for IFN-γ and TNF-α in stimulated CD4+ or CD8+ lymphocytes ten days after the final injection. Expression of IKK2 enhanced both CD4+ and CD8+ T cell responses to HIV-I compared to the inactive mutant (Fig. 6A; p = 0.004, left panel; p = 0.04, right panel). In contrast, expression of JNK2 enhanced CD4+ T cell responses but did not affect CD 8+ T cell responses compared to its inactive mutant (Fig. 6B; p = 0.002, left panel; p = 0.57, right panel). Delayed expression of IKK2 or JNK2 showed a trend towards increased CD4+ and CD8+ T cell responses compared to simultaneous expression of these molecules with HIV- 1 Env but it did not reach statistical significance (Fig. 6A and B). These data suggest that IKK2 increases CD4+ and CD8+ T cell responses, while JNK2 stimulates CD4+ T cell responses.

Referring to Fig. 6, CD4+ and CD 8+ T cell responses to HIV-I Env were measured after DNA immunization with delayed IKK2 and JNK2 vectors. CD4+ (left) and CD8+ (right) intracellular cytokine staining for IFN-γ and TNF-α was performed in mice (n=10) immunized three times with 40 μg each of the indicated vector plasmid; RSV vector alone (control), delayed IKK2 expression vector (delayed IKK2), IKK2 phosphorylation mutant (delayed JKK2ΔP) and constitutive IKK2 expression vector under the control of a constitutive promoter (constitutive IKK2) (Fig. 6A) or in mice immunized with the RSV vector alone (control), and delayed JNK2 expression vector (delayed JNK2), JNK2 phosphorylation mutant (delayed JNK2ΔP) and constitutive JNK2 expression vector under the control of a constitutive promoter (constitutive JNK2) (Fig. 6B). All vectors except the control vector expressed HIV-I Env under the control of the constitutive murine phosphoglycerate kinase promoter and indicated signaling molecules were expressed under the control of ZFHDl -T Ap65 (delayed vector) or RSV promoter (constitutive vector). The P values between delayed vector and phosphorylation mutant delayed vector and between delayed vector and constitutive vector are shown. Flow cytometric analysis of intracellular cytokines and Enzyme-Linked Immunosorbent Assay were done as described previously (Akahata, W. et al. 2005 J Virol 79:626-631). Sera from mice immunized with the above groups were tested for antibody responses in a lectin-capture ELISA for HIV-I Env. IKK2 and JNK2 significantly enhanced the antibody response to HIV-I Env compared to their mutant counterparts, suggesting that the responses were mediated through IKK2 or JNK2 (Fig. 7 A and B; p = 0.03, p = 0.04, respectively). Delayed expression of JNK2 showed no difference in HIV-I Env-specific antibodies compared to simultaneous expression of this signaling molecule with HIV-I Env (Fig. 7B, p = 0.58); however, a delay in expression of IKK2 increased HIV-I -specific antibodies compared to simultaneous expression of IKK2 (Fig. 7A, p = 0.05). These data suggested delayed synthesis of IKK2 relative to antigen expression elicits a better antibody response for this DNA vaccine.

Referring to Fig. 7, Antibody titer to HIV-I Env after DNA immunization with delayed IKK2 and JNK2 vectors was measured. The antibody titer to HIV-I Env in sera from mice immunized with the delayed IKK2 (Fig. 7A) or JNK2 (Fig. 7B) expression vectors was determined by ELISA. ELISA results represent endpoint dilution titers of Env- specific antibodies in mouse sera as determined by optical density. Sera from the five groups of mice were collected 10 days after the third immunization. The P values between delayed vector and phosphorylation mutant delayed vector and between delayed vector and constitutive vector are shown.

To enhance the immune responses of DNA vaccination, adjuvants that promote cytokines, chemokines or co-stimulatory molecules that stimulate T and B cells have been used. Delaying the administration of these signals after antigen delivery is important in eliciting optimal immune responses. Referring to Figure 8, an expression vector was constructed that expresses target gene in a delayed fashion. Using the delayed expression vector, expression of eGFP and IKK2 was observed (Fig. 9). Antibody titer against HIV-I Env was measured after DNA immunization with delayed expression vectors in which IKKl, JNK2, MyD88 and TRAF6 was expressed in a delayed fashion (Fig. 10). A schematic representation of delayed and immediate expression vectors is shown in Fig. 11. A ribbon model of chimeric transcription factor recognition to its specific DNA binding domain in the expression vector is shown in Fig. 12. Antibody titer against HIV-I Env was measured after DNA immunization with delayed IKK2 and JNK2 vectors (Fig. 13).

