WO2007055388A2 - Calcium receptor activator - Google Patents

Calcium receptor activator Download PDF

Info

Publication number
WO2007055388A2
WO2007055388A2 PCT/JP2006/322684 JP2006322684W WO2007055388A2 WO 2007055388 A2 WO2007055388 A2 WO 2007055388A2 JP 2006322684 W JP2006322684 W JP 2006322684W WO 2007055388 A2 WO2007055388 A2 WO 2007055388A2
Authority
WO
WIPO (PCT)
Prior art keywords
glu
val
cys
gly
calcium receptor
Prior art date
Application number
PCT/JP2006/322684
Other languages
French (fr)
Other versions
WO2007055388A3 (en
Inventor
Takeaki Ohsu
Sen Takeshita
Yuzuru Eto
Yusuke Amino
Original Assignee
Ajinomoto Co., Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Ajinomoto Co., Inc. filed Critical Ajinomoto Co., Inc.
Priority to JP2008523061A priority Critical patent/JP5757674B2/en
Priority to EP06823386A priority patent/EP1945201B1/en
Publication of WO2007055388A2 publication Critical patent/WO2007055388A2/en
Publication of WO2007055388A3 publication Critical patent/WO2007055388A3/en
Priority to US12/117,041 priority patent/US8106020B2/en

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/04—Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
    • A61K38/06—Tripeptides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/04—Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
    • A61K38/05—Dipeptides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/02—Stomatological preparations, e.g. drugs for caries, aphtae, periodontitis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00—Drugs for disorders of the respiratory system
    • A61P11/02—Nasal agents, e.g. decongestants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00—Drugs for disorders of the respiratory system
    • A61P11/04—Drugs for disorders of the respiratory system for throat disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00—Drugs for disorders of the respiratory system
    • A61P11/06—Antiasthmatics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00—Drugs for disorders of the urinary system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P15/00—Drugs for genital or sexual disorders; Contraceptives
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • A61P19/08—Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease
    • A61P19/10—Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease for osteoporosis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00—Drugs for disorders of the muscular or neuromuscular system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/04—Centrally acting analgesics, e.g. opioids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/06—Antimigraine agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/14—Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
    • A61P25/16—Anti-Parkinson drugs
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/20—Hypnotics; Sedatives
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00—Drugs for disorders of the senses
    • A61P27/02—Ophthalmic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00—Drugs for disorders of the senses
    • A61P27/16—Otologicals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/04—Anorexiants; Antiobesity agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P5/00—Drugs for disorders of the endocrine system
    • A61P5/18—Drugs for disorders of the endocrine system of the parathyroid hormones
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P5/00—Drugs for disorders of the endocrine system
    • A61P5/18—Drugs for disorders of the endocrine system of the parathyroid hormones
    • A61P5/20—Drugs for disorders of the endocrine system of the parathyroid hormones for decreasing, blocking or antagonising the activity of PTH

