WO2007038933A2 - A method for producing cells with efficient engraftment within the heart - Google Patents

Abstract

Present application relates to a method for producing a cardiomyoctye like cell in an in vitro system comprising culturing a stem cell with the S100A4 polypeptide .

Description

A method for producing celis with efficient engraftment within the heart

Field of invention

The present invention provides polypeptides, inoculums and methods for differentiating embryonic stem cells into cells of a cardiomyocyte hneage More particularly, the present invention shows that S100A4 polypeptides are useful for differentiating mammalian cells into celis of a cardiomyocyte lineage

Background

The unique differentiation potential of embryonic and aduit stem cells together with their outstanding self-renewal capacity makes them a desirable source for somatic cell therapy of human diseases particularly heart disease.

The old paradigm that cardiac musde cells cannot divide and replenish the adult heart after damage have been challenged by the finding of different populations of stem cells that have the capability to become cardiomyocytes

Somatic celis are gasned by in vitro differentiation of stem cells, however there is presently a need for methods to make stem ceils differentiate into cardiac muscle cells

Embryonic stem cells (ESCs) isolated from the inner cell mass of early mammalian blastocyst stage embryos are piuπpotent cells that are able to differentiate to celis of all 3 germ layers in vitro

In the absence of Leukaemia Inhibitory Factor (LIF), murine ESCs spontaneously differentiate into multicellular aggregates termed embryoid bodies (EBs) The differentiation process of ESCs and EBs is regulated by various extracellular stimuli ESCs may represent an alternative source of functionally mature cardiomyocytes for the treatment of heart diseases

The first cell lineage to differentiate from cultured ES cells or cells of the inner ceil mass in vivo is that of the extraembryonic endoderm. These primitive endoderm (PrE) ceils give rise to visceral and parietal endoderm (PE) Previously it has been demonstrated that PE cells promote cardiomyogenesis by a paracrine pathway in EBs

Identification of soluble growth factors, transcription factors and signal cascades capable of inducing cardiomyogenesis is a crucial issue for the in vitro generation of cardiomyocytes from ESCs. While S100A4 is considered a prognostic marker for cancer progression, it has recently become apparent that at least two SlOO family proteins, SlOOAl and SlOOB, play important roles in cardiovascular function Hence, SlOOAl acts as a positive inotropic regulator of heart function (Most, P et al 2004 & Most, P. et al 2003) and inhibits cardiac myocyte apoptosis in vitro (Most, P., et al (2003a) It has also been shown that SlOOAl is down-regulated in heart failure

CA02369826 describes use of SlOO proteins for treatment of cardiac power failure in cardiomyopathies by improving the cardiomyocyte Ca^{9 t} homeostasis and thereby increasing contractility The description discloses studies in cultures of cardiomyocytes In such cultures, SlOOAl gene or protein addition increased the shortening and re- iengthening speed. Specifically, an increased systolic Ca⁷⁴ release from the sarcoplasmatic reticulum (SR) and an accelerated Ca"⁴ re-uptakes into the SR

In addition, in an in vivo mode! of the rabbit heart, SlOOAl gene therapy, resulting in SlOOAl over-expression, increased the velocity of contraction (positive inotropy), and accelerated relaxation (positive lusitropy) This was shown using SlOOAl only. SlOOAl was administered using a recombinant virus in 6 rabbits, resulting tn no statistically significant difference and increases from 10-17% in systolic ejection pressure as compared to rabbits infected with empty virus under basal and isoproterenol stimulation, respectively

Intracoronary adenovirus-mediated SlOOAl gene delivery in vivo to the postinfarcted failing rat heart normalized myocardial contractile function and ^Ca7+ handling In cryothermia-induced myocardial infarction of rat hearts, in vivo intracoronary delivery of adenoviral Ξ100A1 transgenes preserved global in vivo left ventricular function 1 week after myocardial infarction Preservation of left ventricular function was due mainly to SlOOAl-mediated gam of contractility of the remaining viable myocardium (Pleger et al , 2005)

US6468960 contains the suggestion that Ξ 100A4 stimulates angiogenesis m the mouse cornea Angiogenesis is the formation of novel blood vessels by migration, proliferation and differentiation of endothelial and vascular smooth muscle cells. Thus, by analogy this patent suggests that S100A4 might stimulate blood vessel formation and contribute to vascular remodelling in the heart aftei injury

Understanding the development and function of cardiac muscle would be facilitated by the use of stem cells Pluripotent embryonic stem cells represent a possible unlimited source of functional cardiomyocytes. Such cardiomyocytes would likely facilitate the therapeutic application of ESCs in heart disease, as well as provide important tools for probing the molecular mechanism of cardiomyocyte differentiation and heart development. To date, however, the in vitro differentiation of ESCs into cardiomyocytes involves a poorly defined, inefficient and relatively non-selective process. Thus, the art recognizes a need for compositions and methods for inducing and directing the differentiation of ESCs into cardiomyocytes. There is a particular need for molecules that can induce in vivo and in vitro differentiation of ESCs into cells of a myocardial lineage This invention satisfies these and other needs.

Summary of the invention

The present inventors describe that S100A4 will stimulate formation of novel cardiomyocytes. Thus, in some aspects, a composition comprising the S100A4 polypeptide is provided, which is capable of promoting formation of novel cardiomyocytes. In other aspects, methods of inducing cardiomyogenesis in mammalian cells are provided. Cardiomyogenesis can be induced in vivo or in vitro according to the methods of the present invention

The present application describes a factor capable of differentiating stem or progenitor cells, or cells of the cardiomyocyte lineage that could be used to make cardiomyocyte like cells both in vivo and in vitro The cells are obtained by causing cultures of stem or progenitor cells to differentiate in vitro, and then harvesting cells with certain phenotypic features, or by causing stem or progenitor cells to differentiate in vivo. Differentiated cells bear ceil surface and morphologic markers characteristic of cardiomyocytes.

These cells could be used for two mam purposes, to give to a patient after a clinical cardiac event such as a myocardial infarction, or for research purposes for studying cardiomyocytes. Alternatively, the protein could be given directly to the patients' heart after a cardiac dysfunction, such as a cardiac ischemic event

Detailed description

In vitro methods

The present invention has multiple aspects and both in vivo and in vitro applications. A first aspect provides an in vitro method for inducing and directing the differentiation of ESCs into cardiomyocyte like cells The findings of the present invention are organ specific, since cardiomyocytes only reside sn the heart, while blood vessels are formed in multiple places and organs. Additionally, the present invention is cell specific, as it only concerns cardsomyogenesis, i e the differentiation towards cardsomyocyte like cells, not angiogenesis, i e the development of blood vessels, including endothelial and vascular smooth muscle cells

The heart is the first differentiated organ during embryonic development Due to the inaccessibility of the early embryo, EBs are a good alternative to study early events in differentiation of cardiomyocytes

Thus, in one aspect, the present invention relates to a method for producing a cardiomyocyte like cell in an in vitro system comprising cultuπng a stem cell with a SlOO polypeptide

In the in vitro model presented in by the present inventors, initiation and regulation of early cardiomyogenesis can be studied on the cellular and molecular level By this means and by studies with embryonic tissue explants it became apparent that cardiomyogenic growth factors are secreted by endodermal lineages, both of extra-embryonic and embryonic origin, which develop before or concomitantly with cardiomyocytes in EBs

Embryoid bodies plated with S100A4 develop beating cardiomyocytes faster as compared to embryoid bodies without S100A4, as described in the Examples below

In other words, the present invention relates to any use of a method for producing a cardiomyocyte like cell in an in vitro system comprising cultuπng an ESC with a SlOO polypeptide By generating cardiomyocytes as described by the present invention, the person skilled in the art may be able to study the development of cardiac muscle tissue in vitro, generate inoculums comprising increased numbers of cardiomyocyte like cells and/or generate new cardiomyocyte like cells per sβ

In vivo situation The present invention furthermore has multiple aspects and m-vivo applications, as described below

The polypeptides of the present invention can conveniently be used to induce cardiomyogenesis in vivo

Thus, in one embodiment, the invention relates to a method for increasing the number of cardiomyocyte like cells in vivo comprising delivering a S100A4 polypeptide to a mammal in need thereof The invention further relates to use of S100A4 polypeptide for the preparation of a medicament for the production of a cardiomyocyte like cell in a mammal.

