WO2007047699A1 - Méthode et acides nucléiques pour le traitement amélioré de cancers du sein - Google Patents

Méthode et acides nucléiques pour le traitement amélioré de cancers du sein Download PDF

Info

Publication number
WO2007047699A1
WO2007047699A1 PCT/US2006/040600 US2006040600W WO2007047699A1 WO 2007047699 A1 WO2007047699 A1 WO 2007047699A1 US 2006040600 W US2006040600 W US 2006040600W WO 2007047699 A1 WO2007047699 A1 WO 2007047699A1
Authority
WO
WIPO (PCT)
Prior art keywords
expression
pitx2
prognosis
carcinoma
gene
Prior art date
Application number
PCT/US2006/040600
Other languages
English (en)
Inventor
John W. M. Martens
John Foekens
Anieta M. Sieuwerts
Ralf Lesche
Sabine Maier
Oliver Hartmann
Original Assignee
Epigenomics Ag
Erasmus University Medical Centre Rotterdam
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Epigenomics Ag, Erasmus University Medical Centre Rotterdam filed Critical Epigenomics Ag
Publication of WO2007047699A1 publication Critical patent/WO2007047699A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2523/00—Reactions characterised by treatment of reaction samples
    • C12Q2523/10—Characterised by chemical treatment
    • C12Q2523/125—Bisulfite(s)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/118—Prognosis of disease development
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/154—Methylation markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers

Definitions

  • Particular aspects relate generally to methods for prognosis and/or predicted outcome of treatment of cancer, and more particularly to methods for prognosis and/or predicted outcome of treatment breast cell proliferative disorder patients (e.g., breast carcinoma), based, for example, on determining the expression level of the gene PITX2.
  • breast cell proliferative disorder patients e.g., breast carcinoma
  • breast cancer In American women, breast cancer is the most frequently diagnosed cancer and the second leading cause of cancer death. In women aged 40-55, breast cancer is the leading cause of death (Greenlee et al., 2000). In 2002, there were 204,000 new cases of breast cancer in the US (data from the American Society of Clinical Oncology) and a comparable number in Europe.
  • Breast cancer is defined as the uncontrolled proliferation of cells within breast tissues.
  • Breasts are comprised of 15 to 20 lobes joined together by ducts. Cancer arises most commonly in the duct, but is also found in the lobes with the rarest type of cancer termed inflammatory breast cancer. It will be appreciated by those skilled in the art that there exists a continuing need to improve methods of early detection, classification and treatment of breast cancers. In contrast to the detection of some other common cancers such as cervical and dermal there are inherent difficulties in classifying and detecting breast cancers.
  • breast cancer is diagnosed comparatively early: in about 93% of all newly diagnosed cases, the cancer has not yet metastasized, and in 65% of cases, even the lymph nodes are not yet affected.
  • the first step of any treatment is the assessment of the patient's condition comparative to defined classifications of the disease.
  • the value of such a system is inherently dependent upon the quality of the classification.
  • Breast cancers are staged according to their size, location, morphology (i.e. grade) and occurrence of metastasis.
  • Methods of treatment include the use of surgery, radiation therapy, chemotherapy and endocrine therapy, which are also used as adjuvant therapies to surgery.
  • systemic adjuvant treatment has been introduced for both node-positive and node-negative breast cancers.
  • Systemic adjuvant therapy is administered after surgical removal of the tumor, and has been shown to reduce the risk of recurrence significantly (Early Breast Cancer Trialists' Collaborative Group, 1998).
  • endocrine treatment for hormone receptor positive tumors
  • different chemotherapy regimens for novel agents like Herceptin.
  • Suitable adjuvant systemic therapies is determined according to an assessment of the patient's risk of recurrence. Risk of recurrence is assessed primarily according to node status, histological grade, tumour size, oestrogen receptor (ER) status of the primary tumour and menopausal status. Other factors that may be taken into consideration include cerbB2 expression, ratio of lymph nodes positive vs number of lymph nodes resected, presence of vascular invasion and age.
  • recurrence appropriate treatments may be selected that provide a reduction in risk of recurrence or death.
  • Chemotherapy is often prescribed as an adjuvant systematic therapy.
  • the proportional reduction of risk of recurrence and death for any given chemotherapy regimen is fairly constant within defined age and hormone receptor categories but the absolute benefit achieved varies as a function of a patient's risk. Accordingly, in order to determine whether a patient will benefit from chemotherapy it is necessary to accurately determine the risk of recurrence or death.
  • aromatase inhibitors have become a valid option.
  • routine adjuvant treatments such as tamoxifen and who will benefit from alternative therapies aromatase inhibitors- an important question given the lack of information on long-term side effects and the increased costs for aromatase inhibitors. Accordingly there is a long felt need in the art for improved methods of providing a prognosis of breast cancer patients to prevent over treatment and accurately select patients who will benefit from specific treatments.
  • the gene PITX2 is a known marker for prognosis, both with and without Tamoxifen treatment.
  • PCT/EP03/10881 discloses that the gene PITX2 is a marker for response to breast cancer treatments targeting the estrogen pathway(s) (e.g. Tamoxifen), furthermore
  • U.S. patent application 11/011 ,332 discloses that the gene PITX2 is also a general prognostic marker (both with or without adjuvant treatment targeting the estrogen receptor pathways).
  • methylation of CpG positions within or associated with the gene PITX2 were determined to be a characteristic of poor outcome.
  • CpG methylation of genes is a common feature of eukaryotic organisms, and enables the control of gene expression.
  • the gene PITX2 is located on chromosome 4 and multiple mRNA transcript variants of the gene are known.
  • RIEG(I), SOLURSHIN; ARP1 ( ALL1 -responsive gene 1), Brx1; IDG2; IGDS; IHG2; IGDS2;
  • PITX2 is a bicoid-related homeobox transcription factor that is involved in pituitary-specific gene regulation and left-right patterning during embryonal development, and mutations in this gene cause Axenfeld-Rieger syndrome.
  • the PITX2 protein contains a 60 amino acid homeodomain of the paired-bicoid class which is responsible for binding DNA.
  • P1 and P2 Two promoters, designated P1 and P2, are operational (see Figure 6).
  • the P2 promoter drives the transcription of two mRNA variants, leading to the A and B protein.
  • PITX2A and B differ in the amino acids encoded by exon 3.
  • P1 drives the third transcript variant encoding the C protein.
  • the WNT pathway controls the P2 promoter which is of relevance for normal pituitary development, while TGF ⁇ family members regulate the P1 promoter that controls through PITX2C expression proper asymmetric organ development.
  • Figures 1 to 4 provide an annotation of the 4 currently known transcript variants of the gene PITX2 as taken from Ensembl version 34. Exons are shown in alternating bold and plain type, and the translation of the codons is shown below the transcript sequence.
  • Figure 1 provides an annotated overview of the transcript variant of SEQ ID NO: 2 herein referred to as variant A (ENST00000355080).
  • Figure 2 provides an annotated overview of the transcript variant of SEQ ID NO:
  • variant B ENST00000354925
  • Figure 3 provides an annotated overview of the transcript variant of SEQ ID NO:
  • variant C ENST00000306732.
  • Figure 4 provides an annotated overview of the transcript variant of SEQ ID NO: 9 is currently uncharacterised but will be herein referred to as variant D (ENST00000354925).
  • Figure 5 provides an annotated figure of the gene P1TX2 showing alternative transcripts of the gene (Note: the ID reference no. ENST00000296492 was updated to ENST00000354925 since the priority date of this application).
  • Figure 6 provides an alternative annotation of the PITX 2 genes showing the transcript variants, wherein X is the location of the PITX2 assay as used in Example 1 , and Y denotes the homeobox region of the transcripts.
  • P1 and P2 are promoters 1 and 2 respectively.
  • Figure 7 shows the MFS of all untreated lymph node negative patients, separated according to PITX2B expression as measured using the quantitative RT-PCR of Example 1.
  • the low expression group is marked (1)
  • the high expression group is marked (2). Cumulative percent of patients in the sample set is shown on the X-axis, time in months is shown on the Y- axis. For each measured time point, the number of patients remaining in the sample set is shown below the Y-axis.
  • Figure 8 shows the MFS of all untreated lymph node negative hormone receptor positive patients-, separated according to PITX2B expression as measured using the quantitative RT-PCR of example 1.
  • the low expression group is marked (1)
  • the high expression group is marked (2). Cumulative percent of patients in the sample set is shown on the X-axis, time in months is shown on the Y-axis. For each measured time point, the number of patients remaining in the sample set is shown below the Y-axis.
  • Figure 9 shows the MFS of all untreated lymph node negative hormone receptor negative patients separated according to PITX2B expression as measured using the quantitative RT-PCR of Example 1.
  • the low expression group is marked (1)
  • the high expression group is marked (2).
  • Cumulative percent of patients in the sample set is shown on the X-axis
  • time in months is shown on the Y-axis. For each measured time point, the number of patients remaining in the sample set is shown below the Y-axis.
  • Figure 10 shows the MFS of all Untreated NO HR-, separated according to the combined criteria of PITX2B expression and P2 region methylation as measured in example 1.
  • the low mRNA expression + hypomethylation sample set is marked (1)
  • the high mRNA expression + hypermethylation sample set is marked (3).
  • the sample set (2) is patients with low mRNA expression + hypermethylation as well as patients with high mRNA expression + hypomethylation. Cumulative percent of patients in the sample set is shown on the X-axis, time in months is shown on the Y-axis. For each measured time point, the number of patients remaining in the sample set is shown below the Y-axis.
  • MS.AP-PCR Metal-Sensitive Arbitrarily-Primed Polymerase Chain Reaction
  • Methods refers to the art-recognized technology that allows for a global scan of the genome using CG-rich primers to focus on the regions most likely to contain CpG dinucleotides, and described by Gonzalgo et al., Cancer Research 57:594-599, 1997.
  • Method “Methy LightTM” refers to the art-recognized fluorescence-based realtime PCR technique described by Eads et a!., Cancer Res. 59:2302-2306, 1999.
  • Heavy MethylTM assay in the embodiment thereof implemented herein, refers to an assay, wherein methylation specific blocking probes (also referred to herein as blockers) covering CpG positions between, or covered by the amplification primers enable methylation-specific selective amplification of a nucleic acid sample.
  • methylation specific blocking probes also referred to herein as blockers
  • Heavy MethylTM MethyLightTM assay in the embodiment thereof implemented herein, refers to a HeavyMethylTM MethyLightTM assay, which is a variation of the MethyLightTM assay, wherein the MethyLightTM assay is combined with methylation specific blocking probes covering CpG positions between the amplification primers.
  • Ms-SNuPE Metal-sensitive Single Nucleotide Primer
  • MSP Metal-specific PCR
  • COBRA combined Bisulfite Restriction Analysis
  • MCA Metal CpG Island Amplification
  • hybridisation is to be understood as a bond of an oligonucleotide to a complementary sequence along the lines of the Watson-Crick base pairings in the sample DNA, forming a duplex structure.
  • Stringent hybridisation conditions involve hybridising at
  • Methods or “methylation-sensitive restriction enzymes” shall be taken to mean an enzyme that selectively digests a nucleic acid dependant on the methylation state of its recognition site.
  • restriction enzymes which specifically cut if the recognition site is not methylated or hemimethylated, the cut will not take place, or with a significantly reduced efficiency, if the recognition site is methylated.
  • restriction enzymes which specifically cut if the recognition site is methylated, the cut will not take place, or with a significantly reduced efficiency if the recognition site is not methylated.
  • methylation-specific restriction enzymes the recognition sequence of which contains a CG dinucleotide (for instance cgcg or cccggg). Further preferred for some embodiments are restriction enzymes that do not cut if the cytosine in this dinucleotide is methylated at the carbon atom C5.
  • restriction enzymes that do not cut if the cytosine in this dinucleotide is methylated at the carbon atom C5.
  • Non-methylation-specific restriction enzymes or “non-methylation-sensitive restriction enzymes” are restriction enzymes that cut a nucleic acid sequence irrespective of the methylation state with nearly identical efficiency. They are also called “methylation- unspecific restriction enzymes.”
  • the term “gene” shall be taken to include all transcript variants thereof and all promoter and regulatory elements thereof.
  • the term shall be taken to include all sequence variants thereof.
  • the terms “hypermethylated”, “upmethylated” or “overexpression shall be taken to mean a methylation or expression level above that of a specified cut-off point, wherein said cut-off may be a value representing the average or median methylation level for a given population, or is preferably an optimized cut-off level.
  • the "cut-off' is also referred herein as a "threshold".
  • methylated In the context of the present invention the terms “methylated”, “hypermethylated”, or “upmethylated” shall be taken to include a methylation level above the cut-off be zero (0) % (or equivalents thereof) methylation for all CpG positions within and associated with (e.g. in promoter or regulatory regions) the gene PITX2.
  • prognosis' is taken to mean a prediction of outcome of disease progression (wherein the term progression shall be taken to also include recurrence after treatment).
  • Prognosis may be expressed in terms of overall patient survival, disease- or metastatsis- or relapse-free survival, increased tumor-related complications and rate of progression of tumour or metastases, wherein a decrease in any of said factors (with the exception of increased tumor- related complications rate of progression) as relative to a pre-determined level, is a 'negative' outcome and increase thereof is a 'positive' outcome.
  • a decrease in tumor-related complications and/or rate of progression of tumour or metastases as relative to a predetermined level is considered a 'positive' outcome and increase thereof is a 'negative' outcome.
  • prognosis may also be referred to in terms of 'aggressiveness' wherein an aggressive cancer is determined to have a high risk of negative outcome and wherein a non- aggressive cancer has a low risk of negative outcome.
  • the present invention provides a novel method for analysis of expression of the gene PITX2 that has utility for the improved treatment of patients with cell proliferative disorders of the breast tissues.
  • the present invention provides a prognostic marker for breast cancer.
  • PITX2 overexpression, in particular of the B variant is associated with poor outcome in patients treated with therapies targeting the estrogen pathways, furthermore, PITX2 overexpression in particular of the B variant is associated with poor prognosis in patients who have not been treated with said treatment. Accordingly it is herein disclosed that PITX2 overexpression in particular of the B variant is an indicator of poor prognosis that is of utility in determining treatment strategy for breast cancer patients.
  • patients with a poor prognosis are recommended for aggressive therapies such a,s but not limited to chemotherapeutic treatment
  • patients with a good prognosis may be treated solely by adjuvant treatment in particular those targeting the estrogen pathways or spared treatment.
  • the prognostic marker according to the present invention is used to provide an estimate of the risk of negative outcome.
  • Characterisation of a breast cancer in terms of predicted outcome enables the physician to determine the risk of recurrence and/or death. This aids in treatment selection as the absolute reduction of risk of recurrence and death after treatments such as chemotherapy can be determined based on the predicted negative outcome.
  • the absolute reduction in risk attributable to treatment may then be compared to the drawbacks of said treatment (e.g. side effects, cost) in order to determine the suitability of said treatment for the patient.
  • chemotherapeutic treatment is currently prescribed as a routine adjuvant systemic therapy in most cases, by providing a means for determining which patients will not significantly benefit from chemotherapy the present invention thereby prevents the routine over-prescription of chemotherapy.
  • Alternative therapies which may be recommended include but are not limited to treatments which target the estrogen receptor pathway or are involved in estrogen metabolism, production or secretion. Said treatments include, but are not limited ' " fo estrogen " " receptor modulators, estrogen receptor down-regulators, aromatase inhibitors, ovarian ablation, LHRH analogues and other centrally acting drugs influencing estrogen production.