Definitions

  • the present invention relates to a calcium receptor activator containing D-Cys or a peptide, a pharmaceutical composition containing the calcium receptor activator as an active ingredient, and a method for screening for a calcium receptor activation inhibitor using the calcium receptor activator.
  • the calcium receptor is also the called calcium sensing receptor (CaSR) , and is a receptor consisting of 1078 amino acids, and classified into the class C of seven- transmembrane receptors (G protein-coupled receptor; GPCR) . Cloning of the gene for this calcium receptor was reported in 1993 (Non-patent document 1), and it is known to cause various cell responses through elevation of intracellular calcium level etc., when it is activated with calcium etc.
  • the gene sequence of the human calcium receptor is registered with GenBank Accession No. NM_000388, and is well conserved in animals.
  • the aforementioned calcium receptor may act to promote or suppress biological functions. Therefore, at present, therapeutic agents which may act as activators and inhibitors of the calcium receptor are appropriately used in the treatment of neurological diseases, hepatic diseases, cardiovascular diseases, digestive system diseases, and other diseases, depending on pathological conditions.
  • the calcium receptor is able to detect increased blood calcium level in the parathyroid, and suppress secretion of the parathyroid hormone (PTH) to correct the blood calcium level. Therefore, an effect of reducing the blood calcium level is expected for a calcium receptor activator. It has been actually clarified that when a calcium receptor activator is used to treat secondary hyperparathyroidism in a hemodialysis patient, it reduces the PTH level without elevating the calcium and phosphorus levels .
  • Non-patent document 2 Non-patent document 3
  • possibilities thereof for being involved in various biological ⁇ functions and causes of diseases have been proposed.
  • the calcium receptor is involved in the functions of the liver, heart, lung, alimentary canal,- lymphocyte, and pancreas.
  • the inventors of the present invention have also confirmed that it is expressed in a wide range of tissues in living bodies by analyses based on RT-PCR using RNAs extracted from rat tissues. From the aforementioned viewpoints, the values of activators and inhibitors of the calcium receptor are presently rapidly increasing for applications.
  • Non-patent document 4 cations such as gadolinium cation, basic peptides such as polyarginine, polyamine such as spermine, amino acids such as phenylalanine, and so forth have been reported, as calcium receptor activators (Non-patent document 4).
  • activators Although many specific activators have been developed so far as calcium receptor activators as described above, there are few compounds existing in living bodies among them, and the activities of the compounds existing in living bodies are very low. Therefore, therapeutic agents for various diseases containing these activators have serious problems concerning side reaction, permeability and activity. For example, although it is known that amino acids act on the calcium receptor, it is considered that actual application thereof as the activators is difficult, since the activity is very weak. Moreover, although macromolecules such as polyarginine have been reported as the activator as described above, it is estimated that the functions are based on the actions as polyvalent cations having irregular structures. That is, it is not known that a peptide having a specific structure is useful as a calcium receptor activator.
  • An object of the present invention is to provide a highly active calcium receptor activator highly safe to living bodies. Another object of the present invention is to provide a method for screening for a calcium receptor activation inhibitor.
  • the inventors of the present invention searched for activators of the calcium receptor, and as a result, found that low molecular peptides, including glutathione, were able to activate the calcium receptor.
  • the present invention was accomplished on the basis of this finding. That is, the present invention provides the following.
  • a method for screening for a calcium receptor activation inhibitor comprising using the calcium receptor activator according to any one of (1) to (3) .
  • a method for activating a calcium receptor comprising contacting a substance selected from peptides and amino acids used for the present invention, with the calcium receptor.
  • a highly active calcium receptor activator highly safe to living bodies is provided. Moreover, by the present invention, a method for screening for a calcium receptor activation inhibitor is provided.
  • FIG. 1 Drawing showing an action of calcium on the calcium receptor.
  • the human calcium receptor cRNA was introduced into Xenopus laevis oocytes by microinjection. Recorded were values of intracellular response currents which flew when a calcium chloride solution was added at an arbitrary concentration. The maximum values of intracellular currents were considered response current values. It was confirmed that no response was observed in oocytes introduced with distilled water by microinjection as a control.
  • FIG. 2 Drawing showing an action of L-amino acids on the calcium receptor.
  • the ,human calcium receptor cRNA was introduced into Xenopus laevis oocytes by microinjection. Recorded were values of intracellular response currents which flew when a 10 mM L-amino acid solution was added. The maximum values of intracellular currents were considered response current values. It was confirmed that no response was observed in oocytes introduced with distilled water by microinjection as a control.
  • FIG. 3 Drawing showing an action of D-amino acids on the calcium receptor.
  • the human calcium receptor cRNA was introduced into Xenopus laevis oocytes by microinjection. Recorded were values of intracellular response currents which flew when a 10 mM D-amino acid solution was added. The maximum values of intracellular currents were considered response current values. It was confirmed that no response was observed in oocytes introduced with distilled water by microinjection as a control.
  • FIG. 4 Drawing showing an action of peptides on the calcium receptor.
  • the human calcium receptor cRNA was introduced into Xenopus laevis oocytes by microinjection. Recorded were values of intracellular response currents which flew when a peptide solution was added at an arbitrary concentration. The maximum values of intracellular currents were considered response current values. It was confirmed that no response was observed in oocytes introduced with distilled water by microinjection as a control.
  • the calcium receptor activator of the present invention contains one or more kinds of substances selected from ⁇ -Glu-Cys-Gly, ⁇ -Glu-Cys (-SNO) -GIy, ⁇ -Glu-Ala, ⁇ -Glu- GIy, ⁇ -Glu-Cys, ⁇ -Glu-Met, ⁇ -Glu-Thr, ⁇ -Glu-Val, ⁇ -Glu-Orn, Asp-Gly, Cys-Gly, Cys-Met, Glu-Cys, Gly-Cys, Leu-Asp, D-Cys, ⁇ -Glu-Met (0) , Y-Glu-Val-Val, ⁇ -Glu-Val-Glu, ⁇ -Glu-Val-Lys, ⁇ -Glu- ⁇ -Glu-Val, ⁇ -Glu-Val-NH 2 , ⁇ -Glu-Va ' l-ol, ⁇ -Glu-Ser, ⁇ Glu-Tau, ⁇ -Glu-Cys(S-Me) (
  • the aforementioned ⁇ -Glu-Cys (SNO) -GIy has the following structural formula, and the " (O) " in the formulas ⁇ -Glu-Met (0) and ⁇ -Glu-Cys (S-Me) (O) indicates a sulfoxide structure.
  • the "(Y)" in the ⁇ -Glu indicates that glutamic acid bonds to another amino acid via Y position of carboxy group in the glutamic acid.
  • the "calcium 'receptor” is also the called calcium sensing receptor (CaSR) , and belongs to the class C of seven-transmembrane receptors.
  • the “calcium receptor activator” is a substance that acts on the aforementioned calcium receptor to activate the calcium receptor and control the functions of cells which express the calcium receptor.
  • “to activate the calcium receptor” indicates when a ligand (activator) binds to the aforementioned calcium receptor, resulting in activation of the guanine nucleotide binding protein, which thereby transmits signals.
  • the peptides and amino acids can be used. Furthermore, the peptides can be obtained by suitably using a known technique such as (1) a method of chemically synthesizing them, or (2) a method of synthesizing them by an enzymatic reaction. Since the number of residues of the contained amino acid residues of the peptides used for the present invention is as comparatively small as 2 or 3 residues, a method of chemically synthesizing them is convenient. When chemically synthesizing them, the oligopeptides can be synthesized or half-synthesized by using a peptide synthesizer.
  • Examples of the method of chemically synthesizing them include, for example, a peptide solid phase synthetic method.
  • Peptides synthesized as described above can be purified by usual means, for example, ion exchange chromatography, reversed phase high performance liquid chromatography, affinity chromatography, and so forth.
  • Such a peptide solid phase synthetic method and the following purification of peptide are well known in this technical field.
  • the peptides used for the present invention can also be prepared by an enzymatic reaction.
  • the method described in International Patent Publication WO2004/011653 can be used. That is, they can also be prepared by reacting one amino acid or dipeptide of which carboxyl terminus is esterified or amidated and an amino acid having a free amino group (for example, an amino acid of which carboxyl group is protected) in the presence of a peptide producing enzyme, and purifying the produced dipeptide or tripeptide.
  • Examples of the peptide producing enzyme include a culture of microorganisms' having an ability to produce peptides, microbial cells separated from such culture, processed product of cells of such microorganisms, peptide producing enzymes derived from such microorganisms, and so forth.
  • the peptides and amino acids used for the present invention also include those in the form of a salt.
  • a salt with an acidic group such as a carboxyl group in the formula include ammonium salts, salts with alkali metals such as sodium, and potassium, salt with alkaline earth metals such as calcium, and magnesium, aluminum salts, zinc salts, salts with organic amines such as triethylamine, ethanolamine, morpholine, pyrrolidine, piperidine, piperazine, and dicyclohexylamine, and salts with basic amino acids such as arginine, and lysine.
  • Examples of salts with a basic group in case that a basic group exists in the formula include salts with inorganic acids such as hydrochloric acid, sulfuric acid, phosphoric acid, nitric acid, and hydrobromic acid, salts with organic carboxylic acids such as acetic acid, citric acid, benzoic acid, maleic acid, fumaric acid, tartaric acid, succinic acid, tannic acid, butyric acid, hibenzoic acid, pamoic acid, enanthoic acid, decanoic acid, teoclic acid, salicylic acid, lactic acid, oxalic acid, mandelic acid, and malic acid, and salts with organic sulfonic acids such as methanesulfonic acid, benzenesulfonic acid, and p-toluenesulfonic acid.
  • inorganic acids such as hydrochloric acid, sulfuric acid, phosphoric acid, nitric acid, and hydrobromic acid
  • the human calcium receptor encoded by the human calcium receptor gene registered with GenBank Accession No. NM_000388 can be exemplified as a preferred example.
  • the calcium receptor is not limited to the protein encoded by the gene of the aforementioned sequence, and it may be a protein encoded by a gene having a homology of 60% or more, preferably 80% or more, more preferably 90% ' or more, to the aforementioned sequence, so long as the protein has the calcium receptor function.
  • the GPRC ⁇ A receptor and the 5.24 receptor are also known as subtypes of the calcium receptor, and they can be used for the present invention.
  • the calcium receptor function can be examined by expressing a gene of interest in a cell and measuring changes in the electric current, or intracellular calcium ion concentration at the time of the addition of calcium. ⁇
  • the calcium receptor activator of the present invention- may be a substance that activates, besides the aforementioned human calcium receptor, any one of calcium receptors derived from animals such as mouse, rat, and dog.
  • Whether the peptides and amino acids used for the present invention activate a calcium receptor can be confirmed by using live cells expressing a calcium receptor or a fragment thereof, cell membranes expressing a calcium receptor or a fragment thereof, an in vitro system containing a protein of a calcium receptor or a fragment thereof, or the like.
  • a calcium receptor is expressed in cultured cells such as those of Xenopus l ⁇ evis oocytes, hamster ovarian cells, and human fetal kidney cells.
  • the calcium receptor can be expressed by cloning a calcium receptor gene in a plasmid that can contain a foreign gene and introducing the plasmid or cRNA obtained by using the plasmid as a template.
  • electrophysiological techniques fluorescent indicator reagents that indicate an increase in intracellular calcium level, and so forth, can be used.
  • Expression of the calcium receptor is first confirmed based on the response to calcium or a specific activator.
  • Oocytes that showed intracellular current with calcium at a concentration of about 5 mM, or cultured cells that showed fluorescence of the fluorescent indicator reagent with calcium at a concentration of about 5 mM are used.
  • Calcium concentration dependency is determined by changing the calcium concentration.
  • a test substance such as a peptide is prepared to a concentration of about 1 ⁇ M to 1 mM, and added to the oocytes or cultured cells, and whether the aforementioned peptide or the like acts as an activator for the calcium receptor is determined.
  • the calcium receptor activator of the present invention may further contain one or more kinds of compounds having calcium receptor activation activity, in addition to one or more kinds of substances selected from ⁇ -Glu-Cys-Gly, ⁇ -Glu-Cys (SNO) -GIy, ⁇ -Glu-Ala, ⁇ -Glu-Gly, ⁇ Glu-Cys, ⁇ -Glu-Met, ⁇ -Glu-Thr, ⁇ -Glu-Val, ⁇ -Glu-0rn, Asp- GIy, Cys-Gly, Cys-Met, Glu-Cys, Gly-Cys, Leu-Asp, D-Cys, ⁇ Glu-Met(O), Y-Glu-Val-Val, ⁇ -Glu-Val-Glu, ⁇ -Glu-Val-Lys, ⁇ - Glu- ⁇ -Glu-Val, ⁇ -Glu-Val-NH 2 , ⁇ -Glu-Val-ol, ⁇ -Glu-Ser, ⁇ - Glu-Tau,
  • the existing compounds having aforementioned calcium receptor activation activity include cations such as calcium and gadolinium cations, basic peptides such as polyarginine and polylysine, polyamines such as putrescine, spermine and spermidine, proteins such as protamine, amino acids such as phenylalanine, cinacalcet, and so forth, but is not limited to these.
  • the aforementioned existing compounds having calcium receptor activation activity may be added alone, or as a mixture of two or more kinds.
  • cations such as calcium and gadolinium cations are preferred, and the calcium cation is more preferred. That is, it is preferred that at least one kind of the" existing calcium receptor activators further added should be a cation.
  • the ratio of the total amount of the peptides and amino acids used for the present invention and the total amount of the existing compounds having calcium receptor activation activity in the calcium receptor activator of the present invention is not particularly limited, so long as stronger activation of the calcium receptor can be obtained.
  • the mass ratio of the total amount of the peptides and amino acids used for the present invention and the total amount of the existing compounds having calcium receptor activation activity is preferably 1:100 to 100:1.
  • the calcium receptor is expressed in various tissues and is responsible for various physiological functions. Moreover, activators of the calcium receptor have been developed as therapeutic drugs to treat medical diseases (for example, Therapeutic drugs of hypercalcemia, Proc. Natl. Acad. Sci. USA, 1998 Mar. 31, 95 (7 ): 4040-5) .
  • adipocytes the calcium receptor is expressed in both mature adipocytes and undifferentiated adipocytes, and is involved in suppression of differentiation (Endocrinology, 2005 May, 146 ( 5) : 2176-9; Exp. Cell Res., 2004 Dec, 10; 301 (2) : 280-92) , as for bone marrow cells, it is expressed in erythroblasts, megakaryocytes and thrombocytes, and is involved in hematogenous regulation (J. Bone Miner Res., 1997 Dec, 12 ( 12 ): 1959-70.), and it is expressed in gastric parietal cells and is involved in gastric acid secretion (J. Clin.
  • the calcium receptor activator of the present invention can be used as an active ingredient in a pharmaceutical composition for preventing or treating a disease in which the calcium receptor is involved.
  • diseases in which the calcium receptor is involved include medical diseases, surgical diseases, pediatric diseases, orthopedic diseases, plastic surgery diseases, neurosurgical diseases, dermatological diseases, urological diseases, obstetric or gynecological diseases, ophthalmologic diseases, otorhinolaryngological diseases, dentistry or oral surgery diseases, and so forth.
  • the method for applying a pharmaceutical composition which contains the calcium receptor activator of the present invention as an active ingredient is not particularly limited, and oral administration, invasive administration utilizing injection or the like, administration of suppositories, or dermal administration can be employed.
  • the active ingredient can be mixed with a non-toxic pharmaceutical carrier in the form of solid or liquid suitable for administration methods such as oral administration and administration by injection, and administered in the form of a conventional pharmaceutical preparation.
  • a pharmaceutical preparation include, for example, solid preparations such as tablets, granules, powders, and capsules, liquid preparations such as solutions, suspensions, and emulsions, lyophilized preparations, and so forth. These preparations can be prepared by conventional means for the preparation of drugs.
  • non-toxic pharmaceutical carrier examples include, for example, glucose, lactose, sucrose, starch, mannitol, dextrin, aliphatic acid glycerides, polyethylene glycol, hydroxyethylstarch, ethylene glycol, polyoxyethylene sorbitan fatty acid esters, gelatin, albumin, amino acids, water, physiological saline, and so forth.
  • conventional additives such as stabilizers, wetting agents, emulsifiers, binders, and isotonic agents can also be optionally added as required.
  • the dose of the pharmaceutical composition of the present invention may be a quantity which is effective for a therapeutic and prophylactic treatment, and can be suitably adjusted depending on age, sex, weight, symptoms, and so forth of patients.
  • it is preferably 0.01 to 10 g, more preferably 0.1 to 1 g, in terms of the total amount of the peptides and amino acids used for the present invention, per 1 kg of body weight for a one time administration.
  • Frequency of the administration is not particularly limited, and it can be administered once to several times per day.
  • the calcium receptor activator of the present invention can also be used as a food or drink which is effective for treatment or prevention of a disease in which the calcium receptor is involved.
  • it can be prepared as a food or drink indicated that it has a curative or preventive effect for such diseases in which the calcium receptor is involved as mentioned above on a container or package thereof.
  • the calcium receptor activator of the present invention can be used to screen for a calcium receptor activation inhibitor. Although a screening method will be exemplified below, the screening method is not limited to this method.
  • a calcium receptor activation inhibitor By adding any one of the peptides and amino acids used for the present invention and a test substance to Xenopus oocytes or cultured cells derived from a mammal expressing the calcium receptor, measuring the intracellular electric current or intracellular calcium concentration, and choosing a compound that inhibits increasing the intracellular electric current or calcium concentration caused by the peptide or amino acid used for the present invention, a calcium receptor activation inhibitor can be screened for.
  • test substance used for the screening low molecular weight compounds, saccharides, peptides, proteins, and so forth can be used.
  • the gene of the calcium receptor was prepared as follows. On the basis of the DNA sequence registered at NCBI (calcium receptor: NM_000388), synthetic oligo DNAs (forward primer (N) and reverse primer (C)) used for PCR were designed (Table 1, SEQ ID NOS: 1 and 2).
  • Synthetic oligo DNAs forward primer (N) and reverse primer (C) , h: human, r : rat
  • hCASR_N SEQ ID NO: 1
  • hCASR_C SEQ ID NO: 2
  • PCR was performed by using Pfu ultra DNA Polymerase (Stratagene) under the following conditions. After a reaction at 94 0 C for 3 minutes, a cycle of reactions at 94°C for 30 seconds, 55°C for 30 seconds, and 72°C >£or 2 minutes was repeated 35 times, and then a reaction was performed at 72°C for 7 minutes.
  • PCR Whether amplification was attained by PCR was detected by performing agarose electrophoresis, staining with a DNA staining reagent, and ultraviolet irradiation. The chain lengths of the PCR products were confirmed by comparison with DNA markers of known sizes simultaneously subjected to the electrophoresis.
  • the plasmid vector pBR322 (Takara) was digested with the restriction enzyme EcoRV. The gene fragment amplified by PCR was ligated to the cleavage site of the plasmid by using Ligation Kit (Promega).
  • the Escherichia coli DH5 ⁇ strain was transformed with each ligation reaction solution, and a transformant harboring the plasmid in which the PCR amplification product was cloned was selected.
  • the PCR amplification product was confirmed by DNA sequence analysis.
  • cRNA preparation kit (Ambion) , cRNA of the calcium receptor gene was prepared.
  • L-amino acid samples 23 kinds of special grade amino acids, alanine, arginine, asparagine, aspartic acid, cysteine, glutamine, glutamic acid, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, valine, ornithine, taurine (all of these from Ajinomoto), and hydroxyproline (Nakarai Tesque) , were used.
  • D-Cys and D-Trp (Nakarai Tesque) and calcium chloride those of special grade were used.
  • peptide samples ⁇ -Glu-Cys-Gly (Sigma Aldrich Japan), ⁇ -Glu-Cys (SNO) -GIy
  • ⁇ -Glu-Cys As only for ⁇ -Glu-Cys, one having a purity of 80% or higher was used. When the solution dissolving each sample showed an acidic or alkaline pH, the solution was adjusted to an approximately neutral pH by using NaOH or HCl.
  • the solution used for dissolution of amino acids and peptides, preparation of Xehopus laevis oocytes, and culture of the oocytes had the following composition: 96 mM NaCl, 2 mM KCl, 1 mM MgCl 2 , 1.8 mM CaCl 2 , 5 mM Hepes, pH 7.2.
  • Boc-Val-OH (8.69 g, 40.0, mmol) and Gly-OBzl'HCl (8.07 g, 40.0 mmol) were dissolved in methylene chloride (100 ml), and the solution was kept at 0 0 C.
  • Triethylamine (6.13 ml, 44.0 mmol), HOBt ( 1-hydroxybenzotriazole, 6.74 g, 44.0 mmol), and WSC-HCl (l-ethyl-3- ( 3- dimethylaminopropyl) carbodiimide hydrochloride, 8.44 g, 44.0 mmol) were added to the solution, and the mixture was stirred overnight at room temperature.
  • the reaction mixture was concentrated under reduced pressure, and the residue was dissolved in ethyl acetate (200 ml).
  • the solution was washed with water (50 ml), 5% citric acid aqueous solution (50 ml x twice), saturated brine (50 ml), 5% sodium hydrogencarbonate aqueous solution (50 ml x twice), and saturated brine (50 ml).
  • the organic layer was dried over anhydrous magnesium sulfate, magnesium sulfate was removed by filtration, and the filtrate was concentrated under reduced pressure.
  • the residue was recrystallized from ethyl acetate/n-hexane to obtain Boc- Val-Gly-OBzl (13.2 g, 36.2 ramol) as white crystals.
  • Boc-Val-Gly-OBzl (5.47 g, 15.0 ⁇ unol) was added to 4 N HCl/dioxane solution (40 ml), and the mixture was stirred at room temperature for 50 minutes. Dioxane was removed by concentration under reduced pressure, n-hexane (30 ml) was added to the residue, and- the mixture was concentrated under reduced pressure. This procedure was repeated 3 times to quantitatively obtain H-Val-Gly-OBzl » HCl .
  • the reaction mixture was concentrated under reduced pressure, and the residue was dissolved in heated ethyl acetate (1500 ml).
  • the solution was washed with water (200 ml), 5% citric acid aqueous solution (200 ml x twice), saturated brine (150 ml), 5% sodium hydrogencarbonate aqueous solution (200 ml x twice), and saturated brine (150 ml).
  • the organic layer was dried -over anhydrous magnesium sulfate, magnesium sulfate was removed by filtration, and the filtrate was concentrated under reduced pressure.
  • the deposited crystals were collected by filtration, and dried under reduced pressure to obtain Z-GIu(VaI-GIy-OBzI)-OBzI (6.51 g, 10.5 mmol) as white crystals.
  • a Ca ion concentration-dependent Cl ionic current measuring method using a Xenopus laevis oocyte expression system was used. If each activator is added to Xenopus laevis oocytes expressing the calcium receptor, intracellular Ca ions increase. Then, the Ca ion concentration-dependent Cl channel opens, and the intracellular current value changes as an ionic current. By measuring the change in this intracellular current value, whether the calcium receptor activation activity is present or not can be known.
  • oocytes Into the oocytes, 50 nl of 1 ⁇ g/ ⁇ l receptor cRNA or 50 nl of sterilized water per one oocyte was introduced by using a micro glass capillary, and the oocytes were cultured at 18 °C for 2 or 3 days. For the culture, a solution obtained by adding 2 mM pyruvic acid, 10 U/ml of penicillin, and 10 ⁇ g/ml of streptomycin to the solution mentioned in Example 2 was used. After the culture, a test solution was added to the oocytes introduced with cRNA or sterilized water.
  • Electrophysiological measurement was performed by using an amplifier, Geneclamp500 (Axon) , and recording software, AxoScope 9.0 (Axon).
  • the oocytes were voltage-clamped at - 70 mV by the double electrode voltage clamp method, and the intracellular current was measured via the Ca ion concentration-dependent Cl ion channel. The maximum value of the intracellular current was considered as the response current value.
  • the calcium receptor activation activity of calcium was evaluated by using the method described in Example 6. That is, oocytes introduced with cRNA of the calcium receptor or sterilized water were prepared, and voltage- clamped at -70 mV by the double electrode voltage clamp method. To the voltage-clamped oocytes, calcium was added (2 mM, 5 mM, 10 mM, 20 mM) , and Ca ion concentration- dependent Cl response current was measured. The results are shown in Fig. 1. From these results, it was confirmed that cRNA of the calcium receptor introduced into the oocytes were functionally expressed. Furthermore, since the oocytes introduced with water did not respond to even high concentration calcium, it was confirmed that the calcium receptor is not expressed in the oocytes themselves.
  • Calcium receptor activation activity of L-amino acids was evaluated by using the method described in Example 6. That is, oocytes introduced with cRNA of the calcium receptor or sterilized water were prepared, and voltage- clamped at -70 mV by the double electrode voltage clamp method.
  • alanine (10 mM) , arginine (10 mM) , asparagine (10 mM) , aspartic acid (10 mM) , cysteine (10 mM) , glutamine (10 mM) , glutamic acid (10 mM) , glycine (10 mM) , histidine (10 mM) , isoleucine (10 mM) , leucine (1OmM), lysine (10 mM) , methionine (10 mM) , phenylalanine (10 mM) , proline (10 mM) , serine (10 mM) , threonine (10 mM) , tryptophan (10 mM) , tyrosine (10 mM) , valine (10 mM) , ornithine (10 mM) , taurine (10 mM) , or hydroxyproline (10 mM) was
  • D-cysteine Calcium receptor activation activity of D-cysteine was evaluated by using the method described in Example 6. That is, oocytes introduced with cRNA of the calcium receptor or sterilized water were prepared, and voltage- clamped at -70 mV by the double electrode voltage clamp method. To the voltage-clamped oocytes, D-cysteine (10 mM) , L-cysteine (10 mM) , D-tryptophan (10 mM) , or L-tryptophan (10 mM) was added, and Ca ion concentration-dependent Cl response current was measured. The results are shown in Fig. 3. By these results, it was demonstrated that D- cysteine had definite calcium receptor activation activity.
  • Calcium receptor activation activity of peptides was evaluated by using the method described in Example 6. That is, oocytes introduced with cRNA of the calcium receptor or sterilized water were prepared, and voltage-clamped at -70 mV by the double electrode voltage clamp method.
  • RNAs were prepared from rat tissues as follows. From 15-week old male F344 rats, cerebrum, cerebellum, lung, heart, liver, kidney, adrenal body, thyroid, parathyroid, pancreas, spleen, esophagus, upper third of stomach, fundus of stomach, duodenum, jejunum, ileum, caecum, colon, rectum, testis, epididymis, bladder, bone marrow, gastrocnemial muscle, soleus, skeletal muscle, fat, prostate, tongue, sublingual gland, and thymus were isolated. Total RNA was prepared by using Isogen (Nippon Gene) .
  • oligo dT primers and Superscript III reverse transcriptase Invitrogen
  • cDNA was synthesized.
  • the primers shown in Table 1 (rCASR_f: SEQ ID NO: 3 and rCASR_r: SEQ ID NO: 4) were synthesized, and RT-PCR of the calcium receptor was performed as follows.
  • PTH Parathyroid hormone
  • Increase of PTH-amount is directly responsible for hyperparathyroidism and hypoparathyroidism. It is known that PTH is secreted from the parathyroid gland, and its secretion is inhibited when calcium receptor is activated. Male, 10 weeks old, Sprague-Dawley strain rats were used. "Rat Intact PTH ELISA KIT" ( Immutopics) was used for measuring PTH according to the producer's recommended protocol.
  • Receptor activators for the GPCR are universally applicable as curative agents of various diseases.
  • examples of curative commercial agents so far, or those under research include the acetylcholine receptor activator (for treating Alzheimer disease), the adrenoreceptor activator (for treating bronchial asthma, for treating obesity) , the opioid receptor activator (for treating pain diseases), the receptor activator (for treating pain diseases), the calcitonin receptor activator (for treating osteoporosis), the cholecystokinin receptor activator (for treating diabetes) , the serotonine receptor activator (for treating migraine), the dopamine receptor activator (for treating Parkinson's disease, sedative), the melatonin receptor activator (for treating primary insomnia), the melanocortin receptor activator (for treating obesity), and so forth.
  • the calcium receptor activator belonging to GPCR As for the range of applications of the calcium receptor activator belonging to GPCR as a curative agent, since the calcium receptor is distributed over a wide range of tissues as shown in Example 12, Table 3, it is expected that it is applicable to a wide range of diseases.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Chemical & Material Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Neurology (AREA)
  • Biomedical Technology (AREA)
  • Neurosurgery (AREA)
  • Diabetes (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Pulmonology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Epidemiology (AREA)
  • Endocrinology (AREA)
  • Immunology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Otolaryngology (AREA)
  • Pain & Pain Management (AREA)
  • Rheumatology (AREA)
  • Obesity (AREA)
  • Hematology (AREA)
  • Dermatology (AREA)
  • Reproductive Health (AREA)
  • Hospice & Palliative Care (AREA)
  • Anesthesiology (AREA)
  • Psychiatry (AREA)
  • Psychology (AREA)
  • Emergency Medicine (AREA)
  • Urology & Nephrology (AREA)