In this study, we have found that signaling molecules can affect immune responses to a DNA vaccine and that the timing of intracellular signals may further control the character of acquired immunity in response to this mode of vaccination. Immune responses to DNA vaccines (Leltner, W. W. et al. 1999 Vaccine 18:765-777) can be enhanced by increasing antigen expression through codon modifications and improving promoters/enhancers (Andre, S. et al. 1998 J Virol 72:1497-1503; Barouch, D. H. et al. 2005 J Virol 79:8828-8834; Ertl, P. F. and L. L. Thomsen 2003 Methods 31:199-206; Huang, Y. et al. 2001 J Virol 75:4947-4951). Cytokines, chemokines or co-stimulatory molecules that stimulate T and B cells have also been used to enhance immune responses to DNA vaccines (Barouch, D. H. et al. 2000 Science 290:486-492; Boyer, J. D. et al. 1999 Vaccines 17 (Suppl 2):53-64; Cho, J. H. et al. 1999 Vaccine 17:1136-1144; Kim, J. J. et al. 1997 J Immunol 158:816-826; Kim, J. J. et al. 1997 Nat Biotechnol 15:641-646; Kim, J. J. et al. 1999 J Interferon Cytokine Res 19:77-84; Kim, J. J. et al. 1998 Eur J Immunol 28:1089-1103; Kutzler, M. A. et al. 2005 J Immunol 175:112-123; Moore, A. C. et al. 2002 J Virol 76:243-250; Pasquini, S. et al. 1997 Cell Biol 75:397-401; Sasaki, S. et al. 2002 J Virol 76:6652-6659; Schwarz, K. 2003 Eur J Immunol 33:1465-1470; Xiang, Z. and H. C. Ertl 1995 Immunity 2:129-135). Traditional adjuvants such as Freund's adjuvant, lipopolysaccharide (LPS), lipid A and CpG DNA are thought to activate multiple intracellular signaling cascades in APC that lead to synthesis of inflammatory cytokines that stimulate adaptive immunity (Akira, S. et al. 2001 Nat Immunol 2:675-680). Previous studies have shown that administration of CpGs, cytokine, or chemokine expression vectors can enhance immune responses by DNA vaccines (Badovinac, V. P. et al. 2005 Nat Med 11:748-756; Barouch, D. H. et al. 1998 J Immunol 161:1875-1882; Kusakabe, K. et al. 2000 J Immunol 164:3102-3111; Sasaki, S. 2001 Nat Biotechnol 19:543-547; Seaman, M. S. et al. 2004 J Virol 78:206-215). Delay in administration of co-stimulants administered as proteins or cytokines in separate plasmids have shown such enhancement. Here, expression of signal transduction expression vectors together with antigen in a single vector is shown to modulate immunity. A vector that can delay expression of co-stimulatory signals can serve two purposes. First, these plasmids provide a simplified method by which to achieve this effect using a single injection. Second, they can be used to define the mechanisms involved in enhanced antigen presentation. In this study, the NF-κB and ApI transcription pathways are shown to be likely downstream effectors that are implicated in enhanced antigen presentation for cellular and humoral immunity to DNA vaccines. Example 1 Construction of plasmids