  • an appropriate treatment or treatments may be selected from the group consisting of chemotherapy, radiotherapy, surgery, biological therapy, immunotherapy, antibody treatments, treatments involving molecularly targeted drugs, estrogen receptor modulator treatments, estrogen receptor down-regulator treatments, aromatase inhibitors treatments, ovarian ablation, treatments providing LHRH analogues or other centrally acting drugs influencing estrogen production.
  • a cancer is characterised as aggressive it is particularly preferred that a treatment such as, but not limited to, chemotherapy is provided in addition to or instead of further treatments.
  • the herein described markers have further utility in predicting outcome of a patient after treatment with a therapy comprising one or more treatments which target the estrogen receptor pathway or are involved in estrogen metabolism, production or secretion.
  • a therapy comprising one or more treatments which target the estrogen receptor pathway or are involved in estrogen metabolism, production or secretion.
  • Said treatments include, but are not limited to estrogen receptor modulators, estrogen receptor down-regulators, aromatase inhibitors, ovarian ablation, LHRH analogues and other centrally acting drugs influencing estrogen production.
  • Over expression of the gene PITX2, in particular of the B variant is associated with negative outcome of patients treated accordingly. Patients with predicted positive outcome (i.e. under expression) will accordingly have a decreased absolute reduction of risk of recurrence and death after treatment with chemotherapy.
  • Patients with predicted negative outcome i.e. hypermethylation or under expression
  • patients with a negative outcome will be considered more suitable candidates for chemotherapeutic treatment than patients with a positive outcome.
  • Patients with a positive outcome may accordingly be prevented from over prescription of chemotherapeutic treatment. It is particularly preferred that said patients are estrogen receptor positive.
  • the method according to the invention may be used for the determining the risk of metastasis, recurrence and/or death of patients with a wide variety of malignant cell proliferative disorders of the breast tissues including, but not limited to, ductal carcinoma in situ, invasive ductal carcinoma, invasive lobular carcinoma, lobular carcinoma in situ, comedocarcinoma, inflammatory carcinoma, mucinous carcinoma, scirrhous carcinoma, colloid carcinoma, tubular carcinoma, medullary carcinoma, metaplastic carcinoma, and papillary carcinoma and papillary carcinoma in situ, undifferentiated or anaplastic carcinoma and Paget's disease of the breast.
  • the sequence of said gene is disclosed in SEQ ID NO: 1 , it is preferred that any transcript thereof or polypeptide transcribed therefrom is analysed and a prognostic and/or predictive outcome of breast cancer in a subject is determined. It is particularly preferred that said transcript is the B variant as disclosed in SEQ ID NO: 1 , it is preferred that any transcript thereof or polypeptide transcribed therefrom is analysed and a prognostic and/or predictive outcome of breast cancer in a subject is determined. It is particularly preferred that said transcript is the B variant as disclosed in SEQ ID NO: 1 , it is preferred that any transcript thereof or polypeptide transcribed therefrom is analysed and a prognostic and/or predictive outcome of breast cancer in a subject is determined. It is particularly preferred that said transcript is the B variant as disclosed in SEQ
  • the method comprises the following steps: a) obtaining a breast tumour sample from a subject b) determining the expression status of the gene PITX2 in said sample c) determining therefrom the prognosis of said subject whereby overexpression is indicative of negative prognosis.
  • Step b) of said method may be enabled by means of any analysis of the expression of a RNA transcribed therefrom or polypeptide or protein translated from said RNA, preferably by means of mRNA expression analysis or polypeptide expression analysis.
  • the present invention also provides prognostic assays and methods, both quantitative and qualitative for detecting the expression of the gene PITX2 in a subject with a breast cell proliferative disorder and determining therefrom upon the prognosis and/or prediction of treatment outcome in said subject.
  • Aberrant expression of mRNA transcribed from the gene PITX2 are associated with prognosis and/or prediction of treatment outcome of breast carcinoma. Over expression is associated with poor prognosis and/or prediction of treatment outcome, under expression is associated with good prognosis and/or prediction of treatment outcome. It is particularly preferred that the expression of the B variant transcript as disclosed in SEQ ID NO: 7 is determined.
  • a sample is obtained from a patient.
  • the sample may be any suitable sample comprising cellular matter of the tumour, most preferably the primary tumour.
  • Suitable sample types include tumours cells or cell lines, histological slides, paraffin embedded tissues, biopsies, tissue embedded in paraffin, bodily fluids (such as but not limited to nipple aspirate and blood) or another suitable biological sample and all possible combinations thereof.
  • said source is primary tumour tissue.
  • the sample may be treated to extract the RNA contained therein.
  • the resulting nucleic acid from the sample is then analysed.
  • Many techniques are known in the state of the art for determining absolute and relative levels of gene expression, commonly used techniques suitable for use in the present invention include in situ hybridisation (e.g. FISH), Northern analysis, RNase protection assays (RPA), microarrays and PCR-based techniques, such as quantitative PCR and differential display PCR or any other nucleic acid detection method.
  • RT-PCR reverse transcription/polymerisation chain reaction technique
  • the RT-PCR method can be performed as follows. Total cellular RNA is isolated by, for example, the standard guanidium isothiocyanate method and the total RNA is reverse transcribed.
  • the reverse transcription method involves synthesis of DNA on a template of RNA using a reverse transcriptase enzyme and a 3 1 end oligo dT primer and/or random hexamer primers.
  • the cDNA thus produced is then amplified by means of PCR. (Belyavsky et al, Nucl Acid Res 17:2919-2932, 1989; Krug and Berger, Methods in Enzymology, Academic Press, N. Y., Vol.152, pp. 316-325, 1987 which are incorporated by reference).
  • RT-PCR RT-PCR
  • hybridisation probes E.g TaqMan, Lightcycler, Molecular Beacons & Scorpion
  • SYBR green SYBR green
  • the detected signal from the probes or SYBR green is then quantitated either by reference to a standard curve or by comparing the Ct values to that of a calibration standard. Analysis of housekeeping genes is often used to normalize the results.
  • RNA is run on a denaturing agarose gel and detected by hybridization to a labelled probe in the dried gel itself or on a membrane.
  • the resulting signal is proportional to the amount of target RNA in the RNA population. Comparing the signals from two or more cell populations or tissues reveals relative differences in gene expression levels. Absolute quantitation can be performed by comparing the signal to a standard curve generated 'using known amounts of an in vitro transcript corresponding to the target RNA. Analysis of housekeeping genes, genes whose expression levels are expected to remain relatively constant regardless of conditions, is often used to normalize the results, eliminating any apparent differences caused by unequal transfer of RNA to the membrane or unequal loading of RNA on the gel.
  • the first step in Northern analysis is isolating pure, intact RNA from the cells or tissue of interest. Because Northern blots distinguish RNAs by size, sample integrity influences the degree to which a signal is localized in a single band. Partially degraded RNA samples will result in the signal being smeared or distributed over several bands with an overall loss in sensitivity and possibly an erroneous interpretation of the data.
  • DNA, RNA and oligonucleotide probes can be used and these probes are preferably labelled (e.g. radioactive labels, massa labels or fluorescent labels).
  • the size of the target RNA, not the probe, will determine the size of the detected band, so methods such as random-primed labeling, which generates probes of variable lengths, are suitable for probe synthesis.
  • the specific activity of the probe will determine the level of sensitivity, so it is preferred that probes with high specific activities, are used..
  • RNA target and an RNA probe of a defined length are hybridized in solution. Following hybridization, the RNA is digested with RNases specific for single-stranded nucleic acids to remove any unhybridized, single-stranded target RNA and probe. The RNases are inactivated, and the RNA is separated e.g. by denaturing polyacrylamide gel electrophoresis. The amount of intact RNA probe is proportional to the amount of target RNA in the RNA population.
  • RPA can be used for relative and absolute quantitation of gene expression and also for mapping RNA structure, such as intron/exon boundaries and transcription start sites.
  • the RNase protection assay is preferable to Northern blot analysis as it generally has a lower limit of detection.
  • RNA probes used in RPA are generated by in vitro transcription of a DNA template with a defined endpoint and are typically in the range of 50-600 nucleotides.
  • the use of RNA probes that include additional sequences not homologous to the target RNA allows the protected fragment to be distinguished from the full-length probe.
  • RNA probes are typically used instead of DNA probes due to the ease of generating single-stranded RNA probes and the reproducibility and reliability of RNA:RNA duplex digestion with RNases (Ausubel et al. 2003), particularly preferred are probes with high specific activities.
  • microarrays particularly preferred is the use of microarrays.
  • the microarray analysis process can be divided into two main parts. First is the immobilization of known gene sequences onto glass slides or other solid support followed by hybridization of the fluorescently labelled cDNA (comprising the sequences to be interrogated) to the known genes immobilized on the glass slide. After hybridization, arrays are scanned using a fluorescent microarray scanner. Analyzing the relative fluorescent intensity of different genes provides a measure of the differences in gene expression.
  • DNA arrays can be generated by immobilizing presynthesized oligonucleotides onto prepared glass slides.
  • representative gene sequences are manufactured and prepared using standard oligonucleotide synthesis and purification methods. These synthesized gene sequences are complementary to the genes of interest (in this case PITX2) and tend to be shorter sequences in the range of 25-70 nucleotides.
  • immobilized oligos can be chemically synthesized in situ on the surface of the slide. In situ oligonucleotide synthesis involves the consecutive addition of the appropriate nucleotides to the spots on the microarray; spots not receiving a nucleotide are protected during each stage of the process using physical or virtual masks.
  • RNA templates used are representative of the transcription profile of the cells or tissues under study. RNA is first isolated from the cell populations or tissues to be compared. Each RNA sample is then used as a template to generate fluorescently labelled cDNA via a reverse transcription reaction. Fluorescent labeling of the cDNA can be accomplished by either direct labeling or indirect labeling methods. During direct labeling, fluorescently modified nucleotides (e.g., Cy ® 3- or Cy ® 5-dCTP) are incorporated directly into the cDNA during the reverse transcription.
  • fluorescently modified nucleotides e.g., Cy ® 3- or Cy ® 5-dCTP
  • indirect labeling can be achieved by incorporating aminoallyl-modified nucleotides during cDNA synthesis and then conjugating an N-hydroxysuccinimide (NHS)-ester dye to the aminoallyl-modified cDNA after the reverse transcription reaction is complete.
  • the probe may be unlabelled, but may be detectable by specific binding with a ligand which is labelled, either directly or indirectly.
  • Suitable labels and methods for labelling ligands (and probes) are known in the art, and include, for example, radioactive labels which may be incorporated by known methods (e.g., nick translation or kinasing).
  • Other suitable labels include but are not limited to biotin, fluorescent groups, chemiluminescent groups (e.g., dioxetanes, particularly triggered dioxetanes), enzymes, antibodies, and the like.
  • cDNA generated from different RNA samples are labelled with Cy ® 3.
  • the resulting labelled cDNA is purified to remove unincorporated nucleotides, free dye and residual RNA.
  • the labeled cDNA samples are hybridised to the microarray.
  • the stringency of hybridisation is determined by a number of factors during hybridisation and during the washing procedure, including temperature, ionic strength, length of time and concentration of formamide. These factors are outlined in, for example, Sambrook et al. (Molecular Cloning: A Laboratory Manual, 2nd ed., 1989).
  • the microarray is scanned post-hybridization using a fluorescent microarray scanner. The fluorescent intensity of each spot indicates the level of expression for that gene; bright spots correspond to strongly expressed genes, while dim spots indicate weak expression..
  • the raw data must be analyzed.
  • the background fluorescence must be subtracted from the fluorescence of each spot.
  • the data is then normalized to a control sequence, such as an exogenously added RNA, or a housekeeping gene panel to account for any nonspecific hybridization, array imperfections or variability in the array setup, cDNA labeling, hybridization or washing. Data normalization allows the results of multiple arrays to be compared.
  • the present invention further provides for methods for the detection of the presence of the polypeptide encoded by said gene sequences in a sample obtained from a patient. Aberrant levels of polypeptide expression of the polypeptides encoded by the gene
  • PITX2 are associated with breast cell proliferative disorder prognosis and/or treatment outcome. Accordingly over or under expression of said polypeptides are associable with the prognosis and to treatment outcome of breast cancers. Over expression is associated with poor prognosis and under expression is associated with good prognosis. It is particularly preferred that said polypeptides are translated from the B variant transcript. Any method known in the art for detecting polypeptides can be used.
  • Such methods include, but are not limited to masss-spectrometry, immunodiffusion, immunoelectrophoresis, immunochemical methods, binder-ligand assays, immunohistochemical techniques, agglutination and complement assays (e.g., see Basic and Clinical Immunology, Sites and Terr, eds., Appleton & Lange, Norwalk, Conn, pp 217-262, 1991 which is incorporated by reference).
  • binder-ligand immunoassay methods including reacting antibodies with an epitope or epitopes and competitively displacing a labelled polypeptide or derivative thereof.
  • Certain embodiments of the present invention comprise the use of antibodies specific to the polypeptide encoded by the PITX2 gene.
  • Such antibodies are useful for breast cancer prognostic and/or predictive applications.
  • production of monoclonal or polyclonal antibodies can be induced by the use of the coded polypeptide as an antigene.
  • Such antibodies may in turn be used to detect expressed polypeptides as markers for breast cell proliferative disorder prognosis.
  • the levels of such polypeptides present may be quantified by conventional methods.
  • Antibody- polypeptide binding may be detected and quantified by a variety of means known in the art, such as labelling with fluorescent or radioactive ligands.
  • the invention further comprises kits for performing the above-mentioned procedures, wherein such kits contain antibodies specific for the investigated polypeptides.
  • Antibodies employed in such assays may be unlabelled, for example as used in agglutination tests, or labelled for use a wide variety of assay methods.
  • Labels that can be used include radionuclides, enzymes, fluorescers, chemiluminescers, enzyme substrates or co- factors, enzyme inhibitors, particles, dyes and the like.