Abstract

A calcium receptor activator containing one or more kinds of substances selected from Á-Glu-Cys-Gly, Á-Glu-Cys(SNO)-Gly, Á-Glu-Ala, Á-Glu-Gly, Á-Glu-Cys, Á-Glu-Met, Á-Glu-Thr, Á-Glu-Val, Á-Glu-Orn, Asp-Gly, Cys-Gly, Cys-Met, Glu-Cys, Gly-Cys, Leu-Asp, D-Cys, Á-Glu-Met(O), Á-Glu-Val-Val, Á-Glu-Val-Glu, Á-Glu-Val-Lys, Á-Glu- Á-Glu-Val, Á-Glu-Val-NH2, Á-Glu-Val-ol, Á-Glu-Ser, Á-Glu-Tau, Á-Glu-Cys(S-Me)(O), Á-Glu-Leu, Á-Glu-Ile, Á-Glu-t-Leu, Á-Glu-Cys(S-allyl)-Gly, Á-Glu-Gly-Gly, Á-Glu-Val-Phe, Á-Glu-Val-Ser, Á-Glu-Val-Pro, Á-Glu-Val-Arg, Á-Glu-Val-Asp, Á-Glu-Val-Met, Á-Glu-Val-Thr, Á-Glu-Val-His, Á-Glu-Val-Asn, Á-Glu-Val-Gln, Á-Glu-Val-Cys, Á-Glu-Val-Orn, Á-Glu-Ser-Gly, Á-Glu-Cys(S-Me), Á-Glu-Abu-Gly, Á-Glu-Cys(S-Me)-Gly, and Á-Glu-Val-Gly.

