WO2007061128A1 - Method for enzymatic modification of n-terminus of protein - Google Patents

Abstract

The object is to provide a protein having the modified N-terminus in a large quantity. Disclosed is a method for preparation of a protein having an N-terminus that has a modified phenylalanine residue. According to the method, in a protein having an Arg or Lys residue at the N-terminus, a modified phenylalanine residue is added to the N-terminal arginine residue with a modified phenylalanine tRNAPhe using a leucine/phenylalanine-tRNA protein transferase (LFPT) capable of adding a Leu or Phe residue to the terminus, whereby a protein having a modified phenylalanine residue at the N-terminus can be prepared.

Description

 Enzymatic modification of protein N-terminus

Technical field

 The present invention relates to the technical field of protein modification or modification. Furthermore, the present invention relates to a technique for modifying or labeling the N-terminal of a protein, and a technique for giving a mutation to the N-terminal of a protein.

 Background art

 Food

 Various attempts have been made to modify or enhance the function of a protein by modifying the protein. For example, it has already been made to extend the residence time in the blood by PEGylating the protein to be administered into the blood.

 For this kind of protein modification, a label is introduced at any position in the peptide chain using amber suppression as a technique for site-specific labeling of the protein to amino acids in the protein during synthesis. As a technique for C-terminal labeling (modification), as a technique for introducing a label into the C-terminus of the peptide chain using a puromycin derivative, or as an N-terminal labeling (modification) method, c-amino group-modified initiation meth A method for introducing a label into the N-terminus of a peptide chain using a yun is known. Among these, for N-terminal labeled protein synthesis, (1) after charging the starting tRNA with methionine, the ct amino group was modified with the desired labeling agent, and (2) the modified methionyl starting tRNA was purified, (3) A method of synthesizing by adding the above-mentioned modified tRNA when synthesizing a protein with an Escherichia coli S30 extract is known. Specifically, the following methods have already been reported (Patent Documents 1-3 and Non-Patent Documents 1-16).

 Patent Document 1 U.S. Pat.No. 6210941 Methods for the detection and isolation of proteins

 Patent Document 2 US Patent No. 6303337 N-terminal and C-terminal markers in nascent proteins

Patent Document 3 US Patent No. 6306628 Methods for the detect in, analysis and i solat ion of nascent prote ins

 Non-patent literature 1 Gi te S., at al. (2000) Anal. Biochem.279, 218-225 Ultrasens it ive fluorescence-based detection of nascent prote ins in gel s Non-patent literature 2 Olejnik J., et al. 2005) Methods, 36, 252-260 N-terminal label ing of prote ins us ing ini tiator tRNA

 Non-Patent Literature 3 Kudl icki W et al. (1994) J. Mol. Biol., 244, 319-331 Chaperone-dependent folding and activat ion of ribosome-bound nascent rhodanese. Analysi s by f luorescence.

 Non-Patent Document 4 Tsalkova T., et al. (1998) J. Mol. Biol., 278, 713-723. Different conformat ions of nascent peptides on rinosomes.

 Non-Patent Document 5 Mcintosh B., et al., (2000) Biochimie, 82, 167-174 Initiation of protein synthesis with th luorphore- et-tRNA (f) and the involvement of IF-2

 Non-Patent Document 6 Ramachandiran V. Et al., (2000) J. Biol. Chem., 275, 1781-1786 r luorphores at the N-terminus of nascent chloramphenicol acethyl transferase pept ides affect translat ion and movement through the ribosorae. Disclosure

 The conventional method is exclusively used as a separation marker for further analysis of proteins prepared by genetic recombination, and does not attempt to supply a large amount of protein modified with amino acids. Furthermore, when the N-terminus is labeled by the conventional method, since the E. coli S30 extract is used, the starting tRNA is also present in the reaction solution, so the labeling efficiency (labeled out of the synthesized protein) The ratio of the proteins that were produced was extremely low, and there was a problem that it was impossible to obtain a large amount of labeled proteins.

Even if the start tRNA present in the translation reaction system is removed or the start codon described in Non-Patent Document 3 is mutated to an amber codon and a suppressor tRNA is used, the appearance rate of the modified protein itself is not Even if it improves, the reaction system becomes large-scale Since this is uneconomical, it was considered difficult to economically supply a large amount of a modified protein or labeled protein having an unnatural amino acid (modified amino acid) at the N-terminus.

 Accordingly, the first object of the present invention is to provide a large amount of N-terminal modified proteins.

 In order to supply a large amount of N-terminal modified protein, the inventors of the present application can modify an unmodified protein by enzymatic treatment, rather than preparing an N-terminal modified protein by genetic recombination. As a result of diligent research, we have developed a method that can enzymatically modify the N-terminus of any protein. I found it.

The inventors of the present application have already introduced a modified phenylalanin (Phe). A modified phenylalanine (PheRS) modified mutant phenylalanin (PheRS) may be referred to as a mutant phenylalanine tRNA synthetase (PheRS). It is used to bind to tRNA ^phe to prepare modified phenylalanyl tRNA ^Phe . Therefore, leucyl / phenylalanyl-tRNA-protein transferase (hereinafter referred to as LFPT) has the ability to add ^Phe from phenylalanyl tRNA ^Phe to proteins with arginine or lysine at the N-terminus. It was investigated whether the modified phenylalanine can be added to the N-terminus of the protein from the modified phenylalanyl tRNA ^Phe . As a result, it was found that the N-terminus of the protein can be modified by using the LFPT.

That is, the present invention relates to a method for modifying the N-terminus of a protein using LFPT and modified phenylalanyl tRNA ^phe .

First, the present invention relates to a protein having an arginine or lysine at the N-terminus, a leucine / phenylanil-tRNA protein transferase (LFPT) having the ability to add leucine or phenylalanin to the terminus. ) Is used to add a modified phenylalanine from the modified phenylalanyl tRNA ^Phe to the N-terminal arginine or lysine to prepare a protein having a phenylalanine modified at the N-terminus.

Secondly, the present invention is designed to reduce the N-terminal by degrading any protein. Prepared arginine or protein having a lysine, similarly to the above, by using the LFPT, modified Hue qualified phenylene Ruara sulfonyl tRNA ^Phe - the Ruaranin by addition to the N-terminal arginine or lysine, the N-terminal A method for preparing a protein having a modified phenylalanine is included.

Third, the present invention prepares a protein in which arginine or lysine is added to the N-terminal side of an arbitrary protein, and in the same manner as described above, LFPT is used to convert the modified phenylalanine from the modified phenylalanyl tRNA ^Phe to N. Including a method of preparing a protein having phenylalanin modified at the N-terminus by addition to terminal arginyl or lysine.

 This specification includes the contents described in the specification and / or drawings of Japanese Patent Application No. 2005-337537, which is the basis of the priority of the present application. Brief Description of Drawings

 Figure 1 shows confirmation of LFPT gene amplification after PCR: After 1% agarose gel electrophoresis, the gel was stained with ethidium bromide. M indicates a marker, and lane 1 is the result of running the PCR product. Lane 1. An amplified band is seen near the arrow in Fig. 1 (about 700 bp), confirming the increase in the target LFPT gene (705 bp).

 The markers are 10, 8, 6, 5, 4, 3.5, 3, 3, 2.5, 2, 1.5, 1, 0.5 kbp from the top.

 Figure 2 shows the restriction enzyme treatment for LFPT gene confirmation after mini-prep: The recovered plasmid was cleaved with the restriction enzyme used for introduction. After 1% agarose gel electrophoresis, the gel was stained with ethidium bromide. M represents a marker, and the plasmid restriction enzyme-treated reaction solution collected in lanes 1 to 4 was flowed. Near the arrow (approx. 700 bp) Since the band derived from the target LFPT gene was confirmed, introduction of the target gene was confirmed.

 The markers are 10, 8, 6, 5, 4, 3.5, 3, 2.5, 2, 1.5, 1, 0.5 kbp from the top.

The # 3 plasmid solution showed the most clear band and was used for transformation.

Fig. 3 shows LFPT expression and purification in ER2566 strain: ER2566 strain was transformed and expressed. After crushing, purification was performed with Ni-NTA agarose. 15% of each sample during purification Analyzed by SDS PAGE. M indicates a protein marker, and 97.4, 66. 2, 42. 4, 30, 20 kDa from the top. Lane 1 is the insoluble fraction, lane 2 is the S30 fraction, lane 3 is the fraction that did not bind to the Ni-NTA agarose resin, lane 4 is the resin wash fraction, and lane 5 is the fraction required. Since a band that seems to be LFPT (about 27 kDa) can be confirmed in lane 1, most of it seems to be in the insoluble fraction. However, in lane 5, a band thought to be LFPT (about 27 kDa) was confirmed, and a part of the expressed LFPT is present in the soluble fraction and is thought to have a histidine tag.

 The markers are 97.4, 66.2, 42.4, 30.0, 20.0 kDa from the top.

