WO2007049275A2 - Isolated polypeptides, polynucleotides encoding same, transgenic plants expressing same and methods of using same - Google Patents
Isolated polypeptides, polynucleotides encoding same, transgenic plants expressing same and methods of using same Download PDFInfo
- Publication number
- WO2007049275A2 WO2007049275A2 PCT/IL2006/001223 IL2006001223W WO2007049275A2 WO 2007049275 A2 WO2007049275 A2 WO 2007049275A2 IL 2006001223 W IL2006001223 W IL 2006001223W WO 2007049275 A2 WO2007049275 A2 WO 2007049275A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- plant
- fue
- plants
- promoter
- seq
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8273—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for drought, cold, salt resistance
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
- Y02A40/146—Genetically Modified [GMO] plants, e.g. transgenic plants
Definitions
- the present invention relates to isolated polypeptides, polynucleotides encoding same, transgenic plants expressing same and methods of using same.
- the present invention can be used to increase fertilizer use efficiency and stress resistance as well as biomass, vigor and yield of transgenic plants.
- Fertilizers are the foel behind the "green revolution", directly responsible for the exceptional increase in crop yields during the last 40 years. The dramatic rise in crop yields could never have occurred without a parallel increase in fertilizer use.
- fertilizer use particularly nitrogen fertilizers, on water and atmospheric pollution.
- Limits on fertilizer use have been legislated in several countries, and further restrictions are expected in the future. Greater use of fertilizers will be necessary in the future to support food and fiber production for rapid population growth on limited land resources.
- Fertilizer is often mentioned as the number one overhead expense in agriculture.
- main fertilizers N, Phosphate (P) and Potassium (K)
- nitrogen is the only one that usually needs to be replenished every year, particularly for cereals, which comprise more than half of the cultivated areas worldwide.
- a common approach to promoting plant growth has been, and continues to be, the use of nutrients (fertilizers), natural as well as synthetic.
- Synthetic nutrients usually provide a macronutrient in a plant-usable form, such as urea for example, and/or inorganic nitrates, phosphates, or the like compounds. While such nutrients may be applied, more or less, at the convenience of the farmer, and may be applied as often as deemed desirable, the overuse of synthetic nutrients and the inefficient use of synthetic nutrients are major factors responsible for environmental problems such as eutrophication of groundwater, nitrate pollution, phosphate pollution, and the like.
- Nitrogen is an essential macronutrient for the plant, responsible for biosynthesis of amino and nucleic acids, prosthetic groups, plant hormones, plant chemical defenses, etc. Nitrogen is often the rate-limiting element in plant growth and all field crops have a fundamental dependence on inorganic nitrogenous fertilizer.
- Nitrogenous fertilizer which is usually supplied as ammonium nitrate, potassium nitrate, or urea, typically accounts for 40% of the costs associated with crops such as corn and wheat. It has been estimated that by 2050, more than 150 million tons of nitrogenous fertilizer will used worldwide annually. Increased use efficiency of nitrogen by plants should enable crops to be cultivated with lower fertilizer input, or alternatively on soils of poorer quality and would therefore have significant economic impact in both developed and developing agricultural systems. An overview of the undesirable effects of nitrogen fertilizer is presented by Byrnes, Fertilizer Research, 26, pp. 209- 215 (1990).
- the Nitrogen assimilation process begins with NO 3 " being converted to NH 4 + sequentially by the enzymes Nitrate Reductase (NR) and Nitrite Reductase (NiR). The nitrogen is then incorporated into Glutamate (GIu) by Glutamine Synthase (GS) to obtain Glutamine (GIn).
- GS/GOGAT cycle Glutamine Synthase/Glutamate-Oxoglutarate Amine Transferase).
- the remaining amino acids are synthesized from GIn, GIu and Asn by transamination.
- Nitrogen (as amino acids or in the form of nitrates) is translocated to the shoot, where it is stored in the leaves and stalk during the rapid step of plant development and up until flowering.
- plants accumulate the bulk of their organic nitrogen during the period of grain germination, and until flowering. Once fertilization of the plant has occurred, grains begin to form and become the main sink of plant Nitrogen. The stored Nitrogen can then be redistributed from the leaves and stalk that served as storage compartments until grain formation.
- Nitrogen-uptake efficiency is the amount of N in above-ground biomass (gr Nt) divided by the amount of N applied (gr/hectare); Nitrogen utilization efficiency: is the Grain Yield (gr/plant) divided by the amount of N in above-ground biomass (gr Nt); and
- Nitrogen-use efficiency is the Grain Yield (gr/plant) divided by the amount of N applied (gr/Ha).
- the Nitrogen-uptake efficiency [the amount of N in above ground biomass (gr)
- Nt N applied (gr/hectare)
- Nt N applied (gr/hectare)
- the fraction of the assimilated Nitrogen found in a shoot that is ultimately transferred to the grain (yield) is controlled enzymatically, and thus a potential site for transgenic manipulation.
- This parameter is, in effect, equal to the Nitrogen Utilization efficiency (NUE).
- NUE Nitrogen Utilization efficiency
- the NUE for the main crops ranges from 30-70% only, having a direct negative impact on input expenses for the farmer, due to the excess fertilizer applied, which quickly becomes an ecological burden.
- nitrate-containing wastes represent an environmental problem of global significance. Nitrate seepage in water causes eutrophication of lakes, rivers and seas (waters endangered because of algae growth that leads to hypoxia and destruction of marine fauna). Nitrate contamination in drinking water can cause methemoglobinemia, which is especially detrimental to infants and nursing mothers. In fact, the Farming Industry is considered as the largest nitrate polluter of surface and coastal waters and drinking water supplies.
- FUE Fertilizer Use Efficiency
- transgenic canola plants improved drought and nitrogen deficiency tolerance when compared to control plants.
- Dofl constructs of Yanagisawa et al, nor the drought-induced AIaAT constructs of Good et al. have been evaluated in commercial lines, under true field conditions. Hence the economic relevance of the results is yet to be proven.
- nucleic acid construct comprising a nucleic acid sequence at least 85 % identical to a nucleotide sequence selected from the group consisting of SEQ ID NOs: 68, 1, 4, 5, 8,
- the nucleic acid sequence is as set forth in SEQ ID NO: 68, 1, 4, 5, 8, 9, 11, 13, 16, 19, 20, 23, 24, 27, 30, 32, 37, 42, 49, 50, 51, 53, 54, 55, 56, 57, 58, 64, 69, 70, 73, 77, 78, 79, 80, 84, 86, 87, 93, 94, 98, 101, 102, 103, 104, 105, 106, 107, 108, 109, 219-767, 1317, 1318, 1319, 1320, 1321, 1322, 1323, 1324, 1325, 1326, 1327, 1328, 1329, 1330, 1331, 1332, 1333, 1334, 1335 or 1336.
- an isolated polypeptide comprising an amino acid sequence at least 85 % homologous to the amino acid sequence set forth in SEQ ID NO: 177, 110, 113, 114, 117, 118, 120, 122, 125, 128, 129, 132, 133, 136, 139, 141, 146, 151, 158, 159, 160, 162, 163, 164, 165, 166, 167, 173, 178, 179, 182, 186, 187, 188, 189, 193, 195, 196, 202, 203, 207, 210, 211, 212, 213, 214, 215, 216, 217 or 218.
- a plant cell comprising an exogenous polynucleotide which comprises a nucleic acid sequence encoding a polypeptide having an amino acid sequence at least 85 % homologous to SEQ ID NO: 177, 110, 113, 114, 117, 118, 120, 122, 125, 128, 129, 132, 133, 136, 139, 141, 146, 151, 158, 159, 160, 162, 163, 164, 165, 166, 167, 173, 178, 179, 182, 186, 187, 188, 189, 193, 195, 196, 202, 203, 207, 210, 211, 212, 213, 214, 215, 216, 217 or218.
- the plant cell forms a part of a plant.
- the amino acid sequence is as set forth in SEQ ID NO: 177, 110, 113, 114, 117, 118, 120, 122, 125, 128, 129, 132, 133, 136, 139, 141, 146, 151, 158, 159, 160, 162, 163, 164, 165, 166, 167, 173, 178, 179, 182, 186, 187, 188, 189, 193, 195, 196, 202, 203, 207, 210, 211, 212, 213, 214, 215, 216, 217, 218, 768-1051, 1053-1098, 1100-1315 or 1316.
- a method of increasing tolerance of a plant to a stress condition comprising expressing within the plant an exogenous polynucleotide encoding a polypeptide having an amino acid sequence at least 85 % homologous to SEQ ID NO: 177, 110, 113, 114, 117, 118, 120, 122, 125, 128, 129, 132, 133, 136, 139, 141, 146, 151, 158, 159, 160, 162, 163,
- a method of increasing biomass, vigor and/or yield of a plant comprising expressing within the plant an exogenous polynucleotide encoding a polypeptide having an amino acid sequence at least 85 % homologous to SEQ ID NO: 177, 110, 113, 114, 117, 118, 120, 122, 125, 128, 129, 132, 133, 136, 139, 141, 146, 151, 158, 159, 160, 162, 163, 164, 165, 166, 167, 173, 178, 179, 182, 186, 187, 188, 189, 193, 195, 196, 202, 203, 207, 210, 21 1, 212, 213, 214, 215, 216, 217, 218, 1341 or 1343, thereby increasing biomass, vigor and/or yield of the plant.
- a method of increasing fertilizer use efficiency and/or uptake of a plant comprising expressing within the plant an exogenous polynucleotide encoding a polypeptide having an amino acid sequence at least 85 % homologous to SEQ ID NO: 177, 110, 113, 114, 117, 118, 120, 122, 125, 128, 129, 132, 133, 136, 139, 141, 146, 151, 158, 159, 160, 162, 163, 164, 165, 166, 167, 173, 178, 179, 182, 186, 187, 188, 189, 193, 195, 196, 202, 203, 207, 210, 211, 212, 213, 214, 215, 216, 217, 218, 1341 or 1343, thereby increasing fertilizer use efficiency and/or uptake of the plant.
- the transforming is effected by introducing to the plant cell a nucleic acid construct including the exogenous polynucleotide and at least one promoter capable of directing transcription of the exogenous polynucleotide in the plant cell.
- the at least one promoter is a constitutive promoter. According to further features in preferred embodiments of the invention described below, the promoter is a constitutive promoter.
- the constitutive promoter is CaMV 35 S promoter. According to still further features in the described preferred embodiments the promoter is an inducible promoter.
- the inducible promoter is an abiotic stress inducible promoter.
- the promoter is a tissue specific promoter.
- the tissue is a root tissue.
- the host cell is a plant cell.
- the plant cell forms a part of a dicotyledonous plant cell.
- the plant cell forms a part of a monocotyledonous plant cell.
- the stress condition is an abiotic stress.
- the abiotic stress is selected from the group consisting of salinity, drought, low temperature, high temperature, heavy metal toxicity, anaerobiosis, osmoticum, and nutrient deficiency.
- the nutrient is nitrogen.
- the plant is a dicotyledonous plant.
- the plant is a monocotyledonous plant.
- the polynucleotide comprises a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 68, 1, 4, 5, 8, 9, 11, 13, 16, 19, 20, 23, 24, 27, 30, 32, 37, 42, 49, 50, 51, 53, 54, 55, 56, 57, 58, 64, 69, 70, 73, 77, 78, 79, 80, 84, 86, 87, 93, 94, 98, 101, 102, 103, 104, 105, 106, 107, 108, 109, 219-767, 1317, 1318, 1319, 1320, 1321, 1322, 1323, 1324, 1325, 1326, 1327, 1328, 1329, 1330, 1331, 1332, 1333, 1334, 1335, 1336, 1340 or 1342.
- the amino acid sequence is as set forth in SEQ ID NO: 177, 110, 113, 114, 117, 118, 120, 122, 125, 128, 129, 132, 133, 136, 139, 141, 146, 151, 158, 159, 160, 162, 163, 164, 165, 166, 167, 173, 178, 179, 182, 186, 187, 188, 189, 193, 195, 196, 202, 203, 207, 210, 211, 212, 213, 214, 215, 216, 217, 218, 768-1051, 1053-1098, 1100-1316, 1341 or 1343.
- the conditions are abiotic stress conditions.
- the conditions are fertilizer deficiency conditions.
- a method for irrigation comprising:
- an irrigation system for mimicking drought conditions comprising:
- the present invention successfully addresses the shortcomings of the presently known configurations by providing polynucleotides and polypeptides which improve fertilizer use/uptake efficiency in transgenic plants expressing same.
- FIG. IA is a schematic illustration describing the development of the plant root system in drought. Scarce soil humidity induces the formation of a deeper root system. The drawing is adapted from JE Weaver [Root Development of Field Crops. McGraw Hill Inc., New York, 291 p. (1926)].
- FIG. IB is a schematic representation of the biological strategies chosen to improve the NUE trait and the translation of the strategies to the queries performed during computational data mining.
- FIGs. 2A-D show digital expression of FUE_1.
- FIGs. 3A-D are graphs showing expression of control genes (Nitrogen transporters and Glutamine synthase) as a function of nitrogen content in the soil. Plants were grown in 10 liter pots with increasing concentrations of either NH 4 NO 3 (at 0.005, 0.05, 0.5 and 5 niM) or KNO 3 (at 0.01, 0.1, 1 or 5 mM). Plants were grown for approximately 30 days and tissues were snap frozen in liquid nitrogen. RNA was extracted from the tissues and later treated with DNAse. RNA was reverse- transcribed and used for quantification assays using Real Time PCR. For normalization, the expression at each point was divided by the geometric mean of the expression of four housekeeping as described in Example 2. The results shown are the ratio between the normalized expression and the expression levels measured at the highest concentration checked (5mM NH 4 NO 3 or 5 mM KNO 3 ).
- FIGs. 4A-K are graphs showing correlated expression of polynucleotide sequences of the present invention with nitrogen availability.
- FIGs. 5A-E are graphs showing inversely correlated expression of polynucleotide sequences of the present invention with nitrogen availability.
- FIG. 6 is a schematic stepwise representation of the technology used for plant rosette area quantitation from digital images.
- the processing step filters the green parts of the individual plants. After designation of individual ROIs (Region of Interest) the area covered by the rosette area is calculated and exported to a worksheet.
- ROIs Region of Interest
- FIGs. 7A-B are photographs showing the ability of polynucleotides of the present invention to increase nitrogen use efficiency.
- Figure 7 A transgenic - Tl plants expressing FUE_504 (SEQ ID NO: 108) ⁇ nderlhe TT105 promoter.
- Figure 7B one representative transgenic event expressing FUE_43 (SEQ ID NO: 70) under the 35S promoter. Plants were grown at very limiting nitrogen conditions (0.05 and 0.2 mM combined inorganic nitrogen). Control plants (expressing a reporter gene under the same promoter or non-transgenic plants) were treated similarly. The notorious differences in plantlet size are translated into significant differences in the measured fresh weight of the plantlets.
- FIG. 8 is a photograph showing transgenic plants from three independent transgenic events expressing FUE_34_Evo (SEQ ID NO: 54). The plant shows impressive branching at every node as determined by a triple blind assay. The root system from the plants was also highly branched and compact (not shown).
- FIG. 9 shows five independent transgenic events of plants expressing FUE_40 (also termed FUE6/40, SEQ ID NO: 11). It is clearly notable that the flowering stem is unusually upright and stiff. In addition, an unusually high number of siliques can be counted. As a result, transgenic plants expressing FUE_40 are remarkably prolific.
- FIG. 10 a scheme of an irrigation system in accordance with the teachings of the present invention. DESCRIPTION OF THE PREFERRED EMBODIMENTS
- the present invention is of isolated polypeptides, polynucleotides encoding same, transgenic plants expressing same and methods of using same. Specifically the present invention can be used to increase fertilizer use efficiency and stress resistance as well as biomass, vigor and yield of transgenic plants.
- N Nitrogen
- NUE Nitrogen use efficiency
- maize polynucleotide sequences were selected based on several criteria (see Example 1 of the Examples section which follows). These included high levels of calculated digital expression at the root tips especially in water stressed roots (e.g., drought).
- a secondary filter for the above polynucleotide sequences was based on the digital expression of their orthologous sequences (i.e., dicotyledon plants or other monocotyledons species). Orthologous genes showing similar digital expression as the maize genes (e.g., root libraries of stress treated plants subjected) were selected. Data mining and annotation tools were used to filter genes which may have broad effects on cell metabolism.
- a nucleic acid construct comprising a nucleic acid sequence at least about 70 %, at least about 75 %, at least about 80 %, at least about 81 %, at least about 82 %, at least about 83 %, at least about 84 %, at least about 85 %, at least about 86 %, at least about 87 %, at least about 88 %, at least about 89 %, at least about 90 %, at least about 91 %, at least about 92 %, at least about 93 %, at least about 93 %, at least about 94 %, at least about 95 %, at least about 96 %, at least about 97 %, at least about 98 %, at least about 99 %, or more say 100 % identical to a nucleotide sequence selected from the group consisting of SEQ ID NO: 68, 1, 4, 5, 8, 9, 11, 13, 16, 19, 20, 23, 24, 27, 30, 32, 37
- Nucleic acid sequences may encode polypeptide sequences comprising an amino acid sequence at least about 70 %, at least about 75 %, at least about 80 %, at least about 81 %, at least about 82 %, at least about 83 %, at least about 84 %, at least about 85 %, at least about 86 %, at least about 87 %, at least about 88 %, at least about 89 %, at least about 90 %, at least about 91 %, at least about 92 %, at least about 93 %, at least about 93 %, at least about 94 %, at least about 95 %, at least about 96 %, at least about 97 %, at least about 98 %, at least about 99 %, or more say 100 % homologous to SEQ ID NO 177, 110, 113, 114, 117, 118, 120, 122, 125, 128, 129, 132, 133, 136, 139, 141
- Homology e.g., percent homology
- NCBI National Center of Biotechnology Information
- the isolated polynucleotide is as set forth is SEQ ID NO: 68, 1, 4, 5, 8, 9, 11, 13, 16, 19, 20, 23, 24, 27, 30, 32, 37, 42, 49, 50, 51, 53, 54, 55, 56, 57, 58, 64, 69, 70, 73, 77, 78, 79, 80, 84, 86, 87, 93, 94, 98, 101, 102, 103, 104, 105, 106, 107, 108, 109, 219- 767, 1317, 1318, 1319, 1320, 1321, 1322, 1323, 1324, 1325, 1326, 1327, 1328, 1329, 1330, 1331, 1332, 1333, 1334, 1335 or 1336.
- a nucleic acid sequence (also termed herein as isolated polynucleotide) of the present invention refers to a single or double stranded nucleic acid sequence which is isolated and provided in the form of an RNA sequence, a complementary polynucleotide sequence (cDNA), a genomic polynucleotide sequence and/or a composite polynucleotide sequences (e.g., a combination of the above).
- RNA sequence also termed herein as isolated polynucleotide of the present invention refers to a single or double stranded nucleic acid sequence which is isolated and provided in the form of an RNA sequence, a complementary polynucleotide sequence (cDNA), a genomic polynucleotide sequence and/or a composite polynucleotide sequences (e.g., a combination of the above).
- cDNA complementary polynucleotide sequence
- genomic polynucleotide sequence e.g., a combination of
- complementary polynucleotide sequence refers to a sequence, which results from reverse transcription of messenger RNA using a reverse transcriptase or any other RNA dependent DNA polymerase. Such a sequence can be subsequently amplified in vivo or in vitro using a DNA dependent DNA polymerase.
- genomic polynucleotide sequence refers to a sequence derived (isolated) from a chromosome and thus it represents a contiguous portion of a chromosome.
- composite polynucleotide sequence refers to a sequence, which is at least partially complementary and at least partially genomic.
- a composite sequence can include some exonal sequences required to encode the polypeptide of the present invention, as well as some intronic sequences interposing therebetween.
- the intronic sequences can be of any source, including of other genes, and typically will include conserved splicing signal sequences. Such intronic sequences may further include cis acting expression regulatory elements.
- Nucleic acid sequences of the polypeptides of the present invention may be optimized for plant expression. Such optimized sequences are provided in SEQ ID NOs: 1317, 1319, 1320, 1321, 1322, 1324, 1325, 1326, 1327, 1328, 1329, 1330, 1331, 1332, 1333, 1334, 1335 and 1336. Examples of such sequence modifications include, but are not limited to, an altered GIC content to more closely approach that typically found in the plant species of interest, and the removal of codons atypically found in the plant species commonly referred to as codon optimization.
- codon optimization refers to the selection of appropriate DNA nucleotides for use within a structural gene or fragment thereof that approaches codon usage within the plant of interest.
- an optimized gene or nucleic acid sequence refers to a gene in which the nucleotide sequence of a native or naturally occurring gene has been modified in order to utilize statistically-preferred or statistically-favored codons within the plant.
- the nucleotide sequence typically is examined at the DNA level and the coding region optimized for expression in the plant species determined using any suitable procedure, for example as described in Sardana et al. (1996, Plant Cell Reports 15:677-681).
- the standard deviation of codon usage a measure of codon usage bias, may be calculated by first finding the squared proportional deviation of usage of each codon of the native gene relative to that of highly expressed plant genes, followed by a calculation of the average squared deviation.
- Codon Usage Database contains codon usage tables for a number of different species, with each codon usage table having been statistically determined based on the data present in Genbank.
- a naturally- occurring nucleotide sequence encoding a protein of interest can be codon optimized for that particular plant species. This is effected by replacing codons that may have a low statistical incidence in the particular species genome with corresponding codons, in regard to an amino acid, that are statistically more favored.
- one or more less-favored codons may be selected to delete existing restriction sites, to create new ones at potentially useful junctions (5' and 3' ends to add signal peptide or termination cassettes, internal sites that might be used to cut and splice segments together to produce a correct full-length sequence), or to eliminate nucleotide sequences that may negatively effect mRN A stability or expression.
- codon optimization of the native nucleotide sequence may comprise determining which codons, within the native nucleotide sequence, are not statistically-favored with regards to a particular plant, and modifying these codons in accordance with a codon usage table of the particular plant to produce a codon optimized derivative.
- a modified nucleotide sequence may be fully or partially optimized for plant codon usage provided that the protein encoded by the modified nucleotide sequence is produced at a level higher than the protein encoded by the corresponding naturally occurring or native gene. Construction of synthetic genes by altering the codon usage is described in for example PCT Patent Application 93/07278.
- the present invention encompasses nucleic acid sequences described hereinabove; fragments thereof, sequences hybridizable therewith, sequences homologous thereto, sequences orthologous thereto, sequences encoding similar polypeptides with different codon usage, altered sequences characterized by mutations, such as deletion, insertion or substitution of one or more nucleotides, either naturally occurring or man induced, either randomly or in a targeted fashion.
- Nucleic acid sequences of the present invention may encode previously uncharacterized polypeptides
- the present invention provides a polypeptide having an amino acid sequence at least about 70 %, at least about 75 %, at least about 80 %, at least about 81 %, at least about 82 %, at least about 83 %, at least about 84 %, at least about 85 %, at least about 86 %, at least about 87 %, at least about 88 %, at least about 89 %, at least about 90 %, at least about 91 %, at least about 92 %, at least about 93 %, at least about 93 %, at least about 94 %, at least about 95 %, at least about 96 %, at least about 97 %, at least about 98 %, at least about 99 %, or more say 100 % homologous to an amino acid sequence selected from the group consisting of SEQ ID NO: 177, 110, 113, 114, 117, 118
- the isolated polypeptide comprises an amino acid sequence selected from the group consisting of 177, 110, 113, 114, 117, 118, 120, 122, 125, 128, 129, 132, 133, 136, 139, 141, 146, 151, 158, 159, 160, 162, 163, 164, 165, 166, 167, 173, 178, 179, 182, 186, 187, 188, 189, 193, 195, 196, 202, 203, 207, 210, 211, 212, 213, 214, 215, 216, 217, 218, 768-1051, 1053-1098, 1100-1315, 1316, 1341 or 1343.
- the present invention also encompasses sequences homologous and orthologous to the above mentioned polypeptides, fragments of the above described polypeptides and polypeptides having mutations, such as deletions, insertions or substitutions of one or more amino acids, either naturally occurring or man induced, either randomly or in a targeted fashion.
- Polynucleotides and polypeptides of the present invention are used for plant expression.
- plant as used herein encompasses whole plants, ancestors and progeny of the plants and plant parts, including seeds, shoots, stems, roots (including tubers), and plant cells, tissues and organs.
- plant also therefore encompasses suspension cultures, embryos, meristematic regions, callus tissue, leaves, gametophytes, sporophytes, pollen, and microspores.