The polypeptides and/or inoculums of the present invention may be administered to an individual, e.g., a mammal such as a human, in an amount effective to induce differentiation of mammalian stem cells into celis of a cardiomyocyte lineage.

In view of their ability to induce cardiomyogenesis, the polypeptides and/or inoculums are useful for the repair of damaged myocardium in acute heart diseases and for treating disorders such as cardiac dysfunction.

Thus, the invention relates to medicaments for treating cardiac dysfunction. Said medicaments contain a therapeutically effective amount of S100A4 or mutant or fragments of the same, or contain nucleic acsd sequence(s) which code(s) for the S100A4 polypeptide and which are optionally integrated in a transfer vector.

It is also an object of preferred embodiments of the present invention to provide cells and/or inoculums stimulated as described herein capable of efficient engraftment within the heart by allowing the celis/inoculums to develop in-situ as integrated cells within and about the heart, whereby the severity of cardiac dysfunction becomes decreased in the afflicted living subject

The invention describes a therapeutic method and uses which employs one or more category types of pluπpotent stem cells and their multipoteπt progenitor progeny cells - with or without inclusion of their hneage-committed, but undifferentiated descendant offspring ceils - to treat living mammalian subjects afflicted with a clinically recognized form of cardiac dysfunction. The cell category types include embryonic stem cells and thesr offspring cells; as well as cardiomyocyte like cells and their various offspring cells.

The present invention in general relates to "enhancing cardiomyogenesis" in vivo by the use of S100A4, which in the present context relates to stimulating, accelerating, or potentiating the process of cardiomyocyte formation

The stimulation of the cardiomyocyte formation can be initiated in an in vitro environment, thus in one embodiment the present invention relates to a method for increasing the number of cardiomyocyte like celis in a mammal, said method comprising the steps of stimulating in vitro an inoculum of stem ceils obtained from a mammal with a SlOO polypeptide

introducing said stimulated inoculum of stem cells to said mammal, and

allowing said inoculum of stem cells and/or their derivatives to develop in-situ as integrated cells within and about the heart,

thereby increasing the number of cardiomyocyte like cells in said mammal.

In another embodiment, the invention describes a method of increasing the number of cardiomyocyte like cells in a patient comprising administering to a patient in need thereof a therapeutically effective amount of a stem ceϋ stimulated in vitro with SlOO. Such cells may be part of an inoculum cornpπsing these cardiomyocyte like ceils

In another embodiment, the present invention relates to use of a stem cell stimulated in vitro with SlOO for the treatment of a cardiac dysfunction,

In some cases combining the effect of administration of S100A4 with stem cells already stimulated in vitro with S100A4 may increase the therapeutically effect, thus in one embodiment the present invention relates to a method for increasing the number of cardiomyocyte like ceils in a mammal comprising administering a S 100A4 polypeptide and an inoculum of stem cells optionally stimulated in vitro with SlOO

By this combined administration cardiac dysfunction may be assisted by producing cardiomyocyte like cells, thus the present invention also relates to a method for producing more cardiomyocyte like cells in a patient comprising administering to said patient a therapeutically effective amount of Ξ100A4 and at least one stem eel! optionally stimulated in vitro with S100A4

In another embodiment, the polypeptides and/or inoculums of the present invention are used during the treatment of a subject in need of repair or augmentation of damaged or weakened cardiac muscle tissue

In another embodiment, the polypeptides and/or inoculums of the present invention are used to treat a subject who desires augmentation or enhancement of cardiac muscle tissue that is not damaged or weakened Such subjects can include, for example, those at πsk for cardiac diseases or disorders One of skill in the art will appreciate that the polypeptides and/or inoculums of the present invention can be used alone or in combination with other compounds and therapeutic regimens to induce cardiomyogenesis.

For example, a polypeptide and/or inocuium may be administered in conjunction with purified or synthesized growth factors and other agents, or combinations thereof, which enhance the development of cardiac muscle tissue.

Cardiomyocyte like cells differentiated according to the methods of the present invention may be administered to a subject by any means known in the art. Suitable means of administration include, for example, intravenous and surgical implantation. The cardsomyocytes may be directly injected into cardiac muscle or applied topically, for example, during surgery on the heart.

The ceils may be in formulations suitable for administration, such as, for example, aqueous and non-aqueous, isotonic sterile injection solutions, which can contain antioxidants, buffers, bacteπostats, and solutes that render the formulation isotonic with the blood of the intended recipient, and aqueous and non-aqueous sterile suspensions that can include suspending agents, solubthzers, thickening agents, stabilizers, and preservatives. Injection solutions and suspensions can be prepared from sterile powders, granules, and tablets.

For surgical implantation, cardiomyocyte like cells are typically left on an intact solid support, e.g., a three-dimensional matrix or planar surface. The matrix or planar surface is surgically implanted into the appropriate site in a subject. For exampie, a patient needing a replacement of a portion of cardiac muscle tissue can have differentiated cells on an intact solid support surgically implanted.

In determining the effective amount of the cells to be administered in the treatment or prophylaxis of conditions owing to diminished or malfunctioning cardiac muscle cells, the physician evaluates cell toxicity, transplantation reactions, progression of the disease, and the production of anti cell antibodies. For administration, cardiomyocyte like cells differentiated according to the methods of the present invention can be administered in an amount effective to provide cardiac muscle cells to the subject, taking into account the side-effects of the cardiomyocytes at various concentrations, as applied to the mass and overall health of the patient Administration can be accomplished via single or divided doses

For patients who have already suffered a cardiac dysfunction, such as e g myocardiac infarction, the present methods of enhancing cardiomyogenesis can speed up recovery. The subject of the present invention is therefore medicaments/pharmaceutical preparations and paradigms for the treatment of cardiac dysfunctions with reduced and/or damaged cardiomyocyte like cells of whatever cause, by increasing the number of cardiomyocyte like ceils in the myocardium. Thus, one embodiment of the present invention relates to increasing the number of cardiomyocyte like cells in a mammal by use of S100A4, thereby decreasing the seventy of a cardiac dysfunction.

In the present context "cardiac dysfunction" is selected from the group consisting of acute myocardial infarction, cardiac arrythmia, cardiac hypoxia, cardiac ischemia, cardiac shock, cardiac insufficiency and congestive heart failure

Pharmaceutical compositions and formulation

The invention also provides pharmaceutical compositions comprising one or more agents selected from the group consisting of polypeptides of the invention and compounds of the invention

In one embodiment, the pharmaceutical composition comprises one or more polypeptides according to the invention, wherein said polypeptides are amounting from 5-101 amino acid residues.

In a specific embodiment, the pharmaceutical composition comprises one or more agents selected from the group consisting of.

a) a polypeptide comprising amino acids 1-101 of SEQ ID NO . 1, b) a polypeptide having at least 95% sequence identity to a), and c) a peptide comprising sub-sequences of a and b with a minimum length of 6 amino acids

As the skilled artisan would know all the peptides and/or polypeptides above may be tagged wrth and/or fused to additional means, such as but not limited to 6xHis.

In another aspect, the invention provides pharmaceutical composition comprising any of the polypeptides or stimulated stem cells according to the present invention and a pharmaceutical acceptable earner

When administered, the pharmaceutical compositions or cells of the invention are applied in pharmaceutically-acceptable amounts and in pharmaceutically acceptable compositions. Such preparations may routinely contain salts, buffering agents, preservatives, compatible earners, and optionally other therapeutic agents

The polypeptides and/or cells of the invention useful in treating cardiac dysfunction may be combined, optionally, with a pharmaceutically-acceptable carrier or additive.

The term "pharmaceutically acceptable carrier or additive" as used herein means one or more compatible solid or liquid filler, diluents or encapsulating substances which are suitable for administration into an individual. The term "carrier" denotes an organic or inorganic ingredient, natural or synthetic, with which the active ingredient is combined to facilitate the application. The components of the pharmaceutical compositions also are capable of being co-rmngled with the polypeptides of the present invention, and with each other, in a manner such that there is no interaction, which would substantially impair the desired pharmaceutical efficacy

In particular the present invention relates to embodiments where one or more substance(s) is/are added to supplement and/or potentiate the effect of SlOO polypeptide

In one embodiment, the present invention relates to a medicament for the treatment of a cardiac dysfunction comprising a SlOO polypeptide formulated with a pharmaceutical acceptable adjuvant

Cardiomyogemc components suitable for use sn the present methods are preferably provided in a pharmaceutically acceptable carrier, such as oils, water, salme solutions, gel, lipids, liposomes, resins, porous matrices, binders, fillers and the like, or combinations thereof.