Fig. 4 shows confirmation of LFPT aminoamino acid transfer reaction using RI: In order to confirm the activity of LFPT, the amino acid tRNA was prepared in the same reaction system using the radioactive amino acid [ ¹⁴ C] phenylalanine. Transfer to the acceptor protein was measured. After the reaction, they were separated by 15% SDS PAGE and visualized using an imaging plate. M represents a protein molecular weight marker. C shows the results when α casein is used as the receptor protein, and 2 shows the result using EGFP with the ceptin protein treated with TAGZyme, a diaminopeptidase, exposing arginine at the N-terminus. In both lanes C and 2, the band derived from [ ¹⁴ C] phenylalanin can be confirmed, so that it is possible to confirm the transfer activity of LFPT while preparing aminoacyl tRNA in the same reaction system. did it.

 The marker is 170, 130, 100, 72, 55, 40, 33 kDa from the top.

Figure 5 shows the ratio of amino acid transfer by LFPT to various proteins: In order to confirm the chronological change of LFPT activity, aminoacyl tRNA was prepared in the same reaction system using radioactive amino acid [ ¹⁴ C] ferroalanine. The amount transferred to the acceptor protein was measured. Sampling was performed at 0, 10, 20 and 30 minutes, and the amount of [ ¹⁴ C] phenylalanin transferred to the acceptor protein was measured. When using E. coli-derived tRNA ^phe and E. coli-derived PheRS for preparation of the donor phenylalanyl tRNA and α-casein as the acceptor, amino acid transfer by LFPT was confirmed. In addition, even when yeast-derived tRNA ^Phe and yeast-derived PheRS were used to prepare donor phenylalanyl tRNA, amino acid transfer by LFPT was also confirmed. Threos without arginine or lysine at the N-terminus as an acceptor protein In the case of using ur tRNA synthetase (ThrRS) and EGFP, no transposition could be confirmed, whereas in EGFP treated with N-terminal by TAGZyme, amino acid transfer by LFPT was confirmed.

 Figure 6 shows the cloning of pTAG: production of a vector (pTAG) that can be co-expressed with pET21a (+). Using pPR0LarA122, which has a replication origin derived from P15A, as a parent, a multicloning site (MCS) derived from pET21a (+) was introduced.

 Fig. 7 shows the composition of pTAGFRSA and pETFRSB: the yeast-derived PheRS a subunit was introduced into pTAG with Ndel and Notl, and the yeast-derived PheRS / 3 subunit was introduced into pET21a (+) with NdeI and Notl. did. Since these vectors have different origins of replication and different drug resistance genes, it is possible to hold two plasmids on the same host.

 Fig. 8 shows the expression and purification of yeast PheRS-: ER2566 strain was used to express yeast-derived PheRS. Subsequently, purification was performed on Ni-NTA agarose and Phenylsepharose HP columns, and each fraction was analyzed by SDSPAGE. M indicates a protein marker, 97.4, 66.2, 42.4, and 30 kDa from the top. Lane 1 is E. coli-derived PheRS, lane 3 is the S30 fraction after cell disruption, lane 4 is the fraction after purification with Ni-NTA agarose, and lane 5 is the sample purified by Phenyl sepharose HP column. In any of lanes 3 to 5, it was confirmed that bands corresponding to both subunits of the target yeast-derived PheRS could be confirmed and expressed and purified.

Figure 9 shows the measurement of the aminoacylation activity of yeast PheRS: from yeast? In order to confirm the time course of the enzyme activity of heRS, the aminoacylation reaction was measured using the radioactive amino acid [ ¹⁴ C] phenylalanine. Samples were taken at 0, 5, 10, 15 and 20 minutes. Aminoacylation reaction does not occur if the enzyme is not added, but aminoacylation was observed when the enzyme was added, and it was confirmed that the recovered enzyme had a PheRS enzyme function.

Fig. 10 shows the expression and purification of mutant PheRS (T415G and T415A): Expression of fermenter-derived PheRS was performed using ER2566 strain. Subsequently, purification was performed with Ni-NTA agarose, and each fraction was analyzed with SDSPAGE. Lane 1 shows the S30 fraction after disruption of T415A mutant PheRS-expressing cells, and Lane 2 shows the fraction after purification with Ni-NTA agarose. 3 indicates a protein marker, showing 97.4, 66.2, 42.4, 30 kDa from the top. Lane 4 shows the S30 fraction after disruption of T415G mutant PheRS-expressing cells, and Lane 5 shows the fraction after purification with Ni.-NTA agarose. In both lanes 2 and ⁵ , bands corresponding to both subunits of the target yeast-derived PheRS were confirmed, and the expression and purification of each mutant PheRS were confirmed. '

Figure 11 shows the measurement of aminoacylation activity of mutant PheRS (T415G and T415A): To confirm the time course of enzyme activity of mutant PheRS, we used radioactive mino acid [ ¹⁴ C] phenylalanine, The aminoacylation reaction was measured. All of the mutant PheRSs were weaker than the wild type, but it was confirmed that they recognized the original substrate, phenylalanin. -Figure 12 shows the search for unnatural amino acid recognition ability of PheRS using a phenylalanine analog with a substitution at the para position as a substrate: the results of confirmation of the formation of a tripartite complex by gel electrophoresis. ,

 Figure 1 3 is a continuation of Figure 1 2

 Figure 14 is a continuation of Figure 13 Figure 15 is a part of the cloning / express ion region of pET29a: When digested with diaminopeptidase, cleavage occurs at the arrow. When arginine comes out during cleavage, the cleavage reaction is terminated at this site, so that a protein in which arginine is presented at the protein N-terminus can be prepared.

The arrow indicates the cleavage site and the dipeptide whose underline is cleaved. Figure 16 shows the results of 15% SDS PAGE analysis of EGFP TAGZyme digested EGFP cloned products in pET29 treated with TAGZyme. M indicates a protein molecular weight marker, and is 170, 130, 100, 72, 55, 40, and 33 kDa from the top. When α-casein is used as an acceptor protein for C, lane 2 is EGFP treated with TAGZyme, and lane 3 is EGFP not treated. When comparing lanes 2 and 3, a difference in molecular weight was observed with TAGZyme treatment, confirming that EGFP was a substrate for TAGZyme and a cleavage reaction occurred. In addition, since no further degradation products were found, the cleavage reaction stopped with arginine presented at the N-terminus. It is suggested.

 The major force is 170, 130, 100, 72, 55, 40, 33 kDa from the top.

Figure 17: TAGZyme digested amino acid transfer to EGFP and fluorescence: Azidophenylalanine was selected as the vinylalanine analog, and the mutant PheRS was used to prepare the donor aminoacyl tRNA in the same reaction system. However, the transfer to the acceptor protein was measured. After the reaction, a modification reaction is performed with an azide group selective fluorescence modifying reagent, and then separated by 12.5% SDS PAGE and visualized by a fluorescence imager. C shows the result when _α casein is used as the acceptor protein, and 1 shows the result using EGFP in which the receptor protein is treated with TAGZyme, a diaminopeptidase to expose arginine at the N-terminus. In both lanes C and 1, the fluorescence band derived from the azide group selective fluorescence modifying reagent can be confirmed. Therefore, while preparing the azidophenylal tRNA in the same reaction system, the azimuth It was confirmed that = could be transferred.

 Figure 18 shows modification of the N-terminal side of pET_EGFP. : Instead of N-terminal treatment with diaminopeptidase, we modified pET-EGFP to investigate the N-terminal display method of arginine or lysine with Entrokinase. The top shows a part of the sequence from the start codon before modification, and the bottom shows a part of the sequence from the start codon after modification. After the change, the StrepTag sequence was incorporated downstream of the initiation codon, and an Entrokinase cleavage site (EK site) was further introduced downstream. As a result, arginine is exposed by Entrokinase treatment.

Note that the top is before modification and the bottom is after modification.

 In FIG. 19, it was confirmed by 10% SDS PAGE that EGFP modification 1 was cleaved by Entrokinase. : We confirmed the difference in electrophoretic mobility depending on the presence or absence of EGFP Kai 1 Entrokinase treatment. Entrokinase treatment changes about 2.2 kDa. M indicates the protein molecular weight marker, and 97, 66, 42 and 30 kDa from the top. Lane 1 is

Sample EGFP modified 1 treated with Entrokinase, C is untreated EGFP modified 1 From the difference in mobility, it was confirmed that the end treatment was performed by Entrokinase. CBB staining was performed.