- Plants that are particularly useful in the methods of the invention include all plants which belong to the superfamily Viridiplantae, in particular monocotyledonous and dicotyledonous plants which are of commercial value, including a fodder or forage legume, ornamental plant, food crop, tree, or shrub selected from the following non-limiting list comprising Acacia spp., Acer spp., Actinidia spp., Aesculus spp., Agathis australis, Albizia amara, Alsophila tricolor, Andropogon spp., Arachis spp, Areca catechu, Astelia fragrans, Astragalus deer, Baikiaea plurijuga, Betula spp., Brassica spp., Bruguiera gymnorrhiza, Burkea africana, Butea frondosa, Cadaba farinosa, Calliandra spp, Camella sinensis, Canna indica, Capsicum spp., Cassia
- Expressing the exogenous polynucleotide of the present invention within the plant can be effected by transforming one or more cells of the plant with the exogenous polynucleotide, followed by generating a mature plant from the transformed cells and cultivating the mature plant under conditions suitable for expressing the exogenous polynucleotide within the mature plant.
- the transformation is effected by introducing to the plant cell a nucleic acid construct which includes the exogenous polynucleotide of the present invention and at least one promoter capable of directing transcription of the exogenous polynucleotide in the plant cell. Further details of suitable transformation approaches are provided hereinbelow.
- promoter refers to a region of DNA which lies upstream of the transcriptional initiation site of a gene to which RNA polymerase binds to initiate transcription of RNA.
- the promoter controls where (e.g., which portion of a plant, which organ within an animal, etc.) and/or when (e.g., which stage or condition in the lifetime of an organism) the gene is expressed.
- any suitable promoter sequence can be used by the nucleic acid construct of the present invention.
- the following types of promoters are non-limiting examples of promoters used to over-express the selected genes: general promoters, root specific promoters, root-tips specific promoters, drought-induced root promoters, biotic stress- induced promoters, abiotic stress-induced promoters, nitrogen induced promoters, ammonium or nitrate induced promoters, phosphate fertilizer-induced promoters, leaf specific promoters, inducible promoters, constitutive promoters, promoters with two or more of the characteristics described above, or other novel promoters.
- Choice of the promoter is based largely on the phenotype of interest and is determined by such factors as tissue (e.g., seed, fruit, root, pollen, vascular tissue, flower, carpel, etc.), inducibility (e.g., in response to wounding, heat, cold, drought, light, pathogens, etc.), timing, developmental stage, and the like.
- tissue e.g., seed, fruit, root, pollen, vascular tissue, flower, carpel, etc.
- inducibility e.g., in response to wounding, heat, cold, drought, light, pathogens, etc.
- timing developmental stage, and the like.
- Numerous known promoters have been characterized and can favorably be employed to promote expression of a polynucleotide of the invention in a transgenic plant or cell of interest.
- Measures should be taken, however, to select a promoter which will mediate desirable expression levels of the transgene so as to avoid reallocating excessive energetic resources which may affect final yield, strength, mass and lodging and incidence of foliar pathogens. This should also be viewed from an economic perspective.
- Suitable constitutive promoters include, for example, CaMV 35S promoter (SEQ ID NO: 1337; Odell et al, Nature 313:810-812, 1985); Arabidopsis At6669 promoter (SEQ ID NO: 1514, PCT No WO2004/104162); TT105 (SEQ ID NO: 1339, PCT NO.: WO2004/081173) maize Ubi 1 (Christensen et al, Plant Sol. Biol. 18:675- 689, 1992); rice actin (McElroy et al, Plant Cell 2:163-171, 1990); pEMU (Last et al., Theor. Appl. Genet.
- CaMV 35S promoter SEQ ID NO: 1337; Odell et al, Nature 313:810-812, 1985
- Arabidopsis At6669 promoter SEQ ID NO: 1514, PCT No WO2004/104162
- TT105 SEQ ID NO: 1339, PCT NO.:
- tissue-specific promoters include, but not limited to, leaf-specific promoters such as described, for example, by Yamamoto et ah, Plant J. 12:255-265, 1997; Kwon et al, Plant Physiol.
- Root promoters such as the ROOTP promoter [SEQ ID NO: 1338; Upstream region of the gene ATXTH19 (AT4G30290, Xyloglucan endotransglucosylase/hydrolase 19, described in Vissenberg K, et al. Plant Cell Physiol. 2005 Jan;46(l): 192-200].
- a variety of plant gene promoters are known to regulate gene expression in response to environmental, hormonal, chemical, developmental signals, and in a tissue-active manner.
- seed-specific promoters such as the napin, phaseolin or DC3 promoter described in U.S. Pat. No. 5,773,697
- fruit-specific promoters that are active during fruit ripening such as the dru 1 promoter (U.S. Pat. No. 5,783,393), or the 2Al 1 promoter (U.S. Pat. No. 4,943,674) and the tomato polygalacturonase promoter (Bird et al. (1988) Plant MoI. Biol.
- root-specific promoters such as ARSKl, and those disclosed in U.S. Pat. Nos. 5,618,988, 5,837,848 and 5,905,186
- epidermis-specific promoters including CUTl (Kunst et al. (1999) Biochem. Soc. Tians. 28: 651-654), pollen-active promoters such as PTA29, PTA26 and PTA 13 (U.S. Pat. No. 5,792,929), promoters active in vascular tissue
- cytokinin-inducible promoter (Guevara-Garcia (1998) Plant MoI. Biol. 38: 743-753), promoters responsive to gibberellin (Shi et al. (1998) Plant MoI. Biol. 38: 1053-1060, Willmott et al. (1998) Plant MoI. Biol. 38: 817-825) and the like. Additional promoters are those that elicit expression in response to heat (Ainley et al. (1993) Plant MoI. Biol. 22: 13-23), light (e.g., the pea rbcS-3A promoter, described in Kuhlemeier et al.
- timing of the expression can be controlled by using promoters such as those acting at senescence (Gan and Amasino (1995) Science 270: 1986-1988); or late seed development (Odell et al. (1994) Plant Physiol. 106: 447-458).
- promoters are a SUC2 promoter (Truernit and Sauer, Planta. (1995) 196:564-70), and a stress-inducible promoter such as RD29A (Yamaguchi-Shinozaki and Shinozaki K. Plant Cell (1994) 6:251-264), promoters fro the PlantProm database (Shahmuradov et al. Nucleic Acids Res. (2003) 31 : 114-7), the rice CatB promoter (Iwamoto et al. Plant Physiol Biochem.
- the nucleic acid construct of the present invention preferably further includes an appropriate selectable marker and/or an origin of replication.
- the nucleic acid construct utilized is a shuttle vector, which can propagate both in E. colt
- the construct according to the present invention can be, for example, a plasmid, a bacmid, a phagemid, a cosmid, a phage, a virus or an artificial chromosome.
- the nucleic acid construct of the present invention can be utilized to stably or transiently transform plant cells.
- stable transformation the exogenous polynucleotide of the present invention is integrated into the plant genome and as such it represents a stable and inherited trait.
- transient transformation the exogenous polynucleotide is expressed by the cell transformed but it is not integrated into the genome and as such it represents a transient trait.
- the Agrobacterium system includes the use of plasmid vectors that contain defined DNA segments that integrate into the plant genomic DNA. Methods of inoculation of the plant tissue vary depending upon the plant species and the Agrobacterium delivery system. A widely used approach is the leaf disc procedure which can be performed with any tissue explant that provides a good source for initiation of whole plant differentiation. Horsch et al. in Plant Molecular Biology Manual A5, Kluwer Academic Publishers, Dordrecht (1988) p. 1-9. A supplementary approach employs the Agrobacterium delivery system in combination with vacuum infiltration. The Agrobacterium system is especially viable in the creation of transgenic dicotyledonous plants.
- each seed is genetically different and each will grow with its own specific traits. Therefore, it is preferred that the transformed plant be produced such that the regenerated plant has the identical traits and characteristics of the parent transgenic plant. Therefore, it is preferred that the transformed plant be regenerated by micropropagation which provides a rapid, consistent reproduction of the transformed plants.
- Micropropagation is a process of growing new generation plants from a single piece of tissue that has been excised from a selected parent plant or cultivar. This process permits the mass reproduction of plants having the preferred tissue expressing the fusion protein.
- the new generation plants which are produced are genetically identical to, and have all of the characteristics of, the original plant.
- Micropropagation allows mass production of quality plant material in a short period of time and offers a rapid multiplication of selected cultivars in the preservation of the characteristics of the original transgenic or transformed plant.
- the advantages of cloning plants are the speed of plant multiplication and the quality and uniformity of plants produced.
- Micropropagation is a multi-stage procedure that requires alteration of culture medium or growth conditions between stages.
- the micropropagation process involves four basic stages: Stage one, initial tissue culturing; stage two, tissue culture multiplication; stage three, differentiation and plant formation; and stage four, greenhouse culturing and hardening.
- stage one initial tissue culturing
- stage two tissue culture multiplication
- stage three differentiation and plant formation
- stage four greenhouse culturing and hardening.
- stage one initial tissue culturing
- the tissue culture is established and certified contaminant-free.
- stage two the initial tissue culture is multiplied until a sufficient number of tissue samples are produced to meet production goals.
- stage three the tissue samples grown in stage two are divided and grown into individual plantlets.
- the transformed plantlets are transferred to a greenhouse for hardening where the plants' tolerance to light is gradually increased so that it can be grown in the natural environment.
- transgenic plants may be screened for improved nutritional value (e.g., improved oil, amino acids and/or protein content, as well as N content per se) under normal or stress conditions as will be further described hereinbelow.
- transformed and non-transformed (wild type) plants are exposed to an abiotic stress condition, such as water depravation, suboptimal temperature, nutrient deficiency, or preferably a salt stress condition.
- Salt stress can be effected in many ways such as, for example, by irrigating the plants with a hyperosmotic solution, by cultivating the plants hydroponically in a hyperosmotic growth solution (e.g., Hoagland solution), or by culturing the plants in a hyperosmotic growth medium (e.g., MS medium).
- a hyperosmotic growth solution e.g., Hoagland solution
- culturing the plants in a hyperosmotic growth medium e.g., MS medium.
- the salt concentration in the irrigation water, growth solution, or growth medium is preferably adjusted according to the specific characteristics of the specific plant cultivar or variety, so as to inflict a mild or moderate effect on the physiology and/or morphology of the plants (for guidelines as to appropriate concentration please see, Bernstein and Kafkaf ⁇ , Root Growth Under Salinity Stress In: Plant Roots, The Hidden Half 3rd ed. Waisel Y, Eshel A and Kaflcafi U. (editors) Marcel Dekker Inc., New York, 2002, and reference therein). Following exposure to the stress condition the plants are frequently monitored until substantial physiological and/or morphological effects appear in wild type plants. Subsequently, transformed plants not exhibiting substantial physiological and/or morphological effects, or exhibiting higher biomass than wild-type plants, are identified as abiotic stress tolerant plants.
- Transient transformation of leaf cells, meristematic cells or the whole plant is also envisaged by the present invention.
- Transient transformation can be effected by any of the direct DNA transfer methods described above or by viral infection using modified plant viruses.
- Viruses that have been shown to be useful for the transformation of plant hosts include CaMV, TMV and BV. Transformation of plants using plant viruses is described in U.S. Pat. No. 4,855,237 (BGV), EP-A 67,553 (TMV), Japanese Published Application No. 63-14693 (TMV), EPA 194,809 (BV), EPA 278,667 (BV); and Gluzman, Y. et al. , Communications in Molecular Biology: Viral Vectors, Cold Spring Harbor Laboratory, New York, pp. 172-189 (1988). Pseudovirus particles for use in expressing foreign DNA in many hosts, including plants, is described in WO 87/06261.
- the virus of the present invention is avirulent and thus is incapable of causing severe symptoms such as reduced growth rate, mosaic, ring spots, leaf roll, yellowing, streaking, pox formation, tumor formation and pitting.
- a suitable avirulent virus may be a naturally occurring avirulent virus or an artificially attenuated virus.
- Virus attenuation may be effected by using methods well known in the art including, but not limited to, sub-lethal heating, chemical treatment or by directed mutagenesis techniques such as described, for example, by Kurihara and Watanabe (Molecular Plant Pathology 4:259-269, 2003), Gal-on et al. (1992), Atreya et al. (1992) and Huet et al. (1994).
- Suitable virus strains can be obtained from available sources such as, for example, the American Type culture Collection (ATCC) or by isolation from infected plants. Isolation of viruses from infected plant tissues can be effected by techniques well known in the art such as described, for example by Foster and Tatlor, Eds. "Plant Virology Protocols: From Virus Isolation to Transgenic Resistance (Methods in Molecular Biology (Humana Pr), VoI 81)", Humana Press, 1998. Briefly, tissues of an infected plant believed to contain a high concentration of a suitable virus, preferably young leaves and flower petals, are ground in a buffer solution (e.g., phosphate buffer solution) to produce a virus infected sap which can be used in subsequent inoculations.
- a buffer solution e.g., phosphate buffer solution
- the virus When the virus is a DNA virus, suitable modifications can be made to the virus itself. Alternatively, the virus can first be cloned into a bacterial plasmid for ease of constructing the desired viral vector with the foreign DNA. The virus can then be excised from the plasmid. If the virus is a DNA virus, a bacterial origin of replication can be attached to the viral DNA, which is then replicated by the bacteria. Transcription and translation of this DNA will produce the coat protein which will encapsidate the viral DNA. If the virus is an RNA virus, the virus is generally cloned as a cDNA and inserted into a plasmid. The plasmid is then used to make all of the constructions. The RNA virus is then produced by transcribing the viral sequence of the plasmid and translation of the viral genes to produce the coat protein(s) which encapsidate the viral RNA.
- a plant viral polynucleotide in which the native coat protein coding sequence has been deleted from a viral polynucleotide, a non-native plant viral coat protein coding sequence and a non-native promoter, preferably the subgenomic promoter of the non-native coat protein coding sequence, capable of expression in the plant host, packaging of the recombinant plant viral polynucleotide, and ensuring a systemic infection of the host by the recombinant plant viral polynucleotide, has been inserted.
- the coat protein gene may be inactivated by insertion of the non-native polynucleotide sequence within it, such that a protein is produced.
- the recombinant plant viral polynucleotide may contain one or more additional non-native subgenomic promoters.
- Each non-native subgenomic promoter is capable of transcribing or expressing adjacent genes or polynucleotide sequences in the plant host and incapable of recombination with each other and with native subgenomic promoters.
- TSTon-native (foreign) polynucleotide sequences may be inserted adjacent the native plant viral subgenomic promoter or the native and a non- native plant viral subgenomic promoters if more than one polynucleotide sequence is included.
- the non-native polynucleotide sequences are transcribed or expressed in the host plant under control of the subgenomic promoter to produce the desired products.
- a recombinant plant viral polynucleotide is provided as in the first embodiment except that the native coat protein coding sequence is placed adjacent one of the non-native coat protein subgenomic promoters instead of a non-native coat protein coding sequence.
- a recombinant plant viral polynucleotide is provided in which the native coat protein gene is adjacent its subgenomic promoter and one or more non-native subgenomic promoters have been inserted into the viral polynucleotide.
- non-native subgenomic promoters are capable of transcribing or expressing adjacent genes in a plant host and are incapable of recombination with each other and with native subgenomic promoters.
- Non-native polynucleotide sequences may be inserted adjacent the non-native subgenomic plant viral promoters such that the sequences are transcribed or expressed in the host plant under control of the subgenomic promoters to produce the desired product.
- a recombinant plant viral polynucleotide is provided as in the third embodiment except that the native coat protein coding sequence is replaced by a non-native coat protein coding sequence.
- the viral vectors are encapsidated by the coat proteins encoded by the recombinant plant viral polynucleotide to produce a recombinant plant virus.
- the recombinant plant viral polynucleotide or recombinant plant virus is used to infect appropriate host plants.
- the recombinant plant viral polynucleotide is capable of replication in the host, systemic spread in the host, and transcription or expression of foreign gene(s) (exogenous polynucleotide) in the host to produce the desired protein. Techniques for inoculation of viruses to plants may be found in Foster and
- the polynucleotide of the present invention can also be introduced into a chloroplast genome thereby enabling chloroplast expression.
- a technique for introducing exogenous polynucleotide sequences to the genome of the chloroplasts is known. This technique involves the following procedures. First, plant cells are chemically treated so as to reduce the number of chloroplasts per cell to about one. Then, the exogenous polynucleotide is introduced via particle bombardment into the cells with the aim of introducing at least one exogenous polynucleotide molecule into the chloroplasts.
- exogenous polynucleotides selected such that it is integratable into the chloroplast's genome via homologous recombination which is readily effected by enzymes inherent to the chloroplast.
- the exogenous polynucleotide includes, in addition to a gene of interest, at least one polynucleotide stretch which is derived from the chloroplast's genome.
- the exogenous polynucleotide includes a selectable marker, which serves by sequential selection procedures to ascertain that all or substantially all of the copies of the chloroplast genomes following such selection will include the exogenous polynucleotide. Further details relating to this technique are found in U.S. Pat. Nos. 4,945,050; and 5,693,507 which are incorporated herein by reference.
- a polypeptide can thus be produced by the protein expression system of the chloroplast and become integrated into the chloroplast's inner membrane.
- the present invention also envisages expressing a plurality of exogenous polynucleotides in a single host plant to thereby achieve superior NUE, tolerance, biomass and/or yield.
- Expressing a plurality of exogenous polynucleotides in a single host plant can be effected by co-introducing multiple nucleic acid constructs, each including a different exogenous polynucleotide, into a single plant cell.
- the transformed cell can than be regenerated into a mature plant using the methods described hereinabove.
- expressing a plurality of exogenous polynucleotides in a single host plant can be effected by co-introducing into a single plant-cell a single nucleic- acid construct including a plurality of different exogenous polynucleotides.
- a construct can be designed with a single promoter sequence which can transcribe a polycistronic message including all the different exogenous polynucleotide sequences.
- the polynucleotide sequences can be inter-linked via an internal ribosome entry site (IRES) sequence which facilitates translation of polynucleotide sequences positioned downstream of the IRES sequence.
- IRES internal ribosome entry site
- a transcribed polycistronic RNA molecule encoding the different polypeptides described above will be translated from both the capped 5' end and the two internal IRES sequences of the polycistronic RNA molecule to thereby produce in the cell all different polypeptides.
- the construct can include several promoter sequences each linked to a different exogenous polynucleotide sequence.
- the plant cell transformed with the construct including a plurality of different exogenous polynucleotides can be regenerated into a mature plant, using the methods described hereinabove.
- expressing a plurality of exogenous polynucleotides in a single host plant can be effected by introducing different nucleic acid constructs, including different exogenous polynucleotides, into a plurality of plants.
- the regenerated transformed plants can then be cross-bred and resultant progeny selected for superior traits such as NUE, abiotic stress tolerance and/or biomass, using conventional plant breeding techniques.
- transgenic plants of the present invention can be used for improving myriad of commercially desired traits which are all interrelated as is discussed hereinbelow.
- trait refers to a characteristic or quality of a plant which may overall (either directly or indirectly) improve the commercial value of the plant .
- the term “improving” or “increasing” refers to improving or increasing the trait of the transgenic plant of the present invention by at least about 2 % more, 5 % more, 10 % more, 20 % more, 30 % more, 40 % more, 50 % more, 60 % more, 70 % more, 80 % more, 90 % or more than that of the non-transgenic plant (e.g., mock transfected, or na ⁇ ve).
- Fertilizer use efficiency Although the following will be more elaborated regarding Nitrogen (N) Use Efficiency (NUE) it is to be understood that the present invention envisages increasing/improving the overall fertilizer use efficiency of all minerals and organic moieties absorbed from the soil, such as phosphates (PUE) and potassium (KUE) by the transgenic plants of the present invention.
- NUE Nitrogen
- PUE phosphates
- KUE potassium
- N uptake efficiency The efficiency by which N is used by the plant is affected among other things by both N uptake efficiency and N utilization efficiency.
- the ratio of the amount of N uptake by the plant (or N content, kg N) over the amount of N supplied/applied (kg N s ) is an uptake efficiency (kg N kg '1 N s ), while the grain yield (kg grain) to N uptake (kg N) ratio is N utilization efficiency (NUE, kg grain kg "1 N). See Moll 1982 Analysis and interpretation of factors which contribute to efficiency of nitrogen utilization. Argon. J. 74:562-564.
- NUE is also affected by N losses through ammonia volatilization, nitrification-denitrification, leaching and runoff which decrease the availability of N to the plant.
- the present inventors realized that genes which alter root architecture can be used to improve NUE.
- the rationale is to position a higher fraction of the roots in deeper soil layers where the fertilizer is leached or increasing the soil coverage where the fertilizer is concentrated. This strategy was already proven successful with Phosphorous deficiency in soybean (Miller, CR, I Ochoa, KL Nielsen, D Beck, JP
- Root morphogenesis is dramatically affected by development programming as well as by environmental conditions. Drought leads to a pronounced downward development of the root structure to reach water located in deeper soil layers (see Figure IA) while local nutrient availability causes a local root outgrowth increasing the total absorptive surface of the root system.
- ANRl a putative transcription factor with a role in NO 3 " signaling.
- ANRl is down-regulated by antisense or co-suppression, the resulting transgenic lines are defective in their root response to localized supplies of NO 3 " (Zhang, H.,Forde, B. G. 1998, An Arabidopsis MADS box gene that controls nutrient- induced changes in root architecture, Science 270:407).
- altering expression of the polynucleotides of the present invention in transgenic plants may have desirable effects on root morphogenesis, some of them could positively affect NUE and abiotic/biotic stress tolerance and/or to enhance plant yield and vigor.
- Specific examples include FUE_7, FUE l 6 and FUE_34_Evo.
- FUE_101 and FUE_102 comprise a transporter activity and therefore may be used to improve nutrient uptake.
- Storage capacity - polynucleotide and polypeptide sequences of the present invention are directed to enhance the general storage capability of the plant.
- the capacity for grain production is predetermined by the plants ability to absorb and store mineral nitrogen in its early phases of development (Hirel et el. Plant Physiol, March 2001, Vol. 125, pp. 1258-1270). Therefore enhanced storage capacity in the form of nitrate or amino acids highly likely will increase the grain yield.
- This invention includes molecular mechanisms to improve the nitrogen or any metabolic n ⁇ trient storage capacity of the plant. Examples include, amino acids, protein, starch and oil, fiber, ash, chlorophyll and mineral content.
- Plant protein content is directly related to the N concentration in the grain (see Mosse 1990 J. Agric. Food Chem. 38:18-24). This is highly valuable for improving the nutritional value of food. For example, children consuming high-protein (10 %_ milled rice showed improved growth compared with children consuming average- protein (6-7 %) milled rice [Juliano (1993) Rice in Human Nutrition. IRRI and FAO, Rome]. Thus, transgenic plants displaying high efficiency in remobilizing N from vegetative parts to the edible part (e.g., grain) are highly valuable. Since the levels of nitrogen at flowering determine the grain yield, overexpression of the polynucleotide sequences of the present invention will improve the grain yield and/or enhance protein content of grain at the entire plant level.
- FUE_501, FUE_502, FUE_503, FUE_504 or FUE_49, FUE_51, FUE_52, FUE 53 or FUE l 00 and FUE l 01 are expected to increase the storage capacity of the tissues where they are expressed. This may lead to a stronger sink capacity, and to a better use of the fertilizer applied (particularly nitrogen) due to enhanced absorption from the soil.
- Delayed leaf senescence or "stay-green” - extends nutrient uptake longer into the plant cycle providing increased capacity to store nitrogen and to provide photosynthate during grain filling. If a plant has more green leaves at the period of pollination more nitrogen will be available for redistribution to the kernels causing an improvement in fertilizer use efficiency and probably grain yield.
- Some of the genes presented in this invention increase the "stay green” trait or exhibit enhanced growth (faster growth and/or bigger leaves and stalks) as a mechanism to improve fertilizer use efficiency, grain yield and overall stress tolerance of the plant.
- Invertase is an enzyme that is known to delay senescence when expressed under a senescence-activated promoter (Balibrea Lara, et al.
- FUE_30 and FUE_31 have a predicted invertase activity and therefore can extend the stay-green characteristics of the plant and therefore increase the overall capacity to store nitrogen in plants for redistribution during grain filling.
- Cytokinin is involved, among other processes, in the inhibition of leaf senescence.
- FUE_55 is a gene with a striking similarity to tRNA isopentenyltransferase, an important enzyme in the cytokinin metabolic pathway. Increased expression of FUE_55 in the roots or shoots will increase the levels of cytokinin leading to enhanced leaf expansion and cell duplication, delayed senescence, increased sink strength of the tissues, enhanced nitrogen utilization, etc.
- Zeatin is a naturally occurring cytokinin.
- FUE_505 is a putative AP2 domain- containing transcription factor that based on microarray experiments it clusters tightly together with ARR genes (Arabidopsis response regulators) which mediate the response of the shoot to cytokinin.
- ARR genes are Zeatin responsive and are induced after nitrogen addition to nitrogen starved plants.
- FUE_505 co-regulation together with ARRs indicates a role in the cytokinin response. It is highly likely that constitutive expression of FUE_505 will delay leaf senescence and improve nitrogen utilization and plant growth due to continuous activation of the cytokinin response of the shoot.