The cardiomyogemc compositions can be administered to a subject in need of cardiomyogenesss by standard routes, including the oral, nasal, topical, transdermal, parenteral, or rectal route, or by injection or surgical implantation in or proximate to the myocardium.

The somatic cell therapy regime Due to advances in scientific and technical knowledge over the past two decades, a new treatment modality has emerged that involves ( 1) removal of biological material from an individual or animal, (2) manipulation of the biological material in the laboratory, and (3) return of the biological material to the individual or amma! as part of a therapeutic regimen

The biological material can contain living and/or non-living cells in whole or in part as the active ingredient of the biological materia! This type of therapeutic regimen is known by many names, including "adoptive cell therapy" or "cellular therapy" or "gene therapy"

The U S Food and Drug Administration (FDA) refers to these therapies as "Somatic Cell and Gene Therapies" As defined by the FDA, a "somatic cell therapy product" can be one or more autologous (self), allogeneic (intra-species), or xenogeneic (inter-species) cell(s) that have been propagated, expanded, selected, pharmacologically treated, or otherwise altered in bioiogica! characteristics ex-vivo to be administered to humans and applicable to the prevention, treatment, cure, diagnosis, or mitigation of disease or injuries A "gene therapy product", as defined by the FDA, can be one or more products that contain genetic material which are administered to modify and/or manipulate expression of genetic material and/or to alter biological properties of living cells

As describe in detail herein, cells produced by the guidelines of the present invention may be useful in treatment of cardiac dysfunction by somatic ceil therapy regimes, thus in one embodiment, the present invention relates to an inoculum of stem cells stimulated in vitro with a SlOO polypeptide

As the skilled artisan would acknowledge both autologous (self), allogeneic (intra-species), and xenogeneic (inter-spectes) products would be within the scope of the present invention

Embryonic stem cells (ESCs)

In the present context the term "embryonic stem cells" (ESCs) relates to cells that are isolated from the inner cell mass of early mammalian blastocyst stage embryos, and which are pluripotent cells able to differentiate to cells of all three germ layers in vitro

Under a microscope, ES cells appear with high nuclear/cytoplasmic ratios, prominent nucleoh, and compact colony formation with poorly discernable cell junctions

Mammalian ES cells may express one or more of the stage specific embryonic antigens (SSEA) 3 and 4, and markers detectable using antibodies designated Tra 1 60 and Tra-1- 81 Undifferentiated human ES cells also typically express Oct-4 and TERT, as detected by RT-PCR, and alkaline phosphatase activity detected by enzyme assay Differentiation of ES cells in vitro typically results in the loss of these markers (if present).

The present invention provides stem or progenitor cells such as but not limited to one or more identifiable types of mammalian embryonic stem cells and/or their lineage- committed descendant ceils and/or their partially differentiated offspring cells, with or without completely differentiated cells. Identifying markers include, but are not limited to, SSEA-4, TRA-1-60, TRA-1-81, Oct3/4, c-Kit, flt3, Sox2, and Nanog.

Accordingly, for the purposes of this disciosure, mammalian multipotent (alt. : piuripotent) stem cells obtained from a mammalian blastocyst, or an established celi line originally derived from a blastocyst (alt. : from an established line of mammalian embryonic stem cells) may be referred to as stem or progenitor ceils.

Cardiomyocyte like cell

For the purposes of this disclosure, a "cardiomyocyte like cell" is defined as a cell, which have any of the particular properties referred to in this disclosure. For example, they may

• be end-stage cardiomyocytes • be cardiac precursors capable of proliferation in vitro and capable of differentiation in vitro or in vivo into cells having any of the afore listed features

• express one or more of the following markers from an endogenous gene: GATA-4, Nkx2.5, MEF2C, atrial natriuretic factor (ANF), cardiac myosin heavy chain, alpha-cardiac actinin, alpha-sarcomeπc actin, connexin 43, desmin, N-Cadheπn, cardiac troponin I (cTnl), and cardiac troponin T (cTnT).

• express three or more of the other phenotypic markers referred to m this disclosure • be produced by differentiation of mammalian stem or progenitor cells

• have the same genome as an established mammalian embryonic stem cell line

• express spontaneous periodic contractile activity

• express other characteristics of cardiomyocytes, such as ion channel or appropriate electrophysiology.

The cell populations of this invention may be enriched to the point where essentially all of the cells have the characteristics referred to. The cell populations of this invention may be enriched to the point where up to 5, 20, or 60% of the cells have the characteristics referred to

In one embodiment the cardiomyocytes describe herein express the cardiac-specific myosin heavy cham.

In one embodiment the cardiomyocytes describe herein have a spontaneous contractile activity.

Certain ceils of this invention demonstrate spontaneous periodic contractile activity This means that when they are cultured in a suitable tissue culture environment with an appropriate Ca" concentration and electrolyte balance, the ceils can be observed to contract in a periodic fashion across one axis of the cell, and then release from contraction, without havmg to add any additional components to the culture medium.

Stem or progenitor ceil derived cardiomyocytes and their precursors typically have at least one of the following cardiomyocyte specific markers.

Cardiac troponin I (cTnl), a subunit of troponin complex that provides a caiαum- sensitive molecular switch for the regulation of striated muscle contraction. Cardiac troponin T (cTnT). Atrial natriuretic factor (ANF), a hormone expressed in developing heart and fetal cardiomyocytes but down-regulated in adults It is considered a good marker for cardiomyocytes because it is expressed in a highly specific manner in cardiac cells but not skeletal myocytes

The cells will also typically express at least one (and often at least 3, 5, or more) of the following markers: sarcomeπc myosin heavy chain (MHC) Titin, tropomyosin, [alphaj-actinin, and desmin

GATA-4, a transcription factor that is highly expressed in cardiac mesoderm and persists in the developing heart. It regulates many cardiac genes and plays a role in cardiogenesss

Nkx2.5, a cardiac transcription factor expressed in cardiac mesoderm during early mouse embryonic development, which persists in the developing heart

MEF-2A, MEF 2B, MEF-2C, MEF-2D; transcription factors that are expressed in cardiac mesoderm and persist in developing heart

N-cadheπn, which mediates adhesion among cardiac cells

Connexin 43, which forms the gap junction between cardiomyocytes. [beta]l-adrenergιc receptor creatine ksnase MB (CK-MB) and myoglobin, which are elevated in serum following myocardial infarction.

Tissue-specific markers can be detected using any suitable immunological technique, such as flow immunocytochemistry or affinrty adsorption for cell-surface markers, immunocytochermstry (for example, of fixed cells or tissue sections) for intracellular or cell-surface markers, Western blot analysts of cellular extracts, and enzyme-linked immunoassay, for cellular extracts or products secreted into the medium The expression of tissue specific gene products can also be detected at the mRNA level by Northern blot analysis, dot-blot hybridization analysis, or by reverse transcriptase initiated polymerase chain reaction (RT-PCR) using sequence-specific primers in standard amplification methods. Once markers have been identified on the surface of ceils of the desired phenotype, they can be used for immunoselection to further enrich the population by techniques such as immunopanning or antibody-mediated fluorescence-activated cell sorting. Under appropriate circumstances, stem or progenitor cell-derived cardiomyocytes often show spontaneous periodic contractile activity This means that when they are cultured in a suitable tissue culture environment with an appropriate Ca^"1 ' concentration and electrolyte balance, the cells can be observed to contract across one axis of the cell, and then release from contraction, without having to add any additional components to the culture medium Individual cells may show spontaneous periodic contractile activity on their own, or they may show spontaneous periodic contractile activity in concert with neighbouring cells in a tissue, cell aggregate, or cultured cell mass.