  • Preferred assays include but are not limited to radioimmunoassay (RIA), enzyme immunoassays, e.g., enzyme-linked immunosorbent assay (ELISA), fluorescent immunoassays and the like.
  • Polyclonal or monoclonal antibodies or epitopes thereof can be made for use in immunoassays by any of a number of methods known in the art.
  • the proteins may be detected by means of western blot analysis.
  • Said analysis is standar in the art, briefly proteins are separated by means of electrophoresis e.g. SDS-PAGE. The separated proteins are then transferred to a suitable membrane (or paper) e.g. nitrocellulose, retaining the spacial separation achieved by electrophoresis. The membrane is then incubated with a generic protein (e.g. milk protein) to bind remaining sticky places on the membrane.
  • a generic protein e.g. milk protein
  • An antibody specific to the protein of interest is frien a ⁇ e ⁇ , saifcPSiit ⁇ b' ⁇ dy " being detectably labelled for example by dyes or enzymatic means (e.g. alkaline phosphatase or horseradish peroxidase) . The location of the antibody on the membrane is then detected.
  • the proteins may be detected by means of immunohistochemistry (the use of antibodies to probe specific antigens in a sample). Said analysis is standard in the art, wherein detection of antigens in tissues is known as immunohistochemistry, while detection in cultured cells is generally termed immunocytochemistry. Briefly the primary antibody to be detected by binding to its specific antigen. The antibody-antigen complex is then bound by a secondary enzyme conjugated antibody. In the presence of the necessary substrate and chromogen the bound enzyme is detected according to colored deposits at the antibody-antigen binding sites.
  • suitable sample types, antigen-antibody affinity, antibody types, and detection enhancement methods are examples of suitable sample types, antigen-antibody affinity, antibody types, and detection enhancement methods. Thus optimal conditions for immunohistochemical or immunocytochemical detection must be determined by the person skilled in the art for each individual case.
  • One approach for preparing antibodies to a polypeptide is the selection and preparation of an amino acid sequence of all or part of the polypeptide, chemically synthesising the amino acid sequence and injecting it into an appropriate animal, usually a rabbit or a mouse (Milstein and Kohler Nature 256:495-497, 1975; Gulfre and Milstein, Methods in Enzymology: Immunochemical Techniques 73:1-46, Langone and Banatis eds., Academic Press, 1981 which are incorporated by reference).
  • Methods for preparation of the polypeptides or epitopes thereof include, but are not limited to chemical synthesis, recombinant DNA techniques or isolation from biological samples.
  • the prognosis of the patient is determined, whereby overexpression is indicative of negative prognosis.
  • the term overexpression shall be taken to mean expression at a detected level greater than a pre-determined cut off which may be selected from the group consisting of the mean, median or an optimised threshold value.
  • Another aspect of the invention provides a kit for use in providing a prognosis of a subject with a breast cell proliferative disorder, comprising: a means for detecting PITX2 polypeptides.
  • the means for detecting the polypeptides comprise preferably antibodies, antibody derivatives, or antibody fragments.
  • the polypeptides are most preferrably detected by means of Western blotting utilizing a labelled antibody.
  • the kit further comprising means for obtaining a biological sample of the patient.
  • a kit which further comprises a container suitable for containing the means for detecting the polypeptides in the biological sample of the patient, and most preferably further comprises instructions for use and interpretation of the kit results.
  • the kit for use in determining treatment strategy for a patient with a breast cell proliferative disorder comprises: (a) a means tor detecting HI I ⁇ .2 polypeptides; (D) a container suitable for containing the said means and the biological sample of the patient comprising the polypeptides wherein the means can form complexes with the polypeptides; (c) a means to detect the complexes of (b); and optionally (d) instructions for use and interpretation of the kit results.
  • the kit may also contain other components such as buffers or solutions suitable for blocking, washing or coating , packaged in a separate container.
  • kits for use in providing a prognosis of a subject with a breast cell proliferative disorder comprising: a means for measuring the level of transcription of the gene PITX2.
  • the means for measuring the level of transcription comprise oligonucleotides or polynucleotides able to hybridise under stringent or moderately stringent conditions to the transcription products of PITX2.
  • the level of transcription is determined by techniques selected from the group of Northern blot analysis, reverse transcriptase PCR, real-time PCR, RNAse protection, and microarray.
  • the kit further comprises means for obtaining a biological sample of the patient.
  • a kit which further comprises a container suitable for containing the means for measuring the level of transcription and the biological sample of the patient, and most preferably further comprises instructions for use and interpretation of the kit results.
  • the kit for use in determining treatment strategy for a patient with a breast cell proliferative disorder comprises (a) a plurality of oligonucleotides or polynucleotides able to hybridise under stringent or moderately stringent conditions to the transcription products of the gene PITX2; (b) a container suitable for containing the oligonucleotides or polynucleotides and a biological sample of the patient comprising the transcription products wherein the oligonucleotides or polynucleotide can hybridise under stringent or moderately stringent conditions to the transcription products, (c) means to detect the hybridisation of (b); and optionally, (d) instructions for use and interpretation of the kit results.
  • said oligonucleotides or polynucleotides of (a) comprise in each case at least 9, 18 or 25 base ' s of a sequence complementary to or hybridising to SEQ ID NO: 7.
  • the kit may also contain other components such as hybridization buffer (where the oligonucleotides are to be used as a probe) packaged in a separate container.
  • the kit may contain, packaged in separate containers, a polymerase and a reaction buffer optimized for primer extension mediated by the polymerase, such as PCR. 40600
  • the invention provides a further method for providing a prognosis of a subject with a breast cell proliferative disorder comprising the following steps.
  • a breast tumour sample is obtained from the subject.
  • Commonly used techniques suitable for use in the present invention include in situ hybridisation (e.g. FISH), Northern analysis, RNase protection assays (RPA), microarrays and PCR-based techniques, such as quantitative PCR and differential display PCR or any other nucleic acid detection method.
  • RT-PCR reverse transcription/polymerisation chain reaction technique
  • the RT-PCR method can be performed as follows. Total cellular RNA is isolated by, for example, the standard guanidium isothiocyanate method and the total RNA is reverse transcribed.
  • the reverse transcription method involves synthesis of DNA on a template of RNA using a reverse transcriptase enzyme and a 3' end oligo dT primer and/or random hexamer primers.
  • the cDNA thus produced is then amplified by means of PCR. (Belyavsky et al, Nucl Acid Res 17:2919-2932, 1989; Krug and Berger, Methods in Enzymology, Academic Press, N.Y., Vol.152, pp. 316-325, 1987 which are incorporated by reference).
  • RT-PCR RT-PCR
  • hybridisation probes E.g TaqMan, Lightcycler, Molecular Beacons & Scorpion
  • SYBR green SYBR green
  • the detected signal from the probes or SYBR green is then quantitated either by reference to a standard curve or by comparing the Ct values to that of a calibration standard. Analysis of housekeeping genes is often used to normalize the results.
  • RNA is run on a denaturing agarose gel and detected by hybridization to a labelled probe in the dried gel itself or on a membrane.
  • the resulting signal is proportional to the amount of target RNA in the RNA population. Comparing the signals from two or more cell populations or tissues reveals relative differences in gene expression levels. Absolute quantitation can be performed by comparing the signal to a standard curve generated using known amounts of an in vitro transcript corresponding to the target RNA. Analysis of housekeeping genes, genes whose expression levels are expected to remain relatively constant regardless of conditions, is often used to normalize the results, eliminating any apparent differences caused by unequal transfer of RNA to the membrane or unequal loading of RNA on the gel.
  • RNA, RNA and oligonucleotide probes can be used and these probes are preferably labelled (e.g. radioactive labels, massa labels or fluorescent labels).
  • the size of the target RNA, not the probe, will determine the size of the detected band, so methods such as random-primed labeling, which generates probes of variable lengths, are suitable for probe synthesis.
  • the specific activity of the probe will determine the level of sensitivity, so it is preferred that probes with high specific activities, are used..
  • RNA target and an RNA probe of a defined length are hybridized in solution. Following hybridization, the RNA is digested with RNases specific for single-stranded nucleic acids to remove any unhybridized, single-stranded target RNA and probe. The RNases are inactivated, and the RNA is separated e.g. by denaturing polyacrylamide gel electrophoresis. The amount of intact RNA probe is proportional to the amount of target RNA in the RNA population.
  • RPA can be used for relative and absolute quantitation of gene expression and also for mapping RNA structure, such as intron/exon boundaries and transcription start sites.
  • the RNase protection assay is preferable to Northern blot analysis as it generally has a lower limit of detection.
  • RNA probes used in RPA are generated by in vitro transcription of a DNA template with a defined endpoint and are typically in the range of 50-600 nucleotides.
  • the use of RNA probes that include additional sequences not homologous to the target RNA allows the protected fragment to be distinguished from the full-length probe.
  • RNA probes are typically used instead of DNA probes due to the ease of generating single-stranded RNA probes and the reproducibility and reliability of RNA:RNA duplex digestion with RNases (Ausubel et al. 2003), particularly preferred are probes with high specific activities.
  • microarrays particularly preferred is the use of microarrays.
  • the microarray analysis process can be divided into two main parts. First is the immobilization of known gene sequences onto glass slides or other solid support followed by hybridization of the fluorescently labelled cDNA
  • DNA arrays can be generated by immobilizing presynthesized oligonucleotides onto prepared glass slides.
  • representative gene sequences are manufactured and prepared using standard oligonucleotide synthesis and purification methods. These synthesized gene sequences are complementary to the genes of interest (in this case PITX2) and tend to be shorter sequences in the range of 25-70 nucleotides.
  • immobilized oligos can be chemically synthesized in situ on the surface of the slide. In situ oligonucleotide synthesis involves the consecutive addition of the appropriate nucleotides to the spots on the microarray; spots not receiving a nucleotide are protected during each stage of the process using physical or virtual masks.
  • RNA templates used are representative of the transcription profile of the cells or tissues under study.
  • RNA is first isolated from the cell populations or tissues to be compared. Each RNA sample is then used as a template to generate fluorescently labelled cDNA via a reverse transcription reaction.
  • Fluorescent labeling of the cDNA can be accomplished by either direct labeling or indirect labeling methods. During direct labeling, fluorescently modified nucleotides (e.g., Cy ® 3- or Cy ® 5-dCTP) are incorporated directly into the cDNA during the reverse transcription.
  • indirect labeling can be achieved by incorporating aminoallyl-modified nucleotides during cDNA synthesis and then conjugating an N-hydroxysuccinimide (NHS)-ester dye to the aminoallyl-modified cDNA after the reverse transcription reaction is complete.
  • the probe may be unlabelled, but may be detectable by specific binding with a ligand which is labelled, either directly or indirectly.
  • Suitable labels and methods for labelling ligands (and probes) are known in the art, and include, for example, radioactive labels which may be incorporated by known methods (e.g., nick translation or kinasing).
  • Other suitable labels include but are not limited to biotin, fluorescent groups, chemiluminescent groups (e.g., dioxetanes, particularly triggered dioxetanes), enzymes, antibodies, and the like.
  • cDNA generated from different RNA samples are labelled with Cy ® 3.
  • the resulting labelled cDNA is purified to remove unincorporated nucleotides, free dye and residual RNA.
  • the labeled cDNA samples are hybridised to the microarray.
  • the stringency of hybridisation is determined by a number of factors during hybridisation and during the washing procedure, including temperature, ionic strength, length of time and concentration of formamide. These factors are outlined in, for example, Sambrook et al. (Molecular Cloning: A Laboratory Manual, 2nd ed., 1989).
  • the microarray is scanned post-hybridization using a fluorescent microarray scanner. The fluorescent intensity of each spot indicates the level of expression for that gene; bright spots correspond to strongly expressed genes, while dim spots indicate weak expression.
  • the raw data must be analyzed.
  • the background fluorescence must be subtracted from the fluorescence of each spot.
  • the data is then normalized to a control sequence, such as an exogenously added RNA, or a housekeeping gene panel to account for any nonspecific hybridization, array imperfections or variability in the array setup, cDNA labeling, hybridization or washing. Data normalization allows the results of multiple arrays to be compared.
  • the present invention further provides for methods for the detection of the presence of the polypeptide encoded by said gene sequences in a sample obtained from a patient. Aberrant levels of polypeptide expression of the polypeptides encoded by the gene
  • PITX2 are associated with breast cell proliferative disorder prognosis and/or treatment outcome.
  • polypeptides are associable with the prognosis and to treatment outcome of breast cancers. Over expression is associated with poor prognosis and under expression is associated with good prognosis. It is particularly preferred that said polypeptides are translated from the B variant transcript.
  • any method known in the art for detecting polypeptides can be used. Such methods include, but are not limited to masss-spectrometry, immunodiffusion, Immunoelectrophoresis, immunochemical methods, binder-ligand assays, immunohistochemical techniques, agglutination and complement assays (e.g., see Basic and Clinical Immunology, Sites and Terr, eds., Appleton & Lange, Norwalk, Conn, pp 217-262, 1991 which is incorporated by reference).
  • binder-ligand immunoassay methods including reacting antibodies with an epitope or epitopes and competitively displacing a labelled polypeptide or derivative thereof.
  • Certain embodiments of the present invention comprise the use of antibodies specific to the polypeptide encoded by the PITX2 gene.
  • Such antibodies are useful for breast cancer prognostic and/or predictive applications.
  • production of monoclonal or polyclonal antibodies can be induced by the use of the coded polypeptide as an antigene.
  • Such antibodies may in turn be used to detect expressed polypeptides as markers for breast cell proliferative disorder prognosis.
  • the levels of such polypeptides present may be quantified by conventional methods.
  • Antibody- polypeptide binding may be detected and quantified by a variety of means known in the art, such as labelling with fluorescent or radioactive ligands.