- Stress tolerance - Transgenic plants of the present invention are expected to exhibit tolerance to biotic and abiotic stress.
- stress refers to any adverse effect on metabolism, growth, reproduction and/or viability of a plant.
- abiotic stress can be induced by suboptimal environmental growth conditions such as, for example, salinity, water deprivation, flooding, freezing, low or high temperature, heavy metal toxicity, anaerobiosis, nutrient deficiency (including also nutrient inaccessibility such as due to leaching), atmospheric pollution or UV irradiation.
- Biotic stress can be induced for example by pathogens which are found in the environment.
- stress tolerance refers to the ability of a plant to endure an stress (abiotic) without suffering a substantial alteration in metabolism, growth, productivity and/or viability.
- the genetically engineered plants of the present invention exhibit at least about 2% more, 5 % more, 10 % more, 20 % more, 30 % more, 40 % more, 50 % more, 60 % more, 70 % more, 80 % more, 90 % more or even higher tolerance to abiotic stress than non-transgenic plants.
- Plants are subject to a range of environmental challenges. Several of these, including salt stress, general osmotic stress, drought stress and freezing stress, have the ability to impact whole plant and cellular water availability. Not surprisingly, then, plant responses to this collection of stresses are related. In a recent review, Zhu notes that "most studies on water stress signaling have focused on salt stress primarily because plant responses to salt and drought are closely related and the mechanisms overlap" (Zhu (2002) Ann. Rev. Plant Biol. 53: 247-273). Many examples of similar responses and pathways to this set of stresses have been documented. For example, the CBF transcription factors have been shown to condition resistance to salt, freezing and drought (Kasuga et al. (1999) Nature Biotech. 17: 287-291).
- the Arabidopsis rd29B gene is induced in response to both salt and dehydration stress, a process that is mediated largely through an ABA signal transduction process (Uno et al. (2000) Proc. Natl. Acad. Sci. USA 97: 11632-11637), resulting in altered activity of transcription factors that bind to an upstream element within the rd29B promoter.
- McCDPKl calcium-dependent protein kinase
- the stress-induced kinase was also shown to phosphorylate a transcription factor, presumably altering its activity, although transcript levels of the target transcription factor are not altered in response to salt or drought stress.
- Saijo et al. demonstrated that a rice salt/drought-induced calmodulin-dependent protein kinase (OsCDPK7) conferred increased salt and drought tolerance to rice when overexpressed (Saijo et al. (2000) Plant J. 23: 319-327).
- Exposure to dehydration invokes similar survival strategies in plants as does freezing stress (see, for example, Yelenosky (1989) Plant Physiol 89: 444-451) and drought stress induces freezing tolerance (see, for example, Siminovitch et al. (1982) Plant Physiol 69: 250-255; and Guy et al. (1992) Planta 188: 265-270).
- strategies that allow plants to survive in low water conditions may include, for example, reduced surface area, or surface oil or wax production.
- increased solute content of the plant prevents evaporation and water loss due to heat, drought, salinity, osmoticum, and the like therefore providing a better plant tolerance to the above stresses.
- plant biomass refers to the amount or quantity of tissue produced from the plant in a growing season, which could also determine or affect the plant yield or the yield per growing area.
- plant vigor refers to the amount or quantity of tissue produced from the plant in a given time. Hence increase vigor could determine or affect the plant yield or the yield per growing time or growing area.
- plant yield refers to the amount or quantity of tissue produced and harvested as the plant produced product. Hence increase yield could affect the economic benefit one can obtain from the plant in a certain growing time.
- Fertilizer use efficiency To analyze whether the transgenic plants are more responsive to fertilizers, plants are grown in agar plates or pots with a limited amount of fertilizer. The plants are analyzed for their overall size, time to flowering, yield, protein content of shoot and/or grain. An example methodology of a test for fertilizer use efficiency is provided in the work by Yanagisawa et al (Proc Natl Acad Sci U S A. 2004; 101:7833-8) in which seeds of transgenic Arabidopsis are checked for growth rates under limiting-nitrogen conditions (for example at 0.01 mM, 0.05mM 0.15 mM, 0.3 mM, ImM, 3 mM Nitrogen in the form of nitrate or ammonium).
- the parameters checked are the overall size of the mature plant, its wet and dry weight, the weight of the seeds yielded, the average seed size and the number of seeds produced per plant.
- Other parameters that may be tested are: the chlorophyll content of leaves (as nitrogen plant status and the degree of leaf verdure is highly correlated), amino acid and the total protein content of the seeds or other plant parts such as leaves or shoots, oil content, etc.
- Phosphate or Potassium can be added at increasing concentrations. Again, the same parameters measured are the same as listed above. In this way, besides Nitrogen Use Efficiency (NUE), Phosphate Use Efficiency (PUE) and Potassium Use Efficiency (KUE) are assessed checking the ability of the transgenic plants to thrive under nutrient restraining conditions.
- NUE Nitrogen Use Efficiency
- PUE Phosphate Use Efficiency
- KUE Potassium Use Efficiency
- Nitrogen determination The procedure for N concentration determination in the structural parts of the plants involves the potassium persulfate digestion method to convert organic N to NO 3 " (Purcell and King 1996 Argon. J. 88:111-113, the modified Cd " mediated reduction of NO 3 " to NO 2 " (Vodovotz 1996 Biotechniques 20:390-394) and the measurement of nitrite by the Griess assay (Vodovotz 1996, supra). The absorbance values are measured at 550 nm against a standard curve of NaNO 2 . The procedure is described in details in Samonte et al. 2006 Agron. J. 98:168-176.
- Grain protein concentration - Grain protein content (g grain protein m "2 ) is estimated as the product of the mass of grain N (g grain N m “2 ) multiplied by the N/protein conversion ratio of k-5.13 (Mosse 1990, supra). The grain protein concentration is estimated as the ratio of grain protein content per unit mass of the grain (g grain protein kg "1 grain).
- Oil content The amount of oil expressed as percentage of dry weight. Oil content is defined as the maximum amount of material (lipid) that can be removed from the seed by extraction with specific solvents (usually hexane or petroleum ether). Oil content is measured directly by grinding the seed and extracting the oil in a continuous extractor.
- Indirect oil content analysis can be carried out using either Nuclear Magnetic Resonance (NMR) Spectroscopy or Near Infrared (NI) Spectroscopy.
- NMR Nuclear Magnetic Resonance
- NI Near Infrared
- the NMR technique measures the resonance energy absorbed by hydrogen atoms in the liquid state of the sample while NI utilizes the absorption of near infrared energy (1100-2500 nm) by the sample. While the precision of NIR methods is not as good as extraction methods, NMR methods give very accurate and precise results when calibrated carefully.
- Drought tolerance assay/Osmoticum assay - Tolerance to drought is performed to identify the genes conferring better plant survival after acute water deprivation.
- an osmotic stress produced by the non-ionic osmolyte sorbitol in the medium can be performed.
- Control and transgenic plants are germinated and grown in plant-agar plates for 4 days, after which they are transferred to plates containing 500 mM sorbitol. The treatment causes growth retardation, then both control and transgenic plants are compared, by measuring plant weight (wet and dry), yield, and by growth rates measured as time to flowering.
- soil-based drought screens are performed with plants overexpressing the candidate genes detailed above. Seeds from control Arabidopsis plants, or other transgenic plants overexpressing or silencing a polypeptide of the invention are germinated and transferred to pots. Drought stress is obtained after irrigation is ceased accompanied by placing the pots on absorbent paper to enhance the soil-drying rate. Transgenic and control plants are compared to each other when the majority of the control plants develop severe wilting. Plants were re- watered after obtaining a significant fraction of the control plants displaying a severe wilting. Plants are ranked comparing to controls for each of two criteria: tolerance to the drought conditions and recovery (survival) following re- watering.
- Salinity tolerance assay - transgenic plants with tolerance to high salt are expected to exhibit better germination, seedling vigor or growth in high salt. Plants differ in their tolerance to NaCl depending on their stage of development, therefore seed germination, seedling vigor, and plant growth responses are evaluated.
- a salinity tolerance test is taking plants at different developmental stages and irrigate them with increasing concentrations of NaCl (for example 50 mM, 100 mM, 200 mM, 400 mM) applied from the bottom and from above to ensure even dispersal of salt.
- Transgenic plants are compared to control plants in their external phenotypic appearance, degree of wilting, and overall success to reach maturity and yield progeny at concentrations inhibitory to control plants.
- Quantitative parameters of tolerance measured are, the average wet and dry weight, and the weight of the seeds yielded, the average seed size and the number of seeds produced per plant.
- Osmotic stress assays (including NaCl and mannitol assays) are conducted to determine if an osmotic stress phenotype was NaCl-specific or if it was a general osmotic stress related phenotype. Plants tolerant to osmotic stress could also have more tolerance to drought and/or freezing.
- the medium is supplemented for example with 5OmM, 10OmM, 200 mM NaCl or 10OmM, 200 mM NaCl, 400 mM mannitol.
- Cold stress tolerance To analyze cold stress, mature (25 day old) plants are transferred to 4 °C chambers for 1 or 2 weeks, with constitutive light. Later on plants are moved back to greenhouse. Two weeks later damages from chilling period, resulting in growth retardation and other phenotypes, are compared between both control and transgenic plants, by measuring plant weight (wet and dry), and by comparing growth rates measured as time to flowering, plant size, yield, etc.
- Heat stress tolerance - heat stress tolerance is achieved by exposing the plants to temperatures above 34 °C for a certain period. Plant tolerance is examined after transferring the plants back to 22 °C for recovery and evaluation after 5 days relative to internal controls (non-transgenic plants) or plants not exposed to neither cold or heat stress.
- Germination tests compare the percentage of seeds from transgenic plants that could complete the germination process to the percentage of seeds from control plants that are treated in the same manner. Normal conditions are considered for example, incubations at 22 °C. under 22-hour light 2-hour dark daily cycles. Evaluation of germination and seedling vigor is conducted between 4 and 14 days after planting. The basal media is 50% Murashige-Skoog medium (MS)+vitamins. Germination is checked also at unfavorable conditions such as cold
- seed imbibition solutions that contain high concentrations of an osmolyte such as sorbitol (at concentrations of 50 mM, 100 mM, 200 mM, 300 niM, 500 mM, and up to 1000 mM) or applying increasing concentrations of salt (of 50 mM, 100 mM, 200 mM, 300 mM, 50O mM NaCl).
- an osmolyte such as sorbitol
- salt of 50 mM, 100 mM, 200 mM, 300 mM, 50O mM NaCl
- the present invention is also valuable for breeding and ornamental purposes. It is thus envisaged that polynucleotides and polypeptide sequences of the present invention which are associated with root architecture (FUE_34_Evo, SEQ ID NO: 54, see also Example 11 and Figure 8) may also be used to govern plant tillering and as such may be upregulated or downregulated to govern branching and tillering. Methods of downregulating gene expression in plants are well known in the art.
- the present invention is of high agricultural value for promoting commercially desired traits in crop-plants.
- Polynucleotide identification and gene role prediction using bioinformatics and molecular tools Polynucleotides, suitable for increasing FUE and/or abiotic or biotic stress tolerance were identified by in-depth analysis of RNA expression profiles, sequence similarities, gene annotations, biochemical pathways, DNA, ESTs, protein and expression databases, which are publicly available and used as input data to a series of proprietary computational algorithms that allow expert data mining. Trait association was performed using accurate expression profiling by means of quantitative Real Time PCR, to correlate between the expression levels in different tissues and under specific growth conditions for elucidating the function of the expressed polynucleotide.
- the present methodology is based on three stages described in the following examples, essentially the bioinformatic filtering, molecular analysis and in planta validation. Infra is a description of the bioinformatic algorithm.
- Sequence Tag clustering is to incorporate all ESTs that share a transcript or gene parent to the same cluster.
- clustered ESTs are assembled into one or more consensus sequences (contigs) that reflect the transcript diversity, providing these contigs such that the information they contain most truly reflects the sampled biology.
- a gene cluster is fragmented, EST data and (if known) gene mRNA sequence data, consolidated, placed in correct context and indexed by gene such that all expressed data concerning a single gene is in a single index class, and each index class contains the information for only one gene (Burke et al, 1999, D2_cluster: A Validated Method for Clustering EST and Full-length cDNA Sequences. Genome Research, 9(11),1135- 1142).
- the Compugen LEADSTM platform flittp://www.cgen.com/research/Publications/LEADSwhitepaper.pdf) was used for the assembly.
- Digital expression also known as electronic northern blot, compares occurrences of large number of random ESTs from non-normalized cDNA libraries. The variation in the relative frequency of those tags, stored in databases, is then used to elucidate the differential expression of the corresponding genes.
- Digital Northern data can be used to provide quantitative assessment of differential expression between different organs in the plant or at different physiological states (stress versus normal). This tool displays virtual expression profiles of genes based on the EST sequences forming the cluster.
- the tool can provide the expression profile of a cluster in terms of plant anatomy (i.e., in what tissues/organs is the gene expressed), developmental stage (Le., the developmental stages at which a gene can be found) and profile of treatment (i.e., provides the physiological conditions under which a gene is expressed such as drought, cold, pathogen infection and the like).
- the digital expression Given a random distribution of ESTs in the different clusters, the digital expression provides a probability value that describes the probability of a cluster having a total of N ESTs to contain X ESTs from a certain collection of libraries.
- a) the number of ESTs in the cluster b) the number of ESTs originating from a specific library or a group of related libraries, c) the overall number of ESTs available representing the species.
- clusters with low probability values are highly enriched with ESTs from the group of libraries of interest indicating a specialized expression.
- a proprietary vocabulary (limited compendium of terms) is used that takes into consideration the annotation of each EST library and uses specific keywords to describe the experimental data associated with the sequences with regards to tissue type, treatment and developmental stages.
- the terms chosen from the proprietary vocabulary are combined with the calculated digital expression to build an expression profile for each specific gene, based on the source of the libraries that provide the sequences to the gene cluster. A statistic and graphic representation of this profile is built for the digital expression calculations. Because the annotations are from a controlled vocabulary, the entire database is dissected with specific keywords describing specific tissues, developmental stages or treatments.
- Integrating all relevant data for each gene including expression data from microarray experiments, digital expression, annotation, ontology, gene families, conserved motifs and the like -
- a proprietary tool that creates groups of orthologous genes from genomic databases from multiple plant species is used.
- orthologous genes or the orthologous group is tested as a whole to see involvement of the trait of interest according to the keywords that are most significant in their calculated digital expression.
- Gene selection This is done according to several biologically sound assumptions to query the database described above. Gene selection is done by filtering specific groups of genes using carefully selected criteria. The final set of genes should contain a limited number of genes, which one could handle in the following molecular analysis and transgenic experiments. The different criteria utilized herein are described with great detail for each gene below.
- Nutrient deficiencies cause adaptations of the root architecture, particularly notably for example is the root proliferation within nutrient rich patches to increase nutrient uptake.
- Nutrient deficiencies cause also the activation of plant metabolic pathways which maximize the absorption and assimilation processes.
- genes are triggered and activated causing the architectural change (Jose Lopez-Bucio et al, The role of nutrient availability in regulating root architecture, Current Opinion in Plant Biology 2003, 6:280-287).
- Engineering the expression of the triggered genes may cause the plant to exhibit the architectural changes and enhanced metabolism also under other conditions.
- the EST libraries in Genbank 146 for Maize and other species such as Soybean, Tomato, Barley, Sorghum, Rice, Cotton, Wheat and Arabidopsis were examined and annotated using keywords describing the plant tissue used, the treatment applied to grow the plants and the developmental stage of the plants when the tissues were taken.
- a significance value was assigned to the frequency of ESTs in each contig from each EST library or set of libraries sharing the same annotation. The significance value was based on a statistical test that takes into account the number of ESTs from the given category in the contig, the number of these ESTs in the whole production, the size of the contig and the total number of ESTs in the production.
- Table 1 associates internal identifiers (NUE XXX or FUE XXX which are interchangeably used) to SEQ ID Nos.
- overexpression Fold is calculated as the ratio between the number of ESTs found in a gene or an orthologue group for a certain category (“Keyword”) and the number of expected ESTs according to a normal distribution.
- P-value probabilistic value
- FUE_1 was selected for its strong root expression in maize (as shown in Table 2 and Figure 2A and 2B), as well as the expression pattern of its orthologues such as in soybean and rice (as shown in Table 3 and Figure 2C and 2D).
- FUE_1 displays some homology to RCc3 protein (GENEBANK Accession NO. L27208) a known root specific protein putatively associated with lipid transport.
- FUE_2 is a protein of unknown function displaying a digital expression linking it to roots and particularly to roots under drought stress.
- FUE_3 is a putative non-specific lipid transfer protein expressed particularly in roots in maize (Table 4 and Table 5), but also in barley and rice. Its expression in roots under drought is conserved throughout evolution in sorghum, maize, rice and barley (as shown in Table 6 and 7). There are indications that the gene is expressed also under salinity stress in barley and rice and under nitrogen deficiency in barley.
- Keyword Fold p-value Keyword Gene Production ESTs flower 1 89278 7.82327 0.127824 0.999862 seedling + female 1 9012 1 1 0.550246 flower mix 2 90046 7.89057 0.253467 0.998578 root 30 36059 3.15978 9.49432 2.66E-15 primary root
- Keyword Fold p-value Keyword Gene Production ESTs drought 30 21216 1.85912 16.1367 3.44E-15 water stress
- FUE 4 is also a protein of unknown function displaying specific digital expression under drought stress (as shown in Table 8 and 9).
- FUE_5 is a Ubiquinol-cytochrome C reductase complex like protein expressed under several stresses and particularly under drought and salinity in
- FUE_6 displays homology to a multiple stress-associated zinc-finger protein, expressed in maize during grain development and in roots, particularly under drought stress (as shown in tables 11 and 12 respectively).
- the present inventors uncovered that FUE_6 and FUE_40 are part of the same transcript.
- FUE_6 represents the 5' region of the transcript, while FUE_40 the 3' region. For convenience, this transcript is presented in this herein under the name FUE_40.
- FUE_7 is a hypothetical protein displaying similarity to antifreeze protein expressed predominantly in barley and maize in roots and with a more evident expression during drought stress (as shown in Table 13 and 14).
- FUE_8 displays homology to Acyl-ACP thioesterase and expressed in maize roots under drought stress (as shown in Table 15).
- the sorghum and rice orthologues show also a clear association to drought as revealed by the source of the sequences composing the genes.
- FUE_9 is a hypothetical protein expressed in maize roots under drought stress.
- FUE_10 displays homology to electron transport-associated proteins, displaying a strong root expression solely associated to drought in maize (as shown in Table 16 and 17) and to other abiotic stresses as found for its orthologue expression in soybean.
- Keyword Fold p-value Keyword Gene Production ESTs flower 1 89278 3.22135 0.310429 0.974291 seedling + female 1 9012 1 1 0.280367 flower grain 1 73038 2.63537 0.379453 0.946054 pericarp 1 9389 1 1 0.290325 mix 2 90046 3.24906 0.615563 0.870275
- FUE_11 displays homology to the physical impedance induced protein and is expressed in maize in roots also during drought stress.
- FUE_12 is an unknown protein expressed in maize roots under water stress (drought) and in other abiotic stresses such as drought in barley and under nitrogen deficiency and heat stress in sorghum.
- FUE_13 displays homology to Pathogenesis-related protein 10, and is expressed in different stresses in maize (drought, pathogens as Fusarium).
- the barley and rice orthologues are strongly expressed particularly under abiotic and biotic stresses linking this protein to the ubiquitous plant response to stress.
- FUE_14 is a maize protein displaying homology to Germin-like protein 6. The digital expression of its barley orthologue links this protein to pathogen response, as well as drought and nitrogen deficiency response.
- FUE_15 is a putative auxin-regulated protein also expressed in maize roots. Its orthologues from barley, rice and are related to drought as well as other biotic and abiotic stresses such as pathogen response. In tomato and soybean, the protein is linked to the response to pathogens and nutrient deficiencies.
- FUE_16 is an Uclacyanin 3-like protein, expressed strongly in maize roots under water stress (as shown in Table 18 and 19). Its orthologues from barley, rice, soybean and tomato are also expressed in roots but involved in the response to other several biotic and abiotic stresses particularly to light response (as shown in Table 20 and 21).
- Table 20 Digital expression of FUE_16 ortholog group: Anatomy culm flower leaf mix ⁇ root ⁇ seed seedling shoot xylem barley 1 0.45 0.1 * ⁇ 0.48 maize 0.17 L 2.14 . 0.48 poplar I 024 - * 1.57 rice 0.33 • J3.62 0.51 sorghum 0.4 soybean 0.49 0.04 0.07 * 0,43 • 3 0.71 0.46 tomato s 0.48
- FUE_17 is a hypothetical protein displaying a digital expression in maize and other plant species linking it to a response to drought (maize, barley and sorghum), to pathogens (rice, soybean and tomato) and to nitrogen deficiency and water-logging in 5 barley.
- FUE_30 and FUE 31 were selected because of their annotation and the significant EST content derived from root particularly in the case of FUE_30.
- FUE_30 and FUE_31 have a predicted invertase activity, an enzyme which is known to delay senescence when expressed under a senescence-activated promoter (Balibrea 10 Lara, et al. Plant Cell 16: 1276-1287, 2004).
- FUE_30 can extend the stay-green characteristics of the plant and therefore increase the overall capacity to store nitrogen in plants for redistribution during grain filling.
- FUE_32 is annotated as major intrinsic like protein and its wheat orthologue contains several sequences isolated from root. In addition, the maize gene selected
- Brevis Radix is a novel regulator of cell proliferation and elongation that when inactive it creates plants with shorter roots
- FUE_54 displays homology to an Auxin responsive protein.
- the genes contain a significant EST annotation from roots and stressed tissues, as well as its 20 best orthologue from sorghum and rice that are specially expressed under stress conditions and probably enriched in the root.
- Nitrilase is an important enzyme in the auxin biosynthetic pathway that converts 3-indoleacetonitrile to 3-indole-acetic acid (auxin). Increased expression of Nitrilases in the root will enlarge the overall auxin levels and induce root elongation, secondary root formation, enhanced gravitropic response, etc.
- FUE_34 and FUE_35 as well as FUE_46 and FUE_47 are probable transcription factors both expressed particularly in stressed roots as judged by the EST libraries providing the sequences of the genes. As these transcription factors are highly associated with water stressed libraries it may occur that modifying the expression of these genes will activate the genes that induce the structural and metabolic changes associated with stresses.
- FUE_36, FUE_37 and FUE_38 show some degree of similarity to ABA- responsive genes and/or stress annotated genes, and have a significant content of sequences derived from root libraries.
- FUE_36 has probably protein kinase activity with a striking similarity to a SAPK8, a protein that its expression levels are increased during ABA treatment or under salinity conditions, demonstrating a role in the stress response.
- FUE_37 has almost all the sequences derived from root and particularly root under water stress (as shown in Tables 22 and 23).
- the orthologues from barley, wheat and sugar cane also support the contention that the gene is mainly expressed in roots. There are indications that this gene is implicated in the response to water stress deprivation, hyperosmotic salinity response, cold and other stresses.
- Table 23 Digital expression of FUE 37 ortholog group: Treatment hormone drought mix nodulation pathogen salinity treatment barley 1,1 S 0 14 maize 0.4 ⁇ 1 rice 2 38 0.36 soybean 0.4 " 0.69 1
- FUE_38 is derived from various stressed root libraries (as shown in Tables 24 and 25) and displays a notorious similarity to PKABAl.
- PKABAl transcript levels are barely detectable in growing seedlings but are induced dramatically when plants are subjected to dehydration, cold and osmotic stress (Holappa LD and Walker- Simmons MK Plant Physiol. Vol. 108:1203-1210, 1995).
- a modified expression pattern for this gene can provide increased abiotic stress tolerance, increased vigor, increased yield and better use efficiency of fertilizers.
- Keyword Fold p-value Keyword Gene Production ESTs cell culture 3 16132 1 3 0.0367348 flower 1 89278 4.14173 0.241445 0 990968 seedling + female 1 9012 1 1 0.344935 flower grain 1 73038 3 38834 0.29513 0.976577 endosperm 1 25774 1.19569 0.836336 0.709829 mix 2 90046 4.17736 0.478771 0.944464
- FUE_48 Genes with enriched expression in roots and highly responsive to ABA and abiotic stresses (salinity, osmoticum and cold) were identified.
- One of the genes had an orthologue in maize (FUE_48) that showed enhanced content of root-derived sequences.
- the probable sorghum orthologue is a gene mainly composed by stress- derived sequences, particularly from water stress and drought conditions (as shown in 0 Table 26).
- FUE_48 shows similarity to SIP (Seed Imbibition Protein).
- FUE_39 is a root-expressed calcineurin B-like Ca +"1" binding protein.