Fig. 20 shows Entrokinase digested EGFP modified with tetramethylrhodamine (TMR) fluorescence. 1 Fluorescence detection: Using azidophenylalanine and mutant PheRS, transfer to an acceptor protein was measured while preparing donor aminoacyl tRNA in the same reaction system. After the reaction, a modification reaction was performed with an azide group-selective fluorescence modifying reagent, followed by separation by SDS PAGE and visualization with a fluorescence imager (LAS3000). In the case of C, when Hicasein was used as the acceptor protein, Lane 1 was the result of using EGFP modification 1 in which the acceptor protein was treated with Entrokinase and arginine was exposed at the N-terminus. As a result of using, Lane 3 shows the case where no acceptor protein is added to the reaction. In lane 1, the fluorescence band of tetramethylrhodamine derived from the azide group-selective fluorescence modifying reagent can be confirmed, so the protein that has been treated with Entrokinase to expose arginine at the N-terminus can be used as an acceptor protein. I knew it was possible. Figure 21 shows the PEG modification of Entirokinase digested EGFP modified 1 by PAGE. : After the introduction of azidophenylalanin, an azide group-modifying reagent containing PEG was used, and the product was electrophoresed. The fluorescence signal derived from EGFP used as an acceptor protein was detected by a fluorescence imager (LAS3000). Comparing each lane, the addition of an azide group-modifying reagent with PEG shifts the band derived from EGFP upward, and the difference in the average molecular weight of PEG used for modification is also reflected in mobility. Therefore, it is considered that azidophenylalanine was transferred to EGFP modified 1 treated with Entrokinase by LFPT, and then PEG modification could be introduced by selective modification of azide group ^: drug. BEST MODE FOR CARRYING OUT THE INVENTION

 1. Method for producing modified protein with modified vinylanine at the N-terminus using LFPT

 1 1 1. Preparation of LFPT

LFPT is an enzyme that uses leucyl-tRNA ^Leu or phenylalanyl-tRNA ^Phe as a donor and transfers the tRNA-binding amino acid (leucine or phenylalanin) to a protein as an acceptor. As an acceptor protein, the N-terminal must be arginine or lysine. This enzyme is a protein tube It is believed that there is a reason.

 As long as it has LFPT activity (Leucyl / Phenylalany 卜 tRNA-protein transferase activity), the LFPT used in the present invention can be any LFPT. Furthermore, even a mutant LFPT obtained by mutating a natural LFPT can be used as long as it has the LFPT activity.

 Specifically, as LFPT, one derived from E. coli can be used. Furthermore, 1 to 50 amino acids, preferably 1 to 20 amino acids, more preferably 1 to 10 amino acids are missing from the amino acid sequence of these LFPTs (SEQ ID NO: 1). A mutant LFPT having an amino acid sequence having one or more mutations selected from deletion, substitution, or addition, and represented by the amino acid sequence having the LFPT activity is included. More specifically, 1-50 amino acids, preferably 1-20, with respect to LFPT represented by the amino acid sequence of SEQ ID NO: 1 derived from E. coli and the amino acid sequence represented by SEQ ID NO: 1. Of amino acids, more preferably 1 to 10 amino acids, having an amino acid sequence having one or more mutations selected from deletion, substitution, or addition, and represented by the amino acid sequence having the LFPT activity. Mutated LFPT may be mentioned. .

1-2. Modified amino acid tRNA with modified amino acid bound to tRNA

As tRNA to which a modified amino acid that can be used in the present invention is bound, modified leucyl tRNA ^Leu , and modified phenylalanyl tRNA ^Phe can be used.

 In the present invention, the modified phenylalanine includes a compound represented by the following formula (1).

1

COOH

In the above formula 1, I is hydrogen, hydroxyl group, methoxy or acetyl, R ₃ is hydrogen or hydroxyl group, and R ₄ is hydrogen, halogen, azide group, nitro group, methoxy or acetyl or It is a hydroxyl group.

Preferably, R ₂ in the above formula 1 is 0CH ₃ or 0H, R ₃ is 0H, R ₄ is H, F, Cl, Br, I, N ₃ , N0 ₂ , 0CH ₃ or OH.

 In addition, ί! ^ Decorative fenaluanine is sometimes referred to as phenilalanin analog, and modified leucine is sometimes referred to as leucine analog.

1 一 2— 1. Preparation of Modified Amino Acid tRNA

Modified glycyl tRNA ^Leu and modified furanyl tRNA ^phe can be produced by a conventionally known method such as an organic synthesis method. For example, modified leucine, 'or modified fullanine is used as a substrate. Mutant aminoacyl tRNA synthetase, specifically, mutant LeuRS (Leu-tRNA Synthase) or mutant PheRS (Phe-tRNA Synthase), respectively. It can be prepared by binding to tRNA ^Leu or tRNA ^Phe .

1— 2— 2. Aminoacyl tRNA synthetase

Aminoacyl-tRNA synthetase is an enzyme that exists in all living organisms. In protein synthesis, it uses the hydrolysis energy of ATP to activate amino acids and bind them to transfer RNA (tRNA). In prokaryotes, there are 20 types of aminoacyl tRNA synthetases corresponding to 20 kinds of natural amino acids, and in eukaryotes, there are 20 types of aminoacyl tRNA synthetases present in cytoplasm, and in mitochondria. There are 20 aminoacyl tRNA synthetases. These aminoacyl tRNA synthetases are broadly classified into class 1 and class 2, and class 1 has a signature sequence called HXGH in the amino acid sequence and a nucleotide binding region (Rossmanfield) of KMSKS. . Class I includes aminoacyl tRNA synthetases for arginine, cysteine, glutamine, glutamic acid, isoloicin, leucine, methionine, tryptophan, tyrosine, and parin.

 Class II does not contain these characteristic sequences, and includes aminoacyl tRNA synthetases for each of alanine, asparagine, aspartate, glycine, lysine, ferroalanine, proline, and serine.

The aminoacyl tRNA synthetase for each amino acid catalyzes the process of binding the amino acid to tRNA. For example, phenylalanyl tRNA synthetase (PheRS) is phenylalanin (Phe) + ATP + tRNA ^Phe + PheRS—> AMP + -Reacts with tRNA ^Phe (Phe-tRNA ^Phe ) + PheRS.

 So far, aminoacyl RNA synthases have been collected and reported for various amino acids from various species.

In the present invention, the substrate of LFPT may be leucyl tRNA ^Leu or phenylalanyl tRNA ^Phe , leucyl tRNA synthetase (may be abbreviated as LRS or LeuRS) or ferulanyl tRNA synthetase (abbreviated as FRS or PheRS). Use). '

 1— 2— 3. Mutant aminoacyl tRNA synthetase

 Mutations can be introduced into the aminoacyl tRNA synthetase so that the tRNA can be aminoacylated with a modified amino acid.

 In the present invention, mutation is introduced into leucyl tRNA synthetase (may be abbreviated as LRS or LeuRS) or phenylalanyl tRNA synthetase (sometimes abbreviated as FRS or PheRS), and the modified amino acid is bound to tRNA. Mutant LeuRS or mutant PheRS can be used.

Examples of mutant PheRS include mutants of yeast-derived PheRS. Fermenter-derived PheRS is composed of two α subunits and two β subunits. As the modified PheRS, the subunit is, for example, a PheRS abruni Tyr414 represented by SEQ ID NO: 3 and / or a mutant PheRS in which a mutation is introduced into Thr415, preferably threonine at position 415. PheRS mutated to arayun or dalysin can be used. Note that the sequence represented by SEQ ID NO: 2 can be used as the / 3 subunit of PheRS.

The PheRS / 3 subunit is represented by (1) an amino acid sequence in which 1 to several amino acids are substituted, deleted, and / or added in the amino acid sequence represented by SEQ ID NO: 2. PheRS a subunit is used as a PheRS a subunit: (2) In the amino acid sequence represented by SEQ ID NO: 3, 1 to several amino acids are substituted, deleted, And a mutant PheRS a subunit represented by the amino acid sequence represented by the amino acid sequence or the added amino acid sequence, and at least a mutation is introduced into Tyr414 and / or Thr415, and tRNA ^Phe is Mutant PheRS that can be converted into lulanin can also be used.

 1 — 3. Preparation of modified protein (also called acceptor protein)

 (1) If the target protein to be modified at the N-terminus with modified phenylalanine or modified leucine has arginine or lysine at the N-terminus, the protein can be used as it is as a substrate for LFPT.

(2) Modified phenylalanin or modified 'leu. When the N-terminus of the protein to be modified with leucine is not arginine or lysine, peptidase is used to make arginine or lysine N In the end, a protein to be modified (an acceptor protein) can be prepared from the target protein. As the peptidase, for example, endopeptidase or exopeptidase can be used. Endopeptidases include enterokinase (cleaves DDDDKX between DDDDK and X), FactorXa (cleaves after IE / DGR. The part represented by / in the amino acid sequence is the amino acid before / The following can also be used: the same after the geneaseKPGAAHY), the SUM0 protease (which recognizes and cleaves the SUM0 protein), and the like. It is also possible to prepare an acceptor protein from the N-terminal side by acting an exopeptidase. In this case, use aminopeptidase, diaminopeptidase, etc. The diaminopeptidase is preferably an enzyme that terminates the quenching reaction with arginine or lysine. For example, TAGzyme can be used. ■,

 (3) If the N-terminus of the target protein is other than Argyyun or lysine and it is intended to modify the N-terminus with a modified pheralanine or modified leucine without impairing the overall length of the target protein, the N-terminus of the target protein Prepare to add an amino acid sequence upstream. For example, a gene encoding a target protein with an additional sequence, in which a base sequence encoding the amino acid Met_Xaa-Arg / Lys is added upstream of the base sequence encoding the target protein, is expressed by genetic recombination. By treating the Met-Xaa-Arg / Lys-target protein obtained in this way with a diaminopeptidase such as TAGZyme according to the method (2) above, arginine or lysine is added to the N-terminal of the target protein. A modified protein (acceptor protein) can also be prepared. 'Or, the gene is designed to have arginine or lysine downstream of the signal cleavage position of the signal peptide, and arginine or lysine is used as the N-terminus of mature protein poor after cleavage after signal peptide cleavage. Can be obtained.