  • the invention further comprises kits for performing the above-mentioned procedures, wherein such kits contain antibodies specific for the investigated polypeptides.
  • Antibodies employed in such assays may be unlabelled, for example as used in agglutination tests, or labelled for use a wide variety of assay methods.
  • Labels that can be used include radionuclides, enzymes, fluorescers, chemiluminescers, enzyme substrates or co- factors, enzyme inhibitors, particles, dyes and the like.
  • Preferred assays include but are not limited to radioimmunoassay (RIA), enzyme immunoassays, e.g., enzyme-linked immunosorbent assay (ELISA), fluorescent immunoassays and the like.
  • Polyclonal or monoclonal antibodies or epitopes thereof can be made for use in immunoassays by any of a number of methods known in the art.
  • the proteins may be detected by means of western blot analysis.
  • Said analysis is standar in the art, briefly proteins are separated by means of electrophoresis e.g. SDS-PAGE. The separated proteins are then transferred to a suitable membrane (or paper) e.g. nitrocellulose, retaining the spacial separation achieved by electrophoresis. The membrane is then incubated with a generic protein (e.g. milk protein) to bind remaining sticky places on the membrane.
  • a generic protein e.g. milk protein
  • An antibody specific to the protein of interest is then added, said antibody being detectably labelled for example by dyes or enzymatic means (e.g. alkaline phosphatase or horseradish peroxidase) . The location of the antibody on the membrane is then detected.
  • the proteins may be detected by means of immunohistochemistry (the use of antibodies to probe specific antigens in a sample). Said analysis is standard in the art, wherein detection of antigens in tissues is known as immunohistochemistry, while detection in cultured cells is generally termed immunocytochemistry. Briefly the primary antibody to be detected by binding to its specific antigen. The antibody-antigen complex is then bound by a secondary enzyme conjugated antibody. In the presence of the necessary substrate and chromogen the bound enzyme is detected according to colored deposits at the antibody-antigen binding sites.
  • suitable sample types, antigen-antibody affinity, antibody types, and detection enhancement methods are examples of suitable sample types, antigen-antibody affinity, antibody types, and detection enhancement methods. Thus optimal conditions for immunohistochemical or immunocytochemical detection must be determined by the person skilled in the art for each individual case.
  • One approach for preparing antibodies to a polypeptide is the selection and preparation of an amino acid sequence of all or part of the polypeptide, chemically synthesising the amino acid sequence and injecting it into an appropriate animal, usually a rabbit or a mouse (Milstein and Kohler Nature 256:495-497, 1975; Gulfre and Milstein, Methods in Enzymology: Immunochemical Techniques 73:1-46, Langone and Banatis eds., Academic Press, 1981 which are incorporated by reference).
  • Methods for preparation of the polypeptides or epitopes thereof include, but are not limited to chemical synthesis, recombinant DNA techniques or isolation from biological samples.
  • the prognosis of the patient is determined.
  • Over expression of the gene PITX2 is associated with negative prognosis and negative treatment outcome of patients treated by means of therapies targeting the estrogen pathways.
  • Patients with predicted positive prognosis or treatment outcome i.e. under expression
  • Patients with predicted negative prognosis or treatment outcome i.e. over expression
  • patients with predicted negative prognosis or treatment outcome will accordingly have a relatively larger absolute reduction of risk of recurrence and death after treatment with chemotherapy.
  • patients with a negative prognosis or outcome after said treatment will be considered more suitable (i.e. preferred) candidates for chemotherapeutic candidate than patients with a positive prognosis or outcome.
  • Patients with a positive outcome may accordingly be prevented from over prescription of chemotherapeutic treatment.
  • the method of the invention for determining prognosis and/or treatment outcome comprises the steps of: a) obtaining a breast tumour sample from a subject b) determining the expression status of the gene PITX2 in said sample c) determining therefrom the prognosis of said subject whereby overexpression is indicative of negative prognosis.
  • the expression is determined by i) measuring the level of at least one of mRNA, cDNA or polypeptide as described above and additionally ii) determining the methylation status of at least one CpG position of the PITX2 gene and/or its regulatory sequences.
  • hypermethylation is indicative of negative prognosis.
  • said CpG position(s) is located within the P2 promoter region.
  • said CpG position(s) is located within SEQ ID NO: 1.
  • determining the methylation status of at least one CpG position of the PITX2 gene is achieved by contacting the nucleic acid of the gene PITX2 and/or its regulatory regions, or sequences thereof, preferably according to SEQ ID NO: 1 in a biological sample obtained from a subject with at least one reagent or a series of reagents, wherein said reagent or series of reagents, distinguishes between methylated and non methylated CpG dinucleotides within the target nucleic acid.
  • the method comprises the following steps:
  • said method comprises the following steps:
  • a sample of the tissue to be analysed is obtained.
  • the source may be any suitable source, such as cell lines, histological slides, paraffin embedded tissues, biopsies, tissue embedded in paraffin, bodily fluids (such as but not limited to urine, nipple aspirate and blood) and all possible combinations thereof.
  • said source is blood.
  • the DNA is then isolated from the sample. Extraction may be by means that are standard to one skilled in the art, including the use of commercially available kits, detergent lysates, sonification and vortexing with glass beads.
  • the biological sample must be disrupted and lysed by enzymatic, chemical or mechanical means.
  • the DNA solution may then be cleared of proteins and other contaminants e.g. by digestion with proteinase K.
  • the genomic DNA is then recovered from the solution. This may be carried out by means of a variety of methods including salting out, organic extraction or binding of the DNA to a solid phase support. The choice of method will be affected by several factors including time, expense and required quantity of DNA.
  • the genomic double stranded DNA is used in the analysis.
  • the genomic DNA sample is treated in such a manner that cytosine bases which are unmethylated at the 5'-position are converted to uracil, thymine, or another base which is dissimilar to cytosine in terms of hybridization behavior. This will be understood as 'pretreatment' herein.
  • bisulfite reagent refers to a reagent comprising bisulfite, disulfite, hydrogen sulfite or combinations thereof, useful as disclosed herein to distinguish between methylated and unmethylated CpG dinucleotide sequences. Methods of said treatment are known in the art (e.g. PCT/EP2004/011715, which is incorporated by reference in its entirety).
  • the bisulfite treatment is conducted in the presence of denaturing solvents such as but not limited to n-alkylenglycol, particulary diethylene glycol dimethyl ether (DME), or in the presence of dioxane or dioxane derivatives.
  • denaturing solvents such as but not limited to n-alkylenglycol, particulary diethylene glycol dimethyl ether (DME), or in the presence of dioxane or dioxane derivatives.
  • the denaturing solvents are used in concentrations between 1% and 35% (v/v).
  • the bisulfite reaction is carried out in the presence of scavengers such as but not limited to chromane derivatives, e.g., 6-hydroxy-2,5,7,8,-tetramethylchromane 2-carboxylic acid (see: PCT/EP2004/011715 which is incorporated by reference in its entirety).
  • the bisulfite conversion is preferably carried out at a reaction temperature between 30 0 C and 70 0 C, whereby the temperature is increased to over 85°C for short periods of times during the reaction (see: PCT/EP2004/011715 which is incorporated by reference in its entirety).
  • the bisulfite treated DNA is preferably purified prior to the quantification. This may be conducted by any means known in the art, such as but not limited to ultrafiltration, preferably carried out by means of Microcon ⁇ (TM) columns (manufactured by Millipore ⁇ (TM)). The purification is carried out according to a modified manufacturer's protocol (see: PCT/EP2004/011715 which is incorporated by reference in its entirety).
  • fragments of the pretreated DNA are amplified, using sets of primer oligonucleotides according to the present invention, and an amplification enzyme.
  • the amplification of several DNA segments can be carried out simultaneously in one and the same reaction vessel.
  • the amplification is carried out using a polymerase chain reaction (PCR).
  • the set of primer oligonucleotides includes at least two oligonucleotides whose sequences are each reverse complementary to, identical to, or hybridize under stringent or highly stringent conditions to an at least 16-base-pair long segment of the base sequences of one of SEQ ID NO: 3 to SEQ ID NO: 6 and sequences complementary thereto.
  • the methylation status of preselected CpG positions within SEQ ID NO: 1 may be detected by use of methylation-specific primer oligonucleotides.
  • This technique has been described in United States Patent No. 6,265,171 to Herman.
  • MSP primers pairs contain at least one primer that hybridizes to a bisulfite treated CpG dinucleotide. Therefore, the sequence of said primers comprises at least one CpG or TpG dinucleotide.
  • MSP primers specific for non-methylated DNA contain a T' at the 3' position of the C position in the CpG.
  • the base sequence of said primers is required to comprise a sequence having a length of at least 9 nucleotides which hybridizes to a pretreated nucleic acid sequence according to one of SEQ ID NO: 3 to SEQ ID NO: 6 and sequences complementary thereto, wherein the base sequence of said oligomers comprises at least one CpG dinucleotide.
  • a further preferred embodiment of the method comprises the use of blocker oligonucleotides.
  • Blocking probe oligonucleotides are hybridized to the bisulfite treated nucleic acid concurrently with the PCR primers. PCR amplification of the nucleic acid is terminated at the 5' position of the blocking probe, such that amplification of a nucleic acid is suppressed where the complementary sequence to the blocking probe is present.
  • the probes may be designed to hybridize to the bisulfite treated nucleic acid in a methylation status specific manner.
  • suppression of the amplification of nucleic acids which are unmethylated at the position in question would be carried out by the use of blocking probes comprising a 'CpA' or 'TpG' at the position in question, as opposed to a 'CpG' if the suppression of amplification of methylated nucleic acids is desired.
  • blocker oligonucleotides For PCR methods using blocker oligonucleotides, efficient disruption of polymerase- mediated amplification requires that blocker oligonucleotides not be elongated by the polymerase. Preferably, this is achieved through the use of blockers that are 3'- deoxyoligonucleotides, or oligonucleotides derivatized at the 3' position with other than a "free" hydroxyl group. For example, 3'-O-acetyl oligonucleotides are representative of a preferred class of blocker molecule. Additionally, polymerase-mediated decomposition of the blocker oligonucleotides should be precluded.
  • such preclusion comprises either use of a polymerase lacking 5'-3' exonuclease activity, or use of modified blocker oligonucleotides having, for example, thioate bridges at the 5'-termini thereof that render the blocker molecule nuclease-resistant.
  • Particular applications may not require such 5' modifications of the blocker. For example, if the blocker- and primer-binding sites overlap, thereby precluding binding of the primer (e.g., with excess blocker), degradation of the blocker oligonucleotide will be substantially precluded. This is because the polymerase will not extend the primer toward, and through (in the 5'-3' direction) the blocker - a process that normally results in degradation of the hybridized blocker oligonucleotide.
  • a particularly preferred blocker/PCR embodiment for purposes of the present invention and as implemented herein, comprises the use of peptide nucleic acid (PNA) oligomers as blocking oligonucleotides.
  • PNA peptide nucleic acid
  • Such PNA blocker oligomers are ideally suited, because they are neither decomposed nor extended by the polymerase.
  • the base sequence of said blocking oligonucleotides is required to comprise a sequence having a length of at least 9 nucleotides which hybridizes to a pretreated nucleic acid sequence according to one of SEQ ID NO: 3 to SEQ ID NO: 6, and sequences complementary thereto, wherein the base sequence of said oligonucleotides comprises at least one CpG, TpG or CpA dinucleotide.
  • the fragments obtained by means of the amplification can carry a directly or indirectly detectable label.
  • the detection may be carried out and visualized by means of, e.g., matrix assisted laser desorption/ionization mass spectrometry (MALDI) or using electron spray mass spectrometry (ESI).
  • MALDI matrix assisted laser desorption/ionization mass spectrometry
  • ESI electron spray mass spectrometry
  • Matrix Assisted Laser Desorption/ionization Mass Spectrometry is a very efficient development for the analysis of biomolecules (Karas and Hillenkamp, Anal Chem., 60:2299-301 , 1988).
  • An analyte is embedded in a light-absorbing matrix.
  • the matrix is evaporated by a short laser pulse thus transporting the analyte molecule into the vapour phase in an unfragmented manner.
  • the analyte is ionized by collisions with matrix molecules.
  • An applied voltage accelerates the ions into a field-free flight tube. Due to their different masses, the ions are accelerated at different rates. Smaller ions reach the detector sooner than bigger ones.
  • MALDI-TOF spectrometry is well suited to the analysis of peptides and proteins.
  • the analysis of nucleic acids is somewhat more difficult (Gut and Beck, Current Innovations and Future Trends, 1 :147-57, 1995).
  • the sensitivity with respect to nucleic acid analysis is approximately 100-times less than for peptides, and decreases disproportionally with increasing fragment size.
  • the ionization process via the matrix is considerably less efficient.
  • the selection of the matrix plays an eminently important role. For desorption of peptides, several very efficient matrixes have been found which produce a very fine crystallisation.
  • the amplificates obtained during the third step of the method are analysed in order to ascertain the methylation status of the CpG dinucleotides prior to the treatment.
  • the presence or absence of an amplificate is in itself indicative of the methylation state of the CpG positions covered by the primer, according to the base sequences of said primer.
  • Amplificates obtained by means of both standard and methylation specific PCR may be further analyzed by means of hybridization-based methods such as, but not limited to, array technology and probe based technologies as well as by means of techniques such as sequencing and template directed extension.
  • the amplificates synthesised in step three are subsequently hybridized to an array or a set of oligonucleotides and/or PNA probes.
  • the hybridization takes place in the following manner: the set of probes used during the hybridization is preferably composed of at least 2 oligonucleotides or PNA-oligomers; in the process, the amplificates serve as probes which hybridize to oligonucleotides previously Don ⁇ e ⁇ to a son ⁇ pnase; me non-hybridized fragments are subsequently removed; said oligonucleotides contain at least one base sequence having a length of at least 9 nucleotides which is reverse complementary or identical to a segment of the base sequences specified in the present Sequence Listing; and the segment comprises at least one CpG , TpG or CpA dinucleotide.
  • said dinucleotide is present in the central third of the oligomer.
  • said dinucleotide is preferably the fifth to ninth nucleotide from the 5'-end of a 13-mer.
  • One oligonucleotide exists for the analysis of each CpG dinucleotide within the sequence according to SEQ ID NO: 1 , and the equivalent positions within SEQ ID NO: 3, 4, 5 & 6.