- Calcineurins are Ca +4" sensing protein kinases differentially regulated by stress conditions such as salt, drought, cold, and wounding stress. Calcium is involved in several root important behaviors such as gravitropism, hydrotropism, etc and is an 5 important second messenger for various signal transduction pathways. Continuous activation of the protein cascade in which FUE_39 is involved can provide advantageous properties or desired traits compared to a reference plant, including improved abiotic stress tolerance, increased vigor and yield, improved use of fertilizer, etc.
- FUE_40 and FUE_41 are genes expressed in roots particularly at stress conditions.
- the sorghum orthologue of FUE_40 has several sequences derived from stressed tissues including roots.
- FUE_41 and FUE_40 show similarity to stress- responsive proteins.
- FUE_43, FUE 44 and FUE_45 have a distant similarity to an E. coli universal
- FUE_43 shows similarity to an ethylene-responsive protein.
- FUE_44 and FUE_45 show a weak similarity to an early nodulin-like protein. Those proteins expressed ectopically under a different promoter are likely to produce favorable effects in the
- transgenic plants such as enhanced stress tolerance, improved growth at optimal and adverse conditions mainly due to probable modifications in the root architecture.
- FUE_50 was selected using microarray Arabidopsis expression data in which root specific genes were selected if they were also auxin and ethylene responsive. According to the calculated digital expression, the maize orthologue presented in this invention is expressed in roots under water stress conditions and in pathogenesis related tissues. The maize gene shows similarity to nodulin, a protein known to be
- FUE_501 is a putative Arabidopsis thaliana amino acid transporter that shows increased expression under salinity, osmoticum and is also Abscisic acid responsive (ABA - abiotic stress response hormone).
- FUE_51 a maize homologue of FUE_501
- the sorghum orthologue of FUE_51 is involved in stress responses according to the digital expression. Its barley orthologue has sequences derived from roots and stressed roots. Also the wheat orthologue shows several sequences derived from root.
- FUE_502 is a putative amino acid transporter which shows increased expression during salinity stress and osmoticum both in roots and shoots.
- FUE_52 its closest maize orthologue, has also similarity to amino acid transport proteins and has a significant representation of root and stressed root derived sequences.
- FUE_503 has an impressive expression in seeds suggesting a strong role in uptake of amino acids into the developing seeds.
- the gene is strongly upregulated under salinity and in response to methyl jasmonate.
- FUE_504 was chosen because of its strong response to ABA, to salinity (specially of the shoot), to osmoticum, and cold.
- FUE_49 shows a strong similarity at the level of translated amino acids to FUE_504 but low at the level of coding nucleotides.
- Its sorghum orthologue has sequences significantly derived from water stress/drought libraries.
- FUE__53 is a putative amino acid transporter with almost of all the sequences composing the genes derived from root and particularly stressed roots.
- the sorghum, rice and wheat orthologues contain several sequences derived from root and root under stress libraries.
- FUE_101 and FUE_102 show similarity to amino acid transporters.
- FUE_102 is specifically composed from sequences derived from cold treated seedlings and pathogen infected corn ear tip.
- FUE_55 is a gene with a striking similarity to tRNA isopentenyltransferase, an important enzyme in the cytokinin metabolic pathway. Increased expression of FUE_55 in the roots or shoots will increase the levels of cytokinin leading to enhanced leaf expansion and cell duplication, delayed senescence, increased sink strength of the tissues, enhanced nitrogen utilization, etc. FUE 55 is particularly expressed in the endosperm, a tissue that is probably the strongest sink in the plant.
- FUE_505 is a putative AP2 domain-containing transcription factor present in two important list of genes. One list contains the genes that are Zeatin responsive (Zeatin is a naturally occurring cytokinin) while the second list of genes contains nitrogen induced genes after nitrogen addition to nitrogen starved plants (Wang et al., Plant Physiology, June 2003, Vol. 132, pp. 556-567). FUE_505 was found in the cluster of the ARE. (Arabidopsis response regulators) which mediate the response of the shoot to cytokinin. Root cytokinin production increase upon nitrogen availability (Yamada et al. FEBS Lett. Vol. 436, pp:76-80, 1998).
- niRNA expression ofin-silico expressed polynucleotides niRNA levels are determined using reverse transcription assay followed by quantitative Real-Time PCR (qRT-PCR) analysis. RNA levels are compared between different tissues, developmental stages, growing conditions and/or different genetic backgrounds. A correlation analysis between mRNA levels in different experimental conditions/genetic backgrounds as evidence for the role of the gene in the plant.
- Root and leaves were excised fresh from maize plants grown on 10 liter white buckets filled with Vermiculite Size 3. Buckets were watered with tap water until seeds from a commercial hybrid germinated. During the entire growth period (5 weeks), the plants were irrigated with 2 liter/bucket/day with a solution pH 5.7 - 5.8 containing 2mM CaCl 2 , ImM MgSO 4 , ImM KH 2 PO 4 , 7mM KCl and microelements cocktail. Ammonium nitrate was added at the following concentrations: 5 niM, 0.5 niM, 0.05 mM, 0.005 niM or not at all.
- qRT-PCR Quantitative Real Time RT-PCR
- GREEN PCR master mix (Applied Biosystems), forward and reverse primers 0.3 ⁇ M each, and DDW was added up to 20 ⁇ L.
- qPCR reaction was performed in a Stratagene MX 3000 real-time PCR machine with the following conditions 50 0 C for 2min, 95 0 C for lOmin, 40 times of 95 0 C for 15 sec and lmin at 60 0 C, followed by 95 0 C for 15 sec, 60 0 C for 60 sec, and 70 times of 60 0 C for 10 sec +0.5 0 C increase in each cycle.
- a standard curve is prepared from a pool of RTs from all samples, in 5 dilutions (dilutions - 1:60, 1:200, 1:600, 1:2000, 1:10000).
- the dissociation curves obtained were qualified for the absence of non-specific PCR products or primer-dimers. Reactions were repeated at least twice. The calculation method is based on the assumption that the efficiencies of the reactions of the GOI (gene of interest) and of the housekeeping genes are similar.
- FUE_ 30 Reverse Primer CAGGATGCACGTCTTGCCT/SEQ ID NO: 1393
- FUE_ 31 Forward Primer ATGTGCAACGACCCTACTAACTCC/SEQ ID NO: 1394
- FUE_ 31 Reverse Primer TCAGTGTCCTCAGCGCGAT/SEQ ID NO: 1395
- FUE_ 32 Forward Primer CTCGAGCATCACTCAAACCACTAC/SEQ ID NO: 1396
- FUE_ _32 Reverse Primer GCCAGGCCCATTGAATCAC/SEQ ID NO: 1397
- FUE_ _34 Forward Primer GCCACCAACTCCATTCAACTTT/SEQ ID NO: 1400
- FUE_ _35 Forward Primer GACGCTCTGATTAGGCTAGGGAC/SEQ ID NO: 1402
- FUE_ _35 Reverse Primer CCCTGCTGTTACGTGGCC/SEQ ID NO: 1403
- FUE_ _36 Reverse Primer TCCCATCTAGAAGTGTGTTCTCCA/SEQ ID NO: 1405
- FUE_ _38 Forward Primer CTATGGAAATTTGTCACCGTGATC/SEQ ID NO: 1408
- FUE_ _39 Forward Primer CCGATGAGCTAGGAGAAGTGTTG/SEQ ID NO: 1410
- FUE_ _39 Reverse Primer TTTGGCCGATTGGGTATGTC/SEQ ID NO: 1411
- FUE_ _40 Forward Primer ATTGCAGAGAGGGAAAACGTAAGA/SEQ ID NO: 1412
- FUE_ _40 Reverse Primer AAATCAAACACGTCCAAGAACATC/SEQ ID NO: 1413
- FUE_ _41 Forward Primer AAATATTTGTCCTATGGGAATGGG/SEQ ID NO: 1414
- FUE_ _41 Reverse Primer: AGTATAATAGTTCTGTCCAAAGTTGCGT/SEQ ID NO:1415
- FUE_ _42 Reverse Primer: CCAACGACTCGCCTTCCTAAC/SEQ ID NO: 1417
- FUE_ _43 Reverse Primer GCTGGACTCTCTTCACTTCGCT/SEQ ID NO: 1419
- FUE _44 Forward Primer GCACTGATCAATGCCGACTG/SEQ ID NO: 1420
- FUE_ _44 Reverse Primer: AAGGATTGGATCGGATACTTGTAGA/SEQ ID NO: 1421
- FUE_ 45 Forward Primer: TTATCCATGATACCCCGCTGA/SEQ ID NO: 1422
- FUE_ _45 Reverse Primer: GTGCTTGTTGACTTGACGACG/SEQ ID NO: 1423
- FUE_ _46 Forward Primer AGCAGCCGCTGTGTATAACAAG/SEQ ID NO: 1424
- FUE_ _46 Reverse Primer: GGAAGGGAAAGAGGACGTCAA/SEQ ID NO: 1425
- FUE_ _47 Forward Primer TGAACCTACTCTTTGGGATAGCTGT/SEQ ID NO: 1426
- FUE_ _47 Reverse Primer ACGTGGAGAATTACATGCTGATAGTT/SEQ ID NO: 1427
- FUE_ _48 Reverse Primer: CGAAATCGATAGACCACACACG/SEQ ID NO: 1429
- FUE_ J9 Forward Primer CCCTTCTACAAGCAAATACTCACTCC/SEQ ID NO: 1430
- FUE_ _49 Reverse Primer GACCCTCTCATCTCTTATTGAACCA/SEQ ID NO: 1431
- FUE_ _50 Forward Primer GGCGATCCAACGGAGAAGTAG/SEQ ID NO: 1432
- FUE_ _50 Reverse Primer ACATCGGCAGCACGGAGT/SEQ ID NO: 1433
- FUE_ _51 Forward Primer CCGGTGCATAAGGAAATACGAG/SEQ ID NO: 1434
- FUE_ _52 Forward Primer GTCGATCATCGCATTCTCCA/SEQ ID NO: 1436
- FUE_ _52 Reverse Primer TCCTTTCATCGTATCCCCCAT/SEQ ID NO: 1437
- FUE_ _53 Forward Primer CAGATCTTCTTCTCTCAGCTCCCT/SEQ ID NO: 1438
- FUE_ _53 Reverse Primer GGGCTGAATCAACGTCGACT/SEQ ID NO: 1439
- FUE_ _54 Forward Primer GAAGCTGTGGGTCTCAAGGG/SEQ ID NO: 1440
- FUE_ __54 Reverse Primer AGGTCGGCACGTACTCGG/SEQ ID NO: 1441
- Figures 3A and 3B show the results found for two high affinity nitrate and ammonium transporter respectively.
- the expression of the high affinity transporters is downregulated.
- those high affinity transporters obviously essential at conditions in which the substrate is scarce, are upregulated at low nitrate and ammonium concentrations (see Figure 3A and 3B).
- their expression is upregulated under high substrate conditions as shown in Figure 3 C and 3D, respectively.
- low affinity transporters are upregulated with high N concentration.
- high affinity transporters are upregulated with low N concentration.
- Enzymes involved in N-assimilation are upregulated inn the presence of nitrogen.
- the genes identified in Example 1 show the distinctive nitrogen responsive behavior found for the control genes ( Figures 3 A-D).
- FUE_3 shows upregulation at high substrate concentrations as found for the key control assimilation enzymes indicating a clear association of this gene with the nitrogen status of the plant and hence its relation to nitrogen related-responses.
- FUE_12 (as shown in Figure 4B), FUE_30 (as shown in Figure 4C), FUE_33 (as shown in Figure 4D), FUE_34 (as shown in Figure 4E), FUE_38 (as shown in Figure 4F), FUE_43 (as shown in Figure 4G), FUE 47 (as shown in Figure 4H), FUE_48 (as shown in Figure 41), FUE_49 (as shown in Figure 4J) and FUE_52 (as shown in Figure 4K).
- FUE_12 (as shown in Figure 4B), FUE_30 (as shown in Figure 4C), FUE_33 (as shown in Figure 4D), FUE_34 (as shown in Figure 4E), FUE_38 (as shown in Figure 4F), FUE_43 (as shown in Figure 4G), FUE 47 (as shown in Figure 4H), FUE_48 (as shown in Figure 41), FUE_49 (as shown in Figure 4J) and FUE_52 (as
- Example 1 included in Example 1 are genes that show a tight upregulation when nitrogen fertilizer is in short supply.
- This kind of genes is expected to be related to pathways involved in nitrogen assimilation, storage and use under conditions of nitrogen deficiency as is the case of the high affinity nitrate and ammonium transporters ( Figures 2C and 2D).
- Figure 5A shows the results for FUE_4, a gene that undergoes a strong upregulation at low nitrogen fertilizer availability, indicating a clear role of this gene in the plant endogenous response to nitrogen deficient conditions.
- Example 1 other genes in Example 1, display a similar nitrogen- responsiveness curve as FUE 4 such as FUE_10 (as shown in Figure 5B), FUE_37 (as shown in Figure 5C), FUE 46 (as shown in Figure 5D) and FUE_50 (as shown in Figure 5E).
- FUE_10 as shown in Figure 5B
- FUE_37 as shown in Figure 5C
- FUE 46 as shown in Figure 5D
- FUE_50 as shown in Figure 5E.
- Example 1 Twenty eight genes of the 50 genes selected in Example 1 and validated in Example 2 above were cloned into binary vectors for the generation of transgenic plants.
- ORF open reading frame
- EST clusters and in some cases mRNA sequences were analyzed to identify the entire open reading frame by comparing the results of several translation algorithms to known proteins from other plant species.
- RNA extraction was performed using standard protocols described elsewhere (Sambrook J., E.F. Fritsch, and T. Maniatis. 1989. Molecular Cloning. A Laboratory Manual., 2nd Ed. Cold Spring Harbor Laboratory Press, New York.) and are basic for those skilled in the art.
- PCR products were purified using PCR purification kit (Qiagen) and sequencing of the amplified PCR products is performed, using ABI 377 sequencer (Applied Biosystems).
- the primer extension includes an endonuclease restriction site.
- the restriction sites are selected using two parameters: a. The site does not exist in the cDNA sequence, b.
- the restriction sites in the forward and reverse primers are designed so the digested cDNA is inserted in the sense formation into the binary vector utilized for transformation.
- the pPI plasmid vector was constructed by inserting a synthetic poly-(A) signal sequence, originating from pGL3 basic plasmid vector (Promega, Ace. No.
- Synthetic sequences of some of the cloned polynucleotides were ordered from a commercial supplier (GeneArt, GmbH). The synthetic DNA was designed in silico, based on the putative encoded polypeptide sequences described in Example 1. To optimize the coding sequence, codon-usage tables calculated from plant transcriptomes were used (example of such tables can be found in the Codon Usage Database available online at http://www.kazusa.or.jp/codon/). The optimized coding sequences were designed in a way that no changes are introduced in the encoded amino acid sequence while using codons preferred for expression in dicotyledonous plants mainly tomato and Arabidopsis; and monocotyledonous plants such as maize.
- FUEJ_Original M SEQ ID NO: 1318
- FUE_7_Original SEQ ID NO: 1323
- the plasmid pPI was constructed by inserting a synthetic poly-(A) signal sequence, originating from pGL3 basic plasmid vector (Promega, Ace No U47295; bp 4658-4811) into the Hindttl restriction site of the binary vector pBI101.3 (Clontech, Ace. No. U12640).
- the backbone binary plasmid used was pGI which is similar to pPI but the GUS gene was replaced by the GUS-Intron gene (Vancanneyt. G, et al MGG 220, 245-50, 1990).
- pGI was used to clone all the polynucleotide sequences, initially under the control of 35S promoter [Odell, JT 3 et al. Nature 313, 810 - 812 (28 February 1985); SEQ ID NO: 1337].
- RootP SEQ ID NO: 13378 because of its enriched expression in roots, was amplified and cloned from genomic DNA isolated from Arabidopsis thaliana by direct PCR using the following primers.
- the promoter is the 1110 bp upstream region of the gene ATXTH 19 (AT4G30290, Xyloglucan endotransglucosylase/hydrolase 19).
- ATXTH 19 AT4G30290, Xyloglucan endotransglucosylase/hydrolase 19.
- the sequence cloned was already shown to drive root-specific expression (Vissenberg K, et al. Plant Cell Physiol. 2005 Jan;46(l): 192-200).
- the following genes were cloned downstream of the RootP promoter sequence: FUE_3, FUE_4, FUE_8, FUE_9, FUE 13, FUE_14, FUE 16, FUE_33, FUE_34_Evo.
- GUS ⁇ -glucuronidase enzyme
- the TT105 promoter (SEQ ID NO: 1339; 2004/081173) was used to mediate constitutive ubiquitous expression at levels different from those mediated by the 35S promoter.
- the promoter TT 105 contains the upstream region of the ELP gene (Ectopic deposition of Lignin, GENBANK ACCESSION NO: NM_100466, AT1G05850) including the first exon and part of the first intron.
- the genes cloned under the TT105 promoter were FUE_502, FUE_504, FUE_39 and FUE_52.
- GUS ⁇ -glucuronidase enzyme
- Floral dip a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 16(6): 735-43; and Desfeux C, Clough SJ, Bent AF. (20000 Female reproductive tissues are the primary targets of Agrobacterium-mediated transformation by the Arabidopsis floral-dip method. Plant Physiol. 123(3): 895-904.). Briefly- Arabidopsis thaliana var Columbia (T 0 plants) were transformed using the Floral Dip procedure described by Clough SJ and Bent AF (10) and by Desfeux C et al. (11), with minor modifications.
- the cultures were incubated at 28 °C for 48 hrs under vigorous shaking and centrifuged at 4000 rpm for 5 minutes.
- the pellets comprising Agrobacterium cells were resuspended in a transformation medium which contained half-strength (2.15 g/L) Murashige-Skoog (Duchefa); 0.044 ⁇ M benzylamino purine (Sigma); 112 ⁇ g/L B5 Gam strig vitamins (Sigma); 5 % sucrose; and 0.2 ml/L Silwet L-77 (OSI Specialists, CT) in double-distilled water , at pH of 5.7.
- Transformation of T 0 plants was performed by inverting each plant into an Agrobacterium suspension such that the flowering stem was submerged for 3-5 seconds. Each inoculated T 0 plant was immediately placed in a plastic tray, then covered with clear plastic dome to maintain humidity and kept in the dark at room temperature for 18 hrs to facilitate infection and transformation. Transformed (transgenic) plants are then uncovered and transferred to a greenhouse for recovery and maturation. The transgenic To plants were grown in the greenhouse for 3-5 weeks until siliques were brown and dry, then seeds were harvested from plants and kept at room temperature until sowing.
- transgenic T 0 plants For generating Tl and T 2 transgenic plants harboring the genes, seeds collected from transgenic T 0 plants were surface-sterilized by soaking in 70 % ethanol for 1 minute, followed by soaking in 5 % sodium hypochlorite and 0.05 % Triton X- 100 for 5 minutes. The surface-sterilized seeds were thoroughly washed in sterile distilled water then placed on culture plates containing half-strength Murashige- Skoog (Duchefa); 2 % sucrose; 0.8 % plant agar; 50 niM kanamycin; and 200 niM carbenicylin (Duchefa).
- the culture plates were incubated at 4 °C for 48 hours then transferred to a growth room at 25 °C for an additional week of incubation.
- Vital T 1 Arabidopsis plants were transferred to fresh culture plates for another week of incubation.
- the Ti plants were removed from culture plates and planted in growth mix contained in 250 ml pots.
- the transgenic plants were allowed to grow in a greenhouse to maturity. Seeds harvested from T 1 plants were cultured and grown to maturity as T 2 plants under the same conditions as used for culturing and growing the T 1 plants. At least 10 independent transformation events were created from each construct for which bulk of T2 seeds were collected.
- Maize transformation This procedure is done according to (Bronwyn R. Frame, et al, Agrobacterium tumefaciens-Mediated Transformation of Maize Embryos Using a Standard Binary Vector System, Plant Physiology, May 2002, Vol. 129, pp. 13-22) or to the several protocols available elsewhere from the Plant Transformation Facility at Iowa State University
- Transgenic plants were grown as detailed in Example 4 above.
- Total RNA was extracted from 10 freshly excised flowers from the transgenic plants as detailed in Example 2 above.
- qRT-PCR reactions were performed as described in Example 2 above and the results were normalized against the geometric mean of the expression of two housekeeping genes measured in the same samples.
- Assay 1 Nitrogen Use efficiency assay using plantlets - The assay was done according to Yanagisawa-S. et al. with minor modifications ("Metabolic engineering with Dofl transcription factor in plants: Improved nitrogen assimilation and growth under low-nitrogen conditions" Proc. Natl. Acad. ScI USA 101, 7833-7838).
- KNO 3 KNO 3 ) was 0.2 mM or 0.05 mM. Plants were allowed to grow for additional 30-40 days and then photographed, individually removed from the Agar (the shoot without the roots) and immediately weighed (fresh weight) for later statistical analysis. Constructs for which only Tl seeds were available were sown on selective media and at least 25 seedlings (each one representing an independent transformation event) were carefully, transferred to the nitrogen-limiting media. For constructs for which T2 seeds were available, different transformation events were analyzed. Usually, 25 randomly selected plants from each event were transferred to the nitrogen-limiting media allowed to grow for 3-4 additional weeks and individually weighed at the end of that period. Transgenic plants were compared to control plants grown in parallel under the same conditions. Mock- transgenic plants expressing the uidA reporter gene
- Polynucleotide sequences of the present invention were assayed for a number of commercially desired traits.
- Figure 7 shows the ability FUE_504 or FUE 39 to improve NUE of transgenic plants expressing same.
- the transgenic plants grown oh nitrogen are bigger and heavier than control plants expressing a control gene under the same promoter used to express the transgenes.
- transgenic plants expressing FUE_504 are significantly heavier than the control counterparts.
- the results demonstrate an improvement in NUE since the transgenic plants expressing FUE_504 are able to produce significantly more biomass than control plants starting from a similar nitrogen poor-media.
- Table 36 Least square means of fresh weight measured from ⁇ 25 plantlets grown for 30 days in 0.05 mM combined nitrogen concentration (NH4NO 3 and KNO 3) ⁇ (results analyzed using Student's t test)
- Table 37 Least square means of fresh weight measured from -25 plantlets grown for 30 days in 0.2 mM combined nitrogen concentration (NH 4 NO 3 and KNO 3 ) results anal zed usin Student's t test
- Table 38 Least square means of fresh weight measured from -25 plantlets grown for 27 days in 0.05 and 0.2 mM combined nitrogen concentration (NH4NO3 and
- Table 39 Least square means of fresh weight measured from -25 plantlets grown for 27 days in 0.05 and 0.2 mM combined nitrogen concentration (NH 4 NO 3 and KNO 3 ) (results analyzed using Student's t test MANOVA)
- Assay 2 Nitrogen Use efficiency whole plant assay: Growth rate at limited nitrogen concentration - An additional assay designed to identify improved nitrogen use efficiency was developed. This assay follows the rosette area growth of plants grown in the greenhouse at limited nitrogen availability. Surface sterilized seeds were sown and plants grown at 25 0 C under 23 -hour light 1-hour dark daily cycles for 7-10 days in 0.5 x Murashige-Skoog medium in the presence of 2 % sucrose. Then seedlings of similar size were carefully transferred to 100 ml pots filled with an inert growth medium support (a fine perlite mix). Seedlings were allowed to develop for a further week irrigated with a solution containing abundant supply of micro and macronutrients.
- Fertilizer excess was washed from the pots with at least two volumes of low-nitrate tap water. Then, plants were individually inspected and only healthy plants were chosen for growth rate analysis. The chosen plants were randomly distributed in several trays and used to assay for growth rate analysis under nitrogen limiting conditions. Constant nitrogen limiting conditions were achieved irrigating the plants with a solution containing 0.5 mM inorganic nitrogen (combined KNO 3 and NH 4 NO 3 concentration), supplemented with 2 mM CaCl 2 , 1.25 mM KH 2 PO 4 , 1.50 mM MgSO 4 , 5 mM KCl, 0.01 mM H 3 BO 3 and microelements.
- Rosette plant area was then determined from the digital pictures using the methodology described in Figure 6.
- ImageJ software was used for quantifying the plant size from the digital pictures (http://rsb.info.nih.gov/ij/) utilizing proprietary scripts designed to analyze the size of rosette area from individual plants as a function of time. Percentage of growth was calculated as the ratio of the plant rosette area divided by the initial plant area measured at day 1.
- the presence of the selection marker gene was checked using PCR.
- Leaf samples were taken from the plants, genomic DNA was extracted and served as template for a PCR using primers specific for the selection marker gene. Positive plants were tagged in order to exclude from the analysis the non-transgenic plants.
- FUE 39 shows the results of a growth rate assay under limiting nitrogen conditions. Two events showin enhanced NUE were shown.
- FUE_7, FUE_41, FUE_50, FUE_16 expression under the 35S promoter are significantly better than control plants (wild type or expressing a reporter gene under 35S promoter).