There are no particular characteristics that are definitive for cells of the cardiomyocyte lineage or their precursors, but it is recognized that in the normal course of ontogeny, undifferentiated embryonic stem celis first differentiate into mesodermal cells, and then through various precursor stages to a functional (end-stage) cardiomyocyte. Accordingly, for the purposes of this disclosure, a "cardiomyocyte-like-cell" is defined as a cell that is capable (without dedifferentiation or reprogramming) of giving rise to progeny that include cardiomyocytes, and which expresses at least one marker (and preferably at least 3 or 5 markers) from the following list, cardiac troponin I (cTnl), cardiac troponin T (cTnT), sarcomeric myosin heavy chain (MHC), GATA-4, Nkx2.5, N-cadherin, [beta] l-adrenergιc receptor ([beta] l-AR), ANF, the MEF-2 family of transcription factors, creatine kinase MB (CK-MB), myoglobin, or atrial natriuretic factor (ANF). Throughout this disclosure, techniques and compositions that refer to "cardiomyocyte-hke-ceMs" or "cells of the cardiomyocyte lineage" can be taken to apply equally to cells at any stage of cardiomyocyte ontogeny without restriction, as defined above, unless otherwise specified. The cells may or may not have the ability to proliferate or exhibit contractile activity. In one embodiment the cardiomyocytes described herein express at least 3 markers selected from the group consisting of cTnl, cTNT, sarcomeπc myosin heavy chain (MHC), GATA-4, Nkx2.5, N-cadheπn, [betajl-AR, ANF, MEF-2A, MEF-2B MEF-2C, MEF-2D, creatine kinase MB (CK-MB), myoglobin, or atrial natriuretic factor (ANF).

In one embodiment the cardsomyocytes described herein express the cardiac-specific myosin heavy chain.

In one embodiment the cardiomyocytes describe herein have a spontaneous contractile activity

Certain cells of this invention demonstrate spontaneous periodic contractile activity. This means that when they are cultured in a suitable tissue culture environment with an appropriate Ca" concentration and electrolyte balance, the cells can be observed to contract in a periodic fashion across one axis of the cell, and then release from contraction, without having to add any additional components to the culture medium.

Stem and progenitor cell In the present context the term "stem cells" relates to cells that are pluπpotent or multipotent cells, which are able of both self-renewal and the ability to differentiate into more specialized cell types.

The present invention also provides stem or progenitor cells such as but not limited to one or more identifiable types of mammalian aduit stem cells and/or their hneage-committed descendant cells and/or their partially differentiated offspring cells, with or without completely differentiated cells Identifying markers include, but are not limited to, cKit, Seal, AC133, MDRl, CD34, ιsl-1, Kι67, IsIl, and the capacity to exclude Hoechst 33342 dye (so-called side population (SP) cells).

Accordingly, for the purposes of this disclosure, mammalian multipotent stem cells obtained from a mammalian heart, or an established cell line originally derived from such cells may be referred to as stem or progenitor cells.

Mammalian multipotent haematopoietic stem cells, e.g. obtained from mammalian bone marrow or an established cell line originally derived from such cells are also within the context of stem or progenitor cells. Mesenchymal stem cells, that is nonhematopoietic multipotent stem cells of the mammalian bone marrow, or an established cell line originally derived from such cells may be referred to as stem or progenitor cells

Endothelial progenitor ceils obtained from mammalian blood or bone marrow, or an established cell iine originally derived from such ceils may be referred to as stem or progenitor cells.

In the present context the term "cardiac stem cell" relates to stem cells obtained from the heart expressing one or more of the following markers, Sca-1, c-kit and MDRl

In one embodiment the stem celis are cells capable of efficient engraftment in the myocardium for treatment of cardiac diseases

In one embodiment, the stem cell is selected from the group consisting of embryonic stem cells, mesenchymal stem cells, endothelial progenitor cells, haematopoietic stem celis, cardiac stem cells and mammalian multipotent stem cells obtained from a mammalian heart

The model on which the present invention is based originates form a murine embryonic stem cell line, thus in a presently preferred embodiment such particular cells is embedded by the present invention Thus, in one embodiment, the present invention relates to stem cells which are murine embryonic stem cell lines, preferably AB2.2 and/or 66/3. As the skilled addressee would recognise, any embryonic stem cell iine would be suitable for the purpose of the present invention.

SlOO

SlOO proteins have a strongly preserved amino acid sequence with high homology within the SlOO family SlOO proteins are localized in the cytoplasm and/or nucleus of a wide range of cells, and involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation SlOO genes include at least 16 members which are located as a cluster on chromosome Iq21, and the gene coding for SlOOB located on 21q22

By S100A4 protein within the meaning of the invention are meant the complete native protein, mutants of the S100A4 protein, peptides (fragments) of the S100A4 protein or peptide mutants (with a homology of at least 60%, preferably at least 90%, and particularly preferably at least 95%) as well as recombinant!¹/ prepared protein (including a 6xHιs-tagged protein) or peptides or mutants or synthetic peptides or mutants

According to a particular embodiment of the invention the SlOO polypeptide is selected from the group of S100A4, SlOOAl, SlOOB, and S100A6

In a presently preferred embodiment, the SlOO polypeptide is S100A4 (SEQ. ID. NO. 1) or functional variants thereof

Because of the species-general homology of the SlOO proteins according to the invention, proteins and sequences coding for them of any species (such as e.g. rat, mouse, pig, cattle, etc.) can be used, the corresponding human sequences being most preferred.

Cardiomyogemc compositions of the present invention can suitably include other substances that are appropriate or desirabie for cardiomyogenesis These substances can include any other cardiomyogemc compounds, growth hormones, growth factors, biologically active segments of growth factors, interleukins, polysaccharides, or mixtures thereof

In one embodiment, the SlOO polypeptide of the present invention is cardiomyogemc.

SlOO polypeptides of the present invention should be added to a final concentration in the culture of 0.01-1000 ug/ml, such as 0.01-500 μg/ml, 0.1-250 ug/ml or 0.5μg/ml - lOOμg/mi.

SlOO should preferably be used/delivered in a multimeπc form, excluding monomers. Thus in one embodiment the S lOO polypeptide is dimeπc or multimeπc, and in a most preferred embodiment the SlOO polypeptide is multimeπc.

In regards to the in vitro methods of the present invention, the SlOO polypeptide ss preferably added on day 7 after aggregation of EBs in hanging droplets or later.

S100A4

The protein dubbed S100A4 belongs to the SlOO family of proteins that bear two caicium- binding sites including a canonical EP-hand motif. The SlOO family proteins are primarily localized mtracellujariy and involved in a wide range of biological effects including cell survival, induction of metastasis, chemotaxia and contractility.

S100A4 may function in motility, invasion, and tubulin polymerization Chromosomal rearrangements and altered expression of this gene have been implicated in tumor metastasis. Alternative splicing of the 5' UTR results in two gene products.

Specifically, S100A4 is an HkDa protein that enhances metastasis of several types of cancer cells by interaction with cytoskeietal proteins involved in cell motility. In addition, S100A4 is secreted and has important extracellular functions Thus, it stimulates angiogenesis, endothelial cell motility and metailoproteinase activity, as weli as astrocytic tumor cell motility. The molecular mechanisms whereby S100A4 ehcits cellular responses remain largely unknown.

The present application shows that S100A4 is a new PE secreted factor enhancing cardiomyogenesss in vitro in a paracrine fashion. Multimeric S100A4 induces expression of cardiomyogenic transcription factor genes Nkx2.5 and MEF2C in differentiating ESCs which leads to a developmental stage dependent promotion of cardiomyogenesis.

In one embodiment, the present invention provides cardiomyogenic compositions, which include an S100A4 component. A preferred S100A4 component is an S100A4 protein or a functional fragment thereof, preferably, a human S100A4 protein or a functional fragment thereof. U S Pat No 5,801,142, which describes the sequence of human S100A4 protein and how to make a human S100A4 protein and fragments thereof, is incorporated herein by reference.

S100A4 should be used/dehvered in a multimeric form, excluding monomers, dimers, and tπmers The effective concentration of a muitimeπc fraction of S100A4 calculated per monomer will likely be approximately 9OnM in cell cultures. The in vivo concentrations measured in human plasma from cancer patients with excessive S100A4 production were in the range of 30-100ng/ml multsmeπc S 100A4 and 30-80ng/m! dirneπc S100A4 protein. Monomeπc forms were not detected in human plasma nor in the recombinant S100A4 protein solution when purified according to our protocol.

When recombinant S100A4 protean is purified and size fractionated according to protocol, there will neither be significant amounts of contaminating multimers in the dimer fraction nor significant amounts of contaminating dimers in the multimeπc fraction. As the "meπc" structure of S100A4 is dynamic, contaminations may appear in time, but should only amount to few percent (less than 5- 10%). A cardiomyogenic composition of the present invention can include an Ξ100A4 component, e.g., an S100A4 protein, a functional fragment or analog of an S100A4 protein, as well as nucleic acid molecules encoding such proteins, fragments or analogs.