  • Said oligonucleotides may also be present in the form of peptide nucleic acids.
  • the non-hybridized amplificates are then removed.
  • the hybridized amplificates are then detected.
  • labels attached to the amplificates are identifiable at each position of the solid phase at which an oligonucleotide sequence is located.
  • the genomic methylation status of the CpG positions may be ascertained by means of oligonucleotide probes that are hybridised to the bisulfite treated DNA concurrently with the PCR amplification primers (wherein said primers may either be methylation specific or standard).
  • a particularly preferred embodiment of this method is the use of fluorescence-based Real Time Quantitative PCR (Heid et al., Genome Res. 6:986-994, 1996; also see United States Patent No. 6,331 ,393) employing a dual-labeled fluorescent oligonucleotide probe (TaqManTM PCR, using an ABI Prism 7700 Sequence Detection System, Perkin Elmer Applied Biosystems, Foster City, California).
  • the TaqManTM PCR reaction employs the use of a nonextendible interrogating oligonucleotide, called a TaqManTM probe, which, in preferred imbodiments, is designed to hybridize to a GpC-rich sequence located between the forward and reverse amplification primers.
  • the TaqManTM probe further comprises a fluorescent reporter moiety and a quencher moiety covalently bound to linker moieties (e.g., phosphoramidites) attached to the nucleotides of the TaqManTM oligonucleotide.
  • linker moieties e.g., phosphoramidites
  • the fifth step of the method comprises the use of template-directed oligonucleotide extension, such as MS-SNuPE as described by Gonzalgo and Jones, Nucleic Acids Res.
  • the fourth step of the method comprises sequencing and subsequent sequence analysis of the amplificate generated in the third step of the method (Sanger F., et al., Proc Natl Acad Sci USA 74:5463-5467, 1977).
  • the nucleic acid according to SEQ ID NO: 1 is isolated and treated according to the first three steps of the method outlined above, namely: a) obtaining, from a subject, a biological sample having subject genomic DNA; b) extracting or otherwise isolating the genomic DNA; and c) treating the genomic DNA of b), or a fragment thereof, with one or more reagents to convert cytosine bases that are unmethylated in the 5-position thereof to uracil or to another base that is detectably dissimilar to cytosine in terms of hybridization properties; and wherein the subsequent amplification of d) is carried out in a methylation specific manner, namely by use of methylation specific primers or blocking oligonucleotides, and further wherein the detection of the amplificates is carried out by means of a real-time detection probes, as described above.
  • methylation specific primers comprise a sequence having a length of at least 9 nucleotides which hybridizes to a pretreated nucleic acid sequence according to one of SEQ ID NO: 3 to SEQ ID NO: 6, and sequences complementary thereto, wherein the base sequence of said oligomers comprises at least one CpG dinucleotide.
  • Step e) of the method namely the detection of the specific amplificates indicative of the methylation status of one or more CpG positions according to SEQ ID NO: 1 is carried out by means of real-time detection methods as described above.
  • the subsequent amplification of d) is carried out in the presence of blocking oligonucleotides, as described above.
  • Said blocking oligonucleotides comprising a sequence having a length of at least 9 nucleotides which hybridizes to a pretreated nucleic acid sequence according to one of SEQ ID NO: 3 to SEQ ID NO: 6 and sequences complementary thereto, wherein the base sequence of said oligomers comprises at least one CpG, TpG or CpA dinucleotide.
  • Step e) of the method namely the detection of the specific amplificates indicative of the methylation status of one or more CpG positions according to SEQ ID NO: 1 is carried out by means of real-time detection methods as described above.
  • the nucleic acids according to SEQ ID NO: 1 is isolated and treated according to the first three steps of the method outlined above, namely: a) obtaining, from a subject, a biological sample having subject genomic DNA; b) extracting or otherwise isolating the genomic DNA; c) treating the genomic DNA of b), or a fragment thereof, with one or more reagents to convert cytosine bases that are unmethylated in the 5-position thereof to uracil or to another base that is detectably dissimilar to cytosine in terms of hybridization properties; and wherein d) amplifying subsequent to treatment in c) is carried out in a methylation specific manner, namely by use of methylation specific primers or blocking oligonucleotides, and further wherein e) detecting of the amplificates is carried out by means of a real-time detection probes, as described above.
  • methylation specific primers comprise a sequence having a length of at least 9 nucleotides which hybridizes to a pretreated nucleic acid sequence according to one of SEQ ID NO: 3 to SEQ ID NO: 6 and sequences complementary thereto, wherein the base sequence of said oligomers comprises at least one CpG dinucleotide.
  • Additional embodiments of the invention provide a method for the analysis of the methylation status of genomic DNA according to the invention (SEQ ID NO: 1 , and the complement thererof) without the need for pretreatment.
  • the genomic DNA sample is isolated from tissue or cellular sources.
  • tissue or cellular sources include cell lines, histological slides, paraffin embedded tissues, body fluids, or tissue embedded in paraffin.
  • the DNA may be cleaved prior to treatment with methylation sensitive restriction enzymes.
  • methylation sensitive restriction enzymes Such methods are known in the art and may include both physical and enzymatic means.
  • Particularly preferred is the use of one or a plurality of restriction enzymes whicn are not methylation sensitive, and whose recognition sites are AT rich and do not comprise CG dinucleotides. The use of such enzymes enables the conservation of CpG islands and CpG rich regions in the fragmented DNA.
  • the non-methylation-specific restriction enzymes are preferably selected from the group consisting of Msel, Bfal, Csp ⁇ l, Tru11 1 Tvu11, Tru9l, Tvu9l, Mael and Xspl. Particularly preferred is the use of two or three such enzymes. Particularly preferred is the use of a combination of Msel, Bfal and Csp ⁇ l.
  • the fragmented DNA may then be ligated to adaptor oligonucleotides in order to facilitate subsequent enzymatic amplification.
  • the ligation of oligonucleotides to blunt and sticky ended DNA fragments is known in the art, and is carried out by means of dephosphorylation of the ends (e.g. using calf or shrimp alkaline phosphatase) and subsequent ligation using ligase enzymes (e.g. T4 DNA ligase) in the presence of dATPs.
  • the adaptor oligonucleotides are typically at least 18 base pairs in length.
  • the DNA (or fragments thereof) is then digested with one or more methylation sensitive restriction enzymes.
  • the digestion is carried out such that hydrolysis of the DNA at the restriction site is informative of the methylation status of at least one specific CpG dinucleotide of the PITX2 gene
  • the methylation-specific restriction enzyme is selected from the group consisting of Ss/ E1, Hga I HinPI, Hpy99l, Ava I, Bee Al, Bsa HI, Bisl, BstUI, Bshl236l, Accll,
  • the restriction fragments are amplified. This is preferably carried out using a polymerase chain reaction, and said amplificates may carry suitable detectable labels as discussed above, namely fluorophore labels, radionuclides and mass labels. Particularly preferred is amplification by means of an amplification enzyme and at least two primers comprising, in each case a contiguous sequence at least 16 nucleotides in length that is complementary to, or hybridizes under moderately stringent or stringent conditions to SEQ ID NO: 1, and complements thereof. Preferably said contiguous sequence is at least 16, 20 or 25 nucleotides in length. In an alternative embodiment said primers may be complementary to any adaptors linked to the fragments.
  • the amplificates are detected.
  • the detection may be by any means standard in the art, for example, but not limited to, gel electrophoresis analysis, hybridisation analysis, incorporation of detectable tags within the PCR products, DNA array analysis, MALDI or ESI analysis.
  • said detection is carried out by hybridisation to at least one nucleic acid or peptide nucleic acid comprising in each case a contiguous sequence at least 16 nucleotides in length that is complementary to, or hybridizes under moderately stringent or stringent conditions to a SEQ ID NO: 1, and complements thereof.
  • said detection is carried out by hybridisation to at least one nucleic acid or peptide nucleic acid comprising in each case a contiguous sequence at least 16 nucleotides in length that is complementary to, or hybridizes under moderately stringent or stringent conditions to SEQ ID NO: 1 , and complements thereof.
  • said contiguous sequence is at least 16, 20 or 25 nucleotides in length.
  • the prognosis of the patient is determined.
  • Hypermethylation and over expression of the gene PITX2 and/or genomic sequences thereof according to SEQ ID NO: 1 are associated with negative prognosis and negative treatment outcome of patients treated by means of therapies targeting the estrogen pathways.
  • Patients with predicted positive prognosis or treatment outcome i.e. hypomethylation and under expression
  • Patients with predicted negative prognosis or treatment outcome i.e. hypermethylation or over expression
  • patients with a negative prognosis or outcome after said treatment will be considered more suitable (i.e. preferred) candidates for chemotherapeutic candidate than patients with a positive prognosis or outcome.
  • Patients with a positive outcome may accordingly be prevented from over prescription of chemotherapeutic treatment.
  • the invention further provides the modified sequences of genomic sequences of SEQ ID NO: 1.
  • the invention further provides oligonucleotides and/or PNA-oligomers for detecting cytosine methylations within said sequences.
  • the present invention is based on the novel disclosure that the cytosine methylation patterns of said genomic DNAs are particularly suitable for improved treatment and monitoring of breast cancers and enables the person skilled in the art to determine a prognosis and/or prediction of outcome of a subject with said disorder based thereupon.
  • This objective according to the present invention is achieved using a nucleic acid containing a sequence of at least 18 bases in length of the treated genomic DNA according to one of SEQ ID NO: 1 and sequences complementary thereto.
  • the disclosed invention provides treated nucleic acids, derived from genomic SEQ ID NO: 1 , wherein the treatment is suitable to convert at least one unmethylated cytosine base of the genomic DNA sequence to uracil or another base that is detectably dissimilar to cytosine in terms of hybridization.
  • the genomic sequences in question may comprise one, or more, consecutive or random methylated CpG positions.
  • Said treatment preferably comprises use of a reagent selected from the group consisting of bisulfite, hydrogen sulfite, disulfite, and combinations thereof.
  • the objective comprises analysis of a non-naturally occurring modified nucleic acid comprising a sequence of at least 16 contiguous nucleotide bases in length of a sequence selected from the group consisting of SEQ ID NO: 3 to SEQ ID NO: 6, wherein said sequence comprises at least one CpG, TpA or CpA dinucleotide and sequences complementary thereto.
  • the sequences of SEQ ID NO: 3, 4, 5 & 6 provide non-naturally occurring modified versions of the nucleic acid according to SEQ ID NO: 1 , wherein the modification of each genomic sequence results in the synthesis of a nucleic acid having a sequence that is unique and distinct from said genomic sequence as follows.
  • genomic DNA For each sense strand genomic DNA, e.g., SEQ ID NO: 1 , four converted versions are disclosed. A first version wherein “C” is converted to “T,” but “CpG” remains “CpG” (i.e., corresponds to case where, for the genomic sequence, all "C” residues of CpG dinucleotide sequences are methylated and are thus not converted); a second version discloses the complement of the disclosed genomic DNA sequence (i.e. antisense strand), wherein “C” is converted to "T,” but “CpG” remains “CpG” (i.e., corresponds to case where, for all "C” residues of CpG dinucleotide sequences are methylated and are thus not converted).
  • the 'upmethylated' converted sequences of SEQ ID NO: 1 correspond to SEQ ID NO: 3 AND SEQ ID NO: 4.
  • a third chemically converted version of each genomic sequences is provided, wherein "C” is converted to "T” for all "C” residues, including those of "CpG" dinucleotide sequences (i.e., corresponds to case where, for the genomic sequences, all "C” residues of CpG dinucleotide sequences are t/nmethylated); a final chemically converted version of each sequence, discloses the complement of the disclosed genomic DNA sequence (i.e.
  • the object of the present invention is further achieved by an oligonucleotide or oligomer for the analysis of pretreated DNA, for detecting the genomic cytosine methylation state, said oligonucleotide containing at least one base sequence having a length of at least 9 nucleotides which hybridizes to or is identical to a pretreated genomic DNA according to SEQ ID NO: 3 to SEQ ID NO: 6.
  • said oligomers comprise at least one T nucleotide wherein the corresponding base position within genomic (i.e. untreated) DNA is a C, said genomic equivalent of SEQ ID NO: 3 to SEQ ID NO: 6 is provided in the sequence listing.
  • said oligonucleotides hybridise under moderately stringent and/or stringent hybridisation conditions to all or a portion of the sequences SEQ ID NO: 3 to SEQ ID NO: 6 , or to the complements thereof.
  • the hybridising portion of the hybridizing nucleic acids is typically at least 9, 15, 20, 25, 30 or 35 nucleotides in length. However, longer molecules have inventive utility, and are thus within the scope of the present invention.
  • the hybridising portion of the inventive hybridising nucleic acids is at least 95%, or at least 98%, or 100% identical to the sequence, or to a portion thereof of SEQ ID NO: 3 to SEQ ID NO: 6, or to the complements thereof.
  • the oligomer probes according to the present invention constitute important and effective tools which, for the first time, make it possible to ascertain specific epigenetic parameters associated with prognosis of breast cancer patients. Said oligonucleotides thereby allow the improved treatment of breast cancers.
  • the base sequence of the oligomers preferably contains at least one CpG, CpA or TpG dinucleotide.
  • the probes may also exist in the form of a PNA (peptide nucleic acid) which has particularly preferred pairing properties.
  • PNA peptide nucleic acid
  • Particularly preferred are oligonucleotides according to the present invention in which the cytosine of the CpG dinucleotide is within the middle third of said oligonucleotide e.g. the 5 tn - 9 tn nucleotide from the 5'-end of a 13-mer oligonucleotide; or in the case of PNA-oligomers, it is preferred for the cytosine of the CpG dinucleotide to be the 4 th - 6* n nucleotide from the 5'-end of the 9-mer.
  • l he oligomers according to tne present invention are normally used in so called "sets" which contain a plurality of oligomers.
  • oligonucleotide is bound to a solid phase. It is further preferred that all the oligonucleotides of one set are bound to a solid phase.
  • the present invention further relates to a set of at least 5 (Oligonucleotides and/or PNA- oligomers) used for detecting the cytosine methylation state of genomic DNA, by analysis of said sequence (SEQ ID NO: 1) or treated versions of said sequence (SEQ ID NO: 3 to SEQ ID NO: 6). These probes enable improved treatment and monitoring of breast cancers.
  • the set of oligomers may also be used for detecting single nucleotide polymorphisms (SNPs) by analysis of said sequence or treated versions of said sequence.
  • SNPs single nucleotide polymorphisms
  • an arrangement of different oligonucleotides and/or PNA-oligomers made available by the present invention is present in a manner that it is likewise bound to a solid phase.
  • This array of different oligonucleotide- and/or PNA-oligomer sequences can be characterized in that it is arranged on the solid phase in the form of a rectangular or hexagonal lattice.