- the assay described here follows the ability of the plant to grow at limiting nitrogen conditions. Since the transgenic plants described above developed significantly faster than control plants it can be assumed that the outstanding events were able to assimilate the nitrogen available and to convert it to organic matter. As all the plants in the experiment were treated similarly, the results indicate that the outstanding events were able to utilize more efficiently the nitrogen available and therefore display enhanced nitrogen use efficiency.
- Assay 3 Seed Yield assay at limited nitrogen availability - Maize plants absorb and store the majority of the nitrogen in leaves and stalk until flowering. Stored nutrients are then redistributed to the developing kernels. In the present assay plants were grown in limited nitrogen conditions as detailed in Assay 2 above for about 45 days and then grown until full maturity with tap water only. Plants are therefore forced to redistribute the stored nitrogen to the developing seeds. Plants that store more nitrogen are expected to have a better yield. Seeds were collected from individual plants and the yield was measured as seed weight. The yield of at least about 6 transgenic plants was usually measured for each event tested.
- transgenic plants overexpressing FUE_43 (under the 35S promoter) were found to have increased seed yield as shown in Table 43. The results of one of the events are presented below.
- Tolerance to salinity or osmotic stress is aimed at identifying genes that confer better germination, seedling vigor or growth in high salt, drought or combination of same or other environmental stresses. Plants differ in their tolerance to salt stress, high osmoticum and drought during different stages of development. Therefore seed germination, plant development, and yield were evaluated independently under the different stress conditions.
- a typical salinity tolerance test is produced taking plants at different developmental stages and irrigating them with increasing concentrations of NaCl (for example 50 mM, 100 mM, 200 mM, 400 niM) or constant concentration of.NaCl.
- Transgenic plants are then compared to control plants in their external phenotypic appearance, degree of wilting, and overall success to reach maturity and yield progeny at concentrations inhibitory to control plants.
- Quantitative parameters of tolerance measured include, the average wet and dry weight, and the weight of the seeds yielded, the average seed size and the number of seeds produced per plant.
- Osmotic stress assays are conducted to determine if an osmotic stress tolerant phenotype is NaCl-specific or if it is a general osmotic stress related phenotype. Drought assays are performed for example halting irrigation during long period and measuring wilting rate, recovery and final yield. Plants tolerant to osmotic stress are in general more tolerant to drought, salinity and freezing conditions and therefore are highly valuable in terms of agronomic traits. Materials and Methods
- the method used to test the plants for improved abiotic stress tolerance includes the test of germination and seedling growth under adverse conditions such as high salinity and high osmoticum.
- Germination assay under abiotic stresses - Germination tests compare the percentage of seeds from transgenic plants that could complete the germination process (radicle protrusion from the seed coat and complete opening of the cotyledons) to the percentage of seeds from control plants treated in the same manner.
- plants were screened manually or automatically and plant size was determined.
- Various independent transformation events selected from Example 5 were analyzed from each construct. Plants expressing the genes from this invention were compared to control plants (wild type or mock-transformed plants) sown on the same plates under the same conditions. Seedling growth under abiotic stress - A complementary experiment performed with seedlings follows the tolerance of the plants to adverse conditions. Surface sterilized seeds were sown in basal media [50 % Murashige-Skoog medium (MS) + vitamins supplemented with 0.8% plant agar as solidifying agent] in the presence of Kanamycin (for transgenic plants) or in its absence (for wild-type control plants).
- basal media 50 % Murashige-Skoog medium (MS) + vitamins supplemented with 0.8% plant agar as solidifying agent
- ImageJ software was used for quantifying the plant size from the digital pictures (http://rsb.info.nih.gov/ii ⁇ - Proprietary scripts were designed to analyze the size of individual plants rosette areas as a function of time.
- Figure 6 shows the methodology used for image area quantification. Five to ten independent transformation events were analyzed from each construct and at least 6 randomly selected plants from each event were analyzed in each stress experiment. Plants expressing the genes from this invention were compared either to control plants sown on the same stress inducing plates (internal controls) or to the average measurement of all the control plants used in the same experiment (all controls).
- Salinity and osmoticum tolerance were assayed by following plant growth during stress, as evidenced by plant green area.
- Several genes and constructs were checked using the procedure described above and significant tolerance results were found. For instance, transgenic plants overexpressing the following genes have shown statistically significant improved tolerance to high salinity stress: FUE_7, FUE_10, FUE_14, FUE_16, FUE_33, FUE_37, FUE_39, FUE_40, FUE_41, FUE_47, FUE_50, FUE_502, FUE_503 and FUE_504.
- genes provided statistically significant results in coffering abiotic stress tolerance to the transgenic plants overexpressing same when exposed to high osmolarity stress: FUE_3, FUE_9, FUE_10, FUE_13, FUE_37, FUE_39, FUE_40, FUE_41, FUE_43, FUE_49, FUE_502, FUE_503 and FUE_504.
- transgenic plants expressing FUE_43 and FUE_503 were found to have increased ability to germinate under high osmoticum conditions (Data not shown).
- transgenic plants expressing the following genes have shown significantly increased abiotic stress tolerance to either salinity or high osmolarity: FUE_10, FUE_37, FUE_39, FUE_40, FUE_41, FUE_502 and FUE_504.
- Results are expressed as the growth area percentage related to the size of the plant when transferred to stress conditions (i.e., Day 1).
- Table 44b list of genes showing improved seedling growth under osmoticum stress Gene Prom Osmoticum oter - Seedling Growth Assay
- Root size and depth correlates with drought tolerance and fertilizer use efficiency. Deeper root systems can access water in stored in deeper soil layers. Similarly, a highly branched root system provides better coverage of the soil and therefore can effectively absorb all macro and micronutrients available resulting in enhanced fertilizer use efficiency.
- plants were grown in agar plates placed vertically. Plates were photographed every few days and the maximal length and total area covered by the plant roots were assessed from the digital pictures. From every construct created, several independent transformation events were checked in replicates.
- plants overexpressing FUE_16 and FUE_7 original were found to produce the longest root architecture (see Table 46 below).
- FUE_16 was found to produce the fastest penetrating root system from all the constructs tested at all days tested (7, 14 and 21 days after germination).
- the enhanced root architecture allows transgenic plants expressing FUE genes to absorb more successfully the nutrients (fertilizers) and water available in the soil. Increased uptake and nutrient recovery is a key feature for improved fertilizer use efficiency and abiotic stress tolerance. Deeper root systems allow plants to access water available in deeper soil layers enhancing the tolerance to extended drought periods and therefore ensuring high yields also under harsh conditions.
- FUE 40 expressing plants are characterized by a plant architecture for maximal seed production
- EXAMPLElO CT-9 (SEQ ID NO: 1340, 1341) and CT-71 (SEQ ID NO: 1342, 1343) confer drought tolerance and increased yield of transgenic tomato
- CT_9 SEQ ID NOs. 1340, 1341 previously disclosed in PCT Application No. WO2005/12136
- CT_71 SEQ ID NOs. 1342 and 1343, previously disclosed in PCT Application No. WO2005/121364 confer drought resistance and increased yields in transgenic plants expressing same.
- CT_9 and CT_71 were disclosed in PCT Application No. WO2005/121364 to Evogene Ltd. and in US5,597,718 (CT_71).
- Drought assay - The drought assay described herein was effected in field conditions mimicking drought stress by controlling the amount of water supplied and the drought intervals.
- the assay, one source dripping irrigation system (OSDI) is similar to the farmer field since it creates water deficiency in a relatively uniform manner and enables to measure the effect of drought on small size populations of plants.
- OSDI one source dripping irrigation system
- the present irrigation method may be effected as follows:
- Preferred drippers used are pressure-compensated thick-walled dripper line with anti-siphon and anti-drain systems (UniRamTM CNL #16010, Flow Rate 1.6 1/h from Netafim Israel).
- Anti-siphon system prevents dirt backflow into the dripper line while anti-drain (CNL) system eliminates drainage and refill effect, and improves efficiency in pulse irrigation.
- the OSDI method was developed on the basis of the line source sprinklers irrigation system (Hanks et al. 1976 Soil Sci. Soc Am. J. 40 p. 426-429) with significant modifications. Instead of sprinklers irrigation a dripping irrigation was used. In order to create a uniform and deep wet layer (at least 60cm depth) and not the onion shape layer that is typically created by dripping irrigation a low pressure compensating dripping irrigation system was used that allow providing small amount of water in a relatively long period of time.
- the experiment was created in light soil during summer 2006 (from July to September), in an open field nethouse near Rehovot, Israel.
- the water capacity of the soil was measured using the standard procedures by sampling soil from the following three depths: 0 to 20 cm, 20 to 40 cm and 40 to 60 cm. The water content in these soil layers was measured routinely every week.
- the soil contained 5 % hygroscopic water while the maximum water capacity of the soil was 20 %.
- AU fertilizers were applied into the soil prior to sowing. The amount of both phosphorus and potassium was calculated to be sufficient for all season. Nitrogen was applied as recommended, equally to all the treatments through the irrigation system.
- the water control was done separately for each treatment.
- the soil was dried completely before the beginning of the experiment.
- Sowing was done in a nursery conditions under regular water irrigation.
- the seedlings were transplanted after four weeks into wet soil.
- the water amount that was used to uniformly irrigate before transplanting reached the maximum water capacity (20 % w/w) at 60 cm depth however without creation of water overload.
- Each plant was transplanted near a dripper, 30 cm distance between plants with a total density of 2600 plants per 1000 sq. m, according to commercial growth protocol.
- the experiment was structured in four blocks containing three rows irrigated with different water levels and intervals (WLI-O, WLI-I, WLI-2).
- the different water regimes started only four weeks following transplanting when plants reached the flowering stage.
- the amount of water supplied every week during the assay was calculated at every beginning of the week following the recommendations of standard growing protocols.
- WLI-O treatment received the recommended total weekly irrigation volume, but divided in three irrigations.
- the two other treatments represent two different level of water deficiency.
- WLI-I was also irrigated three times a week, but the amount of water supplied was half of the irrigation supplied to WLI-O.
- WLI-I plants received the amount of water required to reach maximum soil water capacity.
- WLI-2 was not irrigated during the week but rather at the beginning of every week. Water was supplied to achieve the maximum water capacity. The water stress experiment lasted throughout the flowering period (23 days) corresponding to 4 cycles of the stresses described above. Afterwards, all the treatments received the recommended amount of water.
- the calculation of the water amount was equal to the difference between water content in dry soil and soil with maximum water capacity. At the end of each stress cycle the water amount was compared between treatments according to actual water content in the soil (Table 47)
- CT-9 or CT-71 ligated to binary constructs, comprising the 35S promoter were transformed into tomato plants via Agrobacterium tumefacience transformation.
- 60 ⁇ L of Agrobacterium tumefaciens LB4404 competent cells were transformed with 20 ng of binary plasmid via electroporation, using a MicroPulser electroporator (Biorad), 0.2 cm cuvettes (Biorad) and EC-2 electroporation program (Biorad).
- Agrobacterium cells were grown on 0.8 mL LB liquid medium at 28 °C for 3 hrs and 0.2 mL of the cell suspension were plated on LB-agar plates supplemented with the antibiotics streptomycin 300 mg/L (for Agrobacterium strain LB4404) and kanamycin 50 mg/L (Sigma). Plates were then incubated at 28 °C for 48 hrs. Agrobacterium colonies were grown and PCR amplification was performed on
- Agrobacterium cells using primers which were designed to span the inserted sequence in the binary vector.
- PCR products were separated on 1.5 % agarose gels and product sizes were determined by comparing to DNA ladder (MBI Fermentas). PCR products with the predicted size were sequenced using the primers which were used for the PCR amplification. Sequencing of the inserted sequence was performed to verify that the right clones were introduced into the Agrobacterium cells.
- DNA sequencing was effected using ABI 377 sequencer (Amersham Biosciences Inc.).
- Transformation of Micro-Tom tomato plants with CT 9 or CT-71 - Tomato (Lycopersicon esculentum, var MicroTom) transformation and cultivation of transgenic plants was effected according to Curtis et al. 1995 Methods MoI Biol. 1995;44:59-70., and Meissner et. al. 2000. Plant J. 2000 May;22(3):265-74. Following transformation, Tl MicroTom tomato plants were grown in a mix contained in 1000 ml pots, until fruit set and T2 seeds harvesting. Transgenic micro- torn tomato plants over expressing the CT-9 or CT-71 genes under the regulation of the 35S promoter were cross-pollinated with M82 commercial variety plants.
- Table 48 Total fruit yield of the plant lines grown under severe water stress (WLI- 2) expressing CT-9 gene compared to control plants.
- the transgenic lines overexpressing CT-9 showed significantly higher fruit yield under severe water deficiency conditions (WLI-2) compared to control plants.
- Table 49 Total fruit yield of the lines over expressing CT-9 compared to control lants rown under avorable water irrigation (WLI-O)
- Plants overexpressing FUE_34_Evo are characterized by enhanced lateral branching
- Control of lateral buds activation can have an important role in modern agriculture and breeding of flowers and ornaments.
- breeders worked for many years towards the reduction of tillers (lateral branches) in order to create single husk plants that reach maturation concurrently.
- tillers lateral branches
- control of tillering in rice breeding has also importance since multiple tillers will allow the production of several panicles on the same plant while overtillering has deleterious effects on the plant.
- lateral branching is important for ornamentals, for example to produce multiple flowers from the same stem, or to produce single large flowers from each stem.
- plants expressing exogenous FUE_34_Evo are characterized by multiple branching of the shoot.
- Expression of FUE_34 Evo (SED ID No: 54) under a constitutive ubiquitous promoter caused unusually active lateral branching phenotype. All the transgenic events obtained with these constructs display this particular branching phenotype at every node. This phenotype can be a result of the loss of the plant apical dominance or more likely to the continuous expression of Evo_34_Evo under an ubiquitous constitutive promoter.
- Evo_34 is a MADS box transcription factor that contains in addition putative phosphorylation sites for cAMP- and cGMP-dependent protein kinase, Casein kinase II and Protein kinase C. Expression under a root preferred promoter such as RootP caused the creation of a compact highly branched root phenotype.
- FUE_34_Evo can be therefore used for example to engineer plants with controlled branching adding a constitutive or inducible promoter active at certain anatomical parts of the plant and/or at certain developing stages. Similarly the gene can be silenced and in this way tillering or lateral branching will be highly likely avoided. Another potential use for this gene is for MAS (Marker assisted breeding).
- Table 50 lists a summary of orthologous and homologous sequences of the polynucleotide sequences and polypeptide sequences of the invention identified using BLAST (TBLASTX program) having at least 85% similarity on at least 85% of the entire protein length.
- GenBank Accession numbers mentioned in this specification are herein incorporated in their entirety by reference into the specification, to the same extent as if each individual publication, patent or patent application or GenBank Accession number was specifically and individually indicated to be incorporated herein by reference.
- citation or identification of any reference in this application shall not be construed as an admission that such reference is available as prior art to the present invention.
- File information is provided as: File name/bite size/date of creation/machine format/ operating system.
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Cell Biology (AREA)
- Botany (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
- Fertilizers (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
Description
Claims
Priority Applications (10)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
EP06809784A EP1940217A4 (en) | 2005-10-24 | 2006-10-24 | Isolated polypeptides, polynucleotides encoding same, transgenic plants expressing same and methods of using same |
AU2006307457A AU2006307457B2 (en) | 2005-10-24 | 2006-10-24 | Isolated polypeptides, polynucleotides encoding same, transgenic plants expressing same and methods of using same |
MX2015010270A MX350551B (en) | 2005-10-24 | 2006-10-24 | Isolated polypeptides, polynucleotides encoding same, transgenic plants expressing same and methods of using same. |
CA2626592A CA2626592C (en) | 2005-10-24 | 2006-10-24 | Methods of increasing abiotic stress tolerance and fertilizer use efficiency of a plant |
US12/083,978 US8962915B2 (en) | 2004-06-14 | 2006-10-24 | Isolated polypeptides, polynucleotides encoding same, transgenic plants expressing same and methods of using same |
BRPI0618965-2A BRPI0618965B1 (en) | 2005-10-24 | 2006-10-24 | method to increase a plant's tolerance to an abiotic stress condition, method to increase a plant's biomass, vigor and / or yield, method to increase the efficiency of fertilizer use and / or absorption of a plant |
MX2012012072A MX338183B (en) | 2005-10-24 | 2006-10-24 | Isolated polypeptides, polynucleotides encoding same, transgenic plants expressing same and methods of using same. |
IL190918A IL190918A0 (en) | 2005-10-24 | 2008-04-16 | Isolated polypeptides, polynucleotides encoding same, transgenic plants expressing same and methods of using same |
IL208739A IL208739A0 (en) | 2005-10-24 | 2010-10-14 | Isolated polypeptides, polynucleotides encoding same, transgenic plants expressing same and methods of using same |
US14/589,020 US10533184B2 (en) | 2004-06-14 | 2015-01-05 | Isolated polypeptides, polynucleotides encoding same, transgenic plants expressing same and methods of using same |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US72918105P | 2005-10-24 | 2005-10-24 | |
US60/729,181 | 2005-10-24 |
Related Parent Applications (2)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/IL2005/000627 Continuation-In-Part WO2005121364A2 (en) | 2004-06-14 | 2005-06-14 | Polynucleotides and polypeptides involved in plant fiber development and methods of using same |
US11/629,411 Continuation-In-Part US7812218B2 (en) | 2004-06-14 | 2005-06-14 | Polynucleotides and polypeptides involved in plant fiber development and methods of using same |
Related Child Applications (3)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
EP20110190921 Previously-Filed-Application EP2716654A1 (en) | 2005-10-24 | 2006-10-24 | Isolated polypeptides, polynucleotides encoding same, transgenic plants expressing same and methods of using same |
US12/083,978 A-371-Of-International US8962915B2 (en) | 2004-06-14 | 2006-10-24 | Isolated polypeptides, polynucleotides encoding same, transgenic plants expressing same and methods of using same |
US14/589,020 Division US10533184B2 (en) | 2004-06-14 | 2015-01-05 | Isolated polypeptides, polynucleotides encoding same, transgenic plants expressing same and methods of using same |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2007049275A2 true WO2007049275A2 (en) | 2007-05-03 |
WO2007049275A3 WO2007049275A3 (en) | 2009-02-12 |
Family
ID=37968214
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/IL2006/001223 WO2007049275A2 (en) | 2004-06-14 | 2006-10-24 | Isolated polypeptides, polynucleotides encoding same, transgenic plants expressing same and methods of using same |
Country Status (10)
Country | Link |
---|---|
US (2) | US8962915B2 (en) |
EP (2) | EP2716654A1 (en) |
CN (1) | CN101505587A (en) |
AU (1) | AU2006307457B2 (en) |
BR (1) | BRPI0618965B1 (en) |
CA (1) | CA2626592C (en) |
MX (2) | MX338183B (en) |
RU (3) | RU2425151C2 (en) |
WO (1) | WO2007049275A2 (en) |
ZA (1) | ZA200803989B (en) |
Cited By (47)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2009013750A2 (en) | 2007-07-24 | 2009-01-29 | Evogene Ltd. | Polynucleotides, polypeptides encoded thereby, and methods of using same for increasing abiotic stress tolerance and/or biomass and/or yield in plants expressing same |
WO2009020528A1 (en) * | 2007-08-07 | 2009-02-12 | University Of Connecticut | Vacuolar pyrophosphatases and uses in plants |
US7534933B2 (en) | 2000-08-18 | 2009-05-19 | University Of Connecticut | Transgenic plants overexpressing a plant vacuolar H + -ATPase |
WO2009148330A1 (en) * | 2008-06-03 | 2009-12-10 | Vialactia Biosciences (Nz) Limited | Compositions and methods for improving plants |
WO2010063637A1 (en) * | 2008-12-03 | 2010-06-10 | Basf Plant Science Gmbh | Plants having enhanced abiotic stress tolerance and/or enhanced yield-related traits and a method for making the same |
WO2010076756A2 (en) | 2008-12-29 | 2010-07-08 | Evogene Ltd. | Polynucleotides, polypeptides encoded thereby, and methods of using same for increasing abiotic stress tolerance, biomass and/or yield in plants expressing same |
WO2010100595A2 (en) | 2009-03-02 | 2010-09-10 | Evogene Ltd. | Isolated polynucleotides and polypeptides, and methods of using same for increasing plant yield and/or agricultural characteristics |