The cardiomyogenic compositions of the present invention can include other substances that are appropriate or beneficial for cardiomyogenesis. These substances can include any other cardiomyogenic compounds, growth hormones, growth factors, biologically active segments of growth factors, interleukins, polysaccharides, or mixtures thereof. Specific examples include, but are not limited to, hepatocyte growth factor, insuhn-hke growth factor-l, SPARC (Secreted Protein, Acidic, Rich in Cysteine), intercellular morphogenetic signaling factors of the Tgf-β/Bmp and Fgf families, hedgehog, wingless, and notch proteins, and the ιnterleukιn-6 family members, including leukemia inhibitory factor (LIF) and cardiotrophin-I

Further in accordance with the present invention, the S100A4 components are preferably provided in a pharmaceutically acceptable carrier. The carrier can be liquid, semi-solid, e.g. pastes, or solid earners. Except insofar as any conventional media, agent, diluent or carrier is detrimental to the recipient or to the therapeutic effectiveness of cardiomyogenic substances contained therein, its use in practicing the methods of the present invention is appropriate. Examples of earners include oils, water, saline solutions, gel, lipids, liposomes, resins, porous matrices, binders, fillers and the like, or combinations thereof.

In accordance with the present invention, the S100A4 components can be combined with the carrier in any convenient and practical manner, e.g., by admixture, solution, suspension, emulsification, encapsulation, absorption and the like, and can be made in formulations suitable for injections, implantations, inhalations, ingestions and the like

In a further aspect of the invention, a cardiomyogenic composition as described heremabove is administered to a subject to enhance cardiomyogenesis. Thus, the present invention provides methods of enhancing cardiomyogenesis in a subject in need thereof by administering to the subject a therapeutically effective amount of an S100A4 component, preferably, with a pharmaceutically acceptable carrier.

The cardiomyogenic compositions of the present invention can be administered to the subject by standard routes, including the oral, nasal, topical, transdermal, parenteral (e.g., intravenous, intraperitoneal, intradermal, subcutaneous or intramuscular) In addition, the cardiomyogenic compositions can be introduced into the body, by injection or by surgical implantation or attachment, proximate to a myocardial site such that a significant amount of a cardiomyogemc substance is able to enter the site, preferably, in a controlled release fashion, by direct diffusion to induce the cardiomyogenesis

The dosage of a cardiomyogemc S100A4 component depends on the disease state or 5 condition being treated and other clinical factors, such as weight and condition of the subject, the subject's response to the therapy, the type of formulations and the route of administration. The precise dosage to be therapeutically effective and non-detnmentai can be determined by those skilled in the art As a genera! rule, the therapeutically effective dosage of an S100A4 protein or functional fragments thereof can be in the range of about

10 0 5μg to about 2 grams per unit dosage form. A unit dosage form refers to physically discrete units suited as unitary dosages for mammalian treatment: each unit containing a pre determined quantity of the active material calculated to produce the desired therapeutic effect in association with any required pharmaceutical carrier. The methods of the present invention contemplate single as well as multiple administrations, given either

15 simultaneously or over an extended period of time.

As used herein, the term "functional fragment" refers to a fragment of an S100A4 protein, having a sufficient length to be cardiomyogemc. According to the present invention, a functional fragment of an S100A4 protein can be as short as 6 amino acid in length, 20 preferably, as small as 8 or 9 amino acid in length, more preferably, as small as about 15 amino acid in length.

Peptide analogs of functional fragments of a S100A4 protein are aiso contemplated by the present invention. "Peptide analogs" refers to variants of an S100A4 peptide having 25 substitutions, insertions or deletions of one or more amino acid residues, or having modifications on the side groups of amino acid residues and which maintain the intended function.

It seems that 5I00A4 can in fact mediate signals via a yet unknown surface receptor and 30 via several intracellular signalling proteins including p53, methionine aminopeptidase 2, nonmuscie myosin II, and others.

Toxicology studies

Epidemiological studies are devoted to identifying and characterizing the πsk associated 35 with exposures to potential agents in our environment. Although most chemical agents at sufficiently large doses may be toxic, not all present a significant risk to human health. Accordingly, the essence of the science of toxicology is defining the line that distinguishes a risk from a residue This requires systems in which to evaluate these agents, which mimics the in vivo situation. Obtaining cardiomyocyte like cells for such a study from live mammals is an ethical issue in itself, thus cell lines that mimics the in vivo situation is of high value to epidemiological studies, thus in one aspect, the present invention relates to a method for evaluating toxicology in an in vitro system comprising

stimulating in vitro an inocuium of stem cells obtained from a mammal with a SlOO polypeptide to produce cardiomyocyte like cells

subjecting said cardiomyocyte like cells to a compound of interest

determining the effect of said compound composition on the stimulated cardiomyocyte like cells to estimate the effect of said compound on a heart tissue.

Detection of Cardiomyogenesis

After administration of the polypeptides and/or inoculums of the present invention in vivo or in vitro, the induction of cardiomyogenesis can be detected by a number of different methods including, but not limited to: detecting expression of cardiomyocyte-speαfic proteins, detecting expression of cardiomyocyte-specific transcription factors, detecting expression of proteins essential for cardiac muscie function, detecting electrophysiological characteristic of cardiomyocytes, and detecting the beating of cardiomyocytes. Specific examples of cardsomyocyte-speαfsc proteins and cardiomyocyte -specific transcription factors are described herein.

General

"Cardiomyogenesis," as used herein, refers to the differentiation of progenitor or precursor cells into cardiac muscle cells (i.e., cardiomyocytes) and the growth of cardiac muscle tissue. Progenitor or precursor cells can be pluπpotent stem cells such as, e g., embryonic stem cells. Progenitor or precursor cells can be cells pre-committed to a cardiomyocyte lineage (e.g., pre-cardiomyocyte cells) or cells that are not pre-committed (e.g., multipotent adult stem cells).

"Cultuπng," as used herein, refers to maintaining celis under conditions in which they can proliferate, differentiate, and avoid senescence. For example, in the present invention, cultured embryonic stem cells proliferate and differentiate into cells of a cardiomyocyte lineage. Cells can be cultured in growth media containing appropriate growth factors, i.e., a growth factor cocktail containing proteins which facilitate or enhance the development of cardiomyocytes

As will be apparent, preferred features and characteristics of one aspect of the invention may be applicable to other aspects of the invention.

Throughout this specification the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated element, integer or step, or group of elements, integers or steps, but not the exclusion of any other element, integer or step, or group of elements, integers or steps.

It should be understood that any feature and/or aspect discussed above in connection with the compositions/polypeptides according to the invention apply by analogy to the cells/ inoculum according to the invention and vice versa.

It should be understood that any feature and/or aspect discussed above in connection with the methods according to the invention apply by analogy to the uses according to the invention and vice versa.

With respect to the above description of the various aspects of the present invention and of the specific embodiments of these aspects it should be understood that any feature and characteristic described or mentioned above in connection with one aspect and/or one embodiment of an aspect of the invention also apply by analogy to any or all other aspects and/or embodiments of the invention described

The invention will hereinafter be described by way of the following non-limiting Figures and Examples.

Examples

Statistical analysis All data are presented as the arithmetic mean ± standard deviation. Statistical significance was evaluated using one sample Student's t-test and values of P<0.05 were considered to indicate statistical significance. Example 1

Culture of AB2.2 and 66/3 ESCs and LIF transgenic SNL76/7 fibroblasts, EB formation, and PrE and PE isolation.