  • the solid phase surface is preferably composed of silicon, glass, polystyrene, aluminum, steel, iron, copper, nickel, silver, or gold.
  • nitrocellulose as well as plastics such as nylon which can exist in the form of pellets or also as resin matrices are suitable alternatives.
  • a further subject matter of the present invention is a method for manufacturing an array fixed to a carrier material for the improved treatment and monitoring of breast cancers.
  • at least one oligomer according to the present invention is coupled to a solid phase.
  • Methods for manufacturing such arrays are known, for example, from US Patent 5,744,305 by means of solid-phase chemistry and photolabile protecting groups.
  • a further subject matter of the present invention relates to a DNA chip for the improved treatment and monitoring of breast cancers.
  • the DNA chip contains at least one nucleic acid according to the present invention.
  • DNA chips are known, for example, in US Patent 5,837,832.
  • kits Moreover, an additional aspect of the present invention is a kit comprising: a means for detecting PITX2 polypeptides and a means for determining PITX2 methylation.
  • the means for detecting the polypeptides comprise preferably antibodies, antibody derivatives, or antibody fragments.
  • the polypeptides are most preferably detected by means of Western blotting utilizing a labelled antibody.
  • the means for determining PITX2 methylation comprise preferably a bisulfite-containing reagent; a set of primer oligonucleotides containing at least two oligonucleotides whose sequences in each case correspond, are complementary, or hybridize under stringent or highly stringent conditions to a 16-base long segment of the sequences SEQ ID NO: 1 or more preferably SEQ ID NO: 3, 4, 5 & 6; oligonucleotides and/or PNA-oligomers; as well as instructions for carrying out and evaluating the described method.
  • said kit may further comprise standard reagents for performing a CpG position-specific methylation analysis, wherein said analysis comprises one or more of the following techniques: MS-SNuPE, MSP, Methy ⁇ ghtTM, HeavyMethyl , COBRA, and nucleic acid sequencing.
  • MS-SNuPE MS-SNuPE
  • MSP Methy ⁇ ghtTM
  • HeavyMethyl COBRA
  • nucleic acid sequencing e.glyceride sequencing
  • the kit further comprising means for obtaining a biological sample of the patient.
  • a kit which further comprises a container suitable for containing the means for detecting the polypeptides and determining the methylation of the gene PITX2 in the biological sample of the patient, and most preferably further comprises instructions for use and interpretation of the kit results.
  • the kit for use in determining treatment strategy for a patient with a breast cell proliferative disorder comprises: (a) a means for detecting PITX2 polypeptides; (b) a container suitable for containing the said means and the biological sample of the patient comprising the polypeptides wherein the means can form complexes with the polypeptides; (c) a means to detect the complexes of (b); (d) a means for detecting PITX2 polypeptides, preferably oligonucleotides and/or PNA- oligomers having a length of at least 16 nucleotides which hybridizes to a pretreated nucleic acid sequence according to one of SEQ ID NO: 3, 4, 5 & 6 and sequences complementary thereto, wherein the base sequence of said oligomers comprises at least one CpG, CpA or TpG dinucleotide and optionally (e) instructions for use and interpretation of the kit results.
  • kits for use in providing a prognosis of a subject with a breast cell proliferative disorder comprising: a means for measuring the level of transcription of the gene PITX2 and a means for determining PITX2 methylation.
  • the means for measuring the level of transcription comprise oligonucleotides or polynucleotides able to hybridise under stringent or moderately stringent conditions to the transcription products of PITX2.
  • the level of transcription is determined by techniques selected from the group of Northern blot analysis, reverse transcriptase PCR, real-time PCR, RNAse protection, and microarray.
  • the means for determining PITX2 methylation comprise preferably a bisulfite-containing reagent; a set of primer oligonucleotides containing at least two oligonucleotides whose sequences in each case correspond, are complementary, or hybridize under stringent or highly stringent conditions to a 16-base long segment of the sequences SEQ ID NO: 1 or more preferably SEQ ID NO: 3, 4, 5 & 6; oligonucleotides and/or PNA-oligomers; as well as instructions for carrying out and evaluating the described method.
  • said kit may further comprise standard reagents for performing a CpG position-specific methylation analysis, wherein said analysis comprises one or more of the following techniques: MS-SNuPE, MSP, MethyLightTM, HeavyMethyl , COBRA, and nucleic acid sequencing.
  • MS-SNuPE MS-SNuPE
  • MSP MethyLightTM
  • HeavyMethyl COBRA
  • nucleic acid sequencing nucleic acid sequencing.
  • a kit along the lines of the present invention can also contain only part of the aforementioned components.
  • the kit further comprises means for obtaining a biological sample of the patient.
  • a kit which further comprises a container suitable for containing the means for measuring the level of transcription and the biological sample of the patient, and most preferably further comprises instructions for use and interpretation of the kit results.
  • the kit for use in determining treatment strategy for a patient with a breast cell proliferative disorder comprises (a) a plurality of oligonucleotides or polynucleotides able to hybridise under stringent or moderately stringent conditions to the transcription products of the gene PITX2; (b) a container suitable for containing the oligonucleotides or polynucleotides and a biological sample of the patient comprising the transcription products wnerein the oligonucleotides or polynucleotide can hybridise under stringent or moderately stringent conditions to the transcription products, (c) means to detect the hybridisation of (b); (d) a means for detecting PITX2 polypeptides, preferably oligonucleotides and/or PNA-oligomers having a length of at least 16 nucleotides which hybridizes to a pretreated nucleic acid sequence according to one of SEQ ID NO: 3, 4, 5 & 6 and sequences complementary
  • said oligonucleotides or polynucleotides of (a) comprise in each case at least 9, 18 or 25 bases of a sequence complementary to or hybridising to SEQ ID NO: 7.
  • the kit may also contain other components such as hybridization buffer (where the oligonucleotides are to be used as a probe) packaged in a separate container.
  • the kit may contain, packaged in separate containers, a polymerase and a reaction buffer optimized for primer extension mediated by the polymerase, such as PCR.
  • kits according to the embodiments of the present invention is used for the determination of expression step of the methods according to other aspects of the invention.
  • the described invention further provides a composition of matter useful for determining the prognosis of a patient with breast cancer.
  • Said composition comprising at least one nucleic acid
  • composition of matter comprises a buffer solution appropriate for the stabilization of said nucleic acid in an aqueous solution and enabling polymerase based reactions within said solution.
  • Suitable buffers are known in the art and commercially available.
  • RT-PCR assays were designed for analysis of the 3 major transcript variants (A, B and C). Furthermore a combined model of PITX2 methylation and mRNA expression was evaluated.
  • Exclusion criteria were residual disease or distant spread diagnosed at or within 1 month after primary surgery, non-invasive breast cancer, neo-adjuvant or adjuvant systemic therapy, a previous other cancer (except basal cell skin cancer or early-stage cervical cancer stage la/Ib), ⁇ 100 mg frozen tissue available, evaluation of tumor content not reliable (2%), ⁇ 30% tumor cell nuclei in the sample (15%), and poor RNA quality (8%).
  • the median age of the patients at surgery was 56 years (range, 25-88 years). Three hundred eighty-seven patients (61%) received radiotherapy. Routine post-surgical follow-up and defining the date of MFS was as described (Wang et al)
  • the median follow-up time was 95 months (range, 11-202 months) with 39% of patients with failures in the analysis of MFS and 35% of patients with failures in the analysis of overall survival.
  • Other relevant clinico-pathologic characteristics of the 700 Lymph node negative patients are included: - 14% of patients were younger than 40; 35% between 41 and 55 ; 31% between 56 and70 and 20% above 70 years of age. 42% were premenopausal, the remaining postmenopausal.
  • a prognostic model was developed in order to provide a clinically relevant comparison point for the mRNA assays.
  • ER estrogen receptor
  • PR progesterone receptor
  • ER and progesterone receptor PgR
  • Tumor cytosols were prepared and processed as recommended by the European Organization for Research and Treatment of Cancer (EORTC Coop group et al 1979).
  • the cut-point used to classify tumors as ER- or PgR-positive was 10 fmol/mg cytosolic protein.
  • the remainder of the tumor tissue was stored in the liquid nitrogen tumor bank at the Erasmus MC. For RNA isolation, 20 to 60 cryostat sections of 30 ⁇ m, corresponding to 30 to 100 mg, were cut from these tissues.
  • RNA isolation and cDNA synthesis were included.
  • RNA The quantity and quality of the isolated RNA was established by UV spectroscopy, by examination of rRNA bands after agarose gel electrophoresis, and by the ability of the sample to be linearly amplified in a serial dilution with our housekeeping gene set (see next section for further details). Samples of total RNA not showing both the 18S and 28S bands (6%) or at 15 ng reverse-transcribed total RNA not amplifiable within 26 cycles at our fixed threshold value of 0.02 (see below) with our housekeeping set, which was the case for 3% of our samples, were excluded from this study.
  • variant 1 also referred to herein as isoform a; A protein; a
  • variant 2 also referred to herein as isoform b; B protein; b
  • PITX2-F3b 5' ⁇ GCCGTTGAATGTCTCTTCTC 3Tm 60°C/50.0% CG Human exon 3 643 PITX2-F3b SEQ ID NO: 13
  • variant 3 also referred to herein as isoform c; C protein; c
  • PCR products were amplified in 35 cycles with 15 seconds of denaturing at 95 0 C, 30 seconds of annealing at 62°C, 10 seconds of ramping to 72 0 C, 20 seconds of extension at 72°C, 10 seconds of ramping to 79°C, and 20 seconds at 79 0 C.
  • SYBR green fluorescent signals of the products were acquired after each cycle at 79 0 C for PCR products with melting temperatures >80°C and only at 72 0 C for those with melting temperatures ⁇ 80°C.
  • a reference dye, ROX was included in all assays to normalize data for non-PCR related signal variation.
  • Quantitative values were obtained from the threshold cycle (C t ) at which the increase in SYBR green or TaqMan probe fluorescent signal associated with an exponential increase of PCR products reached the fixed threshold value of 0.02, which was in all cases, at least 10-fold the standard deviation of the background signal.
  • C t threshold cycle
  • PBGD low abundance housekeeping gene porphobilinogen deaminase
  • HPRT medium abundance housekeeping gene hypoxanthineguanine phosphoribosyltransferase
  • ⁇ 2M the high abundance housekeeping gene ⁇ -2-microglobulin
  • RNA tar ⁇ et 2 ⁇ mean ct h0Usekee P' n9 9e ⁇ es - m ⁇ an ct tar 9 et)
  • Genomic DNA was extracted (QIAamp Blood Kit, QIAGEN, Hilden, Germany) from deep- frozen 100,000xg pellets containing cellular nuclei obtained after tumor tissue cytosol preparation (19). Methylated cytosines in the genomic DNA of tumor tissue specimens were converted to uracils by bisulfite treatment (Olek A, Oswald J, Walter J. A modified and improved method for bisulphite based cytosine methylation analysis. Nucleic Acids Res 1996;24:5064-6.) after which the methylation status of the upstream transcription start site (P2 region) of the PITX2 gene was quantified by real-time PCR (QM-PCR) (Maier S, Nimmrich I, Koenig T, et al.
  • QM-PCR real-time PCR
  • DNA-methylation status of the homeodomain transcription factor PITX2 reliably predicts risk of distant disease recurrence in tamoxifen-treated, node-negative breast cancer patients - technical and clinical validation in a multicenter setting. Eur J Cancer 2006;in press).
  • the assay uses a standard real-time PCR based technology in which the chosen flanking primers ensure unbiased amplification of the region of interest independent of its methylation status while two fluorescent labeled probes measure the relative methylation levels of 3 GpG sites within the amplified fragment.
  • the reaction mixture (20 ⁇ l) consisted of 2 ng bisulfite-converted DNA, PCR amplification primers (100 nM each), FAM- and VIC-labeled probes for specific detection of the methylated and unmethylated variants of the PITX2 P2 start site region (200 nM each (Applied Biosystems, Darmstadt Germany)), dNTPs, reaction buffer, MgCI 2 and Hot-GoldStar-DNA- Polymerase (Eurogentec, Seraing, Belgium).
  • Thermocycling conditions were an initial activation step of 10 min at 95°C, followed by 50 cycles of 95 0 C for 15 sec, and 62 0 C for 45 sec with a single detection of the FAM and VIC signal at the end of the latter step.
  • the preferred variant is the B-transcript variant
  • the preferred patient population is the hormone receptor positive patients group.
  • Figure 7 shows the MFS of all untreated lymph node negative patients, separated according to PITX2B expression as measured using quantitative RT-PCR.
  • the low expression group is marked (1)
  • the high expression group is marked (2).
  • Cumulative percent of patients in the sample set is shown on the X-axis
  • time in months is shown on the Y-axis.
  • the number of patients remaining in the sample set is shown below the Y-axis.
  • Figure 8 shows the MFS of all untreated lymph node negative hormone receptor positive patients-, separated according to PITX2B expression as measured using quantitative RT-PCR.
  • the low expression group is marked (1)
  • the high expression group is marked (2).
  • Cumulative percent of patients in the sample set is shown on the X-axis, time in months is shown on the Y- axis, hor eacn measured nine ⁇ umi, me number of patients remaining in the sample set is shown below the Y-axis.
  • Figure 9 shows the MFS of all untreated lymph node negative hormone receptor negative patients separated according to PITX2B expression as measured using quantitative RT-PCR.
  • the low expression group is marked (1)
  • the high expression group is marked (2).
  • Cumulative percent of patients in the sample set is shown on the X-axis
  • time in months is shown on the Y- axis. For each measured time point, the number of patients remaining in the sample set is shown below the Y-axis.
  • Figure 10 shows the MFS of 76 Untreated node negative HR- patients separated according to the combined criteria of PITX2B expression and P2 region methylation.
  • the low mRNA expression + hypomethylation sample set is marked (1)
  • the high mRNA expression + hypermethylation sample set is marked (3).
  • the sample set (2) is patients with low mRNA expression + hypermethylation as well as patients with high mRNA expression + hypomethylation. Cumulative percent of patients in the sample set is shown on the X-axis, time in months is shown on the Y-axis. For each measured time point, the number of patients remaining in the sample set is shown below the Y-axis.
  • the prognostic model was based on the clinical parameters age, menopausal status, tumor size, tumor grade and hormone receptor status a prognostic model was developed in order to provide a clinically relevant comparison point for the mRNA assays.
  • the prognostic model was based on the clinical parameters age, menopausal status, tumor size, tumor grade and hormone receptor status a prognostic model was developed in order to provide a clinically relevant comparison point for the mRNA assays.
  • EORTC Breast Cancer Cooperative group Revision of the standards for the assessment of hormone receptors in human breast cancer; report of the second E.O.R.T.C.Workshop, held on 16 ⁇ 17 March, 1979, in theNetherlandsCancer Institute. EurJCancer 1980; 16: 1513-5.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Hospice & Palliative Care (AREA)
  • Biophysics (AREA)
  • Oncology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