EP2255003A2 (en) * | 2008-02-15 | 2010-12-01 | Ceres Inc. | Drought and heat tolerance in plants |
US7910800B2 (en) | 2005-08-15 | 2011-03-22 | Evogene Ltd. | Methods of increasing abiotic stress tolerance and/or biomass in plants and plants generated thereby |
WO2011080674A2 (en) | 2009-12-28 | 2011-07-07 | Evogene Ltd. | Isolated polynucleotides and polypeptides and methods of using same for increasing plant yield, biomass, growth rate, vigor, oil content, abiotic stress tolerance of plants and nitrogen use efficiency |
WO2011135527A2 (en) | 2010-04-28 | 2011-11-03 | Evogene Ltd. | Isolated polynucleotides and polypeptides, and methods of using same for increasing plant yield and/or agricultural characteristics |
US8058515B2 (en) | 1999-11-10 | 2011-11-15 | University Of Connecticut | Plant cells and plants overexpressing vacuolar proton pyrophosphatases |
WO2012049661A1 (en) * | 2010-10-15 | 2012-04-19 | Genoplante-Valor | Production of plants with improved tolerance to water deficit |
EP2527451A1 (en) * | 2008-12-10 | 2012-11-28 | Vib Vzm | Screening method for identifying genes involved in plant cell cycle |
US8669108B2 (en) | 2008-04-03 | 2014-03-11 | Vialactia Biosciences (Nz) Limited | Gene expression control in plants |
WO2014159632A1 (en) * | 2013-03-14 | 2014-10-02 | Monsanto Technology Llc | Plant regulatory elements and uses thereof |
US8901376B2 (en) | 2008-12-01 | 2014-12-02 | Vialactia Biosciences (Nz) Limited | Methods and compositions for the improvement of plant tolerance to environmental stresses |
US8921538B2 (en) | 2009-04-01 | 2014-12-30 | Vialactia Biosciences (Nz) Limited | Control of gene expression in plants |
US8937215B2 (en) | 2009-08-04 | 2015-01-20 | Evogene Ltd. | Polynucleotides and polypeptides for increasing desirable plant qualities |
US9051578B2 (en) | 2008-05-28 | 2015-06-09 | Insight Genomics Limited | Methods and compositions for plant improvement |
EP3072972A2 (en) | 2008-08-18 | 2016-09-28 | Evogene Ltd. | Isolated polypeptides and polynucleotides useful for increasing nitrogen use efficiency, abiotic stress tolerance, yield and biomass in plants |
US9631000B2 (en) | 2006-12-20 | 2017-04-25 | Evogene Ltd. | Polynucleotides and polypeptides involved in plant fiber development and methods of using same |
US9670501B2 (en) | 2007-12-27 | 2017-06-06 | Evogene Ltd. | Isolated polypeptides, polynucleotides useful for modifying water user efficiency, fertilizer use efficiency, biotic/abiotic stress tolerance, yield and biomass in plants |
US9714430B2 (en) | 2008-05-22 | 2017-07-25 | Evogene Ltd. | Isolated polynucleotides and polypeptides and methods of using same for increasing plant utility |
US9745595B2 (en) | 2008-10-30 | 2017-08-29 | Evogene Ltd. | Methods of increasing biomass and/or growth rate of a plant under non-stress conditions |
US9771598B2 (en) | 2012-12-26 | 2017-09-26 | Evogene Ltd. | Isolated polynucleotides and polypeptides, construct and plants comprising same and methods of using same for increasing nitrogen use efficiency of plants |
EP3238534A2 (en) | 2009-06-10 | 2017-11-01 | Evogene Ltd. | Isolated polynucleotides and polypeptides, and methods of using same for increasing nitrogen use efficiency, yield, growth rate, vigor, biomass, oil content, and/or abiotic stress tolerance |
US9834781B2 (en) | 2004-06-14 | 2017-12-05 | Evogene Ltd. | Polynucleotides and polypeptides involved in plant fiber development and methods of using same |
US9834782B2 (en) | 2012-05-28 | 2017-12-05 | Evogene Ltd. | Isolated polynucleotides and polypeptides, and methods of using same for increasing plant yield and/or agricultural characteristics |
US9890389B2 (en) | 2012-12-25 | 2018-02-13 | Evogene Ltd. | Isolated polynucleotides and polypeptides, and methods of using same for increasing nitrogen use efficiency of plants |
US9920330B2 (en) | 2012-02-29 | 2018-03-20 | Evogene Ltd. | Isolated polynucleotides and polypeptides and methods of using same for increasing plant yield, biomass, growth rate, vigor, oil content, abiotic stress tolerance of plants and nitrogen use efficiency |
US9920329B2 (en) | 2013-05-22 | 2018-03-20 | Evogene Ltd. | Isolated polynucleotides and polypeptides, and methods of using same for increasing plant yield and/or agricultural characteristics |
US9976157B2 (en) | 2011-08-23 | 2018-05-22 | Evogene Ltd. | Isolated polynucleotides and polypeptides, and methods of using same for increasing plant yield and/or agricultural characteristics |
US10000768B2 (en) | 2011-11-21 | 2018-06-19 | Syngenta Participations Ag | Compositions and methods for increasing nematode resistance in plants |
US10006042B2 (en) | 2013-08-27 | 2018-06-26 | Evogene Ltd. | Isolated polynucleotides and polypeptides, and methods of using same for increasing plant yield and/or agricultural characteristics |
US10036031B2 (en) | 2007-04-09 | 2018-07-31 | Evogene Ltd. | Polynucleotides, polypeptides and methods for increasing oil content, growth rate and biomass of plants |
US10113176B2 (en) | 2011-11-28 | 2018-10-30 | Evogene Ltd. | Isolated polynucleotides and polypeptides, and methods of using same for increasing nitrogen use efficiency, yield, growth rate, vigor, biomass, oil content, and/or abiotic stress tolerance |
US10184132B2 (en) | 2003-05-22 | 2019-01-22 | Evogene Ltd. | Methods of increasing abiotic stress tolerance, yield and/or biomass in plants |
US10260073B2 (en) | 2011-12-28 | 2019-04-16 | Evogene Ltd. | Isolated polynucleotides and polypeptides, and methods of using same for increasing yield of plants |
US10457954B2 (en) | 2010-08-30 | 2019-10-29 | Evogene Ltd. | Isolated polynucleotides and polypeptides, and methods of using same for increasing nitrogen use efficiency, yield, growth rate, vigor, biomass, oil content, and/or abiotic stress tolerance |
US10457952B2 (en) | 2010-12-22 | 2019-10-29 | Evogene Ltd. | Isolated polynucleotides and polypeptides, and methods of using same for improving plant properties |
US10533184B2 (en) | 2004-06-14 | 2020-01-14 | Evogene Ltd. | Isolated polypeptides, polynucleotides encoding same, transgenic plants expressing same and methods of using same |
US10760088B2 (en) | 2011-05-03 | 2020-09-01 | Evogene Ltd. | Isolated polynucleotides and polypeptides and methods of using same for increasing plant yield, biomass, growth rate, vigor, oil content, abiotic stress tolerance of plants and nitrogen use efficiency |
US10766935B2 (en) | 2015-12-28 | 2020-09-08 | Evogene Ltd. | Plant traits conferred by isolated polynucleotides and polypeptides |
US10858403B2 (en) | 2014-08-27 | 2020-12-08 | Evogene Ltd. | Isolated polynucleotides and polypeptides, and methods of using same for increasing plant yield and/or agricultural characteristics |
US10858665B2 (en) | 2012-08-27 | 2020-12-08 | Evogene Ltd. | Isolated polynucleotides, polypeptides and methods of using same for increasing abiotic stress tolerance, biomass and yield of plants |
US10975383B2 (en) | 2014-05-28 | 2021-04-13 | Evogene Ltd. | Isolated polynucleotides, polypeptides and methods of using same for increasing abiotic stress tolerance, biomass and yield of plants |
Families Citing this family (12)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
AU2016202095B2 (en) * | 2005-10-24 | 2017-09-28 | Evogene Ltd. | Isolated Polypeptides, Polynucleotides Encoding Same, Transgenic Plants Expressing Same and Methods of Using Same |
US9139840B2 (en) * | 2006-10-30 | 2015-09-22 | Shanghai Institutes For Biological Sciences, Chinese Academy Of Sciences | Crop grain filling gene (GIF1) and the applications thereof |
US9273322B2 (en) * | 2013-03-12 | 2016-03-01 | Pioneer Hi Bred International Inc | Root-preferred promoter and methods of use |
US9101100B1 (en) | 2014-04-30 | 2015-08-11 | Ceres, Inc. | Methods and materials for high throughput testing of transgene combinations |
CN105779478B (en) * | 2016-04-05 | 2019-02-12 | 西北农林科技大学 | Corn ZmAGA4 gene and its application |
CN106518993B (en) * | 2016-10-25 | 2019-06-28 | 武汉生物工程学院 | Application of the amino acid transport gene OsAAP3 in rice breeding |
CN106381343B (en) * | 2016-12-05 | 2019-08-09 | 中国农业科学院作物科学研究所 | One kind molecular labeling TaSnRK2.3A relevant to thousand grain weight of wheat and plant height and its application |
CN110724705A (en) * | 2019-11-19 | 2020-01-24 | 中国农业科学院作物科学研究所 | Application of wheat TaIAA21 gene in regulation and control of seed traits |
CN111593050B (en) * | 2020-05-08 | 2021-11-30 | 浙江省农业科学院 | Application of protein kinase participating in lycopene biosynthesis |
CN116496372B (en) * | 2023-04-17 | 2024-03-01 | 西南大学 | Rice OsGLP8-11 for inhibiting sclerotinia and application thereof |
CN116355067B (en) * | 2023-04-17 | 2024-02-20 | 西南大学 | Rice OsGLP8-12 for inhibiting sclerotinia and application thereof |
CN116425847B (en) * | 2023-04-17 | 2024-02-20 | 西南大学 | Rice OsGLP8-10 for inhibiting sclerotinia and application thereof |
Family Cites Families (212)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
NL154600B (en) | 1971-02-10 | 1977-09-15 | Organon Nv | METHOD FOR THE DETERMINATION AND DETERMINATION OF SPECIFIC BINDING PROTEINS AND THEIR CORRESPONDING BINDABLE SUBSTANCES. |
NL154598B (en) | 1970-11-10 | 1977-09-15 | Organon Nv | PROCEDURE FOR DETERMINING AND DETERMINING LOW MOLECULAR COMPOUNDS AND PROTEINS THAT CAN SPECIFICALLY BIND THESE COMPOUNDS AND TEST PACKAGING. |
NL154599B (en) | 1970-12-28 | 1977-09-15 | Organon Nv | PROCEDURE FOR DETERMINING AND DETERMINING SPECIFIC BINDING PROTEINS AND THEIR CORRESPONDING BINDABLE SUBSTANCES, AND TEST PACKAGING. |
US3901654A (en) | 1971-06-21 | 1975-08-26 | Biological Developments | Receptor assays of biologically active compounds employing biologically specific receptors |
US3853987A (en) | 1971-09-01 | 1974-12-10 | W Dreyer | Immunological reagent and radioimmuno assay |
US3867517A (en) | 1971-12-21 | 1975-02-18 | Abbott Lab | Direct radioimmunoassay for antigens and their antibodies |
NL171930C (en) | 1972-05-11 | 1983-06-01 | Akzo Nv | METHOD FOR DETERMINING AND DETERMINING BITES AND TEST PACKAGING. |
US3850578A (en) | 1973-03-12 | 1974-11-26 | H Mcconnell | Process for assaying for biologically active molecules |
US3935074A (en) | 1973-12-17 | 1976-01-27 | Syva Company | Antibody steric hindrance immunoassay with two antibodies |
US3996345A (en) | 1974-08-12 | 1976-12-07 | Syva Company | Fluorescence quenching with immunological pairs in immunoassays |
US4034074A (en) | 1974-09-19 | 1977-07-05 | The Board Of Trustees Of Leland Stanford Junior University | Universal reagent 2-site immunoradiometric assay using labelled anti (IgG) |
US3984533A (en) | 1975-11-13 | 1976-10-05 | General Electric Company | Electrophoretic method of detecting antigen-antibody reaction |
US4098876A (en) | 1976-10-26 | 1978-07-04 | Corning Glass Works | Reverse sandwich immunoassay |
US4879219A (en) | 1980-09-19 | 1989-11-07 | General Hospital Corporation | Immunoassay utilizing monoclonal high affinity IgM antibodies |
CA1192510A (en) | 1981-05-27 | 1985-08-27 | Lawrence E. Pelcher | Rna plant virus vector or portion thereof, a method of construction thereof, and a method of producing a gene derived product therefrom |
US5504200A (en) * | 1983-04-15 | 1996-04-02 | Mycogen Plant Science, Inc. | Plant gene expression |
JPS6054684A (en) | 1983-09-05 | 1985-03-29 | Teijin Ltd | Novel dna and hybrid dna |
US5011771A (en) | 1984-04-12 | 1991-04-30 | The General Hospital Corporation | Multiepitopic immunometric assay |
US4666828A (en) | 1984-08-15 | 1987-05-19 | The General Hospital Corporation | Test for Huntington's disease |
US4945050A (en) | 1984-11-13 | 1990-07-31 | Cornell Research Foundation, Inc. | Method for transporting substances into living cells and tissues and apparatus therefor |
US5420034A (en) * | 1986-07-31 | 1995-05-30 | Calgene, Inc. | Seed-specific transcriptional regulation |
US4943674A (en) * | 1987-05-26 | 1990-07-24 | Calgene, Inc. | Fruit specific transcriptional factors |
CA1288073C (en) | 1985-03-07 | 1991-08-27 | Paul G. Ahlquist | Rna transformation vector |
US4683202A (en) | 1985-03-28 | 1987-07-28 | Cetus Corporation | Process for amplifying nucleic acid sequences |
US4801531A (en) | 1985-04-17 | 1989-01-31 | Biotechnology Research Partners, Ltd. | Apo AI/CIII genomic polymorphisms predictive of atherosclerosis |
US5569597A (en) | 1985-05-13 | 1996-10-29 | Ciba Geigy Corp. | Methods of inserting viral DNA into plant material |
GB8608850D0 (en) | 1986-04-11 | 1986-05-14 | Diatech Ltd | Packaging system |
JPS6314693A (en) | 1986-07-04 | 1988-01-21 | Sumitomo Chem Co Ltd | Plant virus rna vector |
US5268463A (en) | 1986-11-11 | 1993-12-07 | Jefferson Richard A | Plant promoter α-glucuronidase gene construct |
US5608142A (en) | 1986-12-03 | 1997-03-04 | Agracetus, Inc. | Insecticidal cotton plants |
ES2060646T3 (en) | 1987-02-09 | 1994-12-01 | Lubrizol Genetics Inc | HYBRID RNA VIRUSES. |
US5316931A (en) | 1988-02-26 | 1994-05-31 | Biosource Genetics Corp. | Plant viral vectors having heterologous subgenomic promoters for systemic expression of foreign genes |
US5693507A (en) | 1988-09-26 | 1997-12-02 | Auburn University | Genetic engineering of plant chloroplasts |
US5495070A (en) * | 1988-10-04 | 1996-02-27 | Agracetus, Inc. | Genetically engineering cotton plants for altered fiber |
US5597718A (en) * | 1988-10-04 | 1997-01-28 | Agracetus | Genetically engineering cotton plants for altered fiber |
US5272057A (en) | 1988-10-14 | 1993-12-21 | Georgetown University | Method of detecting a predisposition to cancer by the use of restriction fragment length polymorphism of the gene for human poly (ADP-ribose) polymerase |
US5302523A (en) | 1989-06-21 | 1994-04-12 | Zeneca Limited | Transformation of plant cells |
US6329570B1 (en) | 1989-07-19 | 2001-12-11 | Calgene, Llc | Cotton modification using ovary-tissue transcriptional factors |
US5689041A (en) | 1989-08-10 | 1997-11-18 | Plant Gentic Systems N.V. | Plants modified with barstar for fertility restoration |
US5192659A (en) | 1989-08-25 | 1993-03-09 | Genetype Ag | Intron sequence analysis method for detection of adjacent and remote locus alleles as haplotypes |
US5859330A (en) * | 1989-12-12 | 1999-01-12 | Epitope, Inc. | Regulated expression of heterologous genes in plants and transgenic fruit with a modified ripening phenotype |
US5618988A (en) | 1990-03-02 | 1997-04-08 | Amoco Corporation | Enhanced carotenoid accumulation in storage organs of genetically engineered plants |
US5837848A (en) | 1990-03-16 | 1998-11-17 | Zeneca Limited | Root-specific promoter |
DE69133128T2 (en) | 1990-04-12 | 2003-06-18 | Syngenta Participations Ag | Tissue-specific promoters |
US5498830A (en) | 1990-06-18 | 1996-03-12 | Monsanto Company | Decreased oil content in plant seeds |
US5187267A (en) | 1990-06-19 | 1993-02-16 | Calgene, Inc. | Plant proteins, promoters, coding sequences and use |
IL101508A0 (en) | 1991-04-08 | 1992-12-30 | Rhone Poulenc Agrochimie | Chimeric plant genes based on upstream regulatory elements of helianthinin |
US5399680A (en) | 1991-05-22 | 1995-03-21 | The Salk Institute For Biological Studies | Rice chitinase promoter |
CA2116449C (en) | 1991-08-27 | 2005-04-05 | Vaughan Alan Hilder | Proteins with insecticidal properties against homopteran insects and their use in plant protection |
DE69233410D1 (en) | 1991-10-04 | 2004-10-21 | Univ North Carolina State | PATHOGENRESISTENT TRANSGENIC PLANTS |
UA48104C2 (en) | 1991-10-04 | 2002-08-15 | Новартіс Аг | Dna fragment including sequence that codes an insecticide protein with optimization for corn, dna fragment providing directed preferable for the stem core expression of the structural gene of the plant related to it, dna fragment providing specific for the pollen expression of related to it structural gene in the plant, recombinant dna molecule, method for obtaining a coding sequence of the insecticide protein optimized for corn, method of corn plants protection at least against one pest insect |
US5356816A (en) * | 1991-11-19 | 1994-10-18 | Board Of Trustees Operating Michigan State University | Method and compositions using polypeptides of arabidopsis thaliana |
US5281521A (en) | 1992-07-20 | 1994-01-25 | The Trustees Of The University Of Pennsylvania | Modified avidin-biotin technique |
US5639950A (en) * | 1992-09-29 | 1997-06-17 | The Ohio State University Research Foundation | Nucleotide sequence encoding for bifunctional enzyme for proline production |
US5296462A (en) * | 1992-11-19 | 1994-03-22 | Board Of Trustees Operating Michigan State University | Method and compositions using polypeptides of arabidopsis thaliana |
US5521708A (en) * | 1992-11-25 | 1996-05-28 | Canon Information & Systems, Inc. | Correlated color temperature detector |
ZA939767B (en) | 1993-01-21 | 1994-09-14 | Univ North Carolina State | Nematode-resistant transgenic plants |
JPH08509871A (en) | 1993-09-30 | 1996-10-22 | アグラシータス インコーポレイテッド | Transgenic cotton plants producing heterologous peroxidase |
US5598515A (en) * | 1994-01-10 | 1997-01-28 | Gen Tech Corp. | System and method for reconstructing surface elements of solid objects in a three-dimensional scene from a plurality of two dimensional images of the scene |
US5633363A (en) | 1994-06-03 | 1997-05-27 | Iowa State University, Research Foundation In | Root preferential promoter |
US5608144A (en) | 1994-08-12 | 1997-03-04 | Dna Plant Technology Corp. | Plant group 2 promoters and uses thereof |
US7262055B2 (en) * | 1998-08-25 | 2007-08-28 | Gendaq Limited | Regulated gene expression in plants |
US6310194B1 (en) * | 1994-09-26 | 2001-10-30 | Carnegie Institution Of Washington | Plant fatty acid hydroxylases |
US5961466A (en) * | 1995-01-03 | 1999-10-05 | Omnicorder Technologies, Inc. | Method of detection of cancerous lesions by their effect on the spatial distribution of modulation of temperature and homogeneity of tissue |
US5659026A (en) | 1995-03-24 | 1997-08-19 | Pioneer Hi-Bred International | ALS3 promoter |
CA2221747A1 (en) | 1995-06-07 | 1996-12-19 | Kevin Mcbride | Cotton fiber transcriptional factors |
JPH0967270A (en) * | 1995-08-31 | 1997-03-11 | Res Dev Corp Of Japan | Prevention and therapy for opacity of crystalline lens and medicine therefor |
US5783393A (en) | 1996-01-29 | 1998-07-21 | Agritope, Inc. | Plant tissue/stage specific promoters for regulated expression of transgenes in plants |
US6084153A (en) | 1996-02-14 | 2000-07-04 | The Governors Of The University Of Alberta | Plants having enhanced nitrogen assimilation/metabolism |
US5773697A (en) | 1996-04-23 | 1998-06-30 | Pioneer Hi-Bred International, Inc. | Genetic constructs and methods for producing fruits with very little or diminished seed |
JPH1094392A (en) | 1996-09-20 | 1998-04-14 | Nisshinbo Ind Inc | Cotton gene |
WO1998017803A1 (en) | 1996-10-24 | 1998-04-30 | Japan Tobacco Inc. | Method for controlling water content of plant |
IL119831A (en) | 1996-12-15 | 2002-12-01 | Cognitens Ltd | Apparatus and method for 3d surface geometry reconstruction |
EP0973906A1 (en) * | 1997-01-21 | 2000-01-26 | Monsanto Company | Strawberry promoters and genes |
CA2301500A1 (en) * | 1997-08-27 | 1999-03-04 | Pioneer Hi-Bred International, Inc. | Genes encoding enzymes for lignin biosynthesis and uses thereof |
US6201541B1 (en) * | 1997-12-11 | 2001-03-13 | Cognitens, Ltd. | System and method for “Stitching” a plurality of reconstructions of three-dimensional surface features of object(s) in a scene defined relative to respective coordinate systems to relate them to a common coordinate system |
RU2138156C1 (en) * | 1998-04-20 | 1999-09-27 | Институт цитологии и генетики СО РАН | Method of development of salt-resistant forms of soft wheat |
US20090093620A1 (en) * | 2000-09-05 | 2009-04-09 | David Kovalic | Annotated Plant Genes |
CA2335522A1 (en) * | 1998-06-24 | 1999-12-29 | Cornell Research Foundation, Inc. | Water stress or salt stress tolerant transgenic cereal plants |
EP1571221B1 (en) * | 1998-08-04 | 2011-10-12 | CropDesign N.V. | Genes involved in tolerance to environmental stress |
US6313375B1 (en) | 1998-08-13 | 2001-11-06 | Pioneer Hi-Bred International, Inc. | Maize aquaporins and uses thereof |
US6313376B1 (en) | 1998-08-14 | 2001-11-06 | Pioneer Hi-Bred International, Inc. | Maize aquaporins and uses thereof |
EP1115744A1 (en) | 1998-09-11 | 2001-07-18 | Agricultural Technology & Genetics GmbH | Regulatory sequences for root specific or root abundant gene expression in plants |
US6717034B2 (en) | 2001-03-30 | 2004-04-06 | Mendel Biotechnology, Inc. | Method for modifying plant biomass |
US7511190B2 (en) * | 1999-11-17 | 2009-03-31 | Mendel Biotechnology, Inc. | Polynucleotides and polypeptides in plants |
JP3178672B2 (en) | 1998-10-14 | 2001-06-25 | 農林水産省国際農林水産業研究センター所長 | Environmental stress tolerant plant |
EP1033405A3 (en) | 1999-02-25 | 2001-08-01 | Ceres Incorporated | Sequence-determined DNA fragments and corresponding polypeptides encoded thereby |
US6392122B1 (en) * | 1999-04-30 | 2002-05-21 | Agritope, Inc. | Apple promoters for expression of transgenes in plants |
US20090087878A9 (en) * | 1999-05-06 | 2009-04-02 | La Rosa Thomas J | Nucleic acid molecules associated with plants |
US20110214206A1 (en) * | 1999-05-06 | 2011-09-01 | La Rosa Thomas J | Nucleic acid molecules and other molecules associated with plants |
US20100293669A2 (en) * | 1999-05-06 | 2010-11-18 | Jingdong Liu | Nucleic Acid Molecules and Other Molecules Associated with Plants and Uses Thereof for Plant Improvement |
US20040031072A1 (en) * | 1999-05-06 | 2004-02-12 | La Rosa Thomas J. | Soy nucleic acid molecules and other molecules associated with transcription plants and uses thereof for plant improvement |
US8877916B2 (en) * | 2000-04-26 | 2014-11-04 | Ceres, Inc. | Promoter, promoter control elements, and combinations, and uses thereof |
US6563022B2 (en) * | 1999-07-05 | 2003-05-13 | Toyo Boseki Kabushiki Kaisha | Cotton plants with improved cotton fiber characteristics and method for producing cotton fibers from these cotton plants |
US7151202B1 (en) | 1999-07-19 | 2006-12-19 | Japan Science And Technology Agency | Environmental stress resistance gene |
US6472588B1 (en) | 1999-09-10 | 2002-10-29 | Texas Tech University | Transgenic cotton plants with altered fiber characteristics transformed with a sucrose phosphate synthase nucleic acid |
US6359196B1 (en) * | 1999-09-23 | 2002-03-19 | Finn Lok | Germination-specific plant promoters |
US6403862B1 (en) * | 1999-09-24 | 2002-06-11 | Pioneer Hi-Bred International, Inc. | Seed-preferred promoter from maize |
IT1313518B1 (en) * | 1999-10-22 | 2002-07-24 | Meta Instr S R L | METHODS AND EQUIPMENT FOR MEASURING THE THREE-DIMENSIONAL DISTRIBUTION OF TEMPERATURES INSIDE DIELECTRIC MEDIA. |
US6407315B1 (en) * | 1999-11-02 | 2002-06-18 | Pioneer Hi-Bred International, Inc. | Seed-preferred promoter from barley |
US6828476B1 (en) | 1999-12-02 | 2004-12-07 | The Regents Of The University Of California | Cotton transcription factors and their uses |
AU3289601A (en) | 2000-01-21 | 2001-07-31 | Pioneer Hi-Bred International, Inc. | Novel root-preferred promoter elements and methods of use |
GB2358752A (en) | 2000-01-31 | 2001-08-01 | Tricorder Technology Plc | Surface or volumetric data processing method and apparatus |
JP3807721B2 (en) * | 2000-02-21 | 2006-08-09 | シャープ株式会社 | Image synthesizer |
US6720477B2 (en) * | 2000-04-07 | 2004-04-13 | Basf Plant Science Gmbh | Signal transduction stress-related proteins and methods of use in plants |