5 All cells were cultured at 37°C with 5% CO_? in a humidified incubator.

ES cells were maintained in DMEM (Gsbco, 41965) supplemented with 15% foetal calf serum (FCS) from HyCSone (SH30070.03), 0.1 mmol/l beta-mercaptoethanol, 0.05 mg/ml streptomycin, and 0.03 mg/m! penicillin on 8xlθVcm⁷ mitomycin C-inactivated SNL76/7

10 fibroblasts in 0.1 % gelatine coated tissue culture dishes. Confluent ES ceils, split 1 : 2 on the day before aggregation, trypsimsed, and re-suspended at a density of 4 x 1O¹ cells/ml in DMEM supplemented with 15 % FCS (Sigma F7524) were aggregated in 20 μl hanging- drop cultures on lids of bacterial culture dishes. This day is termed "day 0" Cultures were incubated for 4 days

15

Embryoid bodies were then plated onto 0 1 % gelatine coated 10cm, or 6-well, tissue culture dishes in DMEM supplemented with 15% (Sigma F7524), 0.1 mmol/l beta- mercaptoethanol, 0.05 mg/ml streptomycin, and 0.03 mg/m! penicillin. The day of EB plating is termed "day 4". Formation of endoderm, mesoderm, and beating cardiomyocytes

20 was monitored from 2ay 4by visual inspection of embryoid bodies under the microscope with phase contrast and dark-field optics and by video microscopy.

With the protocol described here, cardiomyoblasts differentiate to beating cardiomyocytes starting from day 7. 25

S100A4 is secreted by embryoid body-derived parietal endoderm cells

As PE conditioned medium is known to support cardiomyogenesis in embryoid bodies, we searched for new factors secreted by these cells that are able to enhance 30 cardiomyogenesis.

Culture of parietal endoderm-like cells

Cells resembling parietal endoderm were isolated from wild-type embryoid bodies at day 35 16 after aggregation of ES ceils Embryoid bodies were partially trypsinised for 5 mm at 37 ⁰C, suspended in DMEM supplemented with 15% (Sigma F7524), 0 1 mmol/l beta- mercaptoethanol, 0.05 mg/ml streptomycin, and 0.03 mg/ml penicillin, and ceils were sequentially plated over a period of 6 hours. The fraction of cells adhering to gelatinised culture dishes after 2 and 3 hours were virtually free of any other cell type and were propagated by l - 2 splitting over several weeks. Supernatants were mixed 1 : 1 wsth fresh medium and used to feed embryoid bodies every other day from day 4 to 25

Primitive endoderm ( PrE) was generated from ESCs cultured in suspension in the absence of LIF for 3 days.

PE cells and EBs were cultured in serum free DMEM medium supplemented with 2mmol/S glutamsne, 0.05 mg/m! streptomycin, and 0.03 mg/m! penicillin for testing of S 100A4 secretion, and supernatant of intact cells was collected. Ceil culture supernatants were obtained from cultures with equal cell numbers to ensure comparable concentrations of growth factors.

Western blot analysis was performed according to standard procedures using antibodies specific for S100A4 Supernatants of EBs, PrE and PE cells incubated with serum free medium, were collected and concentrated using ultra centrifugal devices (Amicon, Millspore). Blotted proteins were incubated with polyclonal antι-S 100A4 antibody ( l ' 4000) overnight, with H RP conjugated anti-rabbit antibody ( I ¹ IOOOO, Jackson Immunoresearch) for 90 minutes, and detected with ECL solution and exposure to Hyperfslm (Amersham Bsosciences) .

mRNA was isolated from ESCs, PE and EBs day 7, 8, 10 and 11 with the Qiagen RNeasy kit. cDNA was synthesized with Superscript II reverse transcriptase (Invitrogen, 18064- 022). Semi-quantitiative RT-PCR was performed with Taq polymerase (Fermentas) and primers as described in Table 1. Numbers of cycles for each pair of primers was carefully determined by several preliminary experiments and chosen so that none of the obtained signals were saturated.

Western blot analysis of serum free conditioned media of Pi E or PE revealed that Ξ 100A4 is secreted specifically by PE but not by PrE.

A specific band at approximately 11.5 kDa was detected in PE conditioned medium ( Fig IA).

In EBs expression of S 100A4 mRNA was found already on day 7, when cardiomyocytes are developing, and increased until day 11 (Fig I B).

S 100A4 protein is also secreted by EBs into serum free culture medium, low levels were detectable in supernatants of day 8 9 EBs, and higher levels in day 12- 13 EBs ( Fig 1C) . Example 2

S100A4 protein is localized to vesicle like structures of cultured PE cells PE cells were isolated and cultured as described. Cells were fixed in 96% ethano! at -20⁰C for 20 minutes and stained with antι-S100A4 antibody for 90 minutes, and consecutively with TRITC-conjugated secondary antibodies (Sigma T 5268, 1 :80) for 90 minutes. Nuclei were stained with DAPL Photomicrographs were taken on a Zeiss confocal microscope. Immunofluorescence microscopy of cultured PE cells revealed an intracellular localization in vesicle like structures (Fig 2).

Example 3

Recombinant S100A4 protein enhances cardiomyogenesis in embryoid bodies

To test if S100A4 is able to support cardiomyogenesss in EBs, we added recombinant human 6xHιs tagged S100A4 protein to EBs.

EBs were cultured in the presence of 0,5μg/ml - lOOμg/ml of recombinant S100A4 or purified dimeric or multimeπc S100A4, PE-conditioned medium, mixed 1 : 1 with fresh EB differentiation medium starting day 6 or day 7 as indicated. PE was removed from EBs on day 6 as described and cultured with conditioned media from PE cells, and/or 50μg/ml recombinant S100A4, respectively, from day 7 on. EBs were treated with neutralizing anti S100A4 antibody at 1 : 100 dilution. Cardiomyogenesis was compared by counting EBs with beating cardiomyocytes daily. Percentage of EBs with beating cardiomyocytes was normalized to control experiments. The surface of beating EBs was determined using digital camera generated videos of beating EBs and subsequent analysis of beating area with Adobe Photoshop 7.0 software.

Beating cardiomyocytes developed significantly faster and maximum percentage of EBs with beating cardiomyocytes was enhanced from 70% in control cultures to 90% in S100A4 treated EBs (Fig 3A).

To compare relative cardiomyocyte numbers in EBs stimulated with S100A4 with control EBs, we measured percentage of beating area in EBs by video-microscopy. On day 8, 24 h after addition of S100A4 to the culture medium, 8 5% of the EB area contained beating cells, in contrast to 3% in control EBs. On day 16 when maxima! cardiomyocyte numbers were achieved, 7% of the EB area contained beating ceils, whereas with lOOμg/ml S100A4 12% of EB area was beating, showing that S100A4 accelerates cardiomyogeπesis and significantly enhances cardiomyocyte output (Fig 3B),

Example 4

S100A4 affected expression of cardiac marker genes.

mRNA was isofated as described in example 1 of day 11 control EBs and EBs treated with 50μg/ml S100A4 ( + ) or lOOμg/ml S100A4 ( + + ) for 4 days, and subjected to RT-PCR with primers specific for Nkx2.5, Mef2C, MHCu, brachyury (T), AFP and GAPDH as a loading control, as listed in Table 1. Upon treatment with S100A4, cardiac markers Nkx2.5, Mef2-C and MHCu were specifically upregulated, whereas mesodermal marker T and endodemnal marker AFP were not affected.

Tablel

Gene 5 ^'primer 3 'primer

AFP 5 ^' -GCT CAC ACC AAA GCG TCA AC-3 ^' 5 ^' -CCT GTG AAC TCT GGT ATC AG-3 ^'

GAPDH 5 ^' -CGT CTT CAC CAC CAT GGA GA-3 ^' 5 ^' -CGG CCA TCA CGC CAC AGT TT-3 ^'

MEF2C 5'-GGC CAT GGT ACA CCG AGT ACA ACG 5'-GGG GATCCCTGTGTTACCTGCACT

AGC-3' TGG-3'

MHCu S^'-GGAAGAGTGAGC GGCGCATCA 5^'-CTG CTG GAG AGG TTA TTC CTC G-S ^'

AGG-3^'

Nkx2.5 5'-CAGTGG AGCTGG ACA AAG CC-3' 5'-TAG CGA CGG TTC TGG AAC CA-3'

S100A4 S'-GAGAAG GCCCTG GATGTTAT-S' 5'-CAT TTC CTT CCT GGG CTG CTT-S'

T 5 ^' -ATC AAG GAA GGC TTT AGC AAA TGG 5 ^' -GAA CCT CGG ATT CAC ATC GTG

G-3^' AGA-3^'

Example 5

Cardiomyogemc effects of S100A4 are dose dependent, inhibited by specific antibodies and dependent on S100A4 multimeπsation

To determine the optimal concentration of S100A4 enhancing cardiomyogenesis, day 7 EBs were treated with different concentrations of S100A4, ranging from 0.5μg/ml to lOOμg/ml of S100A4 which resulted in an optima! enhancement of cardiomyogenesis at a concentration of lOOμg/ml (Fig 5A). The effect of S100A4 could be inhibited by a specific antibody to Ξ100A4. Cardiomyogenesis was significantly reduced in EBs treated with anti Ξ100A4 antibody starting day 7, suggesting an important role of S100A4 in development of beating cardiomyocytes (Fig 5B). The ohgomeric but not the chimeric form of S100A4 is known to induce differentiation of neurons, therefore we tested of cardiomyogenesis is supported by a distinct form of S100A4. Addition of only 5μg/ml multimeπc S100A4 increased cardiomyogenesis 3.2x (compared to 1.9x enhancement by mixed recombinant protein) whereas the dimeπc form showed no positive effect at all (Fig 5C). This suggests that the multimeric fraction of Ξ100A4 is the most potent enhancer of cardsomyogenesis.