Zif268 zinc finger regions (aa. 333-362) were amplified with the sense primer 5' AGG TTG CGG CCG CAC CAT GGA ACG CCC ATA TGC TTG CCC TGT CGA GTC C 3' (SEQ ID NO: 12) and the antisense primer 5' AAG CTT GGC GCC GCC TGT GTG GGT GCG GAT GTG GGT GGT AAG GTG 3' (SEQ ID NO: 13) (Notl and Sfol sites are shown in bold and the Gly-Gly linker in italics). The Oct-1 DNA binding region (aa. 378-439) was amplified with the sense primer 5'AAG CTT TCG CGA AGG AGG AAG AAA CGC ACC AGC ATA GAG ACC 3' (SEQ ID NO: 14) and the antisense primer 5' AAG CTT AAT ATT GAT TCT TCT TTT TTC TTT CTG GCG GCG GTT ACA 3' (SEQ ID NO: 15) (Nrul and Sspl sites are shown in bold and the Arg-Arg linker in italics). These two fragments were subcloned into the pcDNA3.1(+) vector. The transactivator region from RelA/p65 (GenBank M62399) (aa. 290-551) was amplified with the sense primer 5' AAG CTT TGG CCA GAT ACA GAC GAT CGT CAC CGG ATT GAG 3' (SEQ ID NO: 16) and the antisense primer 5' AAG CTT GGA TCC TTA GGA GCT GAT CTG ACT CAG CAG GGC TGA 3' (SEQ ID NO: 17) (Mscl and BamHI sites are shown in bold). The fragment of the Zif268-Oct-1 DNA binding domain and the fragment of the RelA/p65 transactivator were digested with Notl and Sspl, Mscl and BamHI, respectively, and ligated into the RSV promoter vector (Akahata, W. et al. 2005 J Virol 79:626-631) digested with Notl and BamHI (ZFHDl -TAp65).

The EIb minimal promoter (Spector, D. J. et al 1993 Virology 194:128-136) from adenovirus type 5 was amplified by PCR, the sense primer with 2 or 5 binding site motifs (TAATGATGGGCG) (SEQ ID NO: 18) or mutant motifs (GGGGCGTGGGCG) (SEQ ID NO: 19) with the spacer sequence, CTGCAG (SEQ ID NO: 20), following the EIb minimal promoter region 5'

ATTAATAATGATGGGCGCTGCAGTAATGATGGGCGTTAAATGGGGCGGGGCT TAAAGGGT 3' (SEQ ID NO: 21) (2 x sites), 5' ATTAATAATGATGGGCGCTGCAGTAATGATGGGCGCTGCAGTAATGATGGG CGCTGCAGTAATGATGGGCGCTGCAGTAATGATGGGCGTTAAATGGGGCGG GGCTTAAAGGGT 3' (SEQ ID NO: 22) (5x sites). The binding motifs are shown in bold. The primers for the mutant 2 x sites and the mutant 5 x sites are shown below. 5' ATTAAGGGGCGTGGGCGCTGCAGGGGGCGTGGGCGTTAAATGGGGCGGGGC TTAAAGGGT 3' (SEQ ID NO: 23) (mutant 2 x sites), 5' ATTAAGGGGCGTGGGCGCTGCAGGGGGCGTGGGCGCTGCAGGGGGCGTGG GCGCTGCAGGGGGCGTGGGCGCTGCAGGGGGCGTGGGCGTTAAATGGGGC

GGGGCTTAAAGGGT 3' (SEQ ID NO: 24) (mutant 5 x sites). The mutant binding motifs are shown in bold. The sense primers as shown above were used with the antisense primer 5' GGATCCAAGCTTCATGAGGTCAGATGTAACCAAGAT 3' (SEQ ID NO: 25) to generate individual PCR fragments. The fragments were digested with Asel and HindIII and inserted into a pEGFP-N3 vector (GenBank U57609, Invitrogen) lacking the human cytomegalovirus IE enhancer/promoter. Then ZFHDl -T Ap65 was digested with Mscl upstream of the RSV promoter and inserted into the Asel and AfIII klenow-blunted binding sequence EIb minimal promoter eGFP expression cassette in the same orientation (ZFHDl -TAp65-eGFP).

Intracellular signaling molecule genes replaced the eGFP gene in the ZFHDl- TAp65-eGFP vector having the 5 x sites digested with BstBI and Mfel (delayed vector). The intracellular molecule genes were also inserted into an RSV vector digested with Notl and BamHI (constitutive vector). The genes are amplified by PCR from the clones MyD88 (GenBank BCOl 3589), TRAF6 (GenBank AL570377), JNK2 (GenBank NM_002752) and constitutively active IKK2 gene (Ganesh, L. et al. MoI Cell Biol, 26:3864-3874) with the following primers. For the construction of IKK2 in the delayed vector, the sense primer 5' AATTCCTTCGAACACCATGAGCTGGTCACCTTCCCT 3' (SEQ ID NO: 26) and the antisense primer 5' AATTCCCAATTGTCATGAGGCCTGCTCCAGGC 3' (SEQ ID NO: 27) (BstBI and Mfel sites are in bold) were used. For the construction of IKK2 in the constitutive vector, the sense primer 5'