US20110131679A2 (en) * | 2000-04-19 | 2011-06-02 | Thomas La Rosa | Rice Nucleic Acid Molecules and Other Molecules Associated with Plants and Uses Thereof for Plant Improvement |
US7834146B2 (en) | 2000-05-08 | 2010-11-16 | Monsanto Technology Llc | Recombinant polypeptides associated with plants |
US20040181830A1 (en) * | 2001-05-07 | 2004-09-16 | Kovalic David K. | Nucleic acid molecules and other molecules associated with plants and uses thereof for plant improvement |
US6701081B1 (en) * | 2000-06-06 | 2004-03-02 | Air Controls, Inc. | Dual camera mount for stereo imaging |
EP1313867A2 (en) | 2000-08-24 | 2003-05-28 | The Scripps Research Institute | Stress-regulated genes of plants, transgenic plants containing same, and methods of use |
TW519485B (en) * | 2000-09-20 | 2003-02-01 | Ind Tech Res Inst | Infrared 3D scanning system |
US20020170088A1 (en) * | 2000-11-03 | 2002-11-14 | The Regents Of The University Of California | Novel auxin binding proteins and uses thereof |
JP2002164066A (en) * | 2000-11-22 | 2002-06-07 | Mitsubishi Heavy Ind Ltd | Stacked heat exchanger |
WO2003014347A2 (en) * | 2000-12-01 | 2003-02-20 | Michigan State University | Plant seed specific promoters |
AU2036302A (en) | 2000-12-08 | 2002-06-18 | Commw Scient Ind Res Org | Modification of sucrose synthase gene expression in plant tissue and uses therefor |
US7214786B2 (en) * | 2000-12-14 | 2007-05-08 | Kovalic David K | Nucleic acid molecules and other molecules associated with plants and uses thereof for plant improvement |
US6801257B2 (en) * | 2001-01-12 | 2004-10-05 | Cognitens Ltd. | Optical three-dimensional digital imaging and mensuration system for industrial applications |
CA2441265A1 (en) * | 2001-03-16 | 2002-09-26 | Basf Plant Science Gmbh | Sugar and lipid metabolism regulators in plants |
JP4739569B2 (en) * | 2001-04-09 | 2011-08-03 | パナソニック株式会社 | Driving assistance device |
WO2002082988A2 (en) * | 2001-04-16 | 2002-10-24 | The Johns Hopkins University | Method for imaging and spectroscopy of tumors and determination of the efficacy of anti-tumor drug therapies |
EP1383900A2 (en) | 2001-05-03 | 2004-01-28 | Vlaams Interuniversitair Instituut voor Biotechnologie vzw. | Freeze-tolerant eukaryotic cells |
WO2003020025A2 (en) | 2001-08-31 | 2003-03-13 | The Dow Chemical Company | Nucleic acid compositions conferring insect control in plants |
US7038111B2 (en) * | 2001-09-06 | 2006-05-02 | The Arizona Board Of Regents | Method for increasing stress tolerance in plants |
DE10150918C2 (en) | 2001-10-18 | 2003-10-09 | Inframedic Ag | Process for the evaluation of thermal images of a female or male breast |
ATE495184T1 (en) | 2001-11-07 | 2011-01-15 | Syngenta Participations Ag | PROMOTORS FOR REGULATING GENE EXPRESSION IN PLANT ROOTS |
US20050108791A1 (en) * | 2001-12-04 | 2005-05-19 | Edgerton Michael D. | Transgenic plants with improved phenotypes |
AR037699A1 (en) | 2001-12-04 | 2004-12-01 | Monsanto Technology Llc | TRANSGENIC CORN WITH IMPROVED PHENOTYPE |
EP1572927A4 (en) | 2002-04-08 | 2007-10-17 | Pioneer Hi Bred Int | Enhanced silk exsertion under stress |
US7579517B2 (en) * | 2002-05-08 | 2009-08-25 | Basf Plant Science Gmbh | Methods for increasing oil content in plants |
US20030221218A1 (en) * | 2002-05-17 | 2003-11-27 | The Regents Of The University Of California | Bioengineering cotton fiber properties |
JP2005185101A (en) * | 2002-05-30 | 2005-07-14 | National Institute Of Agrobiological Sciences | VEGETABLE FULL-LENGTH cDNA AND UTILIZATION THEREOF |
AU2003246361B2 (en) * | 2002-07-10 | 2008-04-10 | Basf Plant Science Gmbh | Use of a gene for increasing the oil content in plants |
US7205454B2 (en) | 2002-07-31 | 2007-04-17 | Bayer Bioscience N.V. | Corn root preferential promoters and uses thereof |
WO2004053055A2 (en) | 2002-12-04 | 2004-06-24 | Monsanto Technology Llc | Transgenic maize with enhanced phenotype |
WO2004058963A2 (en) | 2002-12-31 | 2004-07-15 | University Of Delhi | A novel gene osisap1 of rice confers tolerance to stresses and a method thereof |
EP1606304A4 (en) | 2003-03-12 | 2006-09-27 | Evogene Ltd | Nucleotide sequences regulating gene expression and constructs and methods utilizing same |
EP1641930B1 (en) * | 2003-04-15 | 2011-06-29 | BASF Plant Science GmbH | Nucleic acid sequences encoding proteins associated with abiotic stress response and plant cells and plants with increased tolerance to environmental stress |
DE602004013569D1 (en) * | 2003-04-16 | 2008-06-19 | Basf Plant Science Gmbh | N PLANTS |
MXPA05012565A (en) | 2003-05-22 | 2006-05-25 | Evogene Ltd | Methods of increasing abiotic stress tolerance and/or biomass in plants and plants generated thereby. |
AU2005234725B2 (en) * | 2003-05-22 | 2012-02-23 | Evogene Ltd. | Methods of Increasing Abiotic Stress Tolerance and/or Biomass in Plants and Plants Generated Thereby |
US7554007B2 (en) * | 2003-05-22 | 2009-06-30 | Evogene Ltd. | Methods of increasing abiotic stress tolerance and/or biomass in plants |
JP3819377B2 (en) | 2003-06-18 | 2006-09-06 | 株式会社東芝 | Method for analyzing electrostatic discharge of semiconductor integrated circuit |
WO2004111183A2 (en) | 2003-06-19 | 2004-12-23 | Evogene Ltd. | Plant trichome-specific promoter and leucoplast signal sequence |
JP4452876B2 (en) | 2003-08-06 | 2010-04-21 | 国立大学法人 香川大学 | Control of seed yield and dry weight of plants by gene transfer using LKP2 partial cDNA |
US7663027B2 (en) * | 2004-12-08 | 2010-02-16 | Ceres, Inc. | Nucleotide sequences and corresponding polypeptides conferring modulated plant size and biomass in plants |
US7803983B2 (en) * | 2004-06-30 | 2010-09-28 | Ceres, Inc. | Nucleotide sequences and corresponding polypeptides conferring modulated plant growth rate and biomass in plants |
US7884261B2 (en) * | 2004-06-30 | 2011-02-08 | CERES,Inc. | Nucleotide sequences and corresponding polypeptides conferring modulated plant growth rate and biomass in plants |
US7989676B2 (en) * | 2006-08-31 | 2011-08-02 | Ceres, Inc. | Nucleotide sequences and corresponding polypeptides conferring modulated plant characteristics |
US20060143729A1 (en) * | 2004-06-30 | 2006-06-29 | Ceres, Inc. | Nucleotide sequences and polypeptides encoded thereby useful for modifying plant characteristics |
US20060048240A1 (en) * | 2004-04-01 | 2006-03-02 | Nickolai Alexandrov | Sequence-determined DNA fragments and corresponding polypeptides encoded thereby |
US20060150283A1 (en) * | 2004-02-13 | 2006-07-06 | Nickolai Alexandrov | Sequence-determined DNA fragments and corresponding polypeptides encoded thereby |
US20060107345A1 (en) * | 2003-09-30 | 2006-05-18 | Nickolai Alexandrov | Sequence-determined DNA fragments and corresponding polypeptides encoded thereby |
US7411112B2 (en) | 2003-10-09 | 2008-08-12 | Pioneer Hi-Bred International, Inc. | Maize promoter named CRWAQ81 |
EP2302062A1 (en) | 2003-10-20 | 2011-03-30 | CropDesign N.V. | Identification of E2F target genes and uses thereof |
US20050096515A1 (en) * | 2003-10-23 | 2005-05-05 | Geng Z. J. | Three-dimensional surface image guided adaptive therapy system |
WO2005084331A2 (en) | 2004-03-01 | 2005-09-15 | Syngenta Participations Ag | Sorghum gene expression profiling |
AU2005229157B2 (en) | 2004-03-31 | 2011-07-21 | Commonwealth Scientific And Industrial Research Organisation | Genes involved in plant fibre development |
US8049069B2 (en) | 2004-03-31 | 2011-11-01 | Commonwealth Scientific And Industrial Research Organisation | Genes involved in plant fibre development |
ATE503840T1 (en) * | 2004-04-23 | 2011-04-15 | Ceres Inc | NUCLEOTIDE SEQUENCES AND POLYPEPTIDES ENCODED THEREOF FOR ALTERING PERFORMANCE CHARACTERISTICS OF NITROGEN USE IN PLANTS |
WO2005108422A2 (en) | 2004-05-05 | 2005-11-17 | The Royal Veterinary And Agricultural University | Ammonium/ammonia transporter |
EP1766058A4 (en) * | 2004-06-14 | 2008-05-21 | Evogene Ltd | Polynucleotides and polypeptides involved in plant fiber development and methods of using same |
CN101040288A (en) | 2004-07-07 | 2007-09-19 | 真实成像有限公司 | 3d thermal breast cancer detector |
EP1789561B1 (en) | 2004-07-16 | 2010-01-06 | CropDesign N.V. | Plants having improved growth characteristics and method for making the same |
MX2007004884A (en) | 2004-10-22 | 2007-06-22 | Agrinomics Llc | Generation of plants with altered oil content. |
US20080148432A1 (en) * | 2005-12-21 | 2008-06-19 | Mark Scott Abad | Transgenic plants with enhanced agronomic traits |
AU2005319354B2 (en) * | 2004-12-21 | 2012-08-30 | Monsanto Technology, Llc | Transgenic plants with enhanced agronomic traits |
EP1681128A1 (en) * | 2005-01-14 | 2006-07-19 | Siemens Aktiengesellschaft | Method and device for producing a hole |
EP1882392A4 (en) * | 2005-05-10 | 2009-07-01 | Monsanto Technology Llc | Genes and uses for plant improvement |
CN101442903A (en) | 2005-05-26 | 2009-05-27 | 孟山都技术有限公司 | Elevation of oil in monocot plants |
WO2006138012A1 (en) | 2005-06-17 | 2006-12-28 | Ceres Inc. | P450 substrates and methods related thereto |
WO2007027866A2 (en) | 2005-08-30 | 2007-03-08 | Monsanto Technology Llc | Transgenic plants with enhanced agronomic traits |
CA2626592C (en) | 2005-10-24 | 2018-07-17 | Evogene Ltd. | Methods of increasing abiotic stress tolerance and fertilizer use efficiency of a plant |
BRPI0706526A2 (en) * | 2006-01-13 | 2011-03-29 | Ceres Inc | nucleotide sequences and corresponding polypeptides that confer improved nitrogen efficiency in plants |
US20090172834A1 (en) | 2006-03-24 | 2009-07-02 | Basf Plant Science Gmbh | Proteins Associated With Abiotic Stress Response And Homologs |
WO2007113237A2 (en) | 2006-03-31 | 2007-10-11 | Basf Plant Science Gmbh | Plants having enhanced yield-related traits and a method for making the same |
US8362322B2 (en) | 2006-10-27 | 2013-01-29 | Ceres, Inc. | Modulating lignin in plants |
CA2672756C (en) * | 2006-12-20 | 2018-11-20 | Evogene Ltd. | Polynucleotides and polypeptides involved in plant fiber development and methods of using same |
MX341624B (en) * | 2007-04-09 | 2016-08-26 | Evogene Ltd | Polynucleotides, polypeptides and methods for increasing oil content, growth rate and biomass of plants. |
EP2380988A3 (en) | 2007-07-10 | 2012-04-11 | Mosanto Technology LLC | Transgenic plants with enhanced agronomic traits |
ES2547305T3 (en) | 2007-07-24 | 2015-10-05 | Evogene Ltd. | Polynucleotides, polypeptides encoded by them, and methods of using them to increase tolerance to abiotic stress and / or biomass and / or yield in plants that express them |
US8362325B2 (en) * | 2007-10-03 | 2013-01-29 | Ceres, Inc. | Nucleotide sequences and corresponding polypeptides conferring modulated plant characteristics |
MX357387B (en) | 2007-12-27 | 2018-07-06 | Evogene Ltd | Isolated polypeptides, polynucleotides useful for modifying water user efficiency, fertilizer use efficiency, biotic/abiotic stress tolerance, yield and biomass in plants. |
CN107007267A (en) | 2007-12-31 | 2017-08-04 | 真实成像有限公司 | Method, apparatus and system for analyzing thermal image |
EP2231011A1 (en) | 2007-12-31 | 2010-09-29 | Real Imaging Ltd. | System and method for registration of imaging data |
US10299686B2 (en) | 2008-03-28 | 2019-05-28 | Real Imaging Ltd. | Method apparatus and system for analyzing images |
MX2010012697A (en) | 2008-05-22 | 2011-03-15 | Evogene Ltd | Isolated polynucleotides and polypeptides and methods of using same for increasing plant utility. |
EP2297336A1 (en) | 2008-05-29 | 2011-03-23 | Vib Vzw | Minichromosome maintenance complex interacting protein involved in cancer |
MX2011001741A (en) | 2008-08-18 | 2011-03-29 | Evogene Ltd | Isolated polypeptides and polynucleotides useful for increasing nitrogen use efficiency, abiotic stress tolerance, yield and biomass in plants. |
BRPI0914522B1 (en) | 2008-10-30 | 2019-04-02 | Evogene Ltd | METHOD FOR INCREASING YIELD, BIOMASS, GROWTH RATE, STRENGTH, OIL OTEOR, AND / OR EFFICIENCY OF NITROGEN USE OF A PLANT |
CA2744827C (en) | 2008-12-29 | 2019-10-15 | Evogene Ltd. | Polynucleotides, polypeptides encoded thereby, and methods of using same for increasing abiotic stress tolerance, biomass and/or yield in plants expressing same |
AR075773A1 (en) | 2009-03-02 | 2011-04-27 | Evogene Ltd | ISOLATED POLYETHYLES AND POLYUCLEOTIDES AND METHODS FOR USE IN INCREASING PLANT PERFORMANCE AND AGRICULTURAL CHARACTERISTICS |
MX363447B (en) | 2009-06-10 | 2019-03-22 | Evogene Ltd | Isolated polynucleotides and polypeptides, and methods of using same for increasing nitrogen use efficiency, yield, growth rate, vigor, biomass, oil content, and/or abiotic stress tolerance. |
BR112012002543B1 (en) | 2009-08-04 | 2021-03-09 | Evogene Ltd. | method to increase tolerance to abiotic stress, yield, biomass, growth rate, and / or vigor of a plant, and isolated nucleic acid construct |
US20110080674A1 (en) * | 2009-10-02 | 2011-04-07 | Joel Durand | Magnetic azimuth adjustment for tonearm |
US9493785B2 (en) | 2009-12-28 | 2016-11-15 | Evogene Ltd. | Isolated polynucleotides and polypeptides and methods of using same for increasing plant yield, biomass, growth rate, vigor, oil content, abiotic stress tolerance of plants and nitrogen use efficiency |
BR122021002340B1 (en) | 2010-04-28 | 2022-04-05 | Evogene Ltd | Method of increasing a plant's biomass, growth rate and/or nitrogen use efficiency |
MX365161B (en) | 2010-08-30 | 2019-05-24 | Evogene Ltd | Isolated polynucleotides and polypeptides, and methods of using same for increasing nitrogen use efficiency, yield, growth rate, vigor, biomass, oil content, and/or abiotic stress tolerance. |
US9551006B2 (en) | 2010-12-22 | 2017-01-24 | Evogene Ltd. | Isolated polynucleotides and polypeptides, and methods of using same for improving plant properties |
CA3137663A1 (en) | 2011-05-03 | 2012-11-08 | Evogene Ltd. | Isolated polynucleotides and polypeptides and methods of using same for increasing plant yield, biomass, growth rate, vigor, oil content, abiotic stress tolerance of plants and nitrogen use efficiency |
BR112014004130A8 (en) | 2011-08-23 | 2022-05-17 | Evogene Ltd | Isolated polynucleotides and polypeptides and methods of using them to increase plant production and/or agricultural characteristics |
CN104254242A (en) | 2011-11-21 | 2014-12-31 | 先正达参股股份有限公司 | Compositions and methods for increasing nematode resistance in plants |
BR122019023055B1 (en) | 2011-11-28 | 2021-03-30 | Evogene Ltd | METHOD FOR INCREASING EFFICIENCY IN THE USE OF NITROGEN, PRODUCTION, BIOMASS, GROWTH RATE, VIGOR, AND / OR TOLERANCE TO THE ABIOTIC STRESS OF A PLANT, AND, ISOLATED NUCLEIC ACID CONSTRUCTION |
BR112014016080A2 (en) | 2011-12-28 | 2020-06-30 | Evogene Ltd., | isolated polynucleotides and polypeptides and methods of using them to increase plant production |
AR091312A1 (en) | 2012-02-29 | 2015-01-28 | Evogene Ltd | POLINUCLEOTIDES AND ISOLATED POLYPEPTIDES AND METHODS TO USE THEM TO IMPROVE THE PERFORMANCE OF THE PLANT, BIOMASS, GROWTH RATE, VIGOR, OIL CONTENT, TOLERANCE TO THE ABIOTIC STRESS OF THE PLANTS AND EFFECTIVENESS IN THE USE OF THE PLANTS |
BR122021002085B1 (en) | 2012-05-28 | 2022-08-09 | Evogene Ltd | METHOD TO INCREASE PRODUCTION, GROWTH RATE, BIOMASS, VIGOR, SEED PRODUCTION, AND/OR EFFICIENCY IN THE USE OF NITROGEN OF A PLANT |
BR122019028110B1 (en) | 2012-08-27 | 2022-07-12 | Evogene Ltd | METHOD TO INCREASE YIELD, GROWTH RATE, BIOMASS, VIGOR, SEED YIELD, PHOTOSYNTHETIC CAPACITY, NITROGEN USE EFFICIENCY, AND/OR TOLERANCE TO ABIOTIC STRESS OF A PLANT, METHOD FOR PRODUCING A HARVEST, NUCLEIC ACID CONSTRUCTION, AND , METHOD OF CULTIVATING A CULTURE |
MX355797B (en) | 2012-12-25 | 2018-04-30 | Evogene Ltd | Isolated polynucleotides and polypeptides, and methods of using same for increasing nitrogen use efficiency of plants. |
BR122020005652B1 (en) | 2012-12-26 | 2022-05-17 | Evogene Ltd | Method to increase nitrogen use efficiency, yield, growth rate, biomass, vigor, seed yield, photosynthetic capacity and/or tolerance to abiotic stress of a plant, and, nucleic acid construction |
CA2910097A1 (en) | 2013-05-22 | 2014-11-27 | Evogene Ltd. | Isolated polynucleotides and polypeptides, and methods of using same for increasing plant yield and/or agricultural characteristics |
CA2916060A1 (en) | 2013-08-27 | 2015-03-05 | Evogene Ltd. | Isolated polynucleotides and polypeptides, and methods of using same for increasing plant yield and/or agricultural characteristics |
WO2015181823A1 (en) | 2014-05-28 | 2015-12-03 | Evogene Ltd. | Isolated polynucleotides, polypeptides and methods of using same for increasing abiotic stress tolerance, biomass and yield of plants |
CA3176207A1 (en) | 2014-08-27 | 2016-03-03 | Evogene Ltd. | Constructs and methods for increasing plant yield or agricultural characteristics or both |
-
2006
- 2006-10-24 CA CA2626592A patent/CA2626592C/en active Active
- 2006-10-24 MX MX2012012072A patent/MX338183B/en unknown
- 2006-10-24 EP EP20110190921 patent/EP2716654A1/en not_active Withdrawn
- 2006-10-24 EP EP06809784A patent/EP1940217A4/en not_active Withdrawn
- 2006-10-24 AU AU2006307457A patent/AU2006307457B2/en active Active
- 2006-10-24 BR BRPI0618965-2A patent/BRPI0618965B1/en active IP Right Grant
- 2006-10-24 WO PCT/IL2006/001223 patent/WO2007049275A2/en active Application Filing
- 2006-10-24 MX MX2015010270A patent/MX350551B/en unknown
- 2006-10-24 CN CNA2006800476100A patent/CN101505587A/en active Pending
- 2006-10-24 RU RU2008120395A patent/RU2425151C2/en active
- 2006-10-24 RU RU2011113420/10A patent/RU2487166C2/en active
- 2006-10-24 US US12/083,978 patent/US8962915B2/en active Active
-
2008
- 2008-05-09 ZA ZA200803989A patent/ZA200803989B/en unknown
-
2011
- 2011-04-07 RU RU2011113422/10A patent/RU2011113422A/en not_active Application Discontinuation
-
2015
- 2015-01-05 US US14/589,020 patent/US10533184B2/en not_active Expired - Fee Related
Non-Patent Citations (1)
Title |
---|
See references of EP1940217A4 * |
Cited By (129)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US8058515B2 (en) | 1999-11-10 | 2011-11-15 | University Of Connecticut | Plant cells and plants overexpressing vacuolar proton pyrophosphatases |
US8697950B2 (en) | 1999-11-10 | 2014-04-15 | University Of Connecticut | Vacuolar pyrophosphatases and uses in plants |
US8003852B2 (en) | 1999-11-10 | 2011-08-23 | University Of Connecticut | Transgenic plants overexpressing a plant vacuolar pyrophosphatase |
US7534933B2 (en) | 2000-08-18 | 2009-05-19 | University Of Connecticut | Transgenic plants overexpressing a plant vacuolar H + -ATPase |
US8168864B2 (en) | 2000-08-18 | 2012-05-01 | Beth Israel Deaconess Medical Center | Transgenic pollen expressing exogenous plant vacuolar pyrophosphatase and methods for increasing seed production in plants |
US10184132B2 (en) | 2003-05-22 | 2019-01-22 | Evogene Ltd. | Methods of increasing abiotic stress tolerance, yield and/or biomass in plants |
US10774339B2 (en) | 2004-06-14 | 2020-09-15 | Evogene Ltd. | Polynucleotides and polypeptides involved in plant fiber development and methods of using same |
US9834781B2 (en) | 2004-06-14 | 2017-12-05 | Evogene Ltd. | Polynucleotides and polypeptides involved in plant fiber development and methods of using same |
US10533184B2 (en) | 2004-06-14 | 2020-01-14 | Evogene Ltd. | Isolated polypeptides, polynucleotides encoding same, transgenic plants expressing same and methods of using same |
US10829777B2 (en) | 2005-08-15 | 2020-11-10 | Evogene Ltd. | Methods of increasing abiotic stress tolerance and/or biomass in plants and plants generated thereby |
US7910800B2 (en) | 2005-08-15 | 2011-03-22 | Evogene Ltd. | Methods of increasing abiotic stress tolerance and/or biomass in plants and plants generated thereby |
US10214749B2 (en) | 2005-08-15 | 2019-02-26 | Evogene Ltd. | Methods of increasing abiotic stress tolerance and/or biomass in plants and plants generated thereby |
US10844393B2 (en) | 2006-12-20 | 2020-11-24 | Evogene Ltd. | Polynucleotides and polypeptides involved in plant fiber development and methods of using same |
US9631000B2 (en) | 2006-12-20 | 2017-04-25 | Evogene Ltd. | Polynucleotides and polypeptides involved in plant fiber development and methods of using same |
US10036031B2 (en) | 2007-04-09 | 2018-07-31 | Evogene Ltd. | Polynucleotides, polypeptides and methods for increasing oil content, growth rate and biomass of plants |
US10961544B2 (en) | 2007-07-24 | 2021-03-30 | Evogene Ltd. | Polynucleotides, polypeptides encoded thereby, and methods of using same for increasing abiotic stress tolerance and/or biomass and/or yield in plants expressing same |
WO2009013750A2 (en) | 2007-07-24 | 2009-01-29 | Evogene Ltd. | Polynucleotides, polypeptides encoded thereby, and methods of using same for increasing abiotic stress tolerance and/or biomass and/or yield in plants expressing same |
US10995341B2 (en) | 2007-07-24 | 2021-05-04 | Evogene Ltd. | Polynucleotides, polypeptides encoded thereby, and methods of using same for increasing abiotic stress tolerance and/or biomass and/or yield in plants expressing same |
US10155957B2 (en) | 2007-07-24 | 2018-12-18 | Evogene Ltd. | Polynucleotides, polypeptides encoded thereby, and methods of using same for increasing abiotic stress tolerance and/or biomass and/or yield in plants expressing same |
EP2910638A2 (en) | 2007-07-24 | 2015-08-26 | Evogene Ltd. | Polynucleotides, polypeptides encoded thereby, and methods of using same for increasing abiotic stress tolerance and/or biomass and/or yield in plants expressing same |
WO2009020528A1 (en) * | 2007-08-07 | 2009-02-12 | University Of Connecticut | Vacuolar pyrophosphatases and uses in plants |
US10407690B2 (en) | 2007-12-27 | 2019-09-10 | Evogene Ltd. | Isolated polypeptides, polynucleotides useful for modifying water user efficiency, fertilizer use efficiency, biotic/abiotic stress tolerance, yield and biomass in plants |
US9670501B2 (en) | 2007-12-27 | 2017-06-06 | Evogene Ltd. | Isolated polypeptides, polynucleotides useful for modifying water user efficiency, fertilizer use efficiency, biotic/abiotic stress tolerance, yield and biomass in plants |
US11946060B2 (en) | 2008-02-15 | 2024-04-02 | Ceres, Inc. | Drought and heat tolerance in plants |
EP2255003A2 (en) * | 2008-02-15 | 2010-12-01 | Ceres Inc. | Drought and heat tolerance in plants |
EP2255003B1 (en) * | 2008-02-15 | 2015-01-28 | Ceres Inc. | Drought and heat tolerance in plants |
US10604766B2 (en) | 2008-02-15 | 2020-03-31 | Ceres, Inc. | Drought and heat tolerance in plants |
US11530417B2 (en) | 2008-02-15 | 2022-12-20 | Ceres, Inc. | Drought and heat tolerance in plants |
US11578337B2 (en) | 2008-02-15 | 2023-02-14 | Ceres, Inc. | Drought and heat tolerance in plants |
US8669108B2 (en) | 2008-04-03 | 2014-03-11 | Vialactia Biosciences (Nz) Limited | Gene expression control in plants |
US10100326B2 (en) | 2008-05-22 | 2018-10-16 | Evogene Ltd. | Isolated polynucleotides and polypeptides and methods of using same for increasing plant utility |
US9714430B2 (en) | 2008-05-22 | 2017-07-25 | Evogene Ltd. | Isolated polynucleotides and polypeptides and methods of using same for increasing plant utility |
US10900048B2 (en) | 2008-05-22 | 2021-01-26 | Evogene Ltd. | Isolated polynucleotides and polypeptides and methods of using same for increasing plant utility |
US9051578B2 (en) | 2008-05-28 | 2015-06-09 | Insight Genomics Limited | Methods and compositions for plant improvement |
WO2009148330A1 (en) * | 2008-06-03 | 2009-12-10 | Vialactia Biosciences (Nz) Limited | Compositions and methods for improving plants |