Description

Description
CALCIUM RECEPTOR ACTIVATOR
Technical Field
This application claims priority from Japanese Patent Application No. 2005-325300 filed on November 9, 2005 , US Provisional Patent Application No. 60/738562 filed on November 22, 2005, which are hereby incorporated by reference herein.
The present invention relates to a calcium receptor activator containing D-Cys or a peptide, a pharmaceutical composition containing the calcium receptor activator as an active ingredient, and a method for screening for a calcium receptor activation inhibitor using the calcium receptor activator.
Background Art
The calcium receptor is also the called calcium sensing receptor (CaSR) , and is a receptor consisting of 1078 amino acids, and classified into the class C of seven- transmembrane receptors (G protein-coupled receptor; GPCR) . Cloning of the gene for this calcium receptor was reported in 1993 (Non-patent document 1), and it is known to cause various cell responses through elevation of intracellular calcium level etc., when it is activated with calcium etc. The gene sequence of the human calcium receptor is registered with GenBank Accession No. NM_000388, and is well conserved in animals.
The aforementioned calcium receptor may act to promote or suppress biological functions. Therefore, at present, therapeutic agents which may act as activators and inhibitors of the calcium receptor are appropriately used in the treatment of neurological diseases, hepatic diseases, cardiovascular diseases, digestive system diseases, and other diseases, depending on pathological conditions. For example, the calcium receptor is able to detect increased blood calcium level in the parathyroid, and suppress secretion of the parathyroid hormone (PTH) to correct the blood calcium level. Therefore, an effect of reducing the blood calcium level is expected for a calcium receptor activator. It has been actually clarified that when a calcium receptor activator is used to treat secondary hyperparathyroidism in a hemodialysis patient, it reduces the PTH level without elevating the calcium and phosphorus levels .
Since functional analysis of the calcium receptor has been conducted mainly for calcium homeostasis, the applied researches therefor are so far mainly concerned bone metabolic diseases in which calcium regulation is involved. However, it has become clear that the calcium receptor is widely distributed in living bodies other than the parathyroid and kidney from the results of genetic expression analyses etc. (Non-patent document 2, Non-patent document 3), and possibilities thereof for being involved in various biological ■ functions and causes of diseases have been proposed. For example, it is estimated that the calcium receptor is involved in the functions of the liver, heart, lung, alimentary canal,- lymphocyte, and pancreas. The inventors of the present invention have also confirmed that it is expressed in a wide range of tissues in living bodies by analyses based on RT-PCR using RNAs extracted from rat tissues. From the aforementioned viewpoints, the values of activators and inhibitors of the calcium receptor are presently rapidly increasing for applications.
Moreover, other than calcium, cations such as gadolinium cation, basic peptides such as polyarginine, polyamine such as spermine, amino acids such as phenylalanine, and so forth have been reported, as calcium receptor activators (Non-patent document 4).
Although many specific activators have been developed so far as calcium receptor activators as described above, there are few compounds existing in living bodies among them, and the activities of the compounds existing in living bodies are very low. Therefore, therapeutic agents for various diseases containing these activators have serious problems concerning side reaction, permeability and activity. For example, although it is known that amino acids act on the calcium receptor, it is considered that actual application thereof as the activators is difficult, since the activity is very weak. Moreover, although macromolecules such as polyarginine have been reported as the activator as described above, it is estimated that the functions are based on the actions as polyvalent cations having irregular structures. That is, it is not known that a peptide having a specific structure is useful as a calcium receptor activator.
[Non-patent document 1] Nature, 1993 Dec. 9, 366(6455) :575-80
[Non-patent document 2] J. Endocrinol., '2000 May, 165(2) : 17-3-7
[Non-patent document 3] Eur. J. Pharmacol., 2002 JuI. 5, 447 (2-3) :271-8
[Non-patent document 4] Cell Calcium, 2004 Mar., 35(3) :209-16
Disclosure of Invention
[Problems to be solved by the Invention]
An object of the present invention is to provide a highly active calcium receptor activator highly safe to living bodies. Another object of the present invention is to provide a method for screening for a calcium receptor activation inhibitor.
[Means for solving the Problems]
The inventors of the present invention searched for activators of the calcium receptor, and as a result, found that low molecular peptides, including glutathione, were able to activate the calcium receptor. The present invention was accomplished on the basis of this finding. That is, the present invention provides the following. (1) A calcium receptor activator containing one or more kinds of substances selected from γ-Glu-Cys-Gly, γ-Glu- Cys(SNO)-Gly, γ-Glu-Ala, γ-Glu-Gly, γ-Glu-Cys, γ-Glu-Met, γ-Glu-Thr, γ-Glu-Val, γ-Glu-0rn, Asp-Gly, Cys-Gly, Cys-Met, Glu-Cys, Gly-Cys, Leu-Asp, D-Cys, γ-Glu-Met (0) , γ-Glu-Val- VaI, Y-Glu-Val-Glu, γ-Glu-Val-Lys, γ-Glu-γ-Glu-Val, γ-Glu- VaI-NH2, γ-Glu-Val-ol, γ-Glu-Ser, γ-Glu-Tau, γ-Glu-Cys(S- Me) (O), γ-Glu-Leu, γ-Glu-Ile, γ-Glu-t-Leu, γ-Glu-Cys(S- allyl)-Gly, γ-Glu-Gly-Gly, γ-Glu-Val-Phe, γ-Glu-Val-Ser, γ- Glu-Val-Pro, γ-Glu-Val-Arg, γ-Glu-Val-Asp, γ-Glu-Val-Met , γ-Glu-Val-Thr, γ-Glu-Val-His, γ-Glu-Val-Asn, γ-Glu-Val-Gln, γ-Glu-Val-Cys, γ-Glu-Val-0rn, γ-Glu-Ser-Gly, γ-Glu-Cys(S- Me), Y-Glu-Abu-Gly, γ-Glu-Cys (S-Me) -GIy, and γ-Glu-Val- GIy (henceforth also referred to as "peptides and amino acids used for the present invention").
(2) The calcium receptor activator according to (1), which further contains one or more kinds of other compounds having calcium receptor activation activity.
(3) The calcium receptor activator according to (2), wherein the at least one kind of the other compounds having calcium receptor activation activity is a cation.
(4) A pharmaceutical composition for prevention or treatment of a medical disease, a surgical disease, a pediatric disease, an orthopedic disease, a plastic surgery disease, a neurosurgical disease, a dermatological disease, a urological disease, an obstetric or gynecological disease, an ophthalmologic disease, an otorhinolaryngological disease, or a dentistry or oral surgery disease, which contains the calcium receptor activator according to any one of (1) to (3) as an active ingredient.
(5) A method for screening for a calcium receptor activation inhibitor, comprising using the calcium receptor activator according to any one of (1) to (3) .
(6) Use of a substance selected from peptides and amino acids used for the present invention as a calcium receptor activator .
(7) A method for activating a calcium receptor comprising contacting a substance selected from peptides and amino acids used for the present invention, with the calcium receptor.
Effect of the Invention
By the present invention, a highly active calcium receptor activator highly safe to living bodies is provided. Moreover, by the present invention, a method for screening for a calcium receptor activation inhibitor is provided.
Brief Description of the Drawings
[Fig. 1] Drawing showing an action of calcium on the calcium receptor.
The human calcium receptor cRNA was introduced into Xenopus laevis oocytes by microinjection. Recorded were values of intracellular response currents which flew when a calcium chloride solution was added at an arbitrary concentration. The maximum values of intracellular currents were considered response current values. It was confirmed that no response was observed in oocytes introduced with distilled water by microinjection as a control.
[Fig. 2] Drawing showing an action of L-amino acids on the calcium receptor.
The ,human calcium receptor cRNA was introduced into Xenopus laevis oocytes by microinjection. Recorded were values of intracellular response currents which flew when a 10 mM L-amino acid solution was added. The maximum values of intracellular currents were considered response current values. It was confirmed that no response was observed in oocytes introduced with distilled water by microinjection as a control.
[Fig. 3] Drawing showing an action of D-amino acids on the calcium receptor.
The human calcium receptor cRNA was introduced into Xenopus laevis oocytes by microinjection. Recorded were values of intracellular response currents which flew when a 10 mM D-amino acid solution was added. The maximum values of intracellular currents were considered response current values. It was confirmed that no response was observed in oocytes introduced with distilled water by microinjection as a control.
[Fig. 4] Drawing showing an action of peptides on the calcium receptor.
The human calcium receptor cRNA was introduced into Xenopus laevis oocytes by microinjection. Recorded were values of intracellular response currents which flew when a peptide solution was added at an arbitrary concentration. The maximum values of intracellular currents were considered response current values. It was confirmed that no response was observed in oocytes introduced with distilled water by microinjection as a control.
Best Mode for Carrying out the Invention
Hereafter, the present invention will be explained in detail.
The calcium receptor activator of the present invention contains one or more kinds of substances selected from γ-Glu-Cys-Gly, γ-Glu-Cys (-SNO) -GIy, γ-Glu-Ala, γ-Glu- GIy, γ-Glu-Cys, γ-Glu-Met, γ-Glu-Thr, γ-Glu-Val, γ-Glu-Orn, Asp-Gly, Cys-Gly, Cys-Met, Glu-Cys, Gly-Cys, Leu-Asp, D-Cys, γ-Glu-Met (0) , Y-Glu-Val-Val, γ-Glu-Val-Glu, γ-Glu-Val-Lys, γ-Glu-γ-Glu-Val, γ-Glu-Val-NH2, γ-Glu-Va'l-ol, γ-Glu-Ser, γ~ Glu-Tau, γ-Glu-Cys(S-Me) (O), γ-Glu-Leu, γ-Glu-Ile, γ-Glu-t- Leu, γ-Glu-Cys (S-allyl) -GIy, γ-Glu-Gly-Gly, γ-Glu-Val-Phe, γ-Glu-Val-Ser, γ-Glu-Val-Pro, γ-Glu-Val-Arg, γ-Glu-Val-Asp, γ-Glu-Val-Met, γ-Glu-Val-Thr, γ-Glu-Val-His, γ-Glu-Val-Asn, Y-Glu-Val-Gln, γ-Glu-Val-Cys, γ-Glu-Val-Orn, γ-Glu-Ser-Gly, γ-Glu-Cys (S-Me) , γ-Glu-Abu-Gly, γ-Glu-Cys (S-Me) -GIy, and γ- Glu-Val-Gly. In this specification, all the amino acids and amino acid residues constituting the peptides are L- isomers, unless otherwise specified.
In the present specification, abbreviations for amino acid residues are as follows: (1) GIy: Glycine
(2) Ala: Alanine
(3) VaI: Valine
(4) Leu: Leucine
(5) lie: Isoleucine
(6) Met: Methionine
(7) Phe: Phenylalanine
(8) Tyr: Tyrosine
(9) Trp: Trptophan
(10) His: Histidine
(11) Lys: Lysine
(12) Arg: Arginine
(13) Ser: Serine
(14) Thr: Threonine
(15) Asp: Aspartic acid
(16) GIu: Glutamic acid
(17) Asn: Aspargine
(18) GIn: Glutamine
(19) Cys: Cysteine
(20) Pro: Proline
(21) Orn: Ornithine
(22) Sar: Sarcosine
(23) Cit: Citruline
(24) N-VaI: Norvaline
(25) N-Leu: Norleucine
(26) Abu: alpha-Aminobutylic acid
(27) Tau: Taurine
(28) Hyp: Hydroxyproline
(29) t-Leu: tert-Leucine
(30) Cys (S-Me) : S-methyl cysteine
(31) Cys (S-allyl) : S-allyl cysteine
(32) VaI-NH2: valinamide
(33) Val-ol: valinol (2-amino-3-methyl-l-butanol)
The aforementioned γ-Glu-Cys (SNO) -GIy has the following structural formula, and the " (O) " in the formulas γ-Glu-Met (0) and γ-Glu-Cys (S-Me) (O) indicates a sulfoxide structure. The "(Y)" in the γ-Glu indicates that glutamic acid bonds to another amino acid via Y position of carboxy group in the glutamic acid.
Figure imgf000010_0001
S-Nitrosoglutathione (GNSO)
In this specification, the "calcium 'receptor" is also the called calcium sensing receptor (CaSR) , and belongs to the class C of seven-transmembrane receptors. In this specification, the "calcium receptor activator" is a substance that acts on the aforementioned calcium receptor to activate the calcium receptor and control the functions of cells which express the calcium receptor. Furthermore, in this specification, "to activate the calcium receptor" indicates when a ligand (activator) binds to the aforementioned calcium receptor, resulting in activation of the guanine nucleotide binding protein, which thereby transmits signals.
It was demonstrated by the inventors of the present invention that γ-Glu-Cys-Gly, γ-Glu-Cys (SNO) -GIy, γ-Glu-Ala, Y-GIu-GIy, γ-Glu-Cys, γ-Glu-Met, γ-Glu-Thr, γ-Glu-Val, γ~ Glu-Orn, Asp-Gly, Cys-Gly, Cys-Met, Glu-Cys, Gly-Cys, Leu- Asp, D-Cys, γ-Glu-Met (0) , γ-Glu-Val-Val, γ-Glu-Val-Glu, γ~ Glu-Val-Lys, γ-Glu-γ-Glu-Val, γ-Glu-Val-NH2, γ-Glu-Val-ol, γ-Glu-Ser, γ-Glu-Tau, γ-Glu-Cys (S-Me) (0) , γ-Glu-Leu, γ-Glu- He, γ-Glu-t-Leu, γ-Glu-Cys (S-allyl) -GIy, γ-Glu-Gly-Gly, γ~ Glu-Val-Phe, γ-Glu-Val-Ser, γ-Glu-Val-Pro, γ-Glu-Val-Arg, γ-Glu-Val-Asp, γ-Glu-Val-Met , γ-Glu-Val-Thr, γ-Glu-Val-His, γ-Glu-Val-Asn, γ-Glu-Val-Gln, γ-Glu-Val-Cys, γ-Glu-Val-Orn, γ-Glu-Ser-Gly, γ-Glu-Cys (S-Me) , γ-Glu-Abu-Gly, γ-Glu-Cys (S- Me)-GIy, and γ-Glu-Val-Gly activated the calcium receptor. Therefore, γ-Glu-Cys-Gly, γ-Glu-Cys (SNO) -GIy, γ-Glu-Ala, γ~ Glu-Gly, Y-Glu-Cys, γ-Glu-Met, γ-Glu-Thr, γ-Glu-Val, γ-Glu- Orn, Asp-Gly, Cys-Gly, Cys-Met, Glu-Cys, Gly-Cys, Leu-Asp, D-Cys, γ-Glu-Met (O) , γ-Glu-Val-Val, γ-Glu-Val-Glu, γ-Glu- Val-Lys, γ-Glu-γ-Glu-Val, - γ-Glu-Val-NH2, γ-Glu-Val-ol, γ~ Glu-Ser, γ-Glu-Tau, γ-Glu-Cys (S-Me) (0) , γ-Glu-Leu, γ-Glu- He, γ-Glu-t-Leu, γ-Glu-Cys (S-allyl) -GIy, γ-Glu-Gly-Gly, γ~ Glu-Val-Phe, γ-Glu-Val-Ser, γ-Glu-Val-Pro, γ-Glu-Val-Arg, γ-Glu-Val-Asp, γ-Glu-Val-Met, γ-Glu-Val-Thr, γ-Glu-Val-His, γ-Glu-Val-Asn, γ-Glu-Val-Gln, γ-Glu-Val-Cys, γ-Glu-Val-0rn, γ-Glu-Ser-Gly, γ-Glu-Cys (S-Me) , γ-Glu-Abu-Gly, γ-Glu-Cys(S- Me)-GIy, and γ-Glu-Val-Gly (henceforth also ' referred to as the "peptides and amino acids used for the present invention") can be used as activators of the calcium receptor. In the present invention, the peptides and amino acids used for the present invention may be independently used, or can be used as a mixture of arbitrary two or more kinds of them.
As the aforementioned peptides and amino acids, if they are available as commercial products, those can be used. Furthermore, the peptides can be obtained by suitably using a known technique such as (1) a method of chemically synthesizing them, or (2) a method of synthesizing them by an enzymatic reaction. Since the number of residues of the contained amino acid residues of the peptides used for the present invention is as comparatively small as 2 or 3 residues, a method of chemically synthesizing them is convenient. When chemically synthesizing them, the oligopeptides can be synthesized or half-synthesized by using a peptide synthesizer. Examples of the method of chemically synthesizing them include, for example, a peptide solid phase synthetic method. Peptides synthesized as described above can be purified by usual means, for example, ion exchange chromatography, reversed phase high performance liquid chromatography, affinity chromatography, and so forth. Such a peptide solid phase synthetic method and the following purification of peptide are well known in this technical field.
Furthermore, the peptides used for the present invention can also be prepared by an enzymatic reaction. For example, the method described in International Patent Publication WO2004/011653 can be used. That is, they can also be prepared by reacting one amino acid or dipeptide of which carboxyl terminus is esterified or amidated and an amino acid having a free amino group (for example, an amino acid of which carboxyl group is protected) in the presence of a peptide producing enzyme, and purifying the produced dipeptide or tripeptide. Examples of the peptide producing enzyme include a culture of microorganisms' having an ability to produce peptides, microbial cells separated from such culture, processed product of cells of such microorganisms, peptide producing enzymes derived from such microorganisms, and so forth.