Example 6

The cardsomyogenic response of S100A4 is dependent on the developmental stage

To test optimal timing of the S100A4 effect on cardiomyocyte development, we added S100A4 at different stages of development. Upon addition on day 6, S100A4 was not able to enhance cardiomyogenesis, whereas addition on day 7 resulted in 1.9x enhanced percentage of EBs with beating cardiomyocytes (Fig 6) At a later time point addition of S100A4 enhanced expression of cardiac markers, but did not significantly alter percentage of beating cardiomyocytes.

Example 7

S100A4 contributes to the positive effect of parietal endoderm conditioned medium on cardiomyogenesis

We identified S100A4 as a new PE secreted factor. To investigate if S100A4 contributes to the positive effect of PE conditioned medium (PE-S) on cardiomyogenesis, we cultured EBs with antι-S100A4 antibodies, which resulted in decreased cardsomyogenesis as expected. Addition of PE-S rescued cardiomyogenesis in antι-S100A4 antibody treated EBs to the control level (Fig 7A) This suggests that PE secreted factors substitute for the need of S100A4 in cardiomyogenesis Additionally, S100A4 was not able to rescue cardiomyogenesis in EBs depleted of PE, whereas PE conditioned medium partially restored cardiomyogenesis in skinned EBs. Addition of S100A4 together with PE conditioned medium improved the positive effect on cardiomyogenesis (Fig 7B). These results suggest that PE secreted factors and recombinant S100A4 together have an additional positive effect on enhancing cardiomyogenesis in EBs and may therefore be used in combination to enhance in vitro cardiomyogenesss. Example 8

Purification of multimer

Rat and human S100A4 protein show similar activities in cultures of neurons and endothelial ceils The sequence similarity is 91%. When human S100A4 protein became 5 available this was used instead of rat protein, after confirming that their activities in cultures of cardiac myocytes were similar

Protein purification protocol

Human S100A4 cDNA was inserted through BamH l and Smal sites of the multiple cloning

10 site in the pQE-30 expression vector (Qiagen), making the protein product an N-termιπal 6xHιs tagged fusion protein. A strain of Xll-Blue cells was transformed with this vector and selected via an ampicillm resistance gene contained in the vector, and stored in 50% glycerin at -80⁰C. Inoculate Amp-plates with freeze stock of S100A4 clone; incubate ON at 40⁰C.

15 LB medium (4 x 5mJ) with lOOμg/mi ampicillm was inoculated with freeze stock of the S100A4 clone and incubated overnight in shaking incubator, 37°C, 200-250rpm. The following day, the overnight culture was added to new LB medium containing lOOμg/ml ampicillm, in four baffled 11 flasks (400ml LB medium in each bottie) and grown in an incubator shaker at 200rpm and 37°C until an ODβOOnm of approximately 0.6 was

20 reached IPTG ( ImM) was added to induce production of the recombinant protein and protein synthesis was carried out 4-5h at 35°C, 200-250rpm. Bacteria were harvested by centπfugation, 20mιn at 400Og, at 4°C. Supernatant was discarded and pellets were left to drip dry and frozen at -80⁰C. Bacterial pellets were thawed and resuspended on ice in 45ml wash buffer (5OmM Tris, pH 7.5, 20OmM NaCI). Lysate was homogenized with

25 somcator lmin on ice, ahquoted to six tubes, and sonicated again 45s on ice. Homogenates were pooled and NaCI was added to a concentration of lmol/l before spmmng 45mm at 2000Og, 4°C. Supernatant was collected and sterile filtrated. Filtrated supernatant was mixed with Ni-NTA agarose resin in two SOmI tubes with 4ml Ni-NTA resin in each, and mixed end-over-end 2h at RT Each column was washed with approximately

30 100ml buffer (5OmM Tπs, pH 7.5, IM NaCI). Elution was earned out on prep-grade columns with elution buffer ( 10OmM CH₃COONa, pH 4.0, IM NaCI) and ImI fractions were collected. Protein concentration and purity was estimated by Coomassie staining and immunoblotting of SDS-PAGE geis. For unfractionated S100A4 protein, the isolated S100A4 protein was dialyze against PBS in dialysis tube (Snakeskin, 3.5kDa cut-off),

35 aiiquoted, and stored at -80⁰C.

For size fractionation into dimeπc and multimeric forms of S100A4 protein, the isolated S100A4 protein was diaiyzed against "Superdex buffer" (5OmM TπsHcl, 15OmM NaCI, pH 7.5, add ImM DTT immmediateiy before use) in dialysis tube (Snakeskin, 3. SkDa cut-off; Pierce, #68035), and treated as described below.

Size fractionation of purified S100A4 An XK16/70 column was packed with Superdex 75 Prep Grade according to manufacturer's protocol using an FPLC setup (running at lml/min). The column was equilibrated with several volumes of "Superdex buffer" + ImM DTT, at lml/min ImI unfractionated recombinant S100A4 protein was loaded, and fractionated at lml/min into 2ml fractions. Fractions with protein eluted in the first "top" were pooled as multimer and fractions with protein eluted in the second "top" were pooled as dsmer; approximately 14-16 mi top 1 and 10-12ml top 2. Protein solutions were dialysed to PBS in dialysis tube (Snakesktn, 3. SkDa cut-off). Protein fractions were concentrated approximately 10 times in two steps with Armcon Ultra 15ml, 5kD cut-off. Protein concentration was measured again and ahquots were run on 15% SDS-PAGE for Coomassie staining and Western blotting for S100A4. S100A4 protein was aliquoted and stored at -80°C.

Example 9

S100A4 will increase stem cell driven regeneration of the injured heart.

To test this, we GFP label cardiac stem cells {multipotent, clonogenic, seif-renewing resident stem cells of the heart, expressing c-kit, MDRl and/or Sea l), and inject approximately 10000 of these cells in mice hearts, at the anterior and posterior limit of an infarct area induced by ligation of coronary artery.

Some animals also receive recombinant S100A4 protein together with the cardiac progenitor cells.

Additionally, in some experiments, the cardiac progenitor cells are pre-treated with S100A4 protein.

The migration of these celis in the mouse heart is followed under basal and ischemic conditions.

The appearance of GFP-labelled cells in the intact animal heart is analyzed under basal conditions and after the ischemic episode, and the effect of SlOO protein stimulation on infarct size, cardiac regeneration, recruitment of stem cells to the heart, and differentiation of stem cells to cardiomyocyte like cells is evaluated by immunohistochemical methods. The effect of S100A4 delivery and/or pre-treatment on cardiac performance is also evaluated with echocardiography and hemodynarmcal measures

The expression of classical stem cell markers, such as cKst, MDRl, Sca-1, markers of eel! cycling such as Kι67, and cardiomyocyte markers, such as GATA-4, MEF2C, connexin 43, N-cadheπn, and cardiac myosin heavy chain, are evaluated in the infarct area and the undamaged heart tissue These experiments are directed at documenting, that administration of SlOO proteins stimulate generation of novel cardiomyocytes in the injured and/or intact animal heart

With a similar experimental protocol as the outlined above, omitting the injection of cardiac stem cells, we will similarly test effects of S100A4 protein delivery on infarct size, endogenous cardiac regeneration, recruitment of endogenous stem cells to the heart, and differentiation of endogenous stem cells to cardiomyocyte like cells