L’invention concerne des méthodes de pronostic et/ou de prévision de résultat de traitement du cancer, et en particulier des méthodes de pronostic et/ou de prévision de résultat de traitement de patients atteints de troubles prolifératifs de cellules mammaires et en particulier de carcinome du sein. Dans des aspects particuliers, un pronostic et/ou la prévision d'un résultat de traitement est obtenu en déterminant le niveau d'expression du gène PITX2.
PCT/US2006/040600 2005-10-17 2006-10-17 Méthode et acides nucléiques pour le traitement amélioré de cancers du sein WO2007047699A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP05090288 2005-10-17
EP05090288.1 2005-10-17

Publications (1)

Publication Number Publication Date
WO2007047699A1 true WO2007047699A1 (fr) 2007-04-26

Family

ID=37698053

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2006/040600 WO2007047699A1 (fr) 2005-10-17 2006-10-17 Méthode et acides nucléiques pour le traitement amélioré de cancers du sein

Country Status (1)

Country Link
WO (1) WO2007047699A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010099577A1 (fr) * 2009-03-04 2010-09-10 The University Of Queensland Biomarqueurs du cancer et leurs utilisations

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999024572A1 (fr) * 1997-11-11 1999-05-20 Universiteit Utrecht Genes a expression reduite dans les neurones mesencephaliques dopaminergiques
WO2004035803A2 (fr) * 2002-10-01 2004-04-29 Epigenomics Ag Procede et acides nucleiques permettant d'ameliorer le traitement de troubles de la proliferation de celllules mammaires
WO2005059172A2 (fr) * 2003-12-11 2005-06-30 Epigenomics Ag Procede et acides nucleiques permettant un traitement ameliore des troubles proliferatifs des cellules mammaires
WO2005121360A2 (fr) * 2004-06-05 2005-12-22 Epigenomics Ag Marqueurs de pronostic pour la prediction de la reponse a un traitement et / ou de la survie de patientes atteintes de troubles de la proliferation des cellules du sein

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999024572A1 (fr) * 1997-11-11 1999-05-20 Universiteit Utrecht Genes a expression reduite dans les neurones mesencephaliques dopaminergiques
WO2004035803A2 (fr) * 2002-10-01 2004-04-29 Epigenomics Ag Procede et acides nucleiques permettant d'ameliorer le traitement de troubles de la proliferation de celllules mammaires
WO2005059172A2 (fr) * 2003-12-11 2005-06-30 Epigenomics Ag Procede et acides nucleiques permettant un traitement ameliore des troubles proliferatifs des cellules mammaires
WO2005121360A2 (fr) * 2004-06-05 2005-12-22 Epigenomics Ag Marqueurs de pronostic pour la prediction de la reponse a un traitement et / ou de la survie de patientes atteintes de troubles de la proliferation des cellules du sein

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
MAIER S ET AL: "DNA METHYLATION MARKERS- AN OPPORTUNITY TO FURTHER INDIVIDUALIZE THERAPY IN BREAST CANCER?", PERSONALIZED MEDICINE, FUTURE MEDICINE LTD., LONDON, GB, vol. 2, no. 4, November 2005 (2005-11-01), pages 339 - 347, XP001208231, ISSN: 1741-0541 *
SEMINA E V ET AL: "CLONING AND CHARACTERIZATION OF A NOVEL BICOID-RELATED HOMEOBOX TRANSCRIPTION FACTER GENE RIEG INVOLVED IN RIEGER SYNDROME", NATURE GENETICS, NEW YORK, NY, US, vol. 14, no. 4, December 1996 (1996-12-01), pages 392 - 399, XP002062612, ISSN: 1061-4036 *
STEBBING J ET AL: "EPIGENETICS: AN EMERGING TECHNOLOGY IN THE DIAGNOSIS AND TREATMENT OF CANCER", PHARMACOGENOMICS, ASHLEY PUBLICATIONS, GB, vol. 7, no. 5, 2006, pages 747 - 757, XP009077950, ISSN: 1462-2416 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010099577A1 (fr) * 2009-03-04 2010-09-10 The University Of Queensland Biomarqueurs du cancer et leurs utilisations

Similar Documents

Publication Publication Date Title
US11261499B2 (en) Methods and nucleic acids for determining the prognosis of a cancer subject
US9017944B2 (en) Methods for the prognosis of breast cancer
AU2008207110B2 (en) Methods and nucleic acids for analyses of cell proliferative disorders
US20080254470A1 (en) Methods and Nucleic Acids For the Analysis of Gene Expression Associated With the Prognosis of Cell Proliferative Disorders
CA2649777C (fr) Procedes et acides nucleiques pour detecter des troubles de proliferation de cellules colorectales
WO2006071466A2 (fr) Procedes et acides nucleiques pour l'analyse de l'expression genetique associee au pronostic de troubles proliferatifs de cellules prostatiques
SG183708A1 (en) Methods and nucleic acids for analyses of cellular proliferative disorders
US20190119760A1 (en) Methods and nucleic acids for analyses of cellular proliferative disorders
EP2321431A2 (fr) Procédés et acides nucléiques pour l analyse de troubles prolifératifs cellulaires
WO2008008983A2 (fr) Procédés et acides nucléiques pour des analyses de problèmes de la prolifération cellulaire
WO2007019670A1 (fr) Procede et acides nucleiques destines a ameliorer le traitement du cancer du sein
WO2007115213A2 (fr) Méthodes et acides nucléiques pour des analyses de troubles prolifératifs cellulaires
WO2007047699A1 (fr) Méthode et acides nucléiques pour le traitement amélioré de cancers du sein
WO2007137873A1 (fr) Méthode et acides nucléiques utilisés dans le traitement amélioré de cancers du sein

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 06826136

Country of ref document: EP

Kind code of ref document: A1