2. Process for producing modified protein with modified phenylalanine or modified leucine at the N-terminus using LFPT

By treating a protein (acceptor protein) having arginine or lysine at the N-terminus in the presence of LFPT, modified phenyl 'nyl tRNA ^phe or modified roysil-tRNA ^Leu prepared in 1 above, The N-terminus of the ceptor protein can be modified with the modified phenylalanin or modified leucine.

Furthermore, modified Fuweniruaraniru tRNA ^Phe or modified leucyl tRNA, respectively a modified phenyl Aranin or modified leucine, it can be prepared by coupling in the presence of the mutant type FRS or mutant LRS to tRNA ^Phe or tRNA ^Leu, modified Fueniruaraniru tRNA ^Phe or Preparation of modified leucyl tRNA ^Leu and transfer reaction of modified phenylalanine or modified leucine with LFPT can be carried out in the same step (same reaction solution). Thus, the tRNA ^Phe reproduced by transferring from modified Hue Niruaraniru _t RNA ^Phe modified phenylene Ruaranin the N-terminal of the protein, again using modified phenylene Ruaranin and mutant FRS It is more efficient because it can be prepared into a modified file tRNA ^Phe . For example, (1) the N-terminal can be modified with the above-mentioned modified phenolin by treating a protein having arginine or lysine at the N-terminal in the presence of LFPT, tRNA ^Phe , or mutant FRS. (2) The N-terminal can be modified with the modified leucine by treating a protein having arginine or lysine at the N-terminal in the presence of LFPT, tRNA and mutant LRS.

 Specifically, for example, para-azido-phenylalanine is used as a modified pheneno-alanine, and para-azido-phenylalanine is introduced at the N-terminus of a protein (acceptor protein) having arginine or lysine at the N-terminus. be able to. The introduced para-azido-phenylalanine can be used as, for example, a cross-linker, using azide group-modifying reagents, adding polyethylene glycol, and adding a labeling molecule such as a fluorescent molecule or piotin. Etc. are possible.

 [Reference Example 1]

 1. Preparation and activity confirmation of Leucyl / phenylalanyl-tRNA-protein transferase

 1-1. Amplification of LFPT gene

 The LFPT gene was amplified from E. coli genomic DNA by PCR (Polymerase Chain Reaction). The primers used for PCR have the following sequences. Primer

1: GGGGCCATGGCCCGCCTGGTTCAGGCT, primer 2: GGGGCTCGAGTTCTTGTGGTGAAAACA was used. The composition and reaction conditions for the PCR reaction are as follows. PCR reaction solution is lOXpyrobest buffer (kit supplied) 5juL, dNTPmix (kit supplied) 4 and primer 1 (lOOpmol / μΐ) ll primer 2 (100 pmol // iUl; uL, E. coli genomic DNA 1 L, and pyrobest DNA polymerase (5 U / L) 0.5 μί was prepared as 50 L with dH ₂₀ .

The PCR reaction was pre-denatured at 98 ° C for 4 minutes, denatured at 98 ° C for 10 seconds, annealed at 55 ° C for 30 seconds, and extended at 72 ° C for 1 minute for 30 cycles.

 The PCR product was ethanol precipitated by adding 1/20 volume of 5 M NaCl aqueous solution. The precipitate was dried under reduced pressure to recover the DNA fragment.

 The recovered DNA fragment was subjected to 1% agarose gel electrophoresis to confirm amplification of the LFPT gene. The results are shown in Fig. 1. In Figure 1, M is: Marker (10, 8, from top)

6, 5, 4, 3.5, 3, 2.5, 2, 1.5, 1.2, 1.03, 0.9, 0.8, 0.7, 0.6, 0.5, 0.4, 0.3, 0.2, 0.1 kbp).

 1 represents the sample after the PCR reaction, and the arrow indicates the amplified LFPT gene. From Fig. 1, a band was detected at almost the same length as the expected chain length of the LFPT gene, confirming the amplification of the LFPT gene.

1 — 2. Cloning to pET22b

Ethanol precipitated and the remaining PCR product dH ₂ Facial Been 15Ju L to dissolve 6 X loading dye a 2 / L Ka卩E, was carried out for 30 minutes electrophoresed on 1% Agarosugeru. This was immersed in a solution of 0.5 ig / mL ethidium bromide for 10 minutes, the target band was confirmed with UV at a wavelength of 366 nm, and cut with a razor. EASYTRAP ™ was used for DNA extraction from the gel pieces, and the following procedure was performed according to the protocol. Add 3 times the amount of Nal solution of the excised gel, incubate at 55 ° C for several minutes, dissolve the gel, add lOw L glass powder, mix well and let stand for 5 minutes at room temperature to adsorb DNA After that, it was centrifuged at OOOrpm for 10 seconds. The supernatant was removed, 500 zL of washing buffer was added and well suspended, and then centrifuged at 10, OOOrpm for 10 seconds (this operation was repeated twice). Supernatant as possible was _removed, Η ₂ 0 20 μ ί Caro example, after extracting the DNA by incubating at 55 ° for 5 minutes, and centrifuged for 2 min at 10, OOOrpm. After recovering the supernatant, the extraction procedure was repeated once. The recovered DNA solution was incubated at 55 ° C for 5 minutes, centrifuged at 10, OOOrpm for 2 minutes, and the supernatant was transferred to another tube. In order to incorporate the recovered DNA fragment into the pET22b vector, it was digested with Nco I and Xho I. The composition of the reaction solution was determined at 37 ° C with the following guidance. The composition of the digestion reaction solution is 10 XR buffer (attached with restriction enzyme) 3 Collected DNA fragment 19 L, Nco 1 (10 Ό / μ 1) 2 / xL, and Xho 1 (10 U / _w L) 2 / z L It was prepared in dH ₂ 0 30 / L. pET22b was similarly digested with Nco I and Xho I.

 Each digest was mixed, and 0.1 A260 unit of yeast tRNA mixture was added as a carrier, followed by ethanol precipitation. The precipitate was dried under reduced pressure, a reaction solution was prepared as follows, and a ligation reaction was performed. The reaction uses Nibonbon Ligation Pack,

Performed at 16 ° C for 2-3 hours. Incidentally, Ligation reaction solution was lOXLigation buffer 2 ju, the precipitate as DNA mixture was BSA with (kit in the attached) 2.5 z L, T4 DNA Ligase 0.5 L with dH ₂ 0 and 20 L.

Add the solution after the ligation reaction to 100 μL of JM109 strain competent cell, For 5 minutes, spread the solution on a plate of LB-amp medium, and leave it at 37 ° C. The colonies that grew were subjected to the Mini-prep. Method, and the plasmid DNA was recovered. This plasmid DNA was named pET-LFPT.

 The Mini-prep. Method (alkali method) was performed according to the following procedure. The plasmid DNA was prepared by the alkaline method according to the following procedure. The colonies that had grown on the plate were picked with a toothpick, inoculated into 2 mL of LB-amp (50 g / mL ampicillin) medium in a test tube with an aluminum cap, and cultured at 37 ° C with shaking. 1.5 mL of the bacterial cell culture solution was dispensed into an Eppendorf tube and centrifuged at 10,000 rpm for 2 minutes to collect the cells. The medium was removed as much as possible, the cells were suspended in 100 L of Solution I, 200 L of Solutionll was added, and the tube was moved up and down and gently stirred. Next, after 150 ml of Solutionlll was added and stirred further, 150 // L of phenol: formal mouth (1: 1) solution was added, suspended sufficiently, and centrifuged at r2,000 rpm for 10 minutes. The upper layer was collected and ethanol precipitated. The precipitate obtained by centrifugation was dissolved in 30 L TE Buffer. Solution I (TE-Glucose Buffer) contains Tris-HCl (pH 7.6) 25 mM, EDTA-Na (pH 7.0) 10 mM, and Glucose 50 mM.

Further, Solutionll is, NaOH 0 · 2M, a SDS1%, Solutionlll (lOOmL) is, 5M acetate force Li um 60 mL, glacial acetic acid 11.5 mL, dH ₂ 0 28.5 mL force, Ranaru. TE buffer contains Tris-HCl (pH 8.0) 10 mM, and EDTA (pH 8.0) 'lm.

 (Result)

 After ligation with pET22b, it was confirmed whether the LFPT gene was integrated. The result is shown in figure 2. pET_LFPT was digested with Nco I and Xho I. This was subjected to 1% agarose gel electrophoresis.

 M is a marker (from the top 10, 8, 6, 5, 4, 3.5, 3, 2.5, 2, 1.5, 1.2, 1.03, 0.9, 0.8, 0.7, 0.6, 0.5, 0.4, 0.3, 0.2, 0.lkbp ).