Figure legends

Figure 1 S100A4 is secreted by PE cells and EBs (A) Western blot analysis of supernatants of serum free cultured PrE or PE with anti S100A4 antibody (B) Expression of S100A4 during EB development compared to PE cells and fibroblast cells mRNA was isolated from ESCs (1), day 7 EBs (2), day 8 EBs (3), day I I EBs (4), PE cells (5), SNL 76/7 cells (6) and subjected to RT PCR with primers specific for S100A4 GAPDH, loading control (C) Western Blot analysis of S100A4 in supernatants of EBs cultured in serum free medium from day 6 to day 7 (d 6/7), from day 8 to 9 (dδ/9) or from day 12 to 13 (dl2/13) CBB, Coomassie Brilliant Blue, loading control

Figure 2 Immunofluorescence image of PE cells stained with antι-S100A4 antibody (red), nuclei (blue) Bar 20 μm

Figure 3

S100A4 modulates cardiomyogenesis in EBs (A) 66/3 ESC derived EBs were treated with S100A4 starting day 7 Cardiomyogenesis was monitored, mean values of a given day +/- one day are shown to eliminate periodic waves due to change of medium. Number of EBs checked in two independent experiments: N= 60 each. (B) Beating area of control EBs or EBs treated with lOOμg/ml S100A4 was analyzed by video microscopy on day 8 and day 16 as indicated. Number of EBs checked in two independent experiments- 30 each. Error bars, standard deviation σx_{n t}. ^¥ P-values (student ^' s t-test) <0.05 relating to control.

Figure 4

RT-PCR analysis of EBs treated with 50μg/ml S100A4 ( + ) or lOOμg/ml S100A4 ( + + ) for 4 days starting on day 7, with primers as indicated.

Figure 5

S100A4 enhances cardiomyogenesis dependent on concentration and oligomeπc form. (A) EBs were treated with recombinant S100A4 at different concentrations ranging from 0,5μg/ml to lOOμg/ml. Cardsomyogenesis was monitored from day 7 to day 13. Mean values of percentage of EBs wsth beating cardiomyocytes at day 8 are shown. (B) EBs were treated with S100A4 or antι-S100A4 antibodies starting day 7, cardiomyogenesis was monitored on day 8. (C) EBs were cultured with puπfied multimeπc or dimeric forms of S100A4 starting day 7, cardiomyogenesis was monitored on day 8. (A-C) Number of EBs checked in two independent experiments' N= 120. Error bars, standard deviation σx_{h t}. "^♦ P-values <0.05 relating to control

Figure 6

Effect of S100A4 on cardiomyogenesis is dependent on the developmental stage of EBs. EBs were treated with S100A4 starting day 6 or day 7, cardiomyogenesis was monitored on day 8 Numbers of EBs checked in 2 independent experiments. N= 120, Error bars, standard deviation σx_n , . *^■ P-values <0.05 relating to control.

Figure 7

S100A4 is not able to fully rescue cardiomyogenesis in EBs depleted of PE. (A) EBs were treated with PE-S or PE-S combined with anti-S100A4 antibody, cardiomyogenesis was monitored. Mean values of percentage of day 8 EBs with beating cardiomyocytes are shown. (B) EBs depleted of PE were treated with S100A4, PE-S or PE-S combined with S100A4 Cardiomyogenesis was monitored on day 10 (A, B). Number of EBs checked in 2 independent experiments: N= 120, Error bars, standard deviation σx_{n l}. • P-values <0.05 relating to control. Figure 8

Antι-S100A4 antibody inhibits endogenous MHC alpha expression, and MHC alpha expression induced by S100A4 or PE-S, in EBs.

Immunblot of MHC alpha isolated from EBs grown under inducated conditions. Coomassie stain was used as a control for protein loading.

References

CA02369826

UΞ6468960

Most, P., Pleger, S T., Volkers, M., Heidt, B., Boerπes, M., Weichenhan, D., Loffler, E., Janssen, P. M., Eckhart, A. D., Martini, J., Williams, M. L., Katus, H. A., Remppis, A., and Koch, W, J (2004) J CIm Invest 114(11), 1550- 1563

Most, P., Remppis, A., Pleger, S. T., Loffler, E., Ehlermann, P., Bernotat, J., Kleuss, C, Heierhorst, J., Ruiz, P., Witt, H , Karczewski, P., Mao, L., Rockman, H A., Duncan, S J., Katus, H. A., and Koch, W. J. (2003) J Biol Chem 278(36), 33809-33817

Most, P., Boerπes, M., Eicher, C, Schweda, C, Ehlermann, P., Pleger, S. T., Loeffler, E., Koch, W. J., Katus, H A., Schoenenberger, C. A., and Remppis, A (2003, a) J Biol Chem 278(48), 48404-48412

Pleger ST, Remppis A, Heidt B, Volkers M, Chuprun JK, Kuhn M, Zhou RH, Gao E, Ξzabo G, Weichenhan D, Muiler OJ, Eckhart AD, Katus HA, Koch WJ, Most P. MoI Ther. 2005 Sep 13

Claims

Claims

1, A method for producing 3 cardiomyocyte like cell in an in vitro system comprising cultuπng a stem cell with a SlOO polypeptide.

2. A method for increasing the number of cardiomyocyte like cells in vivo comprising delivering a S100A4 polypeptide to a mammal in need thereof

3. A method for increasing the number of cardiomyocyte like cells in a mammal, said method comprising the steps of

stimulating in vitro an inoculum of stem cells obtained from a mammal with a SlOO polypeptide

introducing said stimulated inoculum of stem cells to said mammal, and

allowing said inoculum of stem cells and/or their derivatives to develop in-situ as integrated cells within and about the heart,

hereby increasing the number of cardiomyocyte like celis in said mammal.

4. A method for increasing the number of cardiomyocyte like cells in a mammal comprising administering a S100A4 polypeptide and an inoculum of stem cells optionally stimulated in vitro with SlOO.

5 A method for evaluating toxicology in an in vitro system comprising

stimulating in vitro an inoculum of stem cells obtained from a mammal with a SlOO polypeptide to produce cardiomyocyte like cells

subjecting said cardiomyocyte like cells to a compound of interest

determining the effect of said compound composition on the stimulated cardiomyocyte like cells to estimate the effect of said compound on a heart tissue.

6 A method according to any of the preceding claims, wherein sasd stem cell is selected from the group consisting of embryonic stem cells, mesenchymal stem cells, endothelial progenitor cells, haematopoietic stem cells, cardiac stem cells and mammalian multipotent stem cells obtained from a mammalian heart

7. A method according to any of the preceding claims, wherein said stem cell is a murine embryonic stem eel! line, preferably AB2.2 and/or 66/3.

8. A method according to any of the preceding claims, wherein said SlOO polypeptide is 5 cardiomyogenic.

9. A method according to any of the preceding claims, wherein said SlOO polypeptide is selected from the group of S100A4, SlOOAl, SlOOB, and 5100A6.

10 10 A method according to any of the preceding claims, wherein said SlOO polypeptide is S100A4 (SEQ. ID, NO. 1) or functional variants thereof.

11. A method according to any of the preceding claims, wherein said SlOO polypeptide is added to a final concentration in the culture of 0.01- 1000 ug/ml. 15

12 A method according to any of the preceding claims, wherein said SlOO polypeptide is dimeπc or multirneπc

13 A method according to any of the preceding claims, wherein said SlOO polypeptide is 20 multimeric.

14, A method according to any of the claims 2-4, wherein increasing the number of cardiomyocyte like cells sn a mammal decreases the severity of a cardiac dysfunction in a mammal in need thereof.

25

15, A method according to claim 14, wherein said cardiac dysfunction is selected from the group consisting of acute myocardial infarction, cardiac arrythmia, cardiac hypoxia, cardiac ischemia, cardiac shock, cardiac insufficiency and congestive heart failure

30 16. A method according to any of claims 14 & 15, wherein the number of cardiomyocyte like celis is increased in the myocardium.

17. A method according to claim 7, wherein said S lOO polypeptide is added on day 7 after aggregation of ESCs in EBs or later.

35

18. A method according to claim 1, wherein one or more substance is added to supplement and/or potentiate the effect of SlOO polypeptide.

19. A medicament for the treatment of a cardiac dysfunction comprising a SlOO polypeptide formulated with a pharmaceutical acceptable adjuvant.

20. An inoculum of stem cells stimulated in vitro with a SlOO polypeptide.