AU2009255855B2 (en) * | 2008-06-03 | 2014-02-27 | Insight Genomics Limited | Compositions and methods for improving plants |
US10829776B2 (en) | 2008-08-18 | 2020-11-10 | Evogene Ltd. | Use of MFS transporters for increasing biomass, growth rate, nitrogen use efficiency and low nitrogen tolerance in plants |
EP3616504A2 (en) | 2008-08-18 | 2020-03-04 | Evogene Ltd. | Isolated polypeptides and polynucleotides useful for increasing nitrogen use efficiency, abiotic stress tolerance, yield and biomass in plants |
US9783818B2 (en) | 2008-08-18 | 2017-10-10 | Evogene Ltd. | Use of ADP/ATP transporter genes to increase nitrogen use efficiency and low nitrogen tolerance to a plant |
US10208316B2 (en) | 2008-08-18 | 2019-02-19 | Evogene Ltd. | Use of UMP-CMP kinases for increasing nitrogen use efficiency and low nitrogen tolerance in plants |
EP3072972A2 (en) | 2008-08-18 | 2016-09-28 | Evogene Ltd. | Isolated polypeptides and polynucleotides useful for increasing nitrogen use efficiency, abiotic stress tolerance, yield and biomass in plants |
US11453887B2 (en) | 2008-08-18 | 2022-09-27 | Evogene Ltd. | Isolated polypeptides and polynucleotides useful for increasing nitrogen use efficiency, abiotic stress tolerance, yield and biomass in plants |
US9745595B2 (en) | 2008-10-30 | 2017-08-29 | Evogene Ltd. | Methods of increasing biomass and/or growth rate of a plant under non-stress conditions |
US10793870B2 (en) | 2008-10-30 | 2020-10-06 | Evogene Ltd. | Methods of increasing biomass and/or growth rate of a plant under non-stress conditions |
US8901376B2 (en) | 2008-12-01 | 2014-12-02 | Vialactia Biosciences (Nz) Limited | Methods and compositions for the improvement of plant tolerance to environmental stresses |
CN102300991A (en) * | 2008-12-03 | 2011-12-28 | 巴斯夫植物科学有限公司 | Plants Having Enhanced Abiotic Stress Tolerance And/or Enhanced Yield-related Traits And A Method For Making The Same |
WO2010063637A1 (en) * | 2008-12-03 | 2010-06-10 | Basf Plant Science Gmbh | Plants having enhanced abiotic stress tolerance and/or enhanced yield-related traits and a method for making the same |
EP2527451A1 (en) * | 2008-12-10 | 2012-11-28 | Vib Vzm | Screening method for identifying genes involved in plant cell cycle |
US10975382B2 (en) | 2008-12-29 | 2021-04-13 | Evogene Ltd. | Polynucleotides, polypeptides encoded thereby, and methods of using same for increasing abiotic stress tolerance, biomass and/or yield in plants expressing same |
US8952218B2 (en) | 2008-12-29 | 2015-02-10 | Evogene Ltd. | Polynucleotides, polypeptides encoded thereby, and methods of using same for increasing abiotic stress tolerance, biomass and/or yield in plants expressing same |
WO2010076756A2 (en) | 2008-12-29 | 2010-07-08 | Evogene Ltd. | Polynucleotides, polypeptides encoded thereby, and methods of using same for increasing abiotic stress tolerance, biomass and/or yield in plants expressing same |
EP3000889A2 (en) | 2009-03-02 | 2016-03-30 | Evogene Ltd. | Isolated polynucleotides and polypeptides, and methods of using same for increasing plant yield and/or agricultural characteristics |
US10597671B2 (en) | 2009-03-02 | 2020-03-24 | Evogene Ltd. | Isolated polynucleotides and polypeptides, and methods of using same for increasing plant yield, biomass, oil content and/or growth rate |
US9487795B2 (en) | 2009-03-02 | 2016-11-08 | Evogene Ltd. | Isolated polynucleotides and polypeptides, and methods of using same for increasing plant yield, biomass, oil content and/or growth rate |
WO2010100595A2 (en) | 2009-03-02 | 2010-09-10 | Evogene Ltd. | Isolated polynucleotides and polypeptides, and methods of using same for increasing plant yield and/or agricultural characteristics |
US8921538B2 (en) | 2009-04-01 | 2014-12-30 | Vialactia Biosciences (Nz) Limited | Control of gene expression in plants |
US10791690B2 (en) | 2009-06-10 | 2020-10-06 | Evogene Ltd. | Isolated polynucleotides and polypeptides, and methods of using same for increasing nitrogen use efficiency, yield, growth rate, vigor, biomass, oil content, and/or abiotic stress tolerance |
US11286495B2 (en) | 2009-06-10 | 2022-03-29 | Evogene Ltd. | Isolated polynucleotides and polypeptides, and methods of using same for increasing nitrogen use efficiency, yield, growth rate, vigor, biomass, oil content, and/or abiotic stress tolerance |
EP3238534A2 (en) | 2009-06-10 | 2017-11-01 | Evogene Ltd. | Isolated polynucleotides and polypeptides, and methods of using same for increasing nitrogen use efficiency, yield, growth rate, vigor, biomass, oil content, and/or abiotic stress tolerance |
EP3626051A2 (en) | 2009-06-10 | 2020-03-25 | Evogene Ltd. | Isolated polynucleotides and polypeptides, and methods of using same for increasing nitrogen use efficiency, yield, growth rate, vigor, biomass, oil content, and/or abiotic stress tolerance |
US10006040B2 (en) | 2009-06-10 | 2018-06-26 | Evogene Ltd. | Isolated polynucleotides and polypeptides, and methods of using same for increasing nitrogen use efficiency, yield, growth rate, vigor, biomass, oil content, and/or abiotic stress tolerance |
US8937215B2 (en) | 2009-08-04 | 2015-01-20 | Evogene Ltd. | Polynucleotides and polypeptides for increasing desirable plant qualities |
US10883115B2 (en) | 2009-08-04 | 2021-01-05 | Evogene Ltd. | Protein kinase polynucleotides and polypeptides for increasing abiotic stress tolerance, yield, biomass, growth rate, and/or vigor in a plant |
US11530418B2 (en) | 2009-08-04 | 2022-12-20 | Evogene Ltd. | Polynucleotides and polypeptides for increasing desirable plant qualities |
US9574200B2 (en) | 2009-08-04 | 2017-02-21 | Evogene Ltd. | Polynucleotides and polypeptides for increasing desirable plant qualities |
US10227607B2 (en) | 2009-08-04 | 2019-03-12 | Evogene Ltd. | MADS-box polynucleotides and polypeptides for increasing abiotic stress tolerance, yield, biomass, growth rate, and/or vigor in a plant |
US10351873B2 (en) | 2009-12-28 | 2019-07-16 | Evogene Ltd. | Isolated polynucleotides and polypeptides and methods of using same for increasing plant yield, biomass, growth rate, vigor, oil content, abiotic stress tolerance of plants and nitrogen use efficiency |
WO2011080674A2 (en) | 2009-12-28 | 2011-07-07 | Evogene Ltd. | Isolated polynucleotides and polypeptides and methods of using same for increasing plant yield, biomass, growth rate, vigor, oil content, abiotic stress tolerance of plants and nitrogen use efficiency |
EP3056569A2 (en) | 2009-12-28 | 2016-08-17 | Evogene Ltd. | Isolated polynucleotides and polypeptides and methods of using same for increasing plant yield, biomass, growth rate, vigor, oil content, abiotic stress tolerance of plants and nitrogen use efficiency |
US10982224B2 (en) | 2009-12-28 | 2021-04-20 | Evogene Ltd. | Isolated polynucleotides and polypeptides and methods of using same for increasing plant yield, biomass, growth rate, vigor, oil content, abiotic stress tolerance of plants and nitrogen use efficiency |
US11542522B2 (en) | 2010-04-28 | 2023-01-03 | Evogene Ltd. | Isolated polynucleotides and polypeptides for increasing plant yield and/or agricultural characteristics |
WO2011135527A2 (en) | 2010-04-28 | 2011-11-03 | Evogene Ltd. | Isolated polynucleotides and polypeptides, and methods of using same for increasing plant yield and/or agricultural characteristics |
US10689662B2 (en) | 2010-04-28 | 2020-06-23 | Evogene Ltd. | Isolated polynucleotides and polypeptides for increasing plant yield and/or agricultural characteristics |
US10457954B2 (en) | 2010-08-30 | 2019-10-29 | Evogene Ltd. | Isolated polynucleotides and polypeptides, and methods of using same for increasing nitrogen use efficiency, yield, growth rate, vigor, biomass, oil content, and/or abiotic stress tolerance |
US11130957B2 (en) | 2010-08-30 | 2021-09-28 | Evogene Ltd. | Isolated polynucleotides and polypeptides, and methods of using same for increasing nitrogen use efficiency, yield, growth rate, vigor, biomass, oil content, and/or abiotic stress tolerance |
WO2012049661A1 (en) * | 2010-10-15 | 2012-04-19 | Genoplante-Valor | Production of plants with improved tolerance to water deficit |
FR2966162A1 (en) * | 2010-10-15 | 2012-04-20 | Genoplante Valor | OBTAINING PLANTS HAVING IMPROVED TOLERANCE TO A WATER DEFICIT |
US9447427B2 (en) | 2010-10-15 | 2016-09-20 | Genoplante-Valor | Production of FatA TE-overexpressing plants with improved tolerance to water deficit |
US10457952B2 (en) | 2010-12-22 | 2019-10-29 | Evogene Ltd. | Isolated polynucleotides and polypeptides, and methods of using same for improving plant properties |
US10760088B2 (en) | 2011-05-03 | 2020-09-01 | Evogene Ltd. | Isolated polynucleotides and polypeptides and methods of using same for increasing plant yield, biomass, growth rate, vigor, oil content, abiotic stress tolerance of plants and nitrogen use efficiency |
US11111499B2 (en) | 2011-05-03 | 2021-09-07 | Evogene Ltd. | Isolated polynucleotides and polypeptides and methods of using same for increasing plant yield, biomass, growth rate, vigor, oil content, abiotic stress tolerance of plants and nitrogen use efficiency |
US11293032B2 (en) | 2011-08-23 | 2022-04-05 | Evogene Ltd. | Isolated polynucleotides and polypeptides, and methods of using same for increasing plant yield and/or agricultural characteristics |
US10501750B2 (en) | 2011-08-23 | 2019-12-10 | Evogene Ltd. | Isolated polynucleotides and polypeptides, and methods of using same for increasing plant yield and/or agricultural characteristics |
US9976157B2 (en) | 2011-08-23 | 2018-05-22 | Evogene Ltd. | Isolated polynucleotides and polypeptides, and methods of using same for increasing plant yield and/or agricultural characteristics |
US10900052B2 (en) | 2011-11-21 | 2021-01-26 | Syngenta Participations Ag | Compositions and methods for increasing nematode resistance in plants |
US10000768B2 (en) | 2011-11-21 | 2018-06-19 | Syngenta Participations Ag | Compositions and methods for increasing nematode resistance in plants |
US10113176B2 (en) | 2011-11-28 | 2018-10-30 | Evogene Ltd. | Isolated polynucleotides and polypeptides, and methods of using same for increasing nitrogen use efficiency, yield, growth rate, vigor, biomass, oil content, and/or abiotic stress tolerance |
US11078492B2 (en) | 2011-11-28 | 2021-08-03 | Evogene Ltd. | Isolated polynucleotides and polypeptides, and methods of using same for increasing nitrogen use efficiency, yield, growth rate, vigor, biomass, oil content, and/or abiotic stress tolerance |
US11242538B2 (en) | 2011-12-28 | 2022-02-08 | Evogene Ltd. | Isolated polynucleotides and polypeptides, and methods of using same for increasing yield of plants |
US10260073B2 (en) | 2011-12-28 | 2019-04-16 | Evogene Ltd. | Isolated polynucleotides and polypeptides, and methods of using same for increasing yield of plants |
US10253327B2 (en) | 2012-02-29 | 2019-04-09 | Evogene Ltd. | Isolated polynucleotides and polypeptides and methods of using same for increasing plant yield, biomass, growth rate, vigor, oil content, abiotic stress tolerance of plants and nitrogen use efficiency |
US10815492B2 (en) | 2012-02-29 | 2020-10-27 | Evogene Ltd. | Isolated polynucleotides and polypeptides and methods of using same for increasing plant yield, biomass, growth rate, vigor, oil content, abiotic stress tolerance of plants and nitrogen use efficiency |
US9920330B2 (en) | 2012-02-29 | 2018-03-20 | Evogene Ltd. | Isolated polynucleotides and polypeptides and methods of using same for increasing plant yield, biomass, growth rate, vigor, oil content, abiotic stress tolerance of plants and nitrogen use efficiency |
US11365421B2 (en) | 2012-02-29 | 2022-06-21 | Evogene Ltd. | Isolated polynucleotides and polypeptides and methods of using same for increasing plant yield, biomass, growth rate, vigor, oil content, abiotic stress tolerance of plants and nitrogen use efficiency |
US11326179B2 (en) | 2012-02-29 | 2022-05-10 | Evogene Ltd. | Isolated polynucleotides and polypeptides and methods of using same for increasing plant yield, biomass, growth rate, vigor, oil content, abiotic stress tolerance of plants and nitrogen use efficiency |
US9834782B2 (en) | 2012-05-28 | 2017-12-05 | Evogene Ltd. | Isolated polynucleotides and polypeptides, and methods of using same for increasing plant yield and/or agricultural characteristics |
US10982222B2 (en) | 2012-05-28 | 2021-04-20 | Evogene Ltd. | Isolated polynucleotides and polypeptides, and methods of using same for increasing plant yield and/or agricultural characteristics |
US11512323B2 (en) | 2012-08-27 | 2022-11-29 | Evogene Ltd. | Isolated polynucleotides, polypeptides and methods of using same for increasing abiotic stress tolerance, biomass and yield of plants |
US10858665B2 (en) | 2012-08-27 | 2020-12-08 | Evogene Ltd. | Isolated polynucleotides, polypeptides and methods of using same for increasing abiotic stress tolerance, biomass and yield of plants |
US11485982B1 (en) | 2012-08-27 | 2022-11-01 | Evogene Ltd. | Isolated polynucleotides, polypeptides and methods of using same for increasing abiotic stress tolerance, biomass and yield of plants |
US9890389B2 (en) | 2012-12-25 | 2018-02-13 | Evogene Ltd. | Isolated polynucleotides and polypeptides, and methods of using same for increasing nitrogen use efficiency of plants |
US10597672B2 (en) | 2012-12-25 | 2020-03-24 | Evogene Ltd. | Isolated polynucleotides and polypeptides, and methods of using same for increasing nitrogen use efficiency of plants |
US11352636B2 (en) | 2012-12-25 | 2022-06-07 | Evogene Ltd. | Isolated polynucleotides and polypeptides, and methods of using same for increasing nitrogen use efficiency of plants |
US11453888B2 (en) | 2012-12-26 | 2022-09-27 | Evogene Ltd. | Isolated polynucleotides and polypeptides, construct and plants comprising same and methods of using same for increasing nitrogen use efficiency of plants |
US9771598B2 (en) | 2012-12-26 | 2017-09-26 | Evogene Ltd. | Isolated polynucleotides and polypeptides, construct and plants comprising same and methods of using same for increasing nitrogen use efficiency of plants |
US10501751B2 (en) | 2012-12-26 | 2019-12-10 | Evogene Ltd. | Isolated polynucleotides and polypeptides, construct and plants comprising same and methods of using same for increasing nitrogen use efficiency of plants |
EP3613280A1 (en) * | 2013-03-14 | 2020-02-26 | Monsanto Technology LLC | Plant regulatory elements and uses thereof |
RU2675524C2 (en) * | 2013-03-14 | 2018-12-19 | Монсанто Текнолоджи Ллс | Plant regulatory elements and uses thereof |
US9617553B2 (en) | 2013-03-14 | 2017-04-11 | Monsanto Technology Llc | Plant regulatory elements and uses thereof |
US10421974B2 (en) | 2013-03-14 | 2019-09-24 | Monsanto Technology Llc | Plant regulatory elements and uses thereof |
US11542516B2 (en) | 2013-03-14 | 2023-01-03 | Monsanto Technology, Llc | Plant regulatory elements and uses thereof |
WO2014159632A1 (en) * | 2013-03-14 | 2014-10-02 | Monsanto Technology Llc | Plant regulatory elements and uses thereof |
US10889827B2 (en) | 2013-05-22 | 2021-01-12 | Evogene Ltd. | Isolated polynucleotides and polypeptides, and methods of using same for increasing plant yield and/or agricultural characteristics |
US11560573B2 (en) | 2013-05-22 | 2023-01-24 | Evogene Ltd. | Isolated polynucleotides and polypeptides, and methods of using same for increasing plant yield and/or agricultural characteristics |
US11525141B2 (en) | 2013-05-22 | 2022-12-13 | Evogene Ltd. | Isolated polynucleotides and polypeptides, and methods of using same for increasing plant yield and/or agricultural characteristics |
US10214748B2 (en) | 2013-05-22 | 2019-02-26 | Evogene Ltd. | Isolated polynucleotides and polypeptides, and methods of using same for increasing plant yield and/or agricultural characteristics |
US11549122B2 (en) | 2013-05-22 | 2023-01-10 | Evogene Ltd. | Isolated polynucleotides and polypeptides, and methods of using same for increasing plant yield and/or agricultural characteristics |
US9920329B2 (en) | 2013-05-22 | 2018-03-20 | Evogene Ltd. | Isolated polynucleotides and polypeptides, and methods of using same for increasing plant yield and/or agricultural characteristics |
US10006042B2 (en) | 2013-08-27 | 2018-06-26 | Evogene Ltd. | Isolated polynucleotides and polypeptides, and methods of using same for increasing plant yield and/or agricultural characteristics |
US11499161B2 (en) | 2013-08-27 | 2022-11-15 | Evogene Ltd. | Isolated polynucleotides and polypeptides, and methods of using same for increasing plant yield and/or agricultural characteristics |
US10774340B2 (en) | 2013-08-27 | 2020-09-15 | Evogene Ltd. | Isolated polynucleotides and polypeptides, and methods of using same for increasing plant yield and/or agricultural characteristics |
US10337023B2 (en) | 2013-08-27 | 2019-07-02 | Evogene Ltd. | Isolated polynucleotides and polypeptides, and methods of using same for increasing plant yield and/or agricultural characteristics |
US10975383B2 (en) | 2014-05-28 | 2021-04-13 | Evogene Ltd. | Isolated polynucleotides, polypeptides and methods of using same for increasing abiotic stress tolerance, biomass and yield of plants |
US11421004B2 (en) | 2014-08-27 | 2022-08-23 | Evogene Ltd. | Isolated polynucleotides and polypeptides, and methods of using same for increasing plant yield and/or agricultural characteristics |
US10858403B2 (en) | 2014-08-27 | 2020-12-08 | Evogene Ltd. | Isolated polynucleotides and polypeptides, and methods of using same for increasing plant yield and/or agricultural characteristics |
US11485761B2 (en) | 2014-08-27 | 2022-11-01 | Evogene Ltd. | Isolated polynucleotides and polypeptides, and methods of using same for increasing plant yield and/or agricultural characteristics |
US11472853B1 (en) | 2014-08-27 | 2022-10-18 | Evogene Ltd. | Isolated polynucleotides and polypeptides, and methods of using same for increasing plant yield and/or agricultural characteristics |
US10766935B2 (en) | 2015-12-28 | 2020-09-08 | Evogene Ltd. | Plant traits conferred by isolated polynucleotides and polypeptides |
US11566053B2 (en) | 2015-12-28 | 2023-01-31 | Evogene Ltd. | Plant traits conferred by isolated polynucleotides and polypeptides |
Also Published As
Publication number | Publication date |
---|---|
BRPI0618965B1 (en) | 2021-01-12 |
RU2011113420A (en) | 2012-10-20 |
CA2626592A1 (en) | 2007-05-03 |
AU2006307457A2 (en) | 2008-06-12 |
ZA200803989B (en) | 2009-03-25 |
BRPI0618965A2 (en) | 2010-06-29 |
MX338183B (en) | 2016-04-06 |
AU2006307457A1 (en) | 2007-05-03 |
RU2008120395A (en) | 2009-12-10 |
RU2011113422A (en) | 2012-10-20 |
US20090293154A1 (en) | 2009-11-26 |
US20150121573A1 (en) | 2015-04-30 |
EP2716654A1 (en) | 2014-04-09 |
US8962915B2 (en) | 2015-02-24 |
EP1940217A4 (en) | 2009-11-11 |
CA2626592C (en) | 2018-07-17 |
CN101505587A (en) | 2009-08-12 |
WO2007049275A3 (en) | 2009-02-12 |
MX350551B (en) | 2017-09-08 |
EP1940217A2 (en) | 2008-07-09 |
RU2425151C2 (en) | 2011-07-27 |
AU2006307457B2 (en) | 2012-03-22 |
RU2487166C2 (en) | 2013-07-10 |
US10533184B2 (en) | 2020-01-14 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US10533184B2 (en) | Isolated polypeptides, polynucleotides encoding same, transgenic plants expressing same and methods of using same | |
AU2019204578B2 (en) | Isolated polynucleotides and polypeptides, and methods of using same for improving plant properties | |
AU2018253496B2 (en) | Isolated Polynucleotides and Polypeptides and Methods of Using Same for Increasing Plant Yield, Biomass, Growth Rate, Vigor, Oil Content, Abiotic Stress Tolerance of Plants and Nitrogen Use Efficiency | |
US10208316B2 (en) | Use of UMP-CMP kinases for increasing nitrogen use efficiency and low nitrogen tolerance in plants | |
US10407690B2 (en) | Isolated polypeptides, polynucleotides useful for modifying water user efficiency, fertilizer use efficiency, biotic/abiotic stress tolerance, yield and biomass in plants | |
AU2012359983B2 (en) | Isolated polynucleotides and polypeptides, and methods of using same for increasing yield of plants | |
AU2012298157B2 (en) | Isolated polynucleotides and polypeptides, and methods of using same for increasing plant yield and/or agricultural characteristics | |
AU2011246876B2 (en) | Isolated polynucleotides and polypeptides, and methods of using same for increasing plant yield and/or agricultural characteristics | |
CA2809384C (en) | Isolated polynucleotides and polypeptides, and methods of using same for increasing nitrogen use efficiency, yield, growth rate, vigor, biomass, oil content, and/or abiotic stress tolerance | |
WO2009013750A2 (en) | Polynucleotides, polypeptides encoded thereby, and methods of using same for increasing abiotic stress tolerance and/or biomass and/or yield in plants expressing same | |
AU2016202095B2 (en) | Isolated Polypeptides, Polynucleotides Encoding Same, Transgenic Plants Expressing Same and Methods of Using Same | |
AU2014202590C1 (en) | Isolated Polypeptides, Polynucleotides Encoding Same, Transgenic Plants Expressing Same and Methods of Using Same | |
AU2012203614A1 (en) | Isolated Polypeptides, Polynucleotides Encoding Same, Transgenic Plants Expressing Same and Methods of Using Same | |
AU2015261690B2 (en) | Isolated Polypeptides, Polynucleotides Useful for Modifying Water User Efficiency, Fertilizer Use Efficiency, Biotic/Abiotic Stress Tolerance, Yield and Biomass in Plants | |
AU2014215945B2 (en) | Polynucleotides, Polypeptides Encoded Thereby, and Methods of Using Same for Increasing Abiotic Stress Tolerance and/or Biomass and/or Yield in Plants Expressing Same | |
AU2013263801B2 (en) | Isolated Polypeptides, Polynucleotides Useful for Modifying Water User Efficiency, Fertilizer Use Efficiency, Biotic/Abiotic Stress Tolerance, Yield and Biomass in Plants | |
AU2017228711A1 (en) | Polynucleotides, Polypeptides Encoded Thereby, and Methods of Using Same for Increasing Abiotic Stress Tolerance and/or Biomass and/or Yield in Plants Expressing Same |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
WWE | Wipo information: entry into national phase |
Ref document number: 200680047610.0 Country of ref document: CN |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
WWE | Wipo information: entry into national phase |
Ref document number: 190918 Country of ref document: IL |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2626592 Country of ref document: CA |
|
WWE | Wipo information: entry into national phase |
Ref document number: 12083978 Country of ref document: US Ref document number: MX/a/2008/005280 Country of ref document: MX |
|
NENP | Non-entry into the national phase |
Ref country code: DE |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2006809784 Country of ref document: EP |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2006307457 Country of ref document: AU |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2570/CHENP/2008 Country of ref document: IN |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2008120395 Country of ref document: RU |
|
ENP | Entry into the national phase |
Ref document number: 2006307457 Country of ref document: AU Date of ref document: 20061024 Kind code of ref document: A |
|
WWP | Wipo information: published in national office |
Ref document number: 2006307457 Country of ref document: AU |
|
WWP | Wipo information: published in national office |
Ref document number: 2006809784 Country of ref document: EP |
|
ENP | Entry into the national phase |
Ref document number: PI0618965 Country of ref document: BR Kind code of ref document: A2 |