 1-4 show the sample after digestion reaction of pET-LFPT. Since the band was consistent with the prediction, it was confirmed that the pET-LFPT plasmid was constructed.

 1 1 3. Expression

In addition, plasmid DNA prepared in a competent cell of E. coli ER2566 strain was added to about lng, and transformation was performed using an LB-amp plate. Growing mouth-- Was inoculated into 100 mL of LB_amp medium with platinum ears and cultured at 37 degrees. When the turbidity (A600) reached 0.7, add 0.5M Isopropyl- 3-D-thiogalactopyranoside (IPTG) 1/1000 volume of the medium (final concentration 0.5 mM) and shake at room temperature overnight. . Thereafter, the culture solution was transferred to a 50 mL tube and a 1.5 raL tube, and centrifuged at 4 ° C and 6, OOOrpm for 10 minutes, respectively. After removing the supernatant, the remaining culture solution was added to the same 50 mL tube, and further centrifuged at 4 ° (:, 6, OOOrpm for 10 minutes to remove the supernatant, and the cells were stored frozen at -80 ° C.

 1-4. Purification of LFPT by Ni-NTA Agarose column.

The bacterial cells collected in a 50 mL phenolic tube are mixed with 15 mL of the above Sonication Buffer (20 mM Tris-HCl (pH 7.6), 1 mM MgCl ₂ , 0.2 M NaCl, 6 mM) 3-ercaptoethanoU 5 ° / o glycerin The cells were disrupted by sonication for 15 minutes and centrifuged at 30, OOOxg for 30 minutes (4 ° C). The supernatant was designated as S30. .

Poly-Prep Chomatography Colum (BI0-RAD) was filled with IraL of Ni-NTA Agarose, equilibrated with Sonication Buffer lOmL, and S30 was loaded. Thereafter Wash Buffer (20mM Tri s-HCl (pH7. 6), ImM MgCl 2 0. 2 NaCl, 6mM β -Mercaptoethanol, 5% glycerol,及Pi lOmM imidazole) and washed with lOmL, Elut ion Buffer (20mM Tri s_HCl ( Elution with 8 mL of pH 7.6), ImM MgCl ₂ , 0.2 NaCl, 6 mM i3-ercaptoethanol, 5% glycerin, and lOraM imidazole). As a result of 15% SDS PAGE, an LpPT band was confirmed (Fig. 3), and the eluate was concentrated to about 400 / L using Amicon Ultra, and was designated as LFPT. The purified LFPT was stored at _80 ° C.

 1 — 5. Measurement of LFPT activity using RI labeling.

In order to measure the enzyme activity, the following reaction solution was prepared and reacted at 37 ° C for 30 minutes. The composition of the reaction solution is 5 X AAM (Tris-HCl (pH 7.6) 500m, MgCl ₂ 50mM, KC1 200mM, and ATP 20m) 4 / i L, LFPT 2 / i L, tRNA ^Phe 0.1 A260unit, ¹⁴ C phenylalanine (394raCi / ramol) 1 μL, PheRS (0. lmg / mL) 1 L, acceptor protein (α-casein or TAGZyme-treated EGFP) 50 pmol to 20 μL with dH ₂ 0 Prepared.

 The reaction solution was subjected to 15% SDS PAGE, and the gel was subjected to image analysis using a bioimaging analyzer BAS-2500 (Fig. 4).

The reaction solution was spotted on a filter paper, washed with 5% TCA at 98 ° C for 20 minutes, and then shaken with 5% TCA at 4 ° C for 5 minutes. This was repeated three times. Filter paper water with ethanol The amount of [ ¹⁴ C] Phe incorporated into ct-casein was evaluated by measuring the radioactivity remaining on the filter paper with a liquid scintillation counter after the sample was sufficiently dried (Fig. 5).

 [Reference Example 2]

Preparation and activity confirmation of phenylalanyl tRNA synthetase

 1— 1. Create a co-occurrence 'current vector

 A vector for co-expression with the pET vector was prepared. Figure 6 shows the outline of the procedure. Based on the vectors pET 21-a (+) and pPROLar. A122, primer 1 (corresponds to T7 promoter of pET21-a (+)): 5 '-GGG GTA CCT AAT ACG ACT CAC TAT-3', ' Primer

2 (corresponds to T7 terminator of pET21-a (+)): 5 '-GGG GTA CCC AAA AAA CCC CTC AAG-3' Primer 3 (corresponds upstream of pPROL r. A122MCS): 5 '-GGG GTA CCT CGA CAG TTC ATA GGT-3 ', Primer 4 (corresponding to the downstream of pPROLar. A122MCS): 5'-GGG GTA CCG GAT ATA TTC CGC TTC-3' was designed. Each primer has a Kpnl restriction enzyme recognition site.

First, perform PCR reaction (1) using primers 1 and 2 with the following reaction composition ft. PCR reaction solution is 10 X pyrobest buffer (kit supplied) 5 rep dNTP mix (kit supplied) 4 μύ Primer 1 (100 pmol / zi L) 0.5 μL, Primer 2 (lOOpmol / 1) 0.5 μL, pET21 -a (+) 0.05 ug> and pyrobest DNA polymerase (5 U // z L) 0.5 L were prepared with 50 d of 'dH ₂ O. The PCR reaction was pre-denatured at 95 ° C for 2 minutes, denatured at 95 ° C for 10 seconds, annealed at 55 ° C for 30 seconds, and extended at 72 ° C for 1 minute for 30 cycles. This PCR product is designated as PCR product (1).

Similarly, PCR reaction (2) was performed using primers 3 and 4 with the following reaction composition. PCR reaction solution is 10 X pyrobest buffer (kit supplied) 5 μdNTP mix (kit supplied) 4 / xL, primer 3 (100 pmol / μL) 0.5 / i L, primer 4 (lOOpmol / μL ) 0.5 ^ L _s pPROLarA.1220.g and pyrobest DNA polymerase (5 U / 〃 0.5

/ L was prepared to 50 zL with dH ₂ O. PCR reaction is 30 cycles of pre-denaturation at 95 ° C for 2 minutes, denaturation at 95 ° C for 30 seconds, firing at 55 ° C for 30 seconds, and extension at 72 ° C for 2 minutes. went. This PCR product is designated as PCR product (2).

After the reaction, electrophoresis was performed on a 1% agarose gel for 30 minutes. This is 0.5 / ig / mL. The sample was immersed in a solution of thymium bromide for 10 minutes, the target band was confirmed with UV at a wavelength of 366 nm, and cut with a razor. EASYTRAP ™ was used for DNA extraction from the gel pieces, and the following procedure was performed according to the protocol. Add 3 times the amount of Nal solution of the excised gel, incubate at 55 ° C for several minutes, dissolve the gel, add lO ^ uL glass powder, mix well and let stand at room temperature for 5 minutes to adsorb DNA Thereafter, lOOOOrpmXIOsec was centrifuged. The supernatant was removed, 500 L of washing buffer was added and well suspended, and then centrifuged at lOOOOrpmXIOsec (repeated twice). The supernatant was removed as much as possible, H ₂ 020 / il was added, and DNA was extracted by incubating at 55 ° C for 5 minutes, followed by centrifugation at 10,000 rpm for 2 minutes. After collecting the supernatant, the extraction operation was repeated once more, and the collected 40 DNA solutions were incubated at 55 ° C for 5 minutes and then centrifuged at 10000 rpm for 2 minutes, and the supernatant was transferred to another tube.

 PCR product (1) After purification by EASYTRAP ™ (1) One-fifth of the solution and the total amount of PCR product (2) solution were mixed, and yeast tRNA mix 0.1 A260 unit was added as a carrier, followed by ethanol precipitation.

The collected precipitate was digested with Kpnl. The composition of the reaction solution was as follows and was performed overnight at 37 ° C. The composition of the digestion reaction solution was ΙΟΧΚρη I buffer (with restriction enzyme) 2 / L, the recovered DNA fragment, and Kpn 1 (1011 / /) .3 / 丄 (111 ₂ 0 to 20 / ^).

After the digestion reaction, ethanol precipitation was performed. The precipitate was dried under reduced pressure, a reaction solution was prepared as follows, and a ligation reaction was performed. The reaction was carried out for 3 hours at 16 ° C using a Ligation Pack from Nibonbon Gene. Incidentally, Ligation reaction. Solution, lOXLigation buffer 2 / zL, the precipitate as a DNA mixture (supplied with kit) BSA 2.5 μ L, and was prepared T4 DNA Ligase 0 · 5μ L in the 20 [mu] L with dH ₂ 0.

 After the ligation reaction, the XL-1 Blue combi- tive cell 100 squeezed force!], Left on ice for 5 minutes, spread the solution on the LB-amp medium plate, and left at 37 ° C. did. The colonies that grew were subjected to the Mini-prep. Method, and the plasmid DNA was recovered. This plasmid DNA was named pTAG. Whether it has the target sequence was confirmed using Hitachi DNA Sequencer SQ5500E.