The peptides and amino acids used for the present invention also include those in the form of a salt. When the peptides and amino acids used for the present invention are in the form of a salt, they may be pharmacologically acceptable salts. Examples of a salt with an acidic group such as a carboxyl group in the formula include ammonium salts, salts with alkali metals such as sodium, and potassium, salt with alkaline earth metals such as calcium, and magnesium, aluminum salts, zinc salts, salts with organic amines such as triethylamine, ethanolamine, morpholine, pyrrolidine, piperidine, piperazine, and dicyclohexylamine, and salts with basic amino acids such as arginine, and lysine. Examples of salts with a basic group in case that a basic group exists in the formula include salts with inorganic acids such as hydrochloric acid, sulfuric acid, phosphoric acid, nitric acid, and hydrobromic acid, salts with organic carboxylic acids such as acetic acid, citric acid, benzoic acid, maleic acid, fumaric acid, tartaric acid, succinic acid, tannic acid, butyric acid, hibenzoic acid, pamoic acid, enanthoic acid, decanoic acid, teoclic acid, salicylic acid, lactic acid, oxalic acid, mandelic acid, and malic acid, and salts with organic sulfonic acids such as methanesulfonic acid, benzenesulfonic acid, and p-toluenesulfonic acid.
, As the aforementioned calcium receptor, the human calcium receptor encoded by the human calcium receptor gene registered with GenBank Accession No. NM_000388 can be exemplified as a preferred example. In addition, the calcium receptor is not limited to the protein encoded by the gene of the aforementioned sequence, and it may be a protein encoded by a gene having a homology of 60% or more, preferably 80% or more, more preferably 90% 'or more, to the aforementioned sequence, so long as the protein has the calcium receptor function. The GPRCβA receptor and the 5.24 receptor are also known as subtypes of the calcium receptor, and they can be used for the present invention. The calcium receptor function can be examined by expressing a gene of interest in a cell and measuring changes in the electric current, or intracellular calcium ion concentration at the time of the addition of calcium. ■
The calcium receptor activator of the present invention- may be a substance that activates, besides the aforementioned human calcium receptor, any one of calcium receptors derived from animals such as mouse, rat, and dog.
Whether the peptides and amino acids used for the present invention activate a calcium receptor can be confirmed by using live cells expressing a calcium receptor or a fragment thereof, cell membranes expressing a calcium receptor or a fragment thereof, an in vitro system containing a protein of a calcium receptor or a fragment thereof, or the like.
An example using live cells is shown below. However, confirmation of the calcium receptor activity is not limited to this example. A calcium receptor is expressed in cultured cells such as those of Xenopus lβevis oocytes, hamster ovarian cells, and human fetal kidney cells. The calcium receptor can be expressed by cloning a calcium receptor gene in a plasmid that can contain a foreign gene and introducing the plasmid or cRNA obtained by using the plasmid as a template. To detect the reaction, electrophysiological techniques, fluorescent indicator reagents that indicate an increase in intracellular calcium level, and so forth, can be used.
Expression of the calcium receptor is first confirmed based on the response to calcium or a specific activator. Oocytes that showed intracellular current with calcium at a concentration of about 5 mM, or cultured cells that showed fluorescence of the fluorescent indicator reagent with calcium at a concentration of about 5 mM are used. Calcium concentration dependency is determined by changing the calcium concentration. Then, a test substance such as a peptide is prepared to a concentration of about 1 μM to 1 mM, and added to the oocytes or cultured cells, and whether the aforementioned peptide or the like acts as an activator for the calcium receptor is determined.
Furthermore, the calcium receptor activator of the present invention may further contain one or more kinds of compounds having calcium receptor activation activity, in addition to one or more kinds of substances selected from γ-Glu-Cys-Gly, γ-Glu-Cys (SNO) -GIy, γ-Glu-Ala, γ-Glu-Gly, γ~ Glu-Cys, γ-Glu-Met, γ-Glu-Thr, γ-Glu-Val, γ-Glu-0rn, Asp- GIy, Cys-Gly, Cys-Met, Glu-Cys, Gly-Cys, Leu-Asp, D-Cys, γ~ Glu-Met(O), Y-Glu-Val-Val, γ-Glu-Val-Glu, γ-Glu-Val-Lys, γ- Glu-γ-Glu-Val, γ-Glu-Val-NH2, γ-Glu-Val-ol, γ-Glu-Ser, γ- Glu-Tau, γ-Glu-Cys (S-Me) (0) , γ-Glu-Leu, γ-Glu-Ile, γ-Glu-t- Leu, γ-Glu-Cys (S-allyl) -GIy, γ-Glu-Gly-Gly, γ-Glu-Val-Phe, γ-Glu-Val-Ser, γ-Glu-Val-Pro, γ-Glu-Val-Arg, γ-Glu-Val-Asp, γ-Glu-Val-Met, γ-Glu-Val-Thr, γ-Glu-Val-His, γ-Glu-Val-Asn, Y-Glu-Val-Gln, γ-Glu-Val-Cys, γ-Glu-Val-0rn, γ-Glu-Ser-Gly, γ-Glu-Cys (S-Me) , γ-Glu-Abu-Gly, γ-Glu-Cys (S-Me) -GIy, and γ- Glu-Val-Gly mentioned above. Examples of the existing compounds having aforementioned calcium receptor activation activity include cations such as calcium and gadolinium cations, basic peptides such as polyarginine and polylysine, polyamines such as putrescine, spermine and spermidine, proteins such as protamine, amino acids such as phenylalanine, cinacalcet, and so forth, but is not limited to these. In the present invention, the aforementioned existing compounds having calcium receptor activation activity may be added alone, or as a mixture of two or more kinds. Among the aforementioned existing compounds having calcium receptor activation activity, cations such as calcium and gadolinium cations are preferred, and the calcium cation is more preferred. That is, it is preferred that at least one kind of the" existing calcium receptor activators further added should be a cation.
By the coexistence of the aforementioned existing compounds having calcium receptor activation activity, stronger activation of the calcium receptor can be obtained. The ratio of the total amount of the peptides and amino acids used for the present invention and the total amount of the existing compounds having calcium receptor activation activity in the calcium receptor activator of the present invention is not particularly limited, so long as stronger activation of the calcium receptor can be obtained. However, for example, the mass ratio of the total amount of the peptides and amino acids used for the present invention and the total amount of the existing compounds having calcium receptor activation activity is preferably 1:100 to 100:1.
The calcium receptor is expressed in various tissues and is responsible for various physiological functions. Moreover, activators of the calcium receptor have been developed as therapeutic drugs to treat medical diseases (for example, Therapeutic drugs of hypercalcemia, Proc. Natl. Acad. Sci. USA, 1998 Mar. 31, 95 (7 ): 4040-5) .
Other than the control of calcium, it has been reported that, as for adipocytes, the calcium receptor is expressed in both mature adipocytes and undifferentiated adipocytes, and is involved in suppression of differentiation (Endocrinology, 2005 May, 146 ( 5) : 2176-9; Exp. Cell Res., 2004 Dec, 10; 301 (2) : 280-92) , as for bone marrow cells, it is expressed in erythroblasts, megakaryocytes and thrombocytes, and is involved in hematogenous regulation (J. Bone Miner Res., 1997 Dec, 12 ( 12 ): 1959-70.), and it is expressed in gastric parietal cells and is involved in gastric acid secretion (J. Clin. Endocrinol. Metab., 2005 Mar., 90 (3) : 1489-94 ). In addition to the above, it has been suggested that it is expressed in the duodenum, jejunum, ileum (Am. J. Physiol. Gastrointest .- Liver Physiol., 2002 JuI., 283 ( 1 ) : G240-50. ) , large intestine (Am. J. Physiol. Gastrointest. Liver Physiol., 2002 JuI., 283 (1) :G240-50. ) , epidermal keratinocytes (Cell Calcium, 2004 Mar., 35 (3) : 265-73. ) , hepatic cells (J. Biol. Chem., 2001 Feb. 9, 276 ( 6) : 4070-9) , vortex lentis (Biochem. Biophys. Res. Commun.,- 1997 Apr. 28, 233 (3) : 801-5) , Langerhans' islets in the pancreas (Endocrine., 1999 Dec, 11 (3) :293-300. ) , lung (J. Clin. Endocrinol. Metab., 1998 Feb., 83 (2) : 703-7. ) , monocyte^type cells (J. Clin. Invest., 2000 May, 105 ( 9) : 1299-305.), osteoblasts (Endocrinology, 2004 JuI., 145(7) :3451-62; Am. J. Physiol. Endocrinol. Metab., 2005 Mar., 288 (3) : E608-16, Epub. 2004 Nov. 16), and so forth, and is involved in functional regulation of these tissues .
Therefore, the calcium receptor activator of the present invention can be used as an active ingredient in a pharmaceutical composition for preventing or treating a disease in which the calcium receptor is involved. Examples of the disease in which the calcium receptor is involved include medical diseases, surgical diseases, pediatric diseases, orthopedic diseases, plastic surgery diseases, neurosurgical diseases, dermatological diseases, urological diseases, obstetric or gynecological diseases, ophthalmologic diseases, otorhinolaryngological diseases, dentistry or oral surgery diseases, and so forth.
The method for applying a pharmaceutical composition which contains the calcium receptor activator of the present invention as an active ingredient is not particularly limited, and oral administration, invasive administration utilizing injection or the like, administration of suppositories, or dermal administration can be employed. The active ingredient can be mixed with a non-toxic pharmaceutical carrier in the form of solid or liquid suitable for administration methods such as oral administration and administration by injection, and administered in the form of a conventional pharmaceutical preparation. Examples of such a pharmaceutical preparation include, for example, solid preparations such as tablets, granules, powders, and capsules, liquid preparations such as solutions, suspensions, and emulsions, lyophilized preparations, and so forth. These preparations can be prepared by conventional means for the preparation of drugs.
Examples of the -aforementioned non-toxic pharmaceutical carrier include, for example, glucose, lactose, sucrose, starch, mannitol, dextrin, aliphatic acid glycerides, polyethylene glycol, hydroxyethylstarch, ethylene glycol, polyoxyethylene sorbitan fatty acid esters, gelatin, albumin, amino acids, water, physiological saline, and so forth. Moreover, conventional additives such as stabilizers, wetting agents, emulsifiers, binders, and isotonic agents can also be optionally added as required.
The dose of the pharmaceutical composition of the present invention may be a quantity which is effective for a therapeutic and prophylactic treatment, and can be suitably adjusted depending on age, sex, weight, symptoms, and so forth of patients. However, for oral administration, for example, it is preferably 0.01 to 10 g, more preferably 0.1 to 1 g, in terms of the total amount of the peptides and amino acids used for the present invention, per 1 kg of body weight for a one time administration. Frequency of the administration is not particularly limited, and it can be administered once to several times per day.
The calcium receptor activator of the present invention can also be used as a food or drink which is effective for treatment or prevention of a disease in which the calcium receptor is involved. For example, it can be prepared as a food or drink indicated that it has a curative or preventive effect for such diseases in which the calcium receptor is involved as mentioned above on a container or package thereof.
The calcium receptor activator of the present invention can be used to screen for a calcium receptor activation inhibitor. Although a screening method will be exemplified below, the screening method is not limited to this method.
By adding any one of the peptides and amino acids used for the present invention and a test substance to Xenopus oocytes or cultured cells derived from a mammal expressing the calcium receptor, measuring the intracellular electric current or intracellular calcium concentration, and choosing a compound that inhibits increasing the intracellular electric current or calcium concentration caused by the peptide or amino acid used for the present invention, a calcium receptor activation inhibitor can be screened for.
As the test substance used for the screening, low molecular weight compounds, saccharides, peptides, proteins, and so forth can be used.
Examples
Hereinafter, the present invention will be more specifically explained with reference to examples. However, the scope of the present invention is not limited to these examples .
<Example 1>
<Preparation of gene (cRNA)>
The gene of the calcium receptor was prepared as follows. On the basis of the DNA sequence registered at NCBI (calcium receptor: NM_000388), synthetic oligo DNAs (forward primer (N) and reverse primer (C)) used for PCR were designed (Table 1, SEQ ID NOS: 1 and 2).
Table 1
Synthetic oligo DNAs (forward primer (N) and reverse primer (C) , h: human, r : rat)
Code Sequence (5 ' -3 ' ) hCASR_N ACTAATACGACTCACTATAGGGACCATGGCATTTTATAGCTGCTGCTGG hCASR_C TTATGAATTCACTACGTTTTCTGTAACAG rCASR_f ATGGAAAGCTCAGATGAAATGTC rCASR r GGAGTGTAATACGTTTTCCGTCAC
By using human kidney cDNA (Clontech) as a material, the primers shown in Table 1 (hCASR_N (SEQ ID NO: 1) and hCASR_C (SEQ ID NO: 2)) were synthesized, and PCR was performed by using Pfu ultra DNA Polymerase (Stratagene) under the following conditions. After a reaction at 940C for 3 minutes, a cycle of reactions at 94°C for 30 seconds, 55°C for 30 seconds, and 72°C >£or 2 minutes was repeated 35 times, and then a reaction was performed at 72°C for 7 minutes. Whether amplification was attained by PCR was detected by performing agarose electrophoresis, staining with a DNA staining reagent, and ultraviolet irradiation. The chain lengths of the PCR products were confirmed by comparison with DNA markers of known sizes simultaneously subjected to the electrophoresis. The plasmid vector pBR322 (Takara) was digested with the restriction enzyme EcoRV. The gene fragment amplified by PCR was ligated to the cleavage site of the plasmid by using Ligation Kit (Promega). The Escherichia coli DH5α strain was transformed with each ligation reaction solution, and a transformant harboring the plasmid in which the PCR amplification product was cloned was selected. The PCR amplification product was confirmed by DNA sequence analysis. By using this recombinant plasmid as a template together with a cRNA preparation kit (Ambion) , cRNA of the calcium receptor gene was prepared.
<Example 2>
<Preparation of various samples>
As L-amino acid samples, 23 kinds of special grade amino acids, alanine, arginine, asparagine, aspartic acid, cysteine, glutamine, glutamic acid, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, valine, ornithine, taurine (all of these from Ajinomoto), and hydroxyproline (Nakarai Tesque) , were used. As D-Cys and D-Trp (Nakarai Tesque) and calcium chloride, those of special grade were used. Furthermore, as peptide samples, γ-Glu-Cys-Gly (Sigma Aldrich Japan), γ-Glu-Cys (SNO) -GIy
(Dojin Chemical Laboratory), γ-Glu-Ala (Bachem Feinchemikalien AG) , γ-Glu-Gly (Bachem Feinchemikalien AG) , γ-Glu-Cys (Sigma Aldrich Japan) , γ-Glu-Met (Bachem Feinchemikalien AG), γ-Glu-Abu-Gly (Abu: α-aminobutyric acid, Bachem Feinchemikalien AG) , γ-Glu-Thr (Kokusan Chemical), γ-Glu-Val (Kokusan-Chemical) , γ-Glu-Leu
(contract manufactured product) , γ-Glu-Ile (contract manufactured product), γ-Glu-0rn (Kokusan Chemical), Asp- GIy (contract manufactured product), Cys-Gly (contract manufactured product), Cys-Met (contract manufactured product), Glu-Cys (contract manufactured product), Gly-Cys
(contract manufactured product), Leu-Asp (contract manufactured product ), γ-Glu-Val-Val (contract manufactured product), γ-Glu-Val-Glu (contract manufactured product), γ~ Glu-Val-Lys (contract manufactured product) , γ-Glu-γ-Glu- VaI (contract manufactured product) , γ-Glu-Gly-Gly
(contract manufactured product) , γ-Glu-Val-Phe (contract manufactured product) , γ-Glu-Val-Ser (contract manufactured product ), γ-Glu-Val-Pro (contract manufactured product), γ~ Glu-Val-Arg (contract manufactured product), γ-Glu-Val-Asp
(contract manufactured product), γ-Glu-Val-Met (contract manufactured product) , γ-Glu-Val-Thr (contract manufactured product), γ-Glu-Val-His (contract manufactured product), γ- Glu-Val-Asn (contract manufactured product) , γ-Glu-Val-Gln (contract manufactured product), γ-Glu-Val-Cys (contract manufactured product) , γ-Glu-Val-Orn (contract manufactured product) and γ-Glu-Ser-Gly (contract manufactured product) were used. Glutamine and cysteine were prepared upon use, and the other samples were stored at -200C after preparation. As the peptides, those having a purity of 90% or higher were used. As only for γ-Glu-Cys, one having a purity of 80% or higher was used. When the solution dissolving each sample showed an acidic or alkaline pH, the solution was adjusted to an approximately neutral pH by using NaOH or HCl. The solution used for dissolution of amino acids and peptides, preparation of Xehopus laevis oocytes, and culture of the oocytes had the following composition: 96 mM NaCl, 2 mM KCl, 1 mM MgCl2, 1.8 mM CaCl2, 5 mM Hepes, pH 7.2.