AATTCCGCGGCCGCCACCATGAGCTGGTCACCTTCCCT 3' (SEQ ID NO: 28) and the antisense primer 5' AATTCCTGATCATCATGAGGCCTGCTCCAGGC 3' (SEQ ID NO: 29) (Notl and BcII sites are in bold) were used. For the construction of JNK2 in delayed vector the sense primer 5'

AATTCCTTCGAACACCATGAGCGACAGTAAATGTGA 3' (SEQ ID NO: 30) and the antisense primers 5' AATTCCGAATTCTCATCG ACAGCCTTC AAGGGGT 3' (SEQ ID NO: 31) (BstBI and EcoRI sites are in bold) were used. For the construction of JNK2 in the constitutive vector, the sense primer 5'

AATTCCGCGGCCGCCACCATGAGCGACAGTAAATGTGA 3' (SEQ ID NO: 32) and the antisense primer 5' AATTCCGGATCCTCATCGACAGCCTTCAAGGGGTC 3' (SEQ ID NO: 33) (Notl and BamHI sites are in bold) were used. For construction of MyD88 in the delayed vector, the sense primer 5' AATTCCTTCGAACACCATGGCTGCAGGAGGTCCCGG 3' (SEQ ID NO: 34) and the antisense primer 5' AATTCCCAATTGTCAGGGCAGGGACAAGGCCT 3' (SEQ ID NO: 35) (BstBI and Mfel sites are in bold) were used. For the construction of TRAF6 in the delayed vector the sense primer 5'

AATTCCATCGATACACCATGAGTCTGCTAAACTGTGAAAACAGCTGT 3' (SEQ ID NO: 36) and the antisense primers 5'

AATTCCCAATTGCTATACCCCTGCATCAGTACTTCGTGGCTG 3' (SEQ ID NO: 37) (CIaI and Mfel sites are in bold) were used. All the sense primers included the Kozac sequence CACC before the start codon and all the PCR inserts were confirmed by sequencing.

Constitutive CMV or mPGK promoters were used for HIV-I Env expression. The mPGK promoter (McBurney, M. W. et al. 1991 Nucleic Acids Res 19:5755-5761) was amplified with the sense primer 5' AAT TTG GCC AGG TAC CGA ATT CTA CCG GGT AGG GGA GGC GCT T 3 ' (SEQ ID NO: 38) and the antisense primer 5 ' CCT TGA TAT CGG TCG AAA GGC CCG GAG ATG 3' (SEQ ID NO: 39). The CMV promoter region of 1012-gpl45ΔCFIΔV12 (Yang, Z.-Y. et al. 2004 J Virol 78:4029-4036) was replaced with the mPGK promoter by digestion with Mscl and EcoRV. HIV-I Env gpl45ΔCFI ΔV12 expression cassettes containing the CMV or the mPGK promoter were inserted into the ZFHDl -TAp65-MyD88, TRAF6, IKK2, JNK2 vectors downstream of the ZFHDl- TAp65 gene with Kpnl digestion in the same orientation (delayed-MyD88-CMV-Env, delayed-TRAF6-CMV-Env, delayed-IKK2-CMV-Env, delayed-JNK2-CMV-Env, delayed- MyD88-mPGK-Env, delayed-TRAF6-mPGK-Env, delayed-IKK2-mPGK-Env and delayed- JNK2-mPGK-Env, respectively). RSV-IKK2 and JNK2 vectors were digested downstream of bovine growth hormone polyadenylation signal with Kpnl to insert an HIV-I Env gpl45ΔCFI ΔV12 expression cassette containing the mPGK. promoter in the same orientation (constitutive-IKK2 and constitutive- JNK2).