 1 One 2. Preparation of pTAGFRSA and pETFRSB

In order to clone the yeast PheRS gene into pTAG and pET21_a (+), the entire Saccharomyces cerevisiae genome, IJ Nakatsuji, and the PheRS α subunit Primer 5 (corresponds to ct gene-5 'end, including restriction enzyme sites of Pstl and Ndel): 5'- GGG GCT GCA GCA TAT GTC TGA CTT CCA ATT AGA-3 ', Primer 0 gene-Adapted to the 3' end. Contains restriction sites for Pst I and Not I. ): 5'-GGG GCT GCA GGC GGC CGC TTA TTC GTA CAA GTC TTC GT-3 ', primer 7 (corresponds to 3 genes-5' end, including Pst I and Ndel restriction enzyme sites): 5 ' -GGG GCT GCA GCA TAT GCC TAC CGT CTC CGT GAA CAA-3 ', Primer 8 () 3 gene-Corresponds to the 3' end, and contains restriction sites for Pstl and Notl. ): 5'_GGG GCT GCA GGC GGC CGC TAG GAA GAC TTC GGC CAT-3, and the DNA fragment was amplified by PCR. ',' First, PCR was performed using primers · 5 and 6 with the following reaction composition to amplify the _α subunit gene of PheRS. LOXpyrobest buffer (with kit) 5 // L, dNTPmix (with kit) 4 _W L, primer 5 (lOOpmol / iu L) 1 L, primer 6 (l, 00pmol // L) l Yeast genomic DNA 1 μL, and pyrobest DNA

Was prepared to 50 L with dH ₂ O. The PCR reaction was pre-denatured at 95 ° C for 2 minutes, denatured at 95 ° C for 10 seconds, annealed at 55 ° C for 30 seconds, and elongated at 72 ° C for 1 minute for 30 cycles. . .

 PCR was performed using primers 7 and 8 with the same reaction composition and program as above, and a) 3 subunit genes were amplified.

 After the reaction, electrophoresis was performed on a 1% agarose gel for 30 minutes. This was immersed in a solution of 0.5 · g / ml ethidium bromide for 10 minutes, the target band was confirmed with UV at a wavelength of 366 nm, and cut with a razor. EASYTRAP ™ was used for DNA extraction from the gel pieces, and the following procedure was performed according to the protocol.

In order to incorporate the recovered PheRS α subunit gene and subunit gene into each vector, digestion was performed with Ndel and Notl, respectively. The composition of the reaction solution was as follows, and was performed at 37 ° C. Digestion reaction composition, lOXRbuffer (restriction enzyme attached) 2 // L, recovered DNA fragment precipitation, NdeI (10U / L) l L, and Notl (10U / μ L) in the 20μί a 1 L with dH ₂ 0 Prepared. pET21-a (+) and pTAG were similarly digested with Ndel and Notl.

The α-sublet gene digest of PheRS is mixed with the pTAG digest and mixed with ethanol. As a result, the / 3 subunit gene digest of PheRS was mixed with PET21-a (+) digest and subjected to ethanol precipitation. The precipitate was dried under reduced pressure, and a reaction solution was prepared as follows, and a ligation reaction was performed for each. The reaction was carried out using Nibonbon Ligation Pack for 2 to 3 hours at 16 ° C. The Ligation reaction solution was 10 μL Ligation buffer 2 μΙ, the precipitate as a DNA mixture, BSA (attached to the kit) _2.5 L, and T4 DNA Ligase 0.5 was adjusted to 20 L with dH 20.

After the ligation reaction, force XL-1 Blue combiton and Tocel 100 μL]], leave on ice for ⁵ minutes, spread the solution on the LB-amp medium plate, and leave it at ³⁷ ° C. did. The colony that has grown is subjected to the Mini-prep. Method, and the plasmid DNA is recovered. This plasmid DN.A was named pTAGFRSA and pETFRSB. Whether the target sequence was present was confirmed using Hitachi DNA Sequencer SQ5500E. Figure 7 shows the structure of each vector. ".

 1 — 3. Expression of PheRS

To express yeast PheRS, pETFRSB was added to E. coli ER2566 competent cells, transformed, spread on a LB-amp plate medium with a congeal rod, and left at 37 ° C. While one of the colonies on the plate medium was picked with a toothpick and cultured at 37 ° C in LB-amp medium, the turbidity (0D600) of the culture solution was measured at 600 nm, and the OD600 was 0.3-0. When 4 was reached, the culture was cooled on ice for 15 minutes and collected. Remove the culture medium from the supernatant, and add 1 x TSS (10 g / b Bacto-tryptone, 5 g / b Bacto-yeast extract, lOg / L NaCl, 10% PEG 6000 (w / v), 50 mM MgCl ₂ , And 5 ° /. Dimethyl sulfoxide) was added, frozen in liquid nitrogen and stored at -80 ° C.

 Add plasmid pTAGFRSA to ER2566 competent cells with pETFRSB and perform transformation in the same manner as above, then add LB-50 μg / mL ampicillin in 25 g / mL kanamycin (LB-ampkan) pre-culture medium. Spreaded with a stick and incubated at 37 ° C. The colony produced on the plate medium is inoculated with a toothpick into the LB-ampkan medium and cultured at 37 ° C. When 0D600 reaches 0.7 to 0.9, the culture medium is isopropyl- / 3 -D (- ) -thiogalactopyranoside (IPTG) was added to a final concentration of 500 M, and further cultured at 37 ° C. for 4 hours for expression.

1 1 4. Purification of yeast PheRS In order to purify the expressed yeast PheRS ', the cells of the obtained culture broth were mixed with Sonicati0n Buffer (20 mM Hepes-KOH (pH 7.0), 1 mM MgCl ₂ , 0.2 M NaCl, 6 mM i3-ercaptoethanol , And 5% glycerin), and the cells were sonicated with a Bioruptor and centrifuged to obtain the S30 fraction. Load the S30 fraction sample into a pre-equilibrated Ni-NTA agarose column chromatograph, and use the UV monitor with the Sonication Buffer and Wash Buffer (Sonication Buffer solution containing 10 mM imidazole). The ram was washed until the peak disappeared, and the sample was eluted with Elution Buffer (250 mM imidazole Sonicatipn Buffer solution). The portion where the peak appeared was collected while observing A280 with a UV monitor. Equal amounts of HG. 3 Buffer (40 mM HEPES-K0H (pH 7.0), 2 mM MgCl ₂ , 3M (NH ₄ ) ₂ S0 ₄ , 10% Glycerol, 12 mM β-Mercaptoethanol, and 100 M pABSF HG 1.5 Buffer (20 raM HEPES-KOH (pH 7.0), 1 mM MgCl ₂ , 1.5 M (NH ₄ ) ₂ S0 ₄ , 5% Glycerol, 6 mM β-MercaptoethanoK) And 50 M 'pABSF) equilibrated with Phenyl Sepharose HP column (resin volume 8 ml), and flow HG 1.5 Buffer at a flow rate of 2 mL / min until A280 on UV monitor is below 0.03. did. Then HG 1. 5 Buffer and HG 0 Buffer (20m HEPES-KOH (pH7. 0), ImM MgCl 2, 5% Glycerol, 6mM β -Mercaptoethanol, and 50 M pABSF) using a 150 at a flow rate of 2 mL / min The sample was eluted by applying a linear ammonium sulfate concentration gradient from 1.5 M to 0 M over a period of minutes. This was subjected to 10% SDS-polyacrylamide gel electrophoresis (PAGE), and the target protein was detected and examined with the CBB staining solution (Fig. 8). Figure 8. Lanes 4 and 5 confirm the expression and purification of yeast-derived PheRS because a band was confirmed at the estimated molecular weight position.

 1-5. Measurement of yeast PheRS activity

 In order to measure the activity of the enzyme, an aminoacylation reaction was performed using C phenylalanine. After removing the enzyme with the following reaction composition, the reaction solution was kept at 30 ° C for about 5 minutes, and then the enzyme was added. Incubate at 30 ° C for 0, 5, 10, 15, 20 minutes each time

Spotted on a filter paper moistened with 5% TCA and soaked in 5% TCA. After spotting the reaction solution for each hour, 5% TCA was thrown away and fresh 5% TCA was added to the beaker and shaken for 10 minutes. After repeating this twice, add ethanol and shake gently. Dry under electric light. After that, it was immersed in a scintillator and the count was measured with a liquid scintillation counter.

The composition of the aminoacylation reaction solution was prepared by adding 10 μL of 5XAAM (Amino Acylation Mixture), tRNA ^Phe 0.05 A260 unit of yeast, 0.126 / g of yeast PheRS, and 1 μL of ¹⁴ C ferulalanin in dH ₂₀ .

5XAAM (Amino Acylation Mixtufe) contained Tris-HCl (H 7.6) 500 mM, MgCl ₂ 50 mM, KC1 200 mM, and ATP 20 mM. , '

 For the scintillator, Dotite. DPO 4g and Dotite P0P0P 0. lg were prepared in 1 L with toluene. ,

 The results are shown in FIG. In the absence of the enzyme, no acceptance was seen, and when the enzyme was added to the reaction, the acceptance was seen, so it was confirmed that what was expressed was PheRS. Example 1,-

Preparation and activity verification of mutant phenylalanyl tRNA synthetase

 1. Preparation of mutant funinyllanil tRNA synthetase (mutant PheRS)

 In order to prepare the yeast mutant PheRS, amino acid sequences of various PheRSs were compared, and a phenylalanin binding site was estimated. In order to mutate threonine at position 415 of α. Gene to alanine or glycine, primer based on pTAGFRSA sequence

9: 5'-CTA CAA TCC TTA CGC TGA GCC ATC AAT G-3 'and primer 1 0: 5'-CAT

TGA TGG CTC ACC GTA AGG ATT GTA G-3 ′ DNA sequence was designed.

'The αTAG expression plasmid pTAGFRSA was modified by PCR using the above two primers. The reaction solution is 10 X pyrobest buffer (enzyme attached) 5 i L, dNTP mix (enzyme attached) 4 L, primer 9 (l00pmol / zL) l ^ u L, primer 1 0 (lOOpmol / Dl ^ l, pTAGFRSAO. 05 μg, and pyrobest DNA polymerase (5 U / μL) 0.5 / i L was prepared at 50 / L with dH ₂₀ 0. The PCR program was pre-denaturing at 95 ° C for 2 minutes, with a denaturation of 95 ° A cycle of 30 seconds at C, annealing at 50 ° C for 1 minute, and elongation at 12. for 10 minutes was 16 cycles.

After the reaction, Dpn 1 (10 U / L) was added to the reaction solution and incubated at 37 ° C. for 1 hour to cleave the template, pTAGFRSA. Add 20 / L of the reaction solution after Dpn I treatment to XL-1 blue competent cells, perform transformation, and use mini-prep to prepare the target plasmid. Recovered. By checking the Hai歹IJ, plasmid _(P TAGFRSAt415a, _P TAGFRSAt415g) to Thr415 of PheRS a gene pTAGFRSA is mutated to Ala or Gly, it was confirmed that could be prepared.

 Expression and purification were performed in the same manner as in [Reference Example 2] wild-type yeast PheRS.

 Furthermore, the activity was measured by the same method as 1-5 in [Reference Example 2].

 The results are shown in Fig. 10 and Fig. 11, respectively.

 Fig. 10 In lanes 2 and 5, a band was confirmed at the estimated molecular weight, indicating that expression and purification of both types of yeast-derived mutant PheRS were confirmed. In addition, as shown in Fig. 11, when the enzyme is missing, no receptor is seen, and when the enzyme is added to the reaction, although it is weakly accepted, each mutant PheRS uses phenylalanin as a substrate. It turns out that it has the ability to recognize.

Example 2, '

Search for unnatural amino acids that can be recognized by wild-type PheRS and mutant-type PheRS

 EF-Tu and EF-Ts form a complex, forming a complex of (EF- Tu · EF_Ts) 2. When GTP contacts this complex, EF_Ts dissociates, and when aminoacyl tRNA is present, · EF- Tu · GTP complex is formed. EF-Tu has the ability to bind and form a complex with an aminoacyl-tRNA, but does not bind to tRNA. Complexes bound with aminoacyl tRNA, unreacted EF-Tu, unreacted tRNA (non-aminoacylated tRNA) were separated by gel electrophoresis and bound to any aminoacyl tRNA using the difference in mobility. Aminoacylation can be determined based on whether the complex can be confirmed. In gel electrophoresis, the unreacted tRNA that flows fast is EF-Tu, etc., which is visible at the top, and the complex (intermediate level in the gel results) is between them.

 Specifically, unnatural amino acids that can be recognized by wild-type PheRS (wtPheRS) and mutant-type PheRS (T415G and T415A) were searched using the difference in mobility of the tripartite complex by gel electrophoresis. In order to examine the formation of the ternary complex, a reaction solution was prepared using wtPheRS, T415A, and T415G, and reacted at 37 ° C for 20 minutes. Reaction solution is 5 X Tu Buffer

(Tri s- HCl (pH7. 6 ) 250mM, MgCl 2 25mM, KC1 250mM, NH 4 C1 250m, and '3

-Mercaptoethanol 25 mM) 2 and 5 mM GTP 2 μL, lOm ATP 2 μL, T. th.EF-Tu 100 pmol,

T. th. EF-Ts lOpmoK yeast tRNA ^Phe 0. 036A260unit, wtPheRS (or mutant PheRS <T415A, T415 0.04 g, and phenylalanin analog Inmol were added to a total volume of 10 μm with dH ₂ 0.

 After the reaction, lxTAM 6% PAGE was performed using 6 X LS (ΒΡΒ 0: 25 ° /., Xylene cyanol 0.25% and glycerin 30%). After electrophoresis, it was stained with CBB staining solution, sufficiently decolorized, and then stained with 0.3% methylene blue / 1 M AcOH Buffer (pH 4.7) to detect the band. ΙχΤΑΜ is a solution containing Ti11s base 2511 ^, acetic acid 25 mM and magnesium acetate 5 mM. The results are shown in Fig. 12 to Fig. And Table 1. .

table 1

PheRS PheRS (T414G) PheRS (T414A)

L-Phe ○ ○ ○

 L-p-F-Phe ○ ○ ○

 L-p-Cl-Phe O ○ ○

 L-p-Br-Phe X 〇-

L-i I-Phe X 〇-

L-p-Azido-Phe X 〇-

L-p-Benzozy-Phe X X-,

Lp-N0 ₂ -Phe X 〇-

L-3,5- (N0 ₂ ) ₂ -Phe XX-

L-3,5- (I) ₂ -Phe XX-Les 3,3,5- (I) ₃ -Phe XX-

L-p-OMe-Phe X 〇-

L-p-OPhospho-Phe X X-

L-o-methoxy-Phe X O 〇

 L-3- (1 -Naphty 1)-Alanine X X-Les Tyr X ○-

L-p-O-DANSYL-Tyr X X-o-Tyr ○ ○-m-Tyr ○ ○

 L-DOPA X X ―

 Les Trp X ○-

L-Τ -ΟΗ X 〇-

Example 3

 Preparation of acceptor protein using TAGZyme and modification of N-terminal of acceptor protein

 (1) Preparation of N-terminal arginine EGFP using TAGZyme

TAGZyme is an N-terminal specific dipeptidase (sometimes abbreviated as DAPase) that has been commercialized by QIAGEN. TAGZyme is called the stop point, the force that cleaves the N-terminal dipeptide, lysine, arginine, proline, or glutamine Dipeptide cleavage ends when appears at the N-terminus (Table 2).

 Table 2

 TAGZyme stop point in front of bold amino acid ()

 Since the EGFP used in this study has been cloned into pET29, it is thought that arginine appears at the N-terminus when N-terminal specific dipeptidation with TAGZyme is performed (Fig. 15). . It was thought that amino acid transfer reaction occurred by using this TAGZyme digested EGFP as a substrate, and N-terminal specific dipeptide cleavage of EGFP with TAGZyme was performed. The reaction mixture was DAPase (10U / ml) 2.5 L, cysteamine-HC1 (20m) 5 L, 1 X TAGZyme Buffer (sodium phosphate buffer (pH 7.0) 20 mM and NaCl 150 mM) 67.5 μ ί Mixed and left at room temperature for 5 minutes. EGFP (approx. 0.35 raol / L) was added to it, reacted at 37 ° C for 1 hour, and analyzed by SDS PAGE (Figure 16). As a result, the EGFP band shifted. Since it was divided into two, EGFP dipeptidic cleavage was confirmed.

(2) TAGZyme digestion Confirmation of amino acid transfer to EGFP

 TAGZyme digested EGFP as a substrate [Reference Example] After the reaction solution was reacted at 37 ° C for 30 minutes according to the procedure of 1-5, 15% SDS PAGE was performed, and the gel was imaged using Bio Imaging Analyzer BAS-2500. Analysis was performed (Fig. 4, lane 2). In addition, the amino acid transfer activity was measured by the procedure of [Reference Example] 1-5. From the measurement results of radioactivity using a liquid scintillation counter, TAGZyme-digested EGFP shows amino acid transfer similar to α-casein (Fig. 5).

 (3) TAGZyme digestion Tetramethylrhodamine (TMR) fluorescence of EGFP

5 X AAM 8 ju L, Leucyl / phenylalanyl-tRNA protein transferase 4 / z, 0.5 mM 7 Didophenylalanine 0.8 L, lOOA / ml tRNA ^Phe 1 _μ , 0. lmg / mL mutant phenyl Araniru - tRNA synthetase 1, were mixed TAGzyme digestion EGFP 50 pmol, and the total amount in dH ₂ 0 and 40 / teeth. The mixture was allowed to react at 37 ° C for 30 minutes, and then 1 µL of a fluorescent reagent (trialylphos'fin derivative with 5 mM TMR) was added to 19 L of the above solution, followed by lhr reaction at 37 ° C. After the reaction, 12: 5% SDS PAGE was performed, and the fluorescence of the protein was confirmed with LAS3000 manufactured by Fuji Film (Fig. 17). Since a fluorescent band can be confirmed in lane 1, it is considered that azidophenylalanine was transferred to EGFP treated with TAGZyme by LFPT, and then fluorescence modification was introduced with an azido group selective modification reagent.

Example 4

 Preparation of acceptor protein using Entrokinase and modification of N-terminal of acceptor protein

(1) Quit Change of pET-EGFP (plasma in which EGFP gene was incorporated into pET29) was modified so that the N-terminal side of pET-EGFP was as shown in FIG.

 After Quik Change, XL1-BLUE was transformed with this plasmid. After curing, the LB-Kan plate was inoculated, and the next day the colonies that grew on the plate were cultured in a small test (LB-Kan medium) and then mini-cultured. -Prep was performed and the plasmid was recovered. When this plasmid was sequenced, it was confirmed that the plasmid was modified as shown in FIG. This plasmid is called pET-EGFP modification 1.

 ER2566 was transformed with pET_EGFP modified 1 and inoculated into LB-Kan plate. The next day, the puppy that grew on the plate was cultured in lOOmL LB-Kan medium. When 0D reached 0.6, IPTG concentration It was added to 0.5 mM and collected after shaking at 37 ° C for 4 hours. The cells were sonicated and purified using Ni-NTA Agarose. This purified protein was designated EGFP modified 1.

 (2) Preparation of N-terminal arginine EGFP modified 1 using Entrokinase

Entrokinase is a specific enzyme that cleaves behind Lys of Asp Asp Asp Asp Lys. It is considered that arginine appears at the N-terminus of the EGFP modified 1 used this time when it is cleaved with Entrokinase (Fig. 18). Therefore, cleavage of EGFP modification 1 with Entrokinase was performed using Entrokinase Buffer (Tris-HCl (pH 8.0) 20 mM, NaCl 50 mM and CaCl ₂

2raM).

First, 50 μL of Strep-Tactin Superf low resin is centrifuged at 2, OOOrpm for 2 minutes. After removal, the resin was equilibrated with 1 mL of Entrokinase Buffer, centrifuged at 2, OOOrpm for 2 minutes, and the supernatant was removed. Next, suspend the resin in 50 μL of Entrokinase Buffer, mix approximately 60 μg of EGFP modified 1 well, and then add the entire amount of Ultrafree-C. The resin was washed with Entrokinase Buffer 300; 2, and centrifuged at OOOrpm for 2 minutes to remove the solution from the resin. Wash was performed three times. This resin was suspended in Entrokinase Buffer 300, transferred to i. 5 mL tube, Entrokinase (2 mg / mL) was added thereto, and allowed to stand at room temperature for 1: 'hour. Thereafter, the whole amount was poured into Ultrafree-MC and centrifuged at 2, OOOrpm for 2 minutes to recover the solution. The solution was concentrated using a centrifugal evaporator or VIVASPIN 500-MAXIMUM SPIN SPEED. Finally, it was confirmed by 10% SDS PAGE that EGFP-modified 1 was cleaved by Entrokinase (Fig. 19). Comparing lane C and lane 1, it was considered that the molecular weight of EGFP modified 1 (lane 1) treated with Entrokinase was shortened, and cleavage by Entrokinase was confirmed. Entrokinase digested EGFP modified 1 was stored at -80 ° C.

 (3) Tetromethylrhodamine (TMR) fluorescence of Entrokinase digested EGFP modified 1

5 XAA 4 L, Leucyl / phenylalanyl-tRNA protein transferase 2 / L, 0.Dm, 'Didophenylalanine 0.4 μL, lOOA / mL tRNA ^Phe 0.5 μL, 0.lmg / raL mutant phenyl. Alanyl-tRNA synthetase 0.5 x L and Entrokinase-depleted EGFP modified 1 ca 2 jug were mixed, and the total amount was adjusted to 20 // with dH ₂ 0.

The mixture was reacted at 37 ° C for 30 minutes, and then fluorescent reagent (triarylphosphine derivative with 5 mM TMR) l / L was added to 19 _W L of the above solution and reacted at 37 ° C for 1 hour. After the reaction, 15% SDS PAGE was performed, and protein fluorescence was confirmed with Fuji Film LAS3000 (FIG. 20). Comparing lanes 1 and 2, a band due to a fluorescent molecule can be confirmed only in EGFP modified 1 (lane 1) treated with Entrokinase, and azidoferrulean was transferred to EGFP modified 1 treated with Entrokinase by LFPT. It is considered that the fluorescence modification could be introduced by the group selective modification reagent.

 (4) PEG modification of Entrokinase digested EGFP modified 1

Perform the azidophenylalanine transfer reaction in the same manner as (2) above, and then add the triarylphosphine derivative (GIF-0548 or GIF-0602) 1 L with 5 mM polyethylene glycol (PEG) to the solution 19 / L. And reacted at 37 for 1 hour. After reaction A 10 ° / oNative PAGE was performed, and when the fluorescence of Entrokinase digested EGFP modified 1 was detected with Fuji Film LAS3000, a band shift was confirmed (FIG. 21).

 Compared to the lane, the addition of an azide group-modifying reagent with PEG shifts the band derived from EGFP upward, and the difference in the average molecular weight of PEG used for modification is also mobility. Therefore, it is considered that azido ferroalanine was transferred to EGFP modified with Etrokinase by LFPT, and then PEG modification could be introduced by a selective modification reagent for azide group. ,, Industrial applicability,

 By the method of the present invention, a large amount of protein having an amino acid modified at the N-terminal can be prepared.

 All publications, patents and patent applications cited herein are incorporated herein by reference in their entirety. '.

Claims

The scope of the claims

1. Treat proteins with arginine or lysine at the N-terminus in the presence of (1) modified phenylalanyl tRNA ^Phe or modified leucyl tRNA ' ^Leu , and (2) leucyl / phenylallyl tRNA protein transferase. To modify a protein having arginine or lysine at the N-terminus.

2. The method according to claim 1, wherein the modified phenylalanyl tRNA ^Phe is prepared by linking the modified phenylalanine to the 'tRNA ^Phe by a mutant-type furanyl tRNA or a synthetic enzyme.

 3. The method according to claim 2, wherein the modified phenylalanine is represented by the following formula (1). 1

COOH

H ₂ N—C 1 H

In the above formula 1, R ₂ is hydrogen, hydroxyl group or methoxy or acetyl, R ₃ is hydrogen or hydroxyl, and R ₄ is hydrogen, halogen, azide group, nitro group, methoxy or acetyl or It is a hydroxyl group.

 4. The method according to claim 3, wherein the modified phenylenolanine is para-azido-phenylalanine or fluorescently labeled phenylalanine.

 5. Mutant phenylalanyl tRNA synthetase (PheRS), which is PheRS obtained by mutating threonine at position 415 to alanine or glycine in the α subunit of PheRS represented by SEQ ID NO: 2 1 The method according to item.

6. Proteins with arginine or lysine at the N-terminal 6. The method according to any one of claims 1 to 5, which is prepared by treatment with thidase.

7. A protein having an anoregine or lysine at the N-terminus, (1) modified phenylalanine or modified leucine, (2) tRNA ^Phe or tRNA ^Leu , (3) mutant phenylalanyl tRNA synthetase or mutant leucyl tRNA synthetase And (4) A method for modifying a protein having an N-terminal / legginin or lysine by treatment in the presence of leucyl / phenylalanyl tRNA protein transferase.

 8. The method according to claim 7, wherein the modified phenylalanine is represented by the following formula (1) ^).

H ₂ N

In the above formula 1, R ₂ is hydrogen, hydroxyl group or methoxy or acetyl, R ₃ is hydrogen or hydroxyl, and R ₄ is hydrogen, halogen, azide group, nitro group, methoxy or acetyl or It is a hydroxyl group.

 9. The method according to claim 8, wherein the modified phenylalanine is para-azido-phenylalanine or fluorescently labeled Phe.

 10. Mutant phenyl tRNA synthetase (PheRS) force The PheRS obtained by mutating threonine at position 415 to alanine or glycine in the α subunit of PheRS represented by SEQ ID NO: 2. Method.

 11. The method according to any one of claims 7 to 10, wherein the protein having arginine or lysine at the N-terminal is prepared by treating an arbitrary protein with a peptidase.

1 2. (1) In the amino acid sequence represented by SEQ ID NO: 3, a mutant PheRS represented by an amino acid sequence in which 1 to several amino acids are substituted, deleted, or added _α- subunit, and

 (2) A mutation consisting of a mutant PheRS 3 subunit represented by the amino acid sequence in which one to several amino acids are substituted, deleted, and / or added in the amino acid sequence represented by SEQ ID NO: 2. PheRS,

At least a mutation PheRS in which a mutation is introduced into Tyr414 and / or Thr415 and tRNA ^Phe can be converted to a ferulanine analog.

13. A wild-type yeast PheRS mutant (mutant PheRS) comprising the PheRS a subunit represented by SEQ ID NO: 3 and the PheRS j3 subunit represented by SEQ ID NO: 2, wherein the yeast PheRS Mutants of tRNA ^Phe can be converted to phenylalanine and at least Ty.

14, and / or mutation PheRS in which a mutation is introduced into Thr415.