<Example 3>
<Synthesis of γ-Glu-Val-Gly>
Boc-Val-OH (8.69 g, 40.0, mmol) and Gly-OBzl'HCl (8.07 g, 40.0 mmol) were dissolved in methylene chloride (100 ml), and the solution was kept at 00C. Triethylamine (6.13 ml, 44.0 mmol), HOBt ( 1-hydroxybenzotriazole, 6.74 g, 44.0 mmol), and WSC-HCl (l-ethyl-3- ( 3- dimethylaminopropyl) carbodiimide hydrochloride, 8.44 g, 44.0 mmol) were added to the solution, and the mixture was stirred overnight at room temperature. The reaction mixture was concentrated under reduced pressure, and the residue was dissolved in ethyl acetate (200 ml). The solution was washed with water (50 ml), 5% citric acid aqueous solution (50 ml x twice), saturated brine (50 ml), 5% sodium hydrogencarbonate aqueous solution (50 ml x twice), and saturated brine (50 ml). The organic layer was dried over anhydrous magnesium sulfate, magnesium sulfate was removed by filtration, and the filtrate was concentrated under reduced pressure. The residue was recrystallized from ethyl acetate/n-hexane to obtain Boc- Val-Gly-OBzl (13.2 g, 36.2 ramol) as white crystals.
Boc-Val-Gly-OBzl (5.47 g, 15.0 πunol) was added to 4 N HCl/dioxane solution (40 ml), and the mixture was stirred at room temperature for 50 minutes. Dioxane was removed by concentration under reduced pressure, n-hexane (30 ml) was added to the residue, and- the mixture was concentrated under reduced pressure. This procedure was repeated 3 times to quantitatively obtain H-Val-Gly-OBzl»HCl .
The above H-Val-Gly-OBzl »HC1 and Z-GIu-OBzI (5.57 g, 15.0 mmol) were dissolved in methylene chloride (50 ml), and the solution was kept at 00C. Triethylamine (2.30 ml, 16.5 mmol), HOBt (1-hydroxybenzotriazole, 2.53 g, 16.5 mmol), 'and WSC-HCl ( l-ethyl-3- ( 3- dimethylaminopropyl) carbodiimide hydrochloride, 3.16 g, 16.5 mmol) were added to the solution, and the mixture was stirred at room temperature for 2 days. The reaction mixture was concentrated under reduced pressure, and the residue was dissolved in heated ethyl acetate (1500 ml). The solution was washed with water (200 ml), 5% citric acid aqueous solution (200 ml x twice), saturated brine (150 ml), 5% sodium hydrogencarbonate aqueous solution (200 ml x twice), and saturated brine (150 ml). The organic layer was dried -over anhydrous magnesium sulfate, magnesium sulfate was removed by filtration, and the filtrate was concentrated under reduced pressure. The deposited crystals were collected by filtration, and dried under reduced pressure to obtain Z-GIu(VaI-GIy-OBzI)-OBzI (6.51 g, 10.5 mmol) as white crystals.
The above Z-GIu(VaI-GIy-OBzI)-OBzI (6.20 g, 10.03 mmol) was suspended in ethanol (200 ml), and added with 10% palladium/carbon (1.50 g) , and reduction reaction was performed at 55°C for 5 hours under a hydrogen atmosphere. During the reaction, 100 ml in total of water was gradually added. The catalyst was removed by filtration using a Kiriyama funnel, and the filtrate was concentrated under reduced pressure to a half volume. The reaction mixture was further filtered through a membrane filter, and the filtrate was concentrated under reduced pressure. The residue was dissolved in a small volume of water, and added with ethanol to deposit crystals, and the crystals were collected by filtration, and dried under reduced pressure to obtain white powder of γ-Glu-Val-Gly (2.85 g, 9.40 mmol) . ESI-MS: (M+H)+ = 304.1
1H-NMR (400 MHz, D2O) δ (ppm) : 0.87 (3H, d, J=6.8 Hz), 0.88 (3H, d, J=6.8 Hz), 1.99-2.09 (3H, m) , 2.38-2.51 (2H, m) 3.72 (IH, t, J=6.35 Hz), 3.86 (IH, d, J=17.8 Hz), 3.80 (IH, d, J=17.8 Hz), 4.07 (IH, d, J=6.8 Hz)
<Example 4>
<Synthe'sis of γ-Glu-Cys (S-Me) -GIy [Cys (S-Me): S- methylcysteine] >
Reduced glutathione (15.0 g, 48.8 mmol) was added to water (45 ml), and sodium hydroxide (4.52 g, 2.2 equivalents, 107 mmol)- was added portionwise to the mixture while the mixture was bubbled with nitrogen. Methyl iodide (4.56 ml, 1.5 equivalents, 73 mmol) was added to the mixture, and the mixture was sealed and stirred at room temperature for 2 hours. The reaction mixture was adjusted to pH 2 to 3 with concentrated hydrochloric acid, added with ethanol (150 ml), and stored overnight in a refrigerator. Since oily matter was separated, the supernatant was removed. When the remained oily matter was dissolved in water and gradually added with ethanol, partially crystallized oily matter was deposited. Therefore, the supernatant liquid was removed again. The residue was dissolved in water (300 ml), adsorbed on an ion exchange resin (Dowex 1-acetate, 400 ml) filled in a column, and after washing with water, eluted with 1 N acetic acid aqueous solution. The eluate was concentrated under reduced pressure, and precipitated from water/ethanol to obtain a white powder of γ-Glu-Cys (S-Me) -GIy (5.08 g, 15.8 mmol) . FAB-MS: (M+H)+ = 322
1H-NMR (400 MHz, D2O) δ (ppm) : 2.14 (3H, s), 2.15-2.22 (2H, m) , 2.50-2.58 (2H, m) , 2.86 (IH, dd, J=9.0 Hz, J=14.0 Hz), 3.03 (IH, dd, J=5.0 Hz, J=14.0 Hz), 3.84 (IH, t, J=6.5 Hz), 3.99 (2H, S), 4.59 (IH, dd, J=5.0 Hz, J=9.0 Hz)
<Example 5>
<Synthesis of other peptides> γ-Glu-Met (0) , Y-GIu-VaI-NH2, γ-Glu-Val-ol, γ-Glu-Ser, γ-Glu-Tau, γ-Glu-Cys (S-Me) (O) , γ-Glu-t-Leu, γ-Glu-Cys(S- allyl)-Gly, and γ-Glu-Cys (S-Me) were synthesized in a manner similar to those of Examples 3 and 4.
<Example β>
<Evaluation of calcium receptor activation activity>
For evaluation of calcium receptor activation activity, a Ca ion concentration-dependent Cl ionic current measuring method using a Xenopus laevis oocyte expression system was used. If each activator is added to Xenopus laevis oocytes expressing the calcium receptor, intracellular Ca ions increase. Then, the Ca ion concentration-dependent Cl channel opens, and the intracellular current value changes as an ionic current. By measuring the change in this intracellular current value, whether the calcium receptor activation activity is present or not can be known.
Specifically, abdomen of Xenopus laevis was opened, and an egg batch was taken out and treated with a 1% collagenase solution at 200C for 2 hours to obtain individual oocytes. Into the oocytes, 50 nl of 1 μg/μl receptor cRNA or 50 nl of sterilized water per one oocyte was introduced by using a micro glass capillary, and the oocytes were cultured at 18 °C for 2 or 3 days. For the culture, a solution obtained by adding 2 mM pyruvic acid, 10 U/ml of penicillin, and 10 μg/ml of streptomycin to the solution mentioned in Example 2 was used. After the culture, a test solution was added to the oocytes introduced with cRNA or sterilized water.
Electrophysiological measurement was performed by using an amplifier, Geneclamp500 (Axon) , and recording software, AxoScope 9.0 (Axon). The oocytes were voltage-clamped at - 70 mV by the double electrode voltage clamp method, and the intracellular current was measured via the Ca ion concentration-dependent Cl ion channel. The maximum value of the intracellular current was considered as the response current value.
<Example 7>
<Evaluation of calcium receptor activation activity of calcium>
The calcium receptor activation activity of calcium was evaluated by using the method described in Example 6. That is, oocytes introduced with cRNA of the calcium receptor or sterilized water were prepared, and voltage- clamped at -70 mV by the double electrode voltage clamp method. To the voltage-clamped oocytes, calcium was added (2 mM, 5 mM, 10 mM, 20 mM) , and Ca ion concentration- dependent Cl response current was measured. The results are shown in Fig. 1. From these results, it was confirmed that cRNA of the calcium receptor introduced into the oocytes were functionally expressed. Furthermore, since the oocytes introduced with water did not respond to even high concentration calcium, it was confirmed that the calcium receptor is not expressed in the oocytes themselves.
<Example 8>
<Evaluation of calcium receptor activation activity of L- amino acids>
Calcium receptor activation activity of L-amino acids was evaluated by using the method described in Example 6. That is, oocytes introduced with cRNA of the calcium receptor or sterilized water were prepared, and voltage- clamped at -70 mV by the double electrode voltage clamp method. To the voltage-clamped oocytes, alanine (10 mM) , arginine (10 mM) , asparagine (10 mM) , aspartic acid (10 mM) , cysteine (10 mM) , glutamine (10 mM) , glutamic acid (10 mM) , glycine (10 mM) , histidine (10 mM) , isoleucine (10 mM) , leucine (1OmM), lysine (10 mM) , methionine (10 mM) , phenylalanine (10 mM) , proline (10 mM) , serine (10 mM) , threonine (10 mM) , tryptophan (10 mM) , tyrosine (10 mM) , valine (10 mM) , ornithine (10 mM) , taurine (10 mM) , or hydroxyproline (10 mM) was added, and Ca ion concentration- dependent Cl response current was measured. The results are shown in Fig. 2. By these results, it was demonstrated that cysteine, histidine, phenylalanine, tryptophan, and tyrosine had definite calcium receptor activation activity. As for the aforementioned amino acids, the activation activity was reported in Proc. Natl. Acad. Sci . USA, 2000 Apr. 25, 97 (9) :4814-9.
<Example 9>
<Evaluation of calcium receptor activation activity of D- cysteine>
Calcium receptor activation activity of D-cysteine was evaluated by using the method described in Example 6. That is, oocytes introduced with cRNA of the calcium receptor or sterilized water were prepared, and voltage- clamped at -70 mV by the double electrode voltage clamp method. To the voltage-clamped oocytes, D-cysteine (10 mM) , L-cysteine (10 mM) , D-tryptophan (10 mM) , or L-tryptophan (10 mM) was added, and Ca ion concentration-dependent Cl response current was measured. The results are shown in Fig. 3. By these results, it was demonstrated that D- cysteine had definite calcium receptor activation activity.
<Example 10>
<Evaluation of calcium receptor activation activity of peptides>
Calcium receptor activation activity of peptides was evaluated by using the method described in Example 6. That is, oocytes introduced with cRNA of the calcium receptor or sterilized water were prepared, and voltage-clamped at -70 mV by the double electrode voltage clamp method. To the voltage-clamped oocytes, γ-Glu-Cys-Gly (50 μM) , γ-Glu- Cys(SNO)-Gly (50 μM) , γ-Glu-Ala (50 μM) , γ-Glu-Gly (500 μM) , Y-Glu-Cys (50 μM) , γ-Glu-Met (500 μM) , γ-Glu-Thr (50 μM) , Y-Glu-Val (50 μM) , γ-Glu-Orn (500 μM) , Asp-Gly (1 mM) , Cys- GIy (1 mM) , Cys-Met (1 mM) , Glu-Cys (50 μM) , Gly-Cys (500 μM) or Leu-Asp (1 mM) was -added, and Ca ion concentration- dependent Cl response current was measured. The results are shown in Fig. 4. By these results, it was demonstrated that the aforementioned peptides had definite calcium receptor activation activity.
<Example 11>
<Evaluation of calcium receptor activation activity of peptides>
Calcium receptor activation activity of peptides was evaluated in the same manner as that of Example 10. Each of the peptides shown -in Table 2 was added to voltage- clamped oocytes at 1000 μM, 300 μM, 100 μM, 30 μM, 10 μM, 3 μM, 1 μM, 0.3 μM, and 0.1 μM, and Ca ion concentration- dependent Cl response current >.was measured. The lowest concentration with which current was detected was shown in Table 2 as the activity. From these results, it became clear that these 32 kinds of peptides had calcium receptor activation activity.
Table 2
Figure imgf000028_0001
<Example 12> distribution of the calcium receptor in a living body>
In order to elucidate distribution of the calcium receptor in a living body, expression of the calcium receptor in tissues was investigated as follows by using RNAs obtained from rats as a material and the quantitative RT-PCR method.
RNAs were prepared from rat tissues as follows. From 15-week old male F344 rats, cerebrum, cerebellum, lung, heart, liver, kidney, adrenal body, thyroid, parathyroid, pancreas, spleen, esophagus, upper third of stomach, fundus of stomach, duodenum, jejunum, ileum, caecum, colon, rectum, testis, epididymis, bladder, bone marrow, gastrocnemial muscle, soleus, skeletal muscle, fat, prostate, tongue, sublingual gland, and thymus were isolated. Total RNA was prepared by using Isogen (Nippon Gene) . Each tissue was homogenized by using Fast Prep (BIOlOl) or Polytron homogenizer, and total RNA was extracted from the homogenate. By using the -total RNA as a template, oligo dT primers and Superscript III reverse transcriptase ( Invitrogen) , cDNA was synthesized. The primers shown in Table 1 (rCASR_f: SEQ ID NO: 3 and rCASR_r: SEQ ID NO: 4) were synthesized, and RT-PCR of the calcium receptor was performed as follows. By quantitative PCR using cDNA of each tissue as a template, SYBR Green Realtime PCR Master Mix (TOYOBO) , and ABI PRISM 7700 Sequence Detector, the expression amount of the calcium receptor 'gene was analyzed. Distribution of tissue expression is shown in Table 3. Only for pancreas, human total RNA (Stratagene) was used.
From these results, it was confirmed that the calcium receptor was widely expressed in a living body, and not only in the parathyroid and kidney. This suggested that the calcium receptor was involved not only in functions of the parathyroid and kidney but also in various physiological functions of peripheral tissues and peripheral organs.
Table 3 : Distribution of calcium receptor in living body
Figure imgf000030_0001
<Example 13>
<Pharmacological evaluation of calcium receptor activators using animals>
Pharmacological effects of the peptides were confirmed by animal study. Parathyroid hormone (PTH) is one of the major proteins which relate to calcium homeostasis. Increase of PTH-amount is directly responsible for hyperparathyroidism and hypoparathyroidism. It is known that PTH is secreted from the parathyroid gland, and its secretion is inhibited when calcium receptor is activated. Male, 10 weeks old, Sprague-Dawley strain rats were used. "Rat Intact PTH ELISA KIT" ( Immutopics) was used for measuring PTH according to the producer's recommended protocol. lOOmg/ml of γ-Glu-Val-Gly was dissolved in physiological saline, and 0.1 ml/100 g body weight for each was injected through the tail vein. Blood was collected from the vein under right clavicle, and blood serum was obtained by centrifugation. Each group consists of 3 rats, and resulted PTH variation is shown below as average value±standard error. The result for peptide-administered group was: 148±72.5pg/ml before the administration and 9.44±2.94pg/ml 15 minutes after the administration; meanwhile, the result for control group (physiological saline administered group) was: 89.4±49.5pg/ml before the administration and 41. l±ll .6pg/ml 15 minutes after the administration. As a result, decreased PTH level was shown by the administration of the peptides of the present invention.
Industrial Applicability
Receptor activators for the GPCR (G-protein coupling type receptor) are universally applicable as curative agents of various diseases. Examples of curative commercial agents so far, or those under research, include the acetylcholine receptor activator (for treating Alzheimer disease), the adrenoreceptor activator (for treating bronchial asthma, for treating obesity) , the opioid receptor activator (for treating pain diseases), the receptor activator (for treating pain diseases), the calcitonin receptor activator (for treating osteoporosis), the cholecystokinin receptor activator (for treating diabetes) , the serotonine receptor activator (for treating migraine), the dopamine receptor activator (for treating Parkinson's disease, sedative), the melatonin receptor activator (for treating primary insomnia), the melanocortin receptor activator (for treating obesity), and so forth.
As for the range of applications of the calcium receptor activator belonging to GPCR as a curative agent, since the calcium receptor is distributed over a wide range of tissues as shown in Example 12, Table 3, it is expected that it is applicable to a wide range of diseases.
While the invention has been described in detail with reference to preferred embodiments thereof, it will be apparent to one skilled in the art that various changes can be made, and equivalents employed, without departing from the scope of the invention. All the cited references herein are incorporated as a part of this application by reference.