The JNK2 phosphorylation site mutant (JNK2ΔP) was mutated to Ala-Pro-Phe from the Thr-Pro-Tyr motif in JNK2 (aa. 183-185) (Derijard, B. et al. 1994 Cell 76:1025-1037) using a mutagenesis kit (Stratagene, QuickChange multi site-directed mutagenesis kit, #200514) with the primer 5'

CACTAACTTCATGATGGCCCCTTTCGTGGTGACACGGTAC 3' (SEQ ID NO: 40) (mutant nucleotides are shown in bold) following the manufacturer's instructions. JNK2- tagged V5 in the C terminal was amplified by PCR from the RSV-JNK2 with the sense primer 5' AATTCCGCGGCCGCC ACC ATGAGCG AC AGTAAATGTGA 3' (SEQ ID NO: 41) and the antisense primer 5'

GGTTGGATCCCTAGGTACGCGTAGAATCGAGACCGAGGAGAGGGTTAGGGATA GGCTTACCTTCGAATCGACAGCCTTCAAGGGGTCCCGTCGAGGC 3' (SEQ ID NO: 42). The PCR product was digested with Notl and BamHI, and inserted into the RSV vector. Constitutive IKK2 was constructed by substitution of two Lys at 177 and 181 with GIu (Suh, J. et al. 2002 Prostate 52:183-200). An IKK2 phosphorylation site mutant (IKK2ΔP) was made by changing the amino acid at 44 from Lys to Ala. All PCR products were sequenced.

***

While the present invention has been described in some detail for purposes of clarity and understanding, one skilled in the art will appreciate that various changes in form and detail can be made without departing from the true scope of the invention. AU figures, tables, and appendices, as well as patents, applications, and publications, referred to above, are hereby incorporated by reference.

Claims

WHAT IS CLAIMED IS:

1. A nucleic acid sequence comprising:

(a) a transcription unit encoding a chimeric protein composed of a composite DNA-binding domain and a transcription activation domain,

(b) a transcription unit encoding an immune stimulator expressed under the control of a minimal promoter and an enhancer comprising one or more DNA binding site(s) for the composite DNA-binding domain, and

(c) a transcription unit encoding an immunogen, wherein said composite DNA-binding domain comprises a continuous polypeptide chain containing two or more component polypeptide domains, at least two of which are mutually heterologous.

2. The nucleic acid sequence of claim 1 wherein at least one of the component polypeptide domains is a homeodomain.

3. The nucleic acid sequence of claim 2 wherein said homeodomain is the Oct- 1 homeodomain.

4. The nucleic acid sequence of claim 1 wherein at least one of the component polypeptide domains is a zinc finger domain.

5. The nucleic acid sequence of claim 4 wherein the zinc finger is finger 1 or fmger2 ofZif268.

6. The nucleic acid sequence of claim 1 comprising a composite DNA-binding domain containing a homeodomain covalently linked to at least one zinc finger domain.

7. The nucleic acid sequence of claim 6 comprising the Oct-1 homeodomain covalently linked to zinc finger 1 and/or zinc finger Zif268.

8. The nucleic acid sequence of claim 1 wherein said chimeric protein comprises the peptide sequence of ZFHDl .

9. The nucleic acid sequence of claim 1 wherein said transcription activation domain is the RelA/p65 transcription activation domain.

10. The nucleic acid sequence of claim 1 wherein said DNA binding site is TAATGATGGGCG.

11. The nucleic acid sequence of claim 1 wherein said immune stimulator is selected from the group consisting of a cytokine, a chemokine, a co-stimulatory molecule and a signal transduction activator that increases expression of a co-stimulator.

12. The nucleic acid sequence of claim 11 wherein said immune stimulator is a signal transduction activator that increases expression of a co-stimulator.

13. The nucleic acid sequence of claim 12 wherein said signal transduction activator that increases expression of a co-stimulator is selected from the group consisting of MyD88, TRAF6, IKK2 and JNK2.

14. The nucleic acid sequence of claim 1 wherein said immunogen is an HIV antigen gpl45.

15. A eukaryotic expression construct comprising the nucleic acid sequence of any of claims 1-14 wherein said transcription units are operably linked to expression control elements permitting gene expression in eukaryotic cells.

16. The expression construct of claim 15 wherein said expression construct is a plasmid.

17. The expression construct of claim 16 wherein said expression construct is Delay-IKK2KA-mPGK-gpl45dCFIdV12.

18. A method of achieving delayed expression of an immune stimulator in a cell comprising the steps of: a) providing the expression construct of claim 15, and b) introducing the expression construct into the cell in a manner permitting delayed expression of the immune stimulator in the cell.

19. A method of inducing an immune response in a subject comprising administering the expression construct of claim 15 to said subject to induce an immune response.

20. A method of inducing a prophylactic response in a subject comprising administering the expression construct of claim 15 to said subject to induce a prophylactic response.