Claims

Claims
1. A calcium receptor activator containing one or more kinds of substances selected from γ-Glu-Cys-Gly, γ~ Glu-Cys(SNO)-Gly, γ-Glu-Ala, γ-Glu-Gly, γ-Glu-Cys, γ-Glu- Met, γ-Glu-Thr, γ-Glu-Val, γ-Glu-0rn, Asp-Gly, Cys-Gly, Cys-Met, Glu-Cys, Gly-Cys, Leu-Asp, D-Cys, γ-Glu-Met (O) , γ~ Glu-Val-Val, γ-Glu-Val-Glu, γ-Glu-Val-Lys, γ-Glu-γ-Glu-Val, Y-GIu-VaI-NH2, γ-Glu-Val-ol, γ-Glu-Ser, γ-Glu-Tau, γ-Glu- CyS(S-Me) (O), γ-Glu-Leu, γ-Glu-Ile, γ-Glu-t-Leu, γ-Glu- Cys (S-allyl) -GIy, γ-Glu-Gly-Gly, γ-Glu-Val-Phe, γ-Glu-Val- Ser, γ-Glu-Val-Pro, γ-Glu-Val-Arg, γ-Glu-Val-Asp, γ-Glu- Val-Met, γ-Gl'u-Val-Thr, γ-Glu-Val-His, γ-Glu-Val-Asn, γ~ Glu-Val-Gln, γ-Glu-Val-Cys, γ-Glu-Val-Orn, γ-Glu-Ser-Gly, γ-Glu-Cys (S-Me) , γ-Glu-Abu-Gly, γ-Glu-Cys (S-Me) -GIy, and γ~ Glu-Val-Gly.
2. The calcium receptor activator according to claim
1, which further contains one or more kinds of other compounds having calcium receptor activation activity.
3. The calcium receptor activator according to claim
2, wherein the at least one kind of the other compounds having calcium receptor activation activity is a cation.
4. Pharmaceutical composition comprising calcium receptor activator according any one of claims 1 to 3 as effective ingredient.
5. A method for screening for a calcium receptor activation inhibitor, comprising using the calcium receptor activator according to any one of claims 1 to 3.
PCT/JP2006/322684 2005-11-09 2006-11-08 Calcium receptor activator WO2007055388A2 (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
JP2008523061A JP5757674B2 (en) 2005-11-09 2006-11-08 Calcium receptor activator
EP06823386A EP1945201B1 (en) 2005-11-09 2006-11-08 Calcium receptor activator
US12/117,041 US8106020B2 (en) 2005-11-09 2008-05-08 Calcium receptor activator

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
JP2005325301 2005-11-09
JP2005-325301 2005-11-09
US73856005P 2005-11-22 2005-11-22
US60/738,560 2005-11-22

Related Child Applications (2)

Application Number Title Priority Date Filing Date
EP10002380.3A Previously-Filed-Application EP2233137B1 (en) 2005-11-09 2006-11-08 Calcium receptor activator
US12/117,041 Continuation US8106020B2 (en) 2005-11-09 2008-05-08 Calcium receptor activator

Publications (2)

Publication Number Publication Date
WO2007055388A2 true WO2007055388A2 (en) 2007-05-18
WO2007055388A3 WO2007055388A3 (en) 2007-09-27

Family

ID=37907737

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2006/322684 WO2007055388A2 (en) 2005-11-09 2006-11-08 Calcium receptor activator

Country Status (4)

Country Link
US (1) US8106020B2 (en)
EP (2) EP2233137B1 (en)
JP (2) JP5757674B2 (en)
WO (1) WO2007055388A2 (en)

Cited By (24)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008139945A1 (en) * 2007-05-08 2008-11-20 Ajinomoto Co., Inc. Low-fat food
WO2008139946A1 (en) * 2007-05-08 2008-11-20 Ajinomoto Co., Inc. Sweetener
WO2008139947A1 (en) * 2007-05-08 2008-11-20 Ajinomoto Co., Inc. Prophylactic or therapeutic agent for diarrhea
WO2009102050A1 (en) 2008-02-15 2009-08-20 Ajinomoto Co., Inc. Intestinal immune system stimulator
WO2009107660A1 (en) 2008-02-25 2009-09-03 味の素株式会社 Prophylactic or therapeutic agent for diabetes or obesity
JP2009209131A (en) * 2008-02-07 2009-09-17 Univ Kinki Pharmaceutical composition and additive to health-promoting food
WO2009119554A1 (en) 2008-03-24 2009-10-01 味の素株式会社 Promoter for bicarbonate secretion in gastrointestinal tract
WO2009128523A1 (en) 2008-04-17 2009-10-22 味の素株式会社 Immunostimulating agent
WO2010038895A1 (en) 2008-10-03 2010-04-08 味の素株式会社 Casr agonist
WO2011108724A1 (en) 2010-03-04 2011-09-09 味の素株式会社 Prophylactic or therapeutic agent for diabetes or obesity
US8106020B2 (en) 2005-11-09 2012-01-31 Ajinomoto Co., Inc. Calcium receptor activator
US8173605B2 (en) 2005-11-09 2012-05-08 Ajinomoto Co., Inc. Kokumi-imparting agent
CN102643904A (en) * 2012-04-01 2012-08-22 周宏灏 Kit and method for detecting CYP19A1 gene polymorphism by pyrophosphoric acid sequencing method
WO2013051685A1 (en) 2011-10-07 2013-04-11 味の素株式会社 Mutant γ-glutamyltransferase, and method for producing γ-glutamylvalylglycine or salt thereof
US8420144B2 (en) 2005-11-09 2013-04-16 Ajinomoto Co., Inc. Kokumi-imparting agent, method of using, and compositions containing same
JP5240398B2 (en) * 2010-03-04 2013-07-17 味の素株式会社 Alkylamine derivatives
RU2496864C2 (en) * 2010-07-05 2013-10-27 Закрытое акционерное общество "Научно-исследовательский институт "Аджиномото-Генетика" (ЗАО АГРИ) YEAST EXTRACT CONTAINING GAMMA-Glu-X OR GAMMA-Glu-X-Gly, AND METHOD OF ITS PRODUCTION
US8877739B2 (en) 2010-04-02 2014-11-04 Ajinomoto Co., Inc. Prophylactic agent or therapeutic agent for diabetes or obesity
US9000208B2 (en) 2010-03-24 2015-04-07 Ajinomoto Co., Inc. Glutamate derivatives or salts thereof
US9034403B2 (en) 2010-04-12 2015-05-19 Ajinomoto Co., Inc. Yeast extract containing γ-Glu-X or γ-Glu-X-Gly and a method for producing the same
WO2015115612A1 (en) 2014-01-31 2015-08-06 味の素株式会社 Mutant glutamate-cysteine ligase and method for manufacturing γ-glutamyl-valyl-glycine
EP3530749A1 (en) 2018-02-27 2019-08-28 Ajinomoto Co., Inc. Glutathione synthetase mutant and method for producing gamma-glu-val-gly
RU2768475C1 (en) * 2021-07-08 2022-03-24 Общество с ограниченной ответственностью "ТЕРРАНОВА КАПИТАЛ" Peptide with neurostimulation activity and restore learning and memory formation, pharmaceutical composition on its basis and method for its application
US11788109B2 (en) 2015-09-04 2023-10-17 Ajinomoto Co., Inc. Microorganism and method for producing gamma-glutamyl-valyl-glycine

Families Citing this family (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010114022A1 (en) 2009-04-01 2010-10-07 味の素株式会社 Use of peptide for imparting body taste
CN102686602B (en) 2009-12-28 2014-05-07 味之素株式会社 Lanthionine derivative
MX2012007245A (en) * 2009-12-28 2012-07-30 Ajinomoto Kk Flavor-enriching agent.
EP3115463B1 (en) 2014-03-05 2019-09-18 Ajinomoto Co., Inc. Method for producing gamma-glutamyl-valyl-glycine
CN103936823B (en) * 2014-03-06 2016-08-03 福州大学 A kind of metal chelating peptide and preparation method thereof
KR102100843B1 (en) * 2018-08-08 2020-04-14 샘표식품 주식회사 Peptide having antioxidant activity and composition comprising thereof

Citations (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1994022438A1 (en) 1993-03-26 1994-10-13 Constantin Romulus Dinu Pharmaceutical composition for the treatment of certain viruses and autoimmune diseases and the procedure of its preparation
US5409904A (en) 1984-11-13 1995-04-25 Alcon Laboratories, Inc. Hyaluronic acid compositions and methods
WO2002049653A1 (en) 2000-12-21 2002-06-27 Metabolic Engineering Laboratories Co., Ltd. Compositions for preservation of organs and blood
US20020176900A1 (en) 2000-11-22 2002-11-28 Inna Yegorova Compositions and methods for promoting a healthy cardiovascular system and enhancing blood flow
WO2003029417A2 (en) 2001-10-02 2003-04-10 Southern Illinois University Nutrient medium for maintaining neural cells in injured nervous system
US6573299B1 (en) 1999-09-20 2003-06-03 Advanced Medical Instruments Method and compositions for treatment of the aging eye
WO2003049687A2 (en) 2001-12-06 2003-06-19 Weller Health, Inc. Medicinal compositions & therapeutic methods
US20030211172A1 (en) 2002-05-10 2003-11-13 Jones Jeremy Park Composition and method for substantially reducing the deleterious effects of alcohol on the body
US6733797B1 (en) 2000-11-15 2004-05-11 William K. Summers Neuroceutical for improving memory and cognitive abilities
US20040116345A1 (en) 1999-02-22 2004-06-17 Marc Besman Novel albumin-free factor VIII formulations
US20050244512A1 (en) 2004-05-01 2005-11-03 Holekamp Nancy M Ophthalmic fluid and method of delivering same

Family Cites Families (35)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3331828A (en) * 1964-09-30 1967-07-18 Merck & Co Inc Isolation of gamma-l-glutamyl dipeptides from glutamic acid fermentation broths by ion exchange
JPS58134997A (en) * 1982-02-04 1983-08-11 Ajinomoto Co Inc Preparation of gamma-glutamyl-alpha-amino-n-butyryl-glycine
JPS60160894A (en) * 1984-01-30 1985-08-22 Ajinomoto Co Inc Preparation of gluthathione
US4741914A (en) 1984-11-13 1988-05-03 Ajinomoto Co., Inc. Flavor enhancing seasoning containing deodorized garlic extract and process
EP0276317B1 (en) * 1986-07-07 1993-03-17 Teijin Limited Gamma-l-glutamyl-l-cysteine ethyl ester and drug containing it as effective ingredient
US4758551A (en) * 1986-07-08 1988-07-19 Cornell Research Foundation, Inc. Methods for combatting renal toxicity due to metals or nephrotoxic drugs and for selectively modulating in vivo formation of leukotriene types
FR2611721B1 (en) * 1987-02-26 1990-01-26 Roussel Uclaf NOVEL GLUTAMIC ACID DERIVATIVES, SALTS THEREOF, PROCESS FOR THEIR PREPARATION, APPLICATION AS MEDICAMENTS AND COMPOSITIONS CONTAINING THEM
DE3722647A1 (en) * 1987-07-09 1989-01-19 Gerhard Ohlenschlaeger GALENIC USE OF A TRIPEPTID AS A MEDICINAL PRODUCT
NL9000613A (en) 1990-03-16 1991-10-16 Friesland Condensfab CALCIUM ENRICHED FERMENTED MILK BEVERAGES.
US5364930A (en) 1990-10-16 1994-11-15 Northwestern University Synthetic C1q peptide fragments
DK1281702T3 (en) * 1991-08-23 2006-04-18 Nps Pharma Inc Calcium receptor active molecules
JP4143118B2 (en) * 1993-02-23 2008-09-03 ブリガム・アンド・ウイミンズ・ホスピタル・インコーポレイテッド Calcium receptor activating molecule and related substances
DE69517836T2 (en) 1994-03-18 2001-03-01 Ajinomoto Co., Inc. Protein-containing agent to improve the taste quality of food
EP1142493B2 (en) 1998-11-26 2013-08-07 Ajinomoto Co., Inc. Process for producing flavor-enhancing agent for foods
BRPI0113105B1 (en) 2000-08-08 2018-03-27 Kao Corporation Oil / fat composition, food, feed and pharmaceutical product comprising said composition and process for preparing a food composition comprising a fat or oil
JP3951584B2 (en) 2000-10-10 2007-08-01 味の素株式会社 Method for producing modified raw milk and dairy product using the same
JP4089164B2 (en) * 2001-03-01 2008-05-28 味の素株式会社 Amino acid taste (taste) improvement method by γ-glutamylation
JP2004089181A (en) 2002-07-08 2004-03-25 Ajinomoto Co Inc Method for modifying food material
WO2004011653A1 (en) 2002-07-26 2004-02-05 Ajinomoto Co., Inc. Novel peptide synthase gene
US20040081970A1 (en) * 2002-10-28 2004-04-29 Athersys, Inc. Calcium-sensing receptor 2 (CaR2) and methods for using
JP4458288B2 (en) 2003-04-25 2010-04-28 味の素株式会社 NOVEL GLYCOPEPTIDE AND PEPTIDE HAVING KOKUMI EATING FUNCTION, AND METHOD OF IMPROVING KOKUMI OF FOOD
JP2005080503A (en) * 2003-09-04 2005-03-31 Ajinomoto Co Inc METHOD FOR PRODUCING gamma-D-GLUTAMYL COMPOUND
JP2005168405A (en) * 2003-12-11 2005-06-30 Ajinomoto Co Inc Method for producing dipeptide
US9399030B2 (en) 2005-02-01 2016-07-26 Ajinomoto Co., Inc. Topically applied circulation enhancing agent and skin and hair cosmetic and bath agent containing the same
JP2007117082A (en) 2005-09-27 2007-05-17 Ajinomoto Co Inc L-amino acid producing bacteria and preparation process of l-amino acid
GB0520912D0 (en) 2005-10-14 2005-11-23 Hofmann Thomas F Kokumi flavour compounds and use
US8420144B2 (en) 2005-11-09 2013-04-16 Ajinomoto Co., Inc. Kokumi-imparting agent, method of using, and compositions containing same
EP2233137B1 (en) 2005-11-09 2014-04-30 Ajinomoto Co., Inc. Calcium receptor activator
EP2175273B1 (en) 2005-11-09 2013-09-04 Ajinomoto Co., Inc. Kokumi-imparting agent
JP5321452B2 (en) 2007-05-08 2013-10-23 味の素株式会社 Preventive or therapeutic agent for diarrhea
MY153692A (en) 2007-05-08 2015-03-13 Ajinomoto Kk Sweetener
BRPI0811270A8 (en) 2007-05-08 2017-06-27 Ajinomoto Kk LOW FAT FOOD AND FLAVOR ENHANCEMENT AGENT
CA2716780A1 (en) 2008-02-25 2009-09-03 National University Corporation Hokkaido University Prophylactic or therapeutic agent for diabetes or obesity
WO2009119554A1 (en) 2008-03-24 2009-10-01 味の素株式会社 Promoter for bicarbonate secretion in gastrointestinal tract
JP5533648B2 (en) 2008-04-17 2014-06-25 味の素株式会社 Immunostimulator

Patent Citations (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5409904A (en) 1984-11-13 1995-04-25 Alcon Laboratories, Inc. Hyaluronic acid compositions and methods
WO1994022438A1 (en) 1993-03-26 1994-10-13 Constantin Romulus Dinu Pharmaceutical composition for the treatment of certain viruses and autoimmune diseases and the procedure of its preparation
US20040116345A1 (en) 1999-02-22 2004-06-17 Marc Besman Novel albumin-free factor VIII formulations
US6573299B1 (en) 1999-09-20 2003-06-03 Advanced Medical Instruments Method and compositions for treatment of the aging eye
US6733797B1 (en) 2000-11-15 2004-05-11 William K. Summers Neuroceutical for improving memory and cognitive abilities
US20020176900A1 (en) 2000-11-22 2002-11-28 Inna Yegorova Compositions and methods for promoting a healthy cardiovascular system and enhancing blood flow
WO2002049653A1 (en) 2000-12-21 2002-06-27 Metabolic Engineering Laboratories Co., Ltd. Compositions for preservation of organs and blood
WO2003029417A2 (en) 2001-10-02 2003-04-10 Southern Illinois University Nutrient medium for maintaining neural cells in injured nervous system
WO2003049687A2 (en) 2001-12-06 2003-06-19 Weller Health, Inc. Medicinal compositions & therapeutic methods
US20030211172A1 (en) 2002-05-10 2003-11-13 Jones Jeremy Park Composition and method for substantially reducing the deleterious effects of alcohol on the body
US20050244512A1 (en) 2004-05-01 2005-11-03 Holekamp Nancy M Ophthalmic fluid and method of delivering same

Non-Patent Citations (19)

* Cited by examiner, † Cited by third party
Title
AM. J. PHYSIOL. ENDOCRINOL. METAB., vol. 288, no. 3, March 2005 (2005-03-01), pages E608 - E616
AM. J. PHYSIOL. GASTROINTEST.-LIVER PHYSIOL., vol. 283, no. 1, July 2002 (2002-07-01), pages G240 - G250
BIOCHEM. BIOPHYS. RES. COMMUN., vol. 233, no. 3, 28 April 1997 (1997-04-28), pages 801 - 805
CELL CALCIUM, vol. 35, no. 3, March 2004 (2004-03-01), pages 209 - 216
CELL CALCIUM, vol. 35, no. 3, March 2004 (2004-03-01), pages 265 - 273
DATABASE GENBANK accession no. M_000388
ENDOCRINE, vol. 11, no. 3, December 1999 (1999-12-01), pages 293 - 300
ENDOCRINOLOGY, vol. 145, no. 7, July 2004 (2004-07-01), pages 3451 - 3462
ENDOCRINOLOGY, vol. 6, no. 5, 14 May 2005 (2005-05-14), pages 2176 - 2179
EUR. J. PHARMACOL., vol. 447, no. 2-3, 5 July 2002 (2002-07-05), pages 271 - 278
EXP. CELL RES., vol. 301, no. 2, 10 December 2004 (2004-12-10), pages 280 - 292
J. BIOL. CHEM., vol. 276, no. 6, 9 February 2001 (2001-02-09), pages 4070 - 4079
J. BONE MINER. RES., vol. 12, no. 12, December 1997 (1997-12-01), pages 1959 - 1970
J. CLIN. ENDOCRINOL. METAB., vol. 83, no. 2, February 1998 (1998-02-01), pages 703 - 707
J. CLIN. ENDOCRINOL. METAB., vol. 90, no. 3, March 2005 (2005-03-01), pages 1489 - 1494
J. CLIN. INVEST., vol. 105, no. 9, May 2000 (2000-05-01), pages 1299 - 1305
J. ENDOCRINOL., vol. 165, no. 2, May 2000 (2000-05-01), pages 173 - 177
NATURE, vol. 366, no. 6455, 9 December 1993 (1993-12-09), pages 575 - 580
PROC. NATL. ACAD. SCI. USA, vol. 95, no. 7, 31 March 1998 (1998-03-31), pages 4040 - 4045

Cited By (40)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8106020B2 (en) 2005-11-09 2012-01-31 Ajinomoto Co., Inc. Calcium receptor activator
US8420144B2 (en) 2005-11-09 2013-04-16 Ajinomoto Co., Inc. Kokumi-imparting agent, method of using, and compositions containing same
US9395376B2 (en) 2005-11-09 2016-07-19 Ajinomoto Co., Inc. Kokumi-imparting agent
US8173605B2 (en) 2005-11-09 2012-05-08 Ajinomoto Co., Inc. Kokumi-imparting agent
JP5195751B2 (en) * 2007-05-08 2013-05-15 味の素株式会社 sweetener
WO2008139946A1 (en) * 2007-05-08 2008-11-20 Ajinomoto Co., Inc. Sweetener
WO2008139945A1 (en) * 2007-05-08 2008-11-20 Ajinomoto Co., Inc. Low-fat food
US8399417B2 (en) 2007-05-08 2013-03-19 Ajinomoto Co., Inc. Food
WO2008139947A1 (en) * 2007-05-08 2008-11-20 Ajinomoto Co., Inc. Prophylactic or therapeutic agent for diarrhea
JPWO2008139946A1 (en) * 2007-05-08 2010-08-05 味の素株式会社 sweetener
US9420813B2 (en) 2007-05-08 2016-08-23 Ajinomoto Co., Inc. Sweetener
JP2009209131A (en) * 2008-02-07 2009-09-17 Univ Kinki Pharmaceutical composition and additive to health-promoting food
WO2009102050A1 (en) 2008-02-15 2009-08-20 Ajinomoto Co., Inc. Intestinal immune system stimulator
WO2009107660A1 (en) 2008-02-25 2009-09-03 味の素株式会社 Prophylactic or therapeutic agent for diabetes or obesity
WO2009119554A1 (en) 2008-03-24 2009-10-01 味の素株式会社 Promoter for bicarbonate secretion in gastrointestinal tract
JPWO2009119554A1 (en) * 2008-03-24 2011-07-21 味の素株式会社 Gastrointestinal bicarbonate secretagogue
WO2009128523A1 (en) 2008-04-17 2009-10-22 味の素株式会社 Immunostimulating agent
US8454978B2 (en) 2008-04-17 2013-06-04 Ajinomoto Co., Inc. Immunostimulating agent
JP5533648B2 (en) * 2008-04-17 2014-06-25 味の素株式会社 Immunostimulator
US9174932B2 (en) 2008-10-03 2015-11-03 Ajinomoto Co., Inc. CaSR agonists
WO2010038895A1 (en) 2008-10-03 2010-04-08 味の素株式会社 Casr agonist
CN103980309A (en) * 2008-10-03 2014-08-13 味之素株式会社 Casr agonist
JP5685941B2 (en) * 2008-10-03 2015-03-18 味の素株式会社 CaSR agonist
US8796485B2 (en) 2008-10-03 2014-08-05 Ajinomoto Co., Inc. CaSR agonists
JP5240398B2 (en) * 2010-03-04 2013-07-17 味の素株式会社 Alkylamine derivatives
WO2011108724A1 (en) 2010-03-04 2011-09-09 味の素株式会社 Prophylactic or therapeutic agent for diabetes or obesity
US9150505B2 (en) 2010-03-04 2015-10-06 Ajinomoto Co., Inc. Prophylactic or therapeutic agent for diabetes or obesity
US9000208B2 (en) 2010-03-24 2015-04-07 Ajinomoto Co., Inc. Glutamate derivatives or salts thereof
US8877739B2 (en) 2010-04-02 2014-11-04 Ajinomoto Co., Inc. Prophylactic agent or therapeutic agent for diabetes or obesity
US9034403B2 (en) 2010-04-12 2015-05-19 Ajinomoto Co., Inc. Yeast extract containing γ-Glu-X or γ-Glu-X-Gly and a method for producing the same
RU2496864C2 (en) * 2010-07-05 2013-10-27 Закрытое акционерное общество "Научно-исследовательский институт "Аджиномото-Генетика" (ЗАО АГРИ) YEAST EXTRACT CONTAINING GAMMA-Glu-X OR GAMMA-Glu-X-Gly, AND METHOD OF ITS PRODUCTION
WO2013051685A1 (en) 2011-10-07 2013-04-11 味の素株式会社 Mutant γ-glutamyltransferase, and method for producing γ-glutamylvalylglycine or salt thereof
US9580696B2 (en) 2011-10-07 2017-02-28 Ajinomoto Co., Inc. Method for producing γ-glutamylvalylglycine or a salt thereof
US9677106B2 (en) 2011-10-07 2017-06-13 Ajinomoto Co., Inc. Method for producing gamma-glutamylvalylglycine or a salt thereof
CN102643904A (en) * 2012-04-01 2012-08-22 周宏灏 Kit and method for detecting CYP19A1 gene polymorphism by pyrophosphoric acid sequencing method
WO2015115612A1 (en) 2014-01-31 2015-08-06 味の素株式会社 Mutant glutamate-cysteine ligase and method for manufacturing γ-glutamyl-valyl-glycine
US11788109B2 (en) 2015-09-04 2023-10-17 Ajinomoto Co., Inc. Microorganism and method for producing gamma-glutamyl-valyl-glycine
EP3530749A1 (en) 2018-02-27 2019-08-28 Ajinomoto Co., Inc. Glutathione synthetase mutant and method for producing gamma-glu-val-gly
US11142755B2 (en) 2018-02-27 2021-10-12 Ajinomoto Co., Inc. Mutant glutathione synthetase and method for producing gamma-glutamyl-valyl-glycine
RU2768475C1 (en) * 2021-07-08 2022-03-24 Общество с ограниченной ответственностью "ТЕРРАНОВА КАПИТАЛ" Peptide with neurostimulation activity and restore learning and memory formation, pharmaceutical composition on its basis and method for its application

Also Published As

Publication number Publication date
JP2009519892A (en) 2009-05-21
EP2233137A2 (en) 2010-09-29
EP1945201B1 (en) 2011-09-28
US20090239808A1 (en) 2009-09-24
WO2007055388A3 (en) 2007-09-27
US8106020B2 (en) 2012-01-31
JP5724946B2 (en) 2015-05-27
EP2233137B1 (en) 2014-04-30
JP2012211142A (en) 2012-11-01
EP1945201A2 (en) 2008-07-23
EP2233137A3 (en) 2010-10-20
JP5757674B2 (en) 2015-07-29

Similar Documents

Publication Publication Date Title
EP2233137B1 (en) Calcium receptor activator
EP2156846B1 (en) Prophylactic or therapeutic agent for diarrhea
EP1946110B1 (en) Screening method for kokumi-imparting agents
KR101491984B1 (en) Sweetener
WO2009107660A1 (en) Prophylactic or therapeutic agent for diabetes or obesity
CN101693736B (en) Novel peptides
JP4786047B2 (en) Peptide derivatives
US8420144B2 (en) Kokumi-imparting agent, method of using, and compositions containing same
TWI325003B (en) Ghrelin analogs
NZ581627A (en) Low fat food with a calcium receptor activating additive
TW200408402A (en) Growth hormone releasing peptides
WO2000018793A1 (en) Peptide derivative
EP2399927B1 (en) Novel compound, phosphorylation inhibitor, insulin resistance improving agent, agent to prevent or to treat diabetes, and screening method
WO2011024763A1 (en) Prophylaxis, therapeutic agent, or anorexiant for diabetes
JPWO2007105442A1 (en) Drugs for eating disorders or drinking disorders
JP2000159795A (en) Peptide derivative

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2006823386

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2008523061

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE