WO2007030008A2

WO2007030008A2 - Ruvx holliday junction resolvase genes and methods of use

Info

Publication number: WO2007030008A2
Application number: PCT/NL2006/000450
Authority: WO
Inventors: Daphne Yvette Rainey-Wittich; Peter Egbertus Wittich
Original assignee: Keygene N.V.
Priority date: 2005-09-09
Filing date: 2006-09-11
Publication date: 2007-03-15
Also published as: WO2007030008A3

Abstract

Compositions and methods for modulating recombination in plants are provided. Compositions and methods include the nucleotide sequences of the first plant RuvX homologue that is functional in homologous recombination. RuvX is functional in the resolution of Holliday junctions. The invention finds use in the modulation of the homologous recombination. Also provided are transformed plants, plant cells, plant tissues and seeds.

Description

Title: RuvX Holliday junction resolvase genes and methods of use

TECHNICAL FIELD

[001] The present invention relates to genetic manipulation of plants, particularly to modulating recombination in plants. The present invention further relates to nucleotide sequences that encode polypeptides involved in the process of homologous recombination in plants, and to the polypeptides encoded by those nucleotide sequences. The invention also relates to nucleotide sequences and polypeptide sequences for use in altering the process of homologous recombination in plants. The invention also relates to a process for altering the process of homologous recombination of a plant cell, to a process for increasing genetic variations in plants and to processes for obtaining plants having a desired characteristic or trait.

BACKGROUND OF THE INVENTION

[002] Plant breeding essentially relies on and makes use of genetic variation that occurs naturally within and between members of a family, a genus, a species or a subspecies. Another source of genetic variation is the introduction of genes from other organisms that may or may not be related to the host plant.

[003] Allelic loci or non-allelic genes which constitute or contribute to desired quantitative (e.g. growth performance, yield, etc.) or qualitative (e.g. deposition, content and composition of seed storage products; pathogen resistance genes: etc.) traits that are absent, incomplete or inefficient in a species or subspecies of interest are typically introduced by the plant breeder from other species or subspecies, or de novo. This introduction is often done by crossing, provided that the species to be crossed are sexually compatible. Other means of introducing genomes, individual chromosomes or genes into plant cells or plants are well known in the art. They i include cell fusion, chemically aided transfection (Schocher et al., 1986. Biotechnology 4: 1093) and ballistic transformation (McCabe et al . , 1988, Biotechnology 6: 923), microinjection (Neuhaus et al., 1987, TAG 75: 30), electroporation of protoplasts (Chupeau et al . , 1989, Biotechnology 7: 53) or microbial transformation methods such as Agrobacterium mediated transformation (Horsch et al., 1985, Science 227: 1229; Hiei et al., 1996, Biotechnology 14: 745). [004] However, when a foreign genome, chromosome or gene is introduced into a plant, it will often segregate in subsequent generations from the genome of the recipient plant or plant cell during mitotic and meiotic cell divisions and, in consequence, become lost from the host plant or plant cell into which it had been introduced. Occasionally, however, the introduced genome, chromosome or gene physically combines entirely or in part with the genome, chromosome or gene of the host plant or plant cell in a process which is called recombination . [005] Recombination involves the exchange of covalent linkages between DNA molecules in regions of identical or similar sequence.

[006] From a breeder's perspective, the limits within which naturally occurring homologous recombination occurs, therefore, define a genetic barrier between species, varieties or lines, in contrast to induced (or repressed, for that matter) homologous recombination which can break this barrier. Homologous recombination is thus of great importance for breeding in genaral and in particular for plant breeding. Accordingly there is a need for a process for influencing or controlling, such as enhancing or inhibiting, the frequency of homologous recombination in plants. In particular, there is a need for a process of increasing homologous recombination to significantly shorten the length of breeding programs by reducing the number of crosses required to obtain an otherwise rare recombination event.

[007] Faithful repair of DNA damage such as chromosomal double-strand breaks (DSBs) is necessary for the maintenance of genome integrity. Homologous recombination (HR) is used to repair double strand breaks in DNA. Homologous recombination occurs both somatic and meiotic. The mechanism of HR has been studied in prokaryotes as well as eukaryotes providing a wealth of information on the subject. In E. coll, DSB repair occurs exclusively by HR (Dudas et al., 2003). The basic steps are well known in E. coll and follow the basic mechanism described here : i. initiation of HR by a DNA double-strand break and/or single-strand DNA formation by the RecBCD complex; ii. exchange of DNA strands, including homology recognition and strand displacement, done by RecA-like proteins; iii. heteroduplex extension, with branch or bubble migration, performed by RuvA plus RuvB or RecG to yield a recombination intermediate, a four- way DNA junction named the Holliday junction; and iv. resolution of this heteroduplex Holliday junction by the endonuclease RuvC.

[008] The key intermediate in both homologous and site- specific recombination is the Holliday junction (HJ) . HJs are four-stranded DNA junctions that occur during meiotic recombination or in mitosis from the rescue of stalled replication forks (Holliday, 1964; Postow, 2001) . The bacterial proteins RuvA/RuvB and RuvC/RusA, referred to as resolvases, are responsible for the migration and resolution of HJs. In 1996, Gilbertson and Stahl proposed a modified model of DSB repair intermediates. Resolution of the junctions can occur in two directions with respect to flanking markers, either restoring the parental DNA arrangement or generating a crossover arrangement (Sekiguchi et al., 1996). In bacteria, RuvC binds specifically as a dimer to HJs and promotes resolution of these junctions.

[009] The Holliday junction resolving enzymes bind and cleave the four-way Holliday junctions created during repair and rearrangement of DNA by the process of homologous recombination (Lilly and White, 2001) . These junctions are formed by strand exchange between homologous duplex DNA molecules. Subseguent branch migration of the Holliday junction generates stretches of heteroduplex recombinant DNA. The introduction of paired nicks in opposing strands by a structure-specific endonuclease, or junction resolving enzyme, and subsequent ligation ends the recombination process. Unresolved and partially resolved junctions are potent mutagenic sites, therefore junction resolution must occur with high structure-specificity, and cleave both opposing strands during the lifetime of the enzyme-DNA complex (Middelton et al. , 2004) . [010] Genetic and biochemical studies indicate that branch migration and resolution are coupled by direct interactions between the three RuvABC proteins, possibly by the formation of a RuvABC complex (West, 1997) . A RuvC homolog, CCEl (cruciform cutting endonuclease) , has been reported for mitochondria of Saccharomyces cerevisiae (White and Lilley, 1997) and for the fission yeast Schizosaccharromyces pombe (Whitby and Dixon,

1997). These so-called cruciform-cutting enzymes are unique to S. cerevisiae and S. pombe and have, as yet, no other eukaryotic orthologs. [011] The endonucleases Mus81/Mms4-Emel and XPF-MEI- 9/MUS312 are structurally related to the archaeal resolvases and were found to be involved in crossover formation in S. pombe and Drosophila, respectively. Mutants of mus81 have been shown to accumulate HJs in budding yeast (Heyer et al., 2003) . Unlike bacterial resolvases, Mus81/Mms4 has been shown to cleave DNA at both asymmetric and symmetric sites forming nicked duplexes that cannot be re-ligated (Whitby and Dixon, 2003) .

[012] The Mus81/Mms4 complex (Mms4 is the S. cerevisiae ortholog of the Emel gene in S. pombe in the literature there are alternating references to Mus81-Emel and Mus81-Mms4) has been proposed as the HJ resolvase in S. cerevisiae (Boddy et al., 2001; Chen et al., 2001). However, this interpretation has been questioned by in vitro data showing that the purified Musδl-Emel heterodimer from humans and S. cerevisiae resolve HJs relatively poorly and much prefer to cleave 3 ' flaps and replication fork substrates (Ciccia et al._r 2003, Doe et al._r 2002; Whitby and Dixon, 2003; Osman et al . , 2003).

[013] . These later results have led to suggestions that Musδl cleaves stalled replication forks rather than HJs in mitotic cells and promotes meiosis by removing 3 ' flaps during recombinant formation (Ciccia et al . , 2003; Constantinou et al._r 2002; de los Santos et al., 2001, 2003; Doe et al., 2002; Kaliraman et al., 2001; Osman et al., 2003) . In S. pombe, deletion of Musδl drastically reduces crossovers during meiosis (7-25 fold vs 2 fold in S. cerevisiae, Osman et al . , 2003), and was determined that the action is on a junction that forms before the HJ (Whitby and Dixon, 2003) . Thus the importance of the Musδl-Emel complex differs in level of importance to generation of crossovers in S. pombe and Drosophila as compared with S. cerevisiae. [014] RecQ helicases in combination with Type III topoisomerases have been shown to resolve HJs to non-crossover products (Heyer et al., 2003) . S. cerevisiae' s SGSl has the core of the bacterial RuvB resolvase and has been shown to regulate recombination. An sgsl deletion mutant has an elevated rate of mitotic recombination, which causes genome instability and works in combination with Top3 (encoding topoisomerase III; Hishida et al. , 2003) .

[015] Arabidopsis possesses orthologs to the Musδl/Emel and RecQ/Top3 possible HJ resolvases; the orthologs to the Mus81/Mms4 complex, RecQ helicases and topoisomerase III described above are conserved for all eukaryotes. However,

Arabidopsis also possesses another potential HJ resolvase: an Rnase H fold enzyme, a predicted functional ortholog to the RuvC resolvase (Aravind et al., 2000). [016] HJ resolvases may have evolved independently from at least four distinct structural folds (Rnase H, endonuclease, endonuclease Vll-colicin E and RusA; Aravind et al., 2000). A new family of HJ resolvases was predicted from the Rnase H fold enzyme, which is nearly ubiquitous in bacterial species and related to the RuvC family of endonucleases (Aravind et al._r 2000) . A typical protein of this family is YqfF from E. coli and Aravind et al. (2000) predict that these proteins are likely to function as an alternative to RuvC in most bacteria. This family of endonucleases is often referred to as RuvX and identified as possible HJ resolvases in Mycoplasma sp. and B. subtilis . [017] The present invention relates to the first description and identification of resolvase activity in the family of RuvX resolvases and has hitherto not been known or suggested to exist in plants. Until the present invention, RuvX was only a predicted resolvase and speculated to be one of three families of such proteins. The present invention thus provides proof of the RuvX family function as a resolvase. The present invention also provides the demonstration that plants, thus far the only eukaryotes with RuvX, use this protein to affect recombination. The present invention further provides the insight that a gene that was inherited from the chloroplast or mitochondria now functions as a nuclear encoded protein. The invention further provides for a method for affecting recombination rates by increasing or decreasing Holliday junction cutting efficiency by the use of RuvX.

SUMMARY OF THE INVENTION

[018] The present invention discloses a RuvX resolvase gene whose product is capable of binding and cleaving the four-way Holliday junction. The present invention discloses a RuvX resolvase gene that is functional in plants. The present invention also describes the first testing and confirmation of resolvase activity in the family of RuvX resolvases. [019] Control of homologous recombination by modulating RuvX provides a means to modulate the frequency and efficiency at which HR takes place. Control of this process has important implications in manipulation of crop recombination frequency in meiotic and mitotic cells, improving crop transformation targeting of recombination and reducing the number of backcrosses needed to reduce linkage drag. The present invention provides this and other advantages. The present invention is based on the observation of increased recombination frequencies using a RuvX overexpression construct in an Arabidopsis thaliana F3 population. In certain embodiments the present invention is directed to meiotic homologous recombination. In certain embodiments the present invention is directed to somatic homologous recombination [020] Generally, it is the object of the present invention to provide nucleic acids and proteins relating to RuvX. It is an object of the present invention to provide antigenic fragments of the proteins of the present invention. It is alo an object of the invention to provide transgenic plants comprising the nucleic acids of the present invention. It is also an object of the invention to provide methods for modulating, in a transgenic plant, the expression of the nucleic acids of the present invention.

[021] Therefore, in one aspect, the present invention relates to an isolated nucleic acid molecule comprising a nucleotide sequence selected from the group consisting of:

(a) the nucleotide sequence shown in SEQ ID NO: 60, 5, 7, 9, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38;

(b) a nucleotide sequence that encodes a polypeptide comprising the amino acid sequence of SEQ ID NO: 6, 8, 10, 11, 12, 13, 14, 15, 16 ,17, 18, 19, 20, 21, 22, 23, 24, 25, 26;

(c) a nucleotide sequence encoding an RuvX polypeptide, wherein said nucleotide sequence hybridizes to the nucleotide sequence shown in SEQ ID NO: 60, 5, 7, 9, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38 under stringent conditions;

(d) a nucleotide sequence encoding an RuvX polypeptide, said sequence having at least about 75% sequence identity to the nucleotide sequence shown in SEQ ID NO: 60, 5, 7, 9, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38; (e) a nucleotide sequence encoding an RuvX polypeptide having at least about 75% sequence identity to the polypeptide encoded by the cDNA corresponding to (a) ;

(f) a nucleotide sequence encoding an RuvX polypeptide having at least about 75% sequence identity to the polypeptide sequence shown in SEQ ID NO: 6, 8, 10, 11, 12, 13, 14, 15, 16 ,17, 18, 19, 20, 21, 22, 23, 24, 25, 26

(g) a nucleotide sequence comprising an antisense sequence corresponding to the nucleotide sequence in (a) , (b) , (c) , (d), (e); which is capable of modifying the process of homologous recombination in a plant cell.

[022] The functionality of the nucleotide sequences and the peptide sequences of the present invention can also be described as providing control of homologous recombination. The functionality can also be described as modulating the frequency and efficiency of homologous recombination. The functionality can also be described as providing control of the migration and resolution of Holliday junctions. The functionality can also be described as influencing the outcome of homologous recombination, preferably the outcome of homologous recombination and in particular towards cross-over. [023] The isolated nucleic acid can be DNA, RNA or cDNA and combinations thereof. [024] In another aspect, the present invention relates to recombinant expression cassettes, comprising a nucleic acid of the present invention operably linked to a promoter. [025] In another aspect, the present invention is directed to a host cell into which has been introduced the recombinant expression cassette.

[026] In a further aspect, the present invention relates to an isolated protein comprising a polypeptide having a specified number of contiguous amino acids encoded by an isolated nucleic acid of the present invention. [027] In another aspect, the present invention relates to an isolated nucleic acid comprising a polynucleotide of specified length that selectively hybridises under stringent conditions to a polynucleotide of the present invention, or a complement thereof. In some embodiments, the isolated nucleic acid is operably linked to a promoter.

[028] In another aspect, the present invention relates to a recombinant expression cassette comprising a nucleic acid amplified from a library as 'referred to supra, wherein the nucleic acid is operably linked to a promoter. In some embodiments, the present invention relates to a host cell transfected with this recombinant expression cassette. In some embodiments, the present invention relates to a protein of the present invention that is produced from this host cell. [029] In yet another aspect, the present invention relates to a transgenic plant comprising a recombinant expression cassette comprising a plant promoter operably linked to any of the isolated nucleic acids of the present invention. The present invention also provides transgenic seed from the transgenic plant.

[030] In one aspect the invention relates to the overexpression or silencing of the nucleic acids and (poly) peptides of the invention.

[031] In one aspect the invention relates to an isolated nucleic acid comprising a fragment of SEQ ID NO: 60, 5, 7, 9, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, said fragment comprising at least 15 contiguous nucleotides of the nucleotide sequence of SEQ ID NO: 60, 5, 7, 9, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38.

[032] In a preferred embodiment, the invention relates to an isolated nucleic acid of SEQ ID no: 60, excluding the section between bp 1219-1619 (see Fig 6C) ; to a RuvX polypeptide encoded by said nucleotide sequence; to a nucleotide sequence encoding an RuvX polypeptide, wherein said nucleotide sequence hybridizes to the nucleotide sequence of SEQ ID no: 60, excluding the section between bp 1219-1619; to a nucleotide sequence encoding an RuvX polypeptide, said sequence having at least about 75% sequence identity to the nucleotide sequence shown in SEQ ID NO: 60, excluding the section between bp 1219-1619; to a nucleotde sequnce that comprises the antisense sequence of SEQ IS 60, excluding the section between bp 1219-1619; and to fragment as defined herein elsewhere of SEQ ID 6, excluding the section between bp 1219-1619. [033] In one aspect the invention relates to an isolated nucleic acid comprising a nucleotide sequence comprising at least 15 nucleotides that encodes a fragment of the amino acid sequence set forth in SEQ ID NO: 6, 8, 10, 11, 12, 13, 14, 15, 16 ,17, 18, 19, 20, 21, 22, 23, 24, 25, 26.

DEFINITIONS

[034] Units, prefixes, and symbols may be denoted in their SI accepted form. Unless otherwise indicated, nucleic acids are written left to right in 5 ' to 3 ' orientation; amino acid sequences are written left to right in amino to carboxy orientation, respectively. Numeric ranges are inclusive of the numbers defining the range and include each integer within the defined range. Amino acids may be referred to herein by either their commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Nucleotides, likewise, may be referred to by their commonly accepted single-letter codes. Unless otherwise provided for, software, electrical, and electronics terms as used herein are as defined in The New IEEE Standard Dictionary of Electrical and Electronics Terms (5^th edition, 1993) . The terms defined below are more fully defined by reference to the specification as a whole.

[035] By "amplified" is meant the construction of multiple copies of a nucleic acid sequence or multiple copies complementary to the nucleic acid sequence using at least one of the nucleic acid sequences as a template. Amplification systems include the polymerase chain reaction (PCR) system, ligase chain reaction (LCR) system, nucleic acid sequence based amplification (NASBA, Cangene, Mississauga, Ontario) , Q-Beta Replicase systems, transcription-based amplification system (TAS), and strand displacement amplification (SDA). See, e.g., Diagnostic Molecular Microbiology: Principles and Applications, D. H. Persing et al., Ed., American Society for Microbiology, Washington, D. C. (1993). The product of amplification is termed an amplicon.

[036] The term "antibody" includes reference to antigen binding forms of antibodies (e.g., Fab, F(ab)₂). The term "antibody" frequently refers to a polypeptide substantially encoded by an immunoglobulin gene or immunoglobulin genes, or fragments thereof which specifically bind and recognise an analyte (antigen) . However, while various antibody fragments can be defined in terms of the digestion of an intact antibody, one of skill will appreciate that such fragments may be synthesised de novo either chemically or by utilising recombinant DNA methodology. Thus, the term antibody, as used herein, also includes antibody fragments such as single chain Fv, chimeric antibodies (i.e., comprising constant and variable regions from different species), humanised antibodies (i.e., comprising a complementarity determining region (CDR) from a non-human source) and heteroconjugate antibodies (e.g., bispecific antibodies). [037] The term "antigen" includes reference to a substance to which an antibody can be generated and/or to which the antibody is specifically immunoreactive . The specific immunoreactive sites within the antigen are known as epitopes or antigenic determinants. These epitopes can be a linear array of monomers in a polymeric composition -such as amino acids in a protein- or consist of or comprise a more complex secondary or tertiary structure. Those of skill will recognise that all immunogens (i.e., substances capable of eliciting an immune response) are antigens; however some antigens, such as haptens, are not immunogens but may be made immunogenic by coupling to a carrier molecule. An antibody immunologically reactive with a particular antigen can be generated. In vivo or by recombinant methods such as selection of libraries of recombinant antibodies in phage or similar vectors. See, e.g., Huse et al., Science 246: 1275-1281 (1989); and Ward, et al . , Nature 341: 544-546 (1989); and Vaughan et al . , Nature Biotech. 14: 309-314 (1996) . [038] As used herein, "antisense orientation" includes reference to a duplex polynucleotide sequence that is operably linked to a promoter in an orientation where the antisense strand is transcribed. The antisense strand is sufficiently complementary to an endogenous transcription product such that translation of the endogenous transcription product is often inhibited.

[039] As used herein, "chromosomal region" includes reference to a length of a chromosome that may be measured by reference to the linear segment of DNA that it comprises. The chromosomal region can be defined by reference to two unique DNA sequences, i.e., markers.

[040] The term "conservatively modified variants" applies to both amino acid and nucleic acid sequences. With respect to particular nucleic acid sequences, conservatively modified variants refers to those nucleic acids which encode identical or conservatively modified variants of the amino acid sequences. Because of the degeneracy of the genetic code, a large number of functionally identical nucleic acids encode any given protein. For instance, the codons GCA, GCC, GCG and GCU all encode the amino acid alanine. Thus, at every position where an alanine is specified by a codon, the codon can be altered to any of the corresponding codons described without altering the encoded polypeptide. Such nucleic acid variations are "silent variations" and represent one species of conservatively modified variation. Every nucleic acid sequence herein that encodes a polypeptide also, by reference to the genetic code, describes every possible silent variation of the nucleic acid. One of ordinary skill will recognise that each codon in a nucleic acid (except AUG, which is ordinarily the only codon for methionine; and UGG, which is ordinarily the only codon for tryptophan) can be modified to yield a functionally identical molecule. Accordingly, each silent variation of a nucleic acid which encodes a polypeptide of the present invention is implicit in each described polypeptide sequence and is within the scope of the present invention. [041] As to amino acid, sequences, one of skill will recognise that individual substitutions, deletions or additions to a nucleic acid, peptide, polypeptide, or protein sequence which alters, adds or deletes a single amino acid or a small percentage of amino acids in the encoded sequence is a

"conservatively modified variant" where the alteration results in the substitution of an amino acid with a chemically similar amino acid. Thus, any number of amino acid residues selected from the group of integers consisting of from 1 to 15 can be so altered. Thus, for example, 1, 2, 3, 4, 5, 7, or 10 alterations can be made. Conservatively modified variants typically provide similar biological activity as the unmodified polypeptide sequence from which they are derived. For example, substrate specificity, enzyme activity, or ligand/receptor binding is generally at least 30%, 40%, 50%, 60%, 70%, 80%, or 90% of the native protein for its native substrate. Conservative substitution tables providing functionally similar amino acids are well known in the art . The following six groups each contain amino acids that are conservative substitutions for one another: i. Alanine (A), Serine (S), Threonine (T); ii. Aspartic acid (D), Glutamic acid (E); iii. Asparagine (N), Glutamine (Q); iv. Arginine (R), Lysine (K); v. Isoleucine (1) , Leucine (L) , Methionine (M) ,

Valine (V) ; and vi. Phenylaline (F), Tyrosine (Y), Tryptophan (W). See also, Creighton (1984) Proteins W. H. Freeman and Company. [042] By "encoding" or "encoded", with respect to a specified nucleic acid, is meant comprising the information for translation into the specified protein. A nucleic acid encoding a protein may comprise non-translated sequences (e.g., introns) within translated regions of the nucleic acid, or may lack such intervening non-translated sequences (e.g., as in cDNA) . The information by which a protein is encoded is specified by the use of codons . Typically, the amino acid sequence is encoded by the nucleic acid using the "universal" genetic code. However, variants of the universal code, such as are present in some plant, animal, and fungal mitochondria, the bacterium Mycoplasma capricolum, or the ciliate Macronucleus, may be used when the nucleic acid is expressed therein. [043] When the nucleic acid is prepared or altered synthetically, advantage can be taken of known codon preferences of the intended host where the nucleic acid is to be expressed. For example, although nucleic acid sequences of the present invention may be expressed in both monocotyledonous and dicotyledonous plant species, sequences can be modified to account for the specific codon preferences and GC content preferees of monocotyledons or dicotyledons as these preferences have been shown to differ (Murray et al. Nucl. Acids Res. 17: 477-498 (1989)). Thus, the tomato preferred codon for a particular amino acid may be derived from known gene sequences from tomato.

[044] As used herein "full-length sequence" in reference to a specified polynucleotide or its encoded protein means having the entire amino acid sequence of, a native (non-synthetic) ,^■ endogenous, biologically active form of the specified protein. Methods to determine whether a sequence is full-length are well known in the art including such exemplary techniques as northern or western blots, primer extension, Sl protection, and ribonuclease protection. See, e.g., Plant Molecular Biology: A Laboratory Manual, Clark, Ed., Springer-Verlag, Berlin (1997). Comparison to known full-length homologous (orthologous and/or paralogous) sequences can also be used to identify full-length sequences of the present invention. Additionally, consensus sequences typically present at the 5' and 3' untranslated regions of mRNA aid in the identification of a polynucleotide as full-length. For example, the consensus sequence ANNNNAUGG, where the underlined codon represents the N-terminal methionine, aids in determining whether the polynucleotide has a complete 5' end. Consensus sequences at the 3' end, such as polyadenylation sequences, aid in determining whether the polynucleotide has a complete 3' end. [045] As used herein, "heterologous" in reference to a nucleic acid is a nucleic acid that originates from a foreign species, or, if from the same species, is substantially modified from its native form in composition and/or genomic locus by deliberate human intervention. For example, a promoter operably linked to a heterologous structural gene is from a species different from that from which the structural gene was derived, or, if from the same species, one or both are substantially modified from their original form. A heterologous protein may originate from a foreign species or, if from the same species, is substantially modified from its original form by deliberate human intervention.

[046] By "host cell" is meant a cell which contains a vector and supports the replication and/or expression of the vector. Host cells may be prokaryotic cells such as E. coll, or eukaryotic cells such as yeast, insect, amphibian, or mammalian cells. Preferably, host cells are monocotyledonous or dicotyledonous plant cells. A particularly preferred monocotyledonous host cell is derived from rice or maize host cell.

[047] The term "hybridisation complex" includes reference to a duplex nucleic acid structure formed by two single- stranded nucleic acid sequences selectively hybridised with each other. [048] By "immunologically reactive conditions" or

"immunoreactive conditions" is meant conditions which allow an antibody, reactive to a particular epitope, to bind to that epitope to a detectably greater degree (e.g., at least 2-fold over background) than the antibody binds to substantially any other epitopes in a reaction mixture comprising the particular epitope. Immunologically reactive conditions are dependent upon the format of the antibody binding reaction and typically are those utilised in immunoassay protocols. See Harlow and Lane, Antibodies, A Laboratory Manual, Cold Spring Harbor Publications, New York (1988), for a description of immunoassay formats and conditions. [049] The term "introduced" in the context of inserting a nucleic acid into a cell, means "transfection" or "transformation" or transductions and includes reference to the incorporation of a nucleic acid into a eukaryotic or prokaryotic cell where the nucleic acid may be incorporated into the genome of the cell (e.g., chromosome, plasmid, plasmid or mitochondrial DNA) , converted into an autonomous replicon, or transiently expressed (e.g., transfected mRNA) . [050] The terms "isolated" refers to material, such as a nucleic acid or a protein, which is: (1) substantially or essentially free from components that normally accompany or interact with it as found in its naturally occurring environment. The isolated material optionally comprises material not found with the material in its natural environment; or (2) if the material is in its natal environment, the material has been synthetically (non- naturally) altered by deliberate human intervention to a composition and/or placed at a location in the cell (e.g., genome or subcellular organelle) not native to a material found in that environment. The alteration to yield the synthetic material can be performed on the material within or removed from its natural state. For example, a naturally occurring nucleic acid becomes an isolated nucleic acid if it is altered, or if it is transcribed from DNA which has been altered, by means of human intervention performed within the cell from which it originates. See, e.g., Compounds and Methods for Site Directed Mutagenesis in Eukaryotic Cells, Kmiec, U.S. Pat. No. 5,565,350; In Vivo Homologous Sequence Targeting in Eukaryotic Cells; Zarling et at., PCT/US93/03868. Likewise, a naturally occurring nucleic acid (e.g., a promoter) becomes isolated if it is introduced by non-naturally occurring means to a locus of the genome not native to that nucleic acid. Nucleic acids which are "isolated" as defined herein, are also referred to as "heterologous" nucleic acids. [051] Unless otherwise stated, the term "RuvX nucleic acid" is a nucleic acid of the present invention and means a nucleic acid capable of encoding a polynucleotide of the present invention (a "RuvX polynucleotide") encoding a RuvX polypeptide. A "RuvX gene" is a gene of the present invention and refers to a heterologous genomic form of a full-length RuvX polynucleotide. The RuvX gene and the RuvX peptide are functinalin plants, in particlular in rice, Arabidopsis, maize and tomato.

[052] As used herein, "localised within the chromosomal region defined by and including" with respect to particular markers includes reference to a contiguous length of a chromosome delimited by and including the stated markers. [053] As used herein, "marker" includes reference to a locus on a chromosome that serves to identify a unique position on the chromosome. A "polymorphic marker" includes reference to a marker which appears in multiple forms (alleles) such that different forms of the marker, when they are present in a homologous pair, allow transmission of each of the chromosomes of that pair to be followed. A genotype may be defied by use of one or a plurality of markers. [054] As used herein, "nucleic acid" includes reference to a deoxyribonucleotide or ribonucleotide polymer in either single- or double-stranded form, and unless otherwise limited, encompasses known analogues having the essential nature of natural nucleotides in that they hybridize to single-stranded nucleic acids in a manner similar to naturally occurring nucleotides (e.g., peptide nucleic acids).

[055] By "nucleic acid library" is meant a collection of isolated DNA or RNA molecules which comprise and substantially represent the entire transcribed fraction of a genome of a specified organism. Construction of exemplary nucleic acid libraries, such as genomic and cDNA libraries, is taught in standard molecular biology references such as Berger and Kimmel, Guide to Molecular Cloning Techniques, Methods in Enzymology, Vol. 152, Academic Press, Inc., San Diego, Calif. (Berger); Sambrook et al., Molecular Cloning-A Laboratory Manual, 2^nd ed. , Vol. 1-3 (1989); and Current Protocols in Molecular Biology, F. M. Ausubel et al., Eds., Current Protocols, a joint venture between Greene Publishing Associates, Inc. and John Wiley & Sons, Inc. (1994) . [056] As used herein "operably linked" includes reference to a functional linkage between a promoter and a second sequence, wherein the promoter sequence initiates and mediates transcription of the DNA sequence corresponding to the second sequence. Generally, operably linked means that the nucleic acid sequences being linked are contiguous and, where necessary to join two protein coding regions, contiguous and in the same reading frame.

[057] As used herein, the term "plant" includes reference to whole plants, plant organs (e.g., leaves, stems, roots, etc.), seeds and plant cells and progeny of same. Plant cell, as used herein includes, without limitation, seeds, suspension cultures, embryos, meristematic regions, callus tissue, leaves, roots, shoots, gametophytes, sporophytes, pollen, and microspores. The class of plants which can be used in the methods of the invention is generally as broad as the class of higher plants amenable to transformation techniques, including both monocotyledonous and dicotyledonous plants.

[058] As used herein, "polynucleotide" includes reference to a deoxyribopolynucleotide, ribopolynucleotide, or analogues thereof that have the essential nature of a natural ribonucleotide in that they hybridise, under stringent hybridisation conditions, to substantially the same nucleotide sequence as naturally occurring nucleotides and/or allow translation into the same amino acid(s) as the naturally occurring nucleotide (s) . A polynucleotide can be full-length or a subsequence of a native or heterologous structural or regulatory gene. Unless otherwise indicated, the term includes reference to the specified sequence as well as the complementary sequence thereof. Thus, DNAs or RNAs with backbones modified for stability or for other reasons are "polynucleotides" as that term is intended herein. Moreover, DNAs or RNAs comprising unusual bases, such as inosine, or modified bases, such as tritylated bases, to name just two examples, are polynucleotides as the term is used herein. It will be appreciated that a great variety of modifications have been made to DNA and RNA that serve many useful purposes known to those of skill in the art. Th term polynucleotide as it is employed herein embraces such chemically, enzymatically or metabolically modified forms of polynucleotides, as well as the chemical forms of DNA and RNA characteristic of viruses and cells, including among other things, simple and complex cells. [059] The terms "polypeptide", "peptide" and "protein" are used interchangeably herein to refer to a polymer of amino acid residues. The terms apply to amino acid polymers in which one or more amino acid residue is an artificial chemical analogue of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers. The essential nature of such analogues of naturally occurring amino acids is that, when incorporated into a protein, that protein is specifically reactive to antibodies elicited to the same protein but consisting entirely of naturally occurring amino acids. The terms "polypeptide", "peptide" and "protein" are also inclusive of modifications including, but not limited to, glycosylation, lipid attachment, sulfation, gamma-carboxylation of glutamic acid residues, hydroxylation and ADP-ribosylation. It will be appreciated, as is well known and as noted above, that polypeptides are not always entirely linear. For instance, polypeptides may be branched as a result of ubiquitination, and they may be circular, with or without branching, generally as a result of posttranslation events, including natural processing event and events brought about by human manipulation which do not occur naturally. Circular, branched and branched circular polypeptides may be synthesized by non-translation natural process and by entirely synthetic methods, as well. Further, this invention contemplates the use of both the methionine containing and the methionine-less amino terminal variants of the protein of the invention. [060] As used herein "promoter" includes reference to a region of DNA upstream from the start of transcription and involved in recognition and binding of RNA polymerase and other proteins to initiate transcription. A "plant promoter" is a promoter capable of initiating transcription in plant cells whether or not its origin is a plant cell. Exemplary plant promoters include, but are not limited to, those that are obtained from plants, plant viruses, and bacteria which comprise genes expressed in plant cells such Agrobacterium or Rhizobium. Examples of promoters under developmental control include promoters that preferentially initiate transcription in certain tissues, such as leaves, roots, or seeds. Such promoters are referred to as "tissue preferred". Promoters which initiate transcription only in certain tissue are referred to as "tissue specific". A "cell type" specific promoter primarily drives expression in certain cell types in one or more organs, for example, vascular cells in roots or leaves. An "inducible" or "repressible" promoter is a promoter which is under environmental control. Examples of environmental conditions that may effect transcription by inducible promoters include anaerobic conditions or the presence of light and/or temperature conditions. Tissue specific, tissue preferred, cell type specific, and inducible promoters constitute the class of "non-constitutive" promoters. A "constitutive" promoter is a promoter which is active under most environmental conditions. [061] The term "RuvX polypeptide" is a polypeptide of the present invention and refers to one or more amino acid sequences, in glycosylated or non-glycosylated form. The term is also inclusive of fragments, variants, homologs, alleles or precursors (e.g., preproproteins or proproteins) thereof. A "RuvX protein" is a protein of the present invention and comprises a RuvX polypeptide. A RuvX protein is functional in plants. RuvX proteins that are active in different plants, for instance in tomato or rice, can be depicted as ^ΛTomato RuvX' or ^ΛRice RuvX' and are alsopart of the present invention. [062] As used herein "recombinant" includes reference to a cell or vector, that has been modified by the introduction of a heterologous nucleic acid or that the cell is derived from a cell so modified. Thus, for example, recombinant cells express genes that are not found in identical form within the native (non-recombinant) form of the cell or express native genes that are otherwise abnormally expressed, under-expressed or not expressed at all as a result of deliberate human intervention. The term "recombinant" as used herein does not encompass the alteration of the cell or vector by naturally occurring events (e.g., spontaneous mutation, natural transformation/transduction/transposition) such as those occurring without deliberate human intervention. [063] As used herein, a "recombinant expression cassette" is a nucleic acid construct, generated recombinantly or synthetically, with a series of specified nucleic acid elements which permit transcription of a particular nucleic acid in a host cell. The recombinant expression cassette can be incorporated into a plasmid, chromosome, mitochondrial DNA, plastid DNA, virus, or nucleic acid fragment. Typically, the recombinant expression cassette portion of an expression vector includes, among other sequences, a nucleic acid to be transcribed, and a promoter.

[064] The terms "residue" or "amino acid residue" or "amino acid" are used interchangeably herein to refer to an amino acid that is incorporated into a protein, polypeptide, or peptide (collectively "protein") . The amino acid may be a naturally occurring amino acid and, unless otherwise limited, may encompass non-natural analogs of natural amino acids that can function in a similar maimer as naturally occurring amino acids.

[065] The term "selectively hybridises" includes reference to hybridisation, under stringent hybridisation conditions, of a nucleic acid sequence to a specified nucleic acid target sequence to a detectably greater degree (e. g., at least 2-fold over background) than its hybridisation to non-target nucleic acid sequences and to the substantial exclusion of non-target nucleic acids. Selectively hybridising sequences typically have about at least 80% sequence identity, preferably 90% sequence identity, and most preferably 100% sequence identity (i.e., complementary) with each other.

[066] The term "specifically reactive", includes reference to a binding reaction between an antibody and a protein having an epitope recognized by the antigen binding site of the antibody. This binding reaction is determinative of the presence of a protein having the recognized epitope amongst the presence of a heterogeneous population of proteins and other biologies. Thus, under designated immunoassay conditions, the specified antibodies bind to an analyte having the recognised epitope to a substantially greater degree (e.g., at least 2- fold over background) than to substantially all analytes lacking the epitope which are present in the sample. [067] Specific binding to an antibody under such conditions may require an antibody that is selected for its specificity for a particular protein. For example, antibodies raised to the polypeptides of the present invention can be selected from to obtain antibodies specifically reactive with polypeptides of the present invention. The proteins used as immunogens can be in native conformation or denatured so as to provide a linear epitope .

[068] A variety of immunoassay formats may be used to select antibodies specifically reactive with a particular protein (or other analyte) . For example, solid-phase ELISA immunoassays are routinely used to select monoclonal antibodies specifically immunoreactive with a protein. See Harlow and Lane Antibodies, A Laboratory Manual, Cold Spring Harbor Publications, New York (1988), for a description of immunoassay formats and conditions that can be used to determine selective reactivity.

[069] The term "stringent conditions" or "stringent hybridization conditions" includes reference to conditions under which a probe will hybridize to its target sequence, to a detectably greater degree than to other sequences (e.g., at least 2-fold over background) . Stringent conditions are sequence-dependent and will be different in different circumstances. By controlling the stringency of the hybridization and/or washing conditions, target sequences can be identified which are 100% complementary to the probe

(homologous probing) . Alternatively, stringency conditions can be adjusted to allow some mismatching in sequences so that lower degrees of similarity are detected (heterologous probing) . Generally, a probe is less than about 1000 nucleotides in length, optionally less than 500 nucleotides in length. [070] Typically, stringent conditions will be those in which the salt concentration is less than about 1.5 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30[deg.] C. for short probes (e.g., 10 to 50 nucleotides) and at least about 60[deg.] C. for long probes (e.g., greater than 50 nucleotides) . Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. Exemplary low stringency conditions include hybridization with a buffer solution of 30 to 35% formamide, 1 M NaCl, 1% SDS (sodium dodecyl sulphate) at 37[deg.] C, and a wash in 1* to 2*SSC (20*SSC=3.0 M NaCl/0.3 M trisodium citrate) at 50 to 55[deg.] C. Exemplary moderate stringency conditions include hybridisation in 40 to 45% formamide, 1 M NaCl, 1% SDS at 37[deg.] C, and a wash in 0.5*to 1*SSC at 55 to 60[deg.] C. Exemplary high stringency conditions include hybridisation in 50% formamide, 1 M NaCl, 1% SDS at 37[deg.] C, and a wash in 0.1*SSC at 60 to 65[deg.] C.

[071] Specificity is typically the function of post- hybridization washes, the critical factors being the ionic strength and temperature of the final wash solution. For DNA- DNA hybrids, the Tm can be approximated from the equation of Meinkoth and Wahl, Anal. Biochem. , 138:267-284 (1984): Tm=81.5[deg.] C. +16.6 (log M) +0.41 (%GC)-0.61 (% form) -500/L; where M is the molarity of monovalent cations, %GC is the percentage of guanosine and cytosine nucleotides in the DNA, % form is the percentage of formamide in the hybridization solution, and L is the length of the hybrid in base pairs. The Tm is the temperature (under defined ionic strength and pH) at which 50% of a complementary target sequence hybridizes to a perfectly matched probe. Tm is reduced by about 1 ⁰C. for each 1% of mismatching; thus, Tm, hybridization and/or wash conditions can be adjusted to hybridize to sequences of the desired identity. For example, if sequences with >=90% identity are sought, the Tm, can be decreased 10 ⁰C. Generally, stringent conditions are selected to be about 5 ⁰C lower than the thermal melting point (Tm) for the specific sequence and its complement at a defined ionic strength and pH. However, severely stringent conditions can utilize a hybridization and/or wash at 1, 2, 3, or 4 ⁰C lower than the thermal melting point (Tm) ; moderately stringent conditions can utilize a hybridization and/or wash at 6, 7, 8, 9, or 10 ⁰C lower than the thermal melting point (Tm) ; low stringency conditions can utilize a hybridization and/or wash at 11, 12, 13, 14, 15, or 20 ⁰C lower than the thermal melting point (Tm) . Using the equation, hybridization and wash compositions, and desired Tm, those of ordinary skill will understand that variations in the stringency of hybridization and/or wash solutions are inherently described. If the desired degree of mismatching results in a Tm of less than 45 ⁰C (aqueous solution) or 32 ⁰C (formamide solution) it is preferred to increase the SSC concentration so that a higher temperature can be used. An extensive guide to the hybridization of nucleic acids is found in Tijssen, Laboratory Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic Acid Probes, Part 1, Chapter 2 "Overview of principles of hybridization and the strategy of nucleic acid probe assays", Elsevier, New York (1993); and Current Protocols in Molecular Biology, Chapter 2, Ausubel, et al., Eds., .Greene Publishing and Wiley-Interscience, New York (1995) .

[072] As used herein, "transgenic plant" includes reference to a plant which comprises within its genome a heterologous polynucleotide. Generally, the heterologous polynucleotide is stably integrated within the genome such that the polynucleotide is passed on to successive generations. The heterologous polynucleotide may be integrated into the genome alone or as part of a recombinant expression cassette. [073] Transgenic" is used herein to include any cell, cell line, callus, tissue, plant part or plant, the genotype of which has been altered by the presence of heterologous nucleic acid including those transgenics initially so altered as well as those created by sexual crosses or asexual propagation from the initial transgenic. The term "transgenic" as used herein does not encompass the alteration of the genome (chromosomal or extra-chromosomal) by conventional plant breeding methods or by naturally occurring events such as random cross-fertilisation, non-recombinant viral infection, non-recombinant bacterial transformation, non-recombinant transposition, or spontaneous mutation. [074] As used herein, "vector" includes reference to a nucleic acid used in transfection of a host cell and into which can be inserted a polynucleotide. Vectors are often replicons . Expression vectors permit transcription of a nucleic acid inserted therein. [075] The following terms are used to describe the sequence relationships between two or more nucleic acids or polynucleotides :

(a) "reference sequence",

(b) "comparison window", (c) "sequence identity",

(d) "percentage of sequence identity", and

(e) "substantial identity".

[076] As used herein, "reference sequence" is a defined sequence used as a basis for sequence comparison. A reference sequence may be a subset or the entirety of a specified sequence; for example, as a segment of a full-length cDNA or gene sequence, or the complete cDNA or gene sequence. [077] As used herein, "comparison window" includes reference to a contiguous and specified segment of a polynucleotide/polypeptide sequence, wherein the polynucleotide/polypeptide sequence may be compared to a reference sequence and wherein the portion of the polynucleotide/polypeptide sequence in the comparison window may comprise additions or deletions (i.e., gaps) compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. Generally, the comparison window is at least 20 contiguous nucleotides/amino acids residues in length, and optionally can be 30, 40, 50, 100, or longer. Those of skill in the art understand that to avoid a high similarity to a reference sequence due to inclusion of gaps in the polynucleotide/polypeptide sequence, a gap penalty is typically introduced and is subtracted from the number of matches. [078] Methods of alignment of sequences for comparison are well-known in the art. Optimal alignment of sequences for comparison may be conducted by the local homology algorithm of Smith and Waterman, Adv. Appl. Math. 2: 482 (1981); by the homology alignment algorithm of Needleman and Wunsch, J. MoI. Biol. 48: 443 (1970); by the search for similarity method of Pearson and Lipman, Proc. Natl. Acad Sci. 85: 2444 (1988); by computerized implementations of these algorithms, including, but not limited to: CLUSTAL in the PC/Gene program by

Intelligenetics, Mountain View, Calif.; GAP, BESTFIT, BLAST, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group (GCG), 575 5cience Dr., Madison, Wis., USA; the CLUSTAL program is well described by Higgins and Sharp, Gene 73: 237-244 (1988); Higgins and Sharp, CABIOS 5: 151-153 (1989); Corpet, et al., Nucleic Acids Research 16: 10881-90 (1988); Huang, et al . , Computer Applications in the Biosciences 8: 155-65 (1992), and Pearson, el al., Methods in Molecular Biology 24: 307-331 (1994). [079] The BLAST family of programs which can be used for database similarity searches includes: BLASTN for nucleotide query sequences against nucleotide database sequences; BLASTX for nucleotide query sequences against protein database sequences; BLASTP for protein query sequences against protein database sequences; TBLASTN for protein query sequences against nucleotide database sequences; and TBLASTX for nucleotide query sequences against nucleotide database sequences. See, Current Protocols in Molecular Biology, Chapter 19, Ausubel, et al., Eds., Greene Publishing and Wiley-Interscience, New York (1995) .

[080] Software for performing BLAST analyses is publicly available, e.g., through the National Center for Biotechnology Information. This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold. These initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them. The word hits are then extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always>0) and N (penalty score for mismatching residues; always<0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses as defaults a wordlength (W) of 11, an expectation (E) of 10, a cutoff of 100, M=5, N=-4, and a comparison of both strands. For amino acid sequences, the BLASTP program uses as defaults a wordlength (W) of 3, an expectation (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff & Henikoff (1989) Proc. Natl. Acad. Sci. USA 89:10915) . [081] In addition to calculating percent sequence identity, the BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, eg., Karlin & Altschul, Proc. Nat'l. Acad. Sci. USA 90:5873-5877 (1993)). One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance. [082] BLAST searches assume that proteins can be modeled as random sequences. However, many real proteins comprise regions of nonrandom sequences which may be homopolymeric tracts, short-period repeats, or regions enriched in one or more amino acids. Such low-complexity regions may.be aligned between unrelated proteins even though other regions of the protein are entirely dissimilar. A number of low-complexity filter programs can be employed to reduce such low-complexity alignments. For example, the SEG (Wooten and Federhen, Comput . Chem. , 17:149- 163 (1993)) and XNU (Claverie and States, Comput. Chem.,

17:191-201 (1993)) low-complexity filters can be employed alone or in combination.

[083] GAP can also be used to compare a polynucleotide or polypeptide of the present invention with a reference sequence. GAP uses the algorithm of Needleman and Wunsch (J. MoI. Biol. 48: 443-453, 1970) to find the alignment of two complete sequences that maximizes the number of matches and minimizes the number of gaps. GAP considers all possible alignments and gap positions and creates the alignment with the largest number of matched bases and the fewest gaps. It allows for the provision of a gap creation penalty and a gap extension penalty in units of matched bases. GAP must make a profit of gap creation penalty number of matches for each gap it inserts. If a gap extension penalty greater than zero is chosen, GAP must, in addition, make a profit for each gap inserted of the length of the gap times the gap extension penalty. Default gap creation penalty values and gap extension penalty values in Version 10 of the Wisconsin Genetics Software Package for protein sequences are 8 and 2, respectively. For nucleotide sequences the default gap creation penalty is 50 while the default gap extension penalty is 3. The gap creation and gap extension penalties can be expressed as an integer selected from the group of integers consisting of from 0 to 200. Thus, for example, the gap creation and gap extension penalties can each independently be: 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 65 or greater. [084] GAP presents one member of the family of best alignments. There may be many members of this family, but no other member has a better quality. GAP displays four figures of merit for alignments: Quality, Ratio, Identity, and Similarity. 5 The Quality is the metric maximized in order to align the sequences. Ratio is the quality divided by the number of bases in the shorter segment. Percent Identity is the percent of the symbols that actually match. Percent Similarity is the percent of the symbols that are similar. Symbols that are across from

10 gaps are ignored. A similarity is scored when the scoring matrix value for a pair of symbols is greater than or equal to 0.50, the similarity threshold. The scoring matrix used in Version 10 of the Wisconsin Genetics Software Package is BLOSUM62 (see Henikoff & Henikoff (1989) Proc. Natl. Acad. Sci.

15 USA 89:10915) .

[085] Unless otherwise stated, sequence identity/similarity values provided herein refer to the value obtained using the BLAST 2.0 suite of programs using default parameters (Altschul et al., Nucleic Acids Res. 25:3389-3402, 1997; Altschul et al.,

20 J.- MoI. Bio. 215: 403-410, 1990) or to the value obtained using the GAP program using default parameters (see the Wisconsin Genetics Software Package, Genetics Computer Group (GCG) , 575 Science Dr., Madison, Wis . , USA). Although these techniques are sufficient, there is a preference for the technologies as

25 described in the examples of the present application.

[086] As used herein, "sequence identity" or "identity" in the context of two nucleic acid or polypeptide sequences includes reference to the residues in the two sequences which are the same when aligned for maximum , correspondence over a

30. specified comparison window. When percentage of sequence identity is used in reference to proteins it is recognized that residue positions which are not identical often differ by conservative amino acid substitutions, where amino acid residues are substituted for other amino acid residues with

35 similar chemical properties (e.g. charge or hydrophobicity) and therefore do not change the functional properties of the molecule. Where sequences differ in conservative substitutions, the percent sequence identity may be adjusted upwards to correct for the conservative nature of the substitution. Sequences which differ by such conservative substitutions are said to have "sequence similarity" or "similarity". Means for making this adjustment are well-known to those of skill in the art. Typically this involves scoring a conservative substitution as a partial rather than a full mismatch, thereby increasing the percentage sequence identity. Thus, for example, where an identical amino acid is given a score of 1 and a non- conservative substitution is given a score of zero, a conservative substitution is given a score between zero and 1. The scoring of conservative substitutions is calculated, e.g., according to the algorithm of Meyers and Miller, Computer Applic. Biol. Sci., 4: 11-17 (1988) e.g., as implemented in the program PC/GENE (Intelligenetics, Mountain View, Calif., USA). [087] As used herein, "percentage of sequence identity" means the value determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide sequence in the comparison window may comprise additions or deletions (i.e., gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the result by 100 to yield the percentage of sequence identity. [088] The term "substantial identity" of polynucleotide sequences means that a polynucleotide comprises a sequence that has at least 70% sequence identity, preferably at least 80%, more preferably at least 90% and most preferably at least 95%, compared to a reference sequence using one of the alignment programs described using standard parameters. One of skill will recognise that these values can be appropriately adjusted to determine corresponding identity of proteins encoded by two nucleotide sequences by taking into account codon degeneracy, amino acid similarity, reading frame positioning and the like. Substantial identity of amino acid sequences for these purposes normally means sequence identity of at least 60%, more preferably at least 70%, 80%, 90%, and most preferably at least 95%.

[089] Another indication that nucleotide sequences are substantially identical is if two molecules hybridize to each other under stringent conditions. However, nucleic acids which do not hybridize to each other under stringent conditions are still substantially identical if the polypeptides which they encode are substantially identical. This may occur, e.g., when a copy of a nucleic acid is created using the maximum codon degeneracy permitted by the genetic code. One indication that two nucleic acid sequences are substantially identical is that the polypeptide which the first nucleic acid encodes is immunologically cross reactive with the polypeptide encoded by the second nucleic acid. [090] The terms "substantial identity" in the context of a peptide indicates that a peptide comprises a sequence with at least 70% sequence identity to a reference sequence, preferably 80%, more preferably 85%, most preferably at least 90% or 95% sequence identity to the reference sequence over a specified comparison window. Optionally, optimal alignment is conducted using the homology alignment algorithm of Needleman and Wunsch, J. MoI. Biol. 48: 443 (1970). An indication that two peptide sequences are substantially identical is that one peptide is immunologically reactive with antibodies raised against the second peptide. Thus, a peptide is substantially identical to a second peptide, for example, where the two peptides differ only by a conservative substitution. Peptides which are "substantially similar" share sequences as noted above except that residue positions which are not identical may differ by conservative amino acid changes.

[091] DETAILED DESCRIPTION OF THE INVENTION [092] The present invention provides, among other things, compositions and methods for modulating (i.e., increasing or decreasing) the level of polynucleotides and polypeptides of the present invention in plants. In particular, the polynucleotides and polypeptides of the present invention can be expressed temporally or spatially, e.g., at developmental stages, in tissues, and/or in quantities, which are uncharacteristic of non-recombinantly engineered plants. Thus, the present invention provides utility in such exemplary applications as in the control of recombination efficiency or transformation efficiency in plants.

[093] The present invention also provides isolated nucleic acid comprising polynucleotides of sufficient length and complementarity to a gene of the present invention to use as probes or amplification primers in the detection, quantitation, or isolation of gene transcripts. For example, isolated nucleic acids of the present invention can be used as probes in detecting deficiencies in the level of mRNA in screenings for desired transgenic plants, for detecting mutations in the gene (e.g., substitutions, deletions, or additions), for monitoring upregulation of expression or changes in enzyme activity in screening assays of compounds, for detection of any number of allelic variants (polymorphism) , orthologs, or paralogs of the gene, or for site directed mutagenesis in eukaryotic cells (see, e.g., U.S. Pat. No. 5,565,350). The isolated nucleic acids of the present invention can also be used for recombinant expression of their encoded polypeptides, or for use as immunogens in the preparation and/or screening of antibodies. The isolated nucleic acids of the present invention can also be employed for use in sense or antisense suppression of one or more genes of the present invention in a host cell, tissue, or plant. Attachment of chemical agents which bind, intercalate, cleave and/or crosslink to the isolated nucleic acids of the present invention can also be used to modulate transcription or translation.

[094] The present invention also provides isolated proteins comprising a polypeptide of the present invention (e.g., preproenzyme, proenzyme, or enzymes) . The present invention also provides proteins comprising at least one epitope from a polypeptide of the present invention. The proteins of the present invention can be employed in assays for enzyme agonists or antagonists of enzyme function, or for use as immunogens or antigens to obtain antibodies specifically immunoreactive with a protein of the present invention. Such antibodies can be used in assays for expression levels, for identifying and/or isolating nucleic acids of the present invention from expression libraries, for identification of homologous polypeptides from other species, or for purification of polypeptides of the present invention.

[095] The isolated nucleic acids and polypeptides of the present invention can be used over a broad range of plant types, particularly monocots or dicots, preferably dicots.

Examples of preferred plant types are Oryza, Lycopersicon and Zea (e.g., Z . mays) .

[096] The isolated nucleic acid and proteins of the present invention can also be used in species from the genera: Cucurbita, Rosa, Vitis, Juglans, Fragaria, Lotus, Medicago, Onobrychis, Trifolium, Trigonella, Vigna, Citrus, Linum, Geranium, Manihot, Daucus, Arabidopsis, Brassica, Raphanus, Sinapis, Atropa, Capsicum, Datura, Hyoscyamus, Lycopersicon, Nicotiana, Solanum, Petunia, Digitalis, Majorana, Ciahorium, Helianthus, Lactuca, Bromus, Asparagus, Antirrhinum,

Heterocallis, Nemesis, Pelargonium, Panieum, Pennisetum, Ranunculus, Senecio, Salpiglossis, Cucumis, Browaalia, Glycine, Pisum, Phaseolus, cotton, soy and Lolium. A further preference is for each of Cucurbita, Brassica, Lycopersicon, Solanum, Oryza and Zea. A preference is for each of Avena, Medicago, Capsicum, Nicotiana, Lactuca, Pisum, Cucurbita, Brassica, Lycopersicon, Solanum, Oryza and Zea.

Nucleic Acids [097] The present invention provides, among other things, isolated nucleic acids of RNA, DNA, and analogs and/or chimeras thereof, comprising a polynucleotide of the present invention. [098] A polynucleotide of the present invention is inclusive of:

(a) a polynucleotide encoding a polypeptide of SEQ ID NOS: 6, 8, 10, 11, 12, 13, 14, 15, 16 ,17, 18, 19, 20, 21, 22, 23, 24, 25, 26, and conservatively modified and polymorphic variants thereof, including exemplary polynucleotides of SEQ ID NOS: 60, 5, 7, 9, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38

(b) a polynucleotide which is the product of amplification from a nucleic acid library, such as from a public tomato or arabidopsis library using primer pairs which selectively hybridize under stringent conditions to loci within a polynucleotide selected from the group consisting of SEQ ID NOS: 60, 5, I₁ 9, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, wherein the polynucleotide has substantial sequence identity to a polynucleotide selected from the group consisting of SEQ ID NOS: 60, 5, 7, 9, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38;

(c) a polynucleotide which selectively hybridizes to a polynucleotide of (a) or (b) ;

(d) a polynucleotide having a specified sequence identity with polynucleotides of (a) , (b) , or (c) ;

(e) a polynucleotide encoding a protein having a specified number of contiguous amino acids from a prototype polypeptide, wherein the protein is specifically recognized by antisera elicited by presentation of the protein and wherein the protein does not detectably immunoreact to antisera which has been fully immunosorbed with the protein;

(f) complementary sequences of polynucleotides of (a), (b), (C), (d), or (e); and

(g) a polynucleotide comprising at least a specific number of contiguous nucleotides from a polynucleotide of (a) , (b) , ^• (C), (d), (e), or (f) .

(A) Polynucleotides Encoding A Polypeptide of the Present

Invention or Conservatively Modified or Polymorphic Variants Thereof . [099] As indicated in (a) , above, the present invention provides isolated nucleic acids comprising a polynucleotide of the present invention, wherein the polynucleotide encodes a polypeptide of the present invention, or conservatively modified or polymorphic variants thereof. Accordingly, the present invention includes polynucleotides of SEQ ID NOS: 60, 5, 7, 9, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, and silent variations of .polynucleotides encoding a polypeptide of SEQ ID NOS: 6, 8, 10, 11, 12, 13, 14, 15, 16 ,17, 18, 19, 20, 21, 22, 23, 24, 25, 26. The present invention further provides isolated nucleic acids comprising polynucleotides encoding conservatively modified variants of a polypeptide of SEQ ID NOS: 6, 8, 10, 11, 12, 13, 14, 15, 16 ,17,. 18, 19, 20, 21, 22, 23, 24, 25, 26. Conservatively modified variants can be used to generate or select antibodies immunoreactive to the non-variant polypeptide. Additionally, the present invention further provides isolated nucleic acids comprising polynucleotides encoding one or more allelic (polymorphic) variants of polypeptides/polynucleotides. Polymorphic variants are frequently used to follow segregation of chromosomal regions in, for example, marker assisted selection methods for crop improvement .

B . Polynucleotides Amplified from a Nucleic Acid Library [0100] As indicated in (b) , above, the present invention provides an isolated nucleic acid comprising a polynucleotide of the present invention, wherein the polynucleotides are amplified from a nucleic acid library such as for example tomoato and Arabidopsis cDNA libraries. The nucleic acid library may be a cDNA library, a genomic library, or a library generally constructed from nuclear transcripts at any stage of intron processing. cDNA libraries can be normalized to increase the representation of relatively rare cDNAs. In optional embodiments, the cDNA library is constructed using a full- length cDNA synthesis method. Examples of such methods include Oligo-Capping (Maruyama, K. and Sugano, S. Gene 138: 171-174, 1994), Biotinylated CAP Trapper (Carninci, P., Kvan, C, et al. Genomics 37: 327-336, 1996), and CAP Retention Procedure (Edery, E., Chu, L. L., et al . Molecular and Cellular Biology 15: 3363-3371, 1995) . cDNA synthesis is often catalyzed at 50- 55[deg.] C. to prevent formation of RNA secondary structure. Examples of reverse transcriptases that are relatively stable at these temperatures are SUPERSCRIPT II Reverse Transcriptase (Life Technologies, Inc.), AMV Reverse Transcriptase (Boehringer Mannheim) and RETROAMP Reverse Transcriptase (Epicentre) . Rapidly growing tissues, or rapidly dividing cells are preferably used as mRNA sources.

[0101] The present invention also provides subsequences of the polynucleotides of the present invention. A variety of subsequences can be obtained using primers which selectively hybridize under stringent conditions to at least two sites within a polynucleotide of the present invention, or to two sites within the nucleic acid which flank and comprise a polynucleotide of the present invention, or to a site within a polynucleotide of the present invention and a site within the nucleic acid which comprises it. Primers are chosen to selectively hybridize, under stringent hybridization conditions, to a polynucleotide of the present invention. Generally, the primers are complementary to a subsequence of the target nucleic acid which they amplify. As those skilled in the art will appreciate, the sites to which the primer pairs will selectively hybridize are chosen such that a single contiguous nucleic acid can be formed under the desired amplification conditions.

[0102] In optional embodiments, the primers will be constructed so that they selectively hybridize under stringent conditions to a sequence (or its complement) within the target nucleic acid which comprises the codon encoding the carboxy or amino terminal amino acid residue (i.e., the 3' terminal coding region and 5' terminal coding region, respectively) of the polynucleotides of the present invention. Optionally within these embodiments, the primers will be constructed to selectively hybridize entirely within the coding region of the target polynucleotide of the present invention such that the product of amplification of a cDNA target will consist of the coding region of that cDNA. The primer length in nucleotides is selected from the group of integers consisting of from at least 15 to 50. Thus, the primers can be at least 15, 18, 20, 25, 30, 40, or 50 nucleotides in length. Those of skill will recognize that a lengthened primer sequence can be employed to increase specificity of binding (i.e., annealing) to a target sequence. A non-annealing sequence at the 5' end of a primer (a "tail") can be added, for example, to introduce a cloning site, at the terminal ends of the amplicon.

[0103] The amplification products can be translated using expression systems well known to those of skill in the art and as discussed, infra. The resulting translation products can be confirmed as polypeptides of the present invention by, for example, assaying for the appropriate catalytic activity (e.g., specific activity and/or substrate specificity) , or verifying the presence of one or more linear epitopes which are specific to a polypeptide of the present invention. Methods for protein synthesis from PCR derived templates are known in the art and available commercially. See, e.g., Amersham Life Sciences, Inc, Catalog '97, p.354.

[0104] Methods for obtaining 5' and/or 3' ends of a vector inert are well known in the art. Sec, e.g., RACE (Rapid Amplification of Complementary Ends) as described in Frohman, M. A., in PCR Protocols: A Guide to Methods and Applications, M. A. Innis, D. H. Gelfand, J. J. Sninsly, T. J. White, Eds. (Academic Press, Inc^'., San Diego), pp. 28-38 (1990)); see also, U.S. Pat. No. 5,470,722, and Current Protocols in Molecular Biology, Unit 15.6, Ausubel, et al., Eds, Greene Publishing and Wiley-Interscience, New York (1995) ; Frohman and Martin, Techniques 1:165 (1989).

C. Polynucleotides Which Selectively Hybridize to a Polynucleotide of (A) or (B) . [0105] As indicated in (c) , above, the present invention provides isolated nucleic acids comprising polynucleotides of the present invention, wherein the polynucleotides selectively hybridize, under selective hybridization conditions, to a polynucleotide of sections (A) or (B) as discussed above. Thus, the polynucleotides of this embodiment can be used for isolating, detecting, and/or quantifying nucleic acids comprising the polynucleotides of (A) or (B) . For example, polynucleotides of the present invention can be used to identify, isolate, or amplify partial or full-length clones in a (deposited) library. In some embodiments, the polynucleotides are genomic or cDNA sequences isolated or otherwise complementary to a cDNA from a dicot or monocot nucleic acid library. Exemplary species of monocots and dicots include, but are not limited to: corn, canola, soybean, cotton, wheat, sorghum, sunflower, oats, sugar cane, millet, barley, rice, tomato, tobacco, cucurbitacea, capsicum. [0106] Optionally, the cDNA library comprises at least 80% full-length sequences, preferably at least 85% or 90% full- length sequences, and more preferably at least 95% full-length sequences. The cDNA libraries can be normalized to increase the representation of rare sequences. Low stringency hybridization conditions are typically, but not exclusively, employed with sequences having a reduced sequence identity relative to complementary sequences. Moderate and high stringency conditions can optionally be employed for sequences of greater identity. Low stringency conditions allow selective hybridization of sequences having about 70% sequence identity and can be employed to identify orthologous or paralogous sequences .

D . Polynucleotides Having a Specific Sequence Identity With the Polynucleotides of (A) , (B) or (C) .

[0107] As indicated in (d) , above, the present invention provides isolated nucleic acids comprising polynucleotides of the present invention, wherein the polynucleotides have a specified identity at the nucleotide level to a polynucleotide as disclosed above in sections (A), (B), or (C), above. The percentage of identity to a reference sequence is at least 60% and, rounded upwards to the nearest integer, can be expressed as an integer selected from the group of integers consisting of from 60 to 99. Thus, for example, the percentage of identity to a reference sequence can be at least 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%.

[0108] Optionally, the polynucleotides of this embodiment will encode a polypeptide that will share an epitope with a polypeptide encoded by the polynucleotides of sections (A) , (B) , or (C) . Thus, these polynucleotides encode a first polypeptide which elicits production of antisera comprising antibodies which are specifically reactive to a second polypeptide encoded by a polynucleotide of (A) , (B) , or (C) . However, the first polypeptide does not bind to antisera raised against itself when the antisera has been fully immunosorbed with the first polypeptide. Hence, the polynucleotides of this embodiment can be used to generate antibodies for use in, for example, the screening of expression libraries for nucleic acids comprising polynucleotides of (A) , (B) , or (C) , or for purification of, or in immunoassays for, polypeptides encoded by the polynucleotides of (A) , (B) , or (C) . The polynucleotides of this embodiment embrace nucleic acid sequences which can be employed for selective hybridization to a polynucleotide encoding a polypeptide of the present invention. [0109] Screening polypeptides for specific binding to antisera can be conveniently achieved using peptide display libraries. This method involves the screening of large collections of peptides for individual members having the desired function or structure. Antibody screening of peptide display libraries is well known in the art. The displayed peptide sequences can be from 3 to 5000 or more amino acids in length, frequently from 5-100 amino acids long, and often from about 8 to 15 amino acids long. In addition to direct chemical synthetic methods for generating peptide libraries, several recombinant DNA methods have been described. One type involves the display of a peptide sequence on the surface of a bacteriophage or cell. Each bacteriophage or cell contains the nucleotide sequence encoding the particular displayed peptide sequence. Such methods are described in PCT patent publication Nos. 91/17271, 91/18980, 91/19818, and 93/08278. Other systems for generating libraries of peptides have aspects of both in vitro chemical synthesis and recombinant methods. See, PCT Patent publication Nos. 92/05258, 92/14843, and 96/19256. See also, U.S. Pat. Nos. 5,658,754; and 5,643,768. Peptide display libraries, vectors, and screening, kits are commercially available from such suppliers as Invitrogen (Carlsbad, Calif.).

E. Polynucleotides Encoding a Protein Having a Subsequence From a Prototype Polypeptide and is Cross-Reactive to the Prototype Polypeptide .

[0110] As indicated in (e) , above, the present invention provides isolated nucleic acids comprising polynucleotides of the present invention, wherein the polynucleotides encode a protein having a subsequence of contiguous amino acids from a prototype polypeptide of the present invention such as are provided in (a), above. The length of contiguous amino acids from the prototype polypeptide is selected from the group of integers consisting of from at least 10 to the number of amino acids within the prototype sequence. Thus, for example, the polynucleotide can encode a polypeptide having a subsequence having at least 10, 15, 20, 25, 30, 35, 40, 45, or 50, contiguous amino acids from the prototype polypeptide. Further, the number of such subsequences encoded by a polynucleotide of the instant embodiment can be any integer selected from the group consisting of from 1 to 20, such as 2, 3, 4, or 5. The subsequences can be separated by any integer of nucleotides from 1 to the number of nucleotides in the sequence such as at least 5, 10, 15, 25, 50, 100, or 200 nucleotides.

[0111] The proteins encoded by polynucleotides of this embodiment, when presented as an immunogen, elicit the production of polyclonal antibodies which specifically bind to a prototype polypeptide such as but not limited to, a polypeptide encoded by the polynucleotide of (a) or (b) , above. Generally, however, a protein encoded by a polynucleotide of this embodiment does not bind to antisera raised against the prototype polypeptide when the antisera has been fully iinmunosorbed with the prototype polypeptide. Methods of making and assaying for antibody binding specificity/affinity are well known in the art Exemplary immunoassay formats include ELISA, competitive immunoassays, radioimmunoassays, Western blots, indirect immunofluorescent assays and the like. ^'. [0112] In a preferred assay method, fully immunosorbed and pooled antisera which is elicited to the prototype polypeptide can be used in a competitive binding assay to test the protein. The concentration of the prototype polypeptide required to inhibit 50% of the binding of the antisera to the prototype polypeptide is determined. If the amount of the protein required to inhibit binding is less than twice the amount of the prototype protein, then the protein is said to specifically bind to the antisera elicited to the immunogen. Accordingly, the proteins of the present invention embrace allelic variants, conservatively modified variants, and minor recombinant modifications to a prototype polypeptide. [0113] A polynucleotide of the present invention optionally encodes a protein having a molecular weight as the non- glycosylated protein within 20% of the molecular weight of the full-length non-glycosylated polypeptides of the present invention. Molecular weight can be readily determined by SDS- PAGE under reducing conditions . Optionally, the molecular weight is within 15% of a full length polypeptide of the present invention, more preferably within 10% or 5%, and most preferably within 3%, 2%, or 1% of a full length polypeptide of the present invention. [0114] Optionally, the polynucleotides of this embodiment will encode a protein having a specific enzymatic activity at least 50%, 60%, 80%, or 90% of a cellular extract comprising the native, endogenous full-length polypeptide of the present invention. Further, the proteins encoded by polynucleotides of this embodiment will optionally have a substantially similar affinity constant (Km) and/or catalytic activity (i.e., the microscopic rate constant, kcat) as the native endogenous, full-length protein. Those of skill in the art will recognize that kcat/Km value determines the specificity for competing substrates and is often referred to as the specificity constant. Proteins of this embodiment can have a kcat/Km value at least 10% of a full-length polypeptide of the present invention as determined using the endogenous substrate of that polypeptide. Optionally, the kcat/Km value will be at least 20%, 30%, 40%, 50%, and most preferably at least 60%, 70%, 80%, 90%, or 95% the kcat/Km value of the full-length polypeptide of the present invention. Determination of kcat, Km, and kcat/Km can be determined by any number of means well known to those of skill in the art. For example, the initial rates (i.e., the first 5% or less of the reaction) can be determined using rapid mixing and sampling techniques (e.g., continuous-flow, stopped- flow, or rapid quenching techniques) , flash photolysis, or relaxation methods (e.g., temperature jumps) in conjunction with such exemplary methods of measuring as spectrophotometry, spectrofluorimetry, nuclear magnetic resonance, or radioactive procedures. Kinetic values are conveniently obtained using a Lineweaver-Burk or Eadie-Hofstee plot.

F. Polynucleotides Complementary to the Polynucleotides of (A)- (E) .

[0115] As indicated in (f) , above, the present invention provides isolated nucleic acids comprising polynucleotides complementary to the polynucleotides of paragraphs A-E, above. As those of skill in the art will recognize, complementary sequences base-pair throughout the entirety of their length with the polynucleotides of sections (A)-(E) (i.e., have 100% sequence identity over their entire length) . Complementary bases associate through hydrogen bonding in double stranded nucleic acids. For example, the following base pairs are complementary: guanine and cytosine; adenine and thymine; and adenine and uracil.

G. Polynucleotides Which are Subsequences of the Polynucleotides of (A) - (F) . [0116] As indicated in (g) , above, the present invention provides isolated nucleic acids comprising polynucleotides which comprise at least 15 contiguous bases from the polynucleotides of sections (A) through (F) as discussed above. The length of the polynucleotide is given as an integer selected from the group consisting of from at least 15 to the length of the nucleic acid sequence from which the polynucleotide is a subsequence of. Thus, for example, polynucleotides of the present invention are inclusive of polynucleotides comprising at least 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90 or 100 contiguous- nucleotides in length from the polynucleotides of (A)-(F). Optionally, the number of such subsequences encoded by a polynucleotide of the instant embodiment can be any integer selected from the group consisting of from 1 to 20, such as 2, 3, 4, or 5. The subsequences can be separated by any integer of nucleotides from 1 to the number of nucleotides in the sequence such as at least 5, 10, 15, 25, 50, 100, or 200 nucleotides. [0117] The subsequences of the present invention can comprise structural characteristics of the sequence from which it is derived. Alternatively, the subsequences can lack certain structural characteristics of the larger sequence from which it is derived such as a poly (A) tail. Optionally, a subsequence from a polynucleotide encoding a polypeptide having at least one linear epitope in common with a prototype polypeptide sequence as provided in (a) , above, may encode an epitope in common with the prototype sequence. Alternatively, the subsequence may not encode an epitope in common with the prototype sequence but can be used to isolate the larger sequence by, for example, nucleic acid hybridization with the sequence from which it's derived. Subsequences can be used to modulate or detect gene expression by introducing into the subsequences compounds which bind, intercalate, cleave and/or crosslink to nucleic acids. Exemplary compounds include acridine, psoralen, phenanthroline, naphthoquinone, daunomycin or chloroethylaminoaryl conjugates. Construction of Nucleic Acids

[0118] The isolated nucleic acids of the present invention can be made using (a) standard recombinant methods, (b) synthetic techniques, or combinations thereof. In some embodiments, the polynucleotides of the present invention will be cloned, amplified, or otherwise constructed from a monocot or a dicot. In certain embodiments, the polynucleotides will be cloned, amplified, or otherwise constructed from a monocot. In certain embodiments, the polynucleotides will be cloned, amplified, or otherwise constructed from a dicot. In certain embodiments the dicot is tomato.

[0119] The nucleic acids may conveniently comprise sequences in addition to a polynucleotide of the present invention. For example, a multi-cloning site comprising one or more endonuclease restriction sites may be inserted into the nucleic acid to aid in isolation of the polynucleotide. Also, translatable sequences may be inserted to aid in the isolation of the translated polynucleotide of the present invention. For example, a hexa-histidine marker sequence provides a convenient means to purify the proteins of the present invention. A polynucleotide of the present invention can be attached to a vector, adapter, or linker for cloning and/or expression of a polynucleotide of the present invention. Additional sequences may be added to such cloning and/or expression sequences to optimize their function in cloning and/or expression, to aid in isolation of the polynucleotide, or to improve the introduction of the polynucleotide into a cell. Typically, the length of a nucleic acid of the present invention less the length of its polynucleotide of the present invention is less than 20 kilobase pairs, often less than 15 kb, and frequently less than 10 kb. Use of cloning vectors, expression vectors, adapters, and linkers is well known and extensively described in the art. For a description of various nucleic acids see, for example, Stratagene Cloning Systems, Catalogs 1995, 1996, 1997 (La Jolla, Calif.); and, Amersham Life Sciences, Inc, Catalog '97 (Arlington Heights, 111.). Recombinant Methods for Constructing Nucleic Acids [0120] The isolated nucleic acid compositions of this invention, such as RNA, cDNA, genomic DNA, or a hybrid thereof, can be obtained from plant biological sources using any number of cloning methodologies known to those of skill in the art. In some embodiments, oligonucleotide probes which selectively hybridize, under stringent conditions, to the polynucleotides of the present invention are used to identify the desired sequence in a cDNA or genomic DNA library. While isolation of RNA, and construction of cDNA and genomic libraries is well known to those of ordinary skill in the art, the following highlights some of the methods employed.

1. mRNA Isolation and Purification [0121] Total RNA from plant cells comprises such nucleic acids as mitochondrial RNA, chloroplastic RNA, rRNA, tRNA, hnRNA and mRNA. Total RNA preparation typically involves lysis of cells and removal of organelles and proteins, followed by precipitation of nucleic acids. Extraction of total RNA from plant cells can be accomplished by a variety of means.

Frequently, extraction buffers include a strong detergent such as SDS and an organic denaturant such as guanidinium isothiocyanate, guanidine hydrochloride or phenol. Following total RNA isolation, poly (A)⁺ mRNA is typically purified from the remainder RNA using oligo(dT) cellulose. Exemplary total RNA and mRNA isolation protocols are described in Plant Molecular Biology: A Laboratory Manual, Clark, Ed., Springer- Verlag, Berlin (1997); and, Current Protocols in Molecular Biology, Ausubel, et at., Eds., Greene Publishing and Wiley- Interscience, New York (1995) . Total RNA and mRNA isolation kits are commercially available from vendors such as Stratagene (La Jolla, Calif.), Clonetech (Palo Alto, Calif.), Pharmacia (Piscataway, N.J.), and 5'-3' (Paoli Inc., PA.). See also, U.S. Pat. Nos. 5,614,391; and, 5,459,253. The mRNA can be fractionated into populations with size ranges of about 0.5, 1.0, 1.5, 2.0, 2.5 or 3.0 kb. The cDNA synthesized for each of these fractions can be size selected to the same size range as its mRNA prior to vector insertion. This method helps eliminate truncated cDNA formed by incompletely reverse transcribed mRNA.

2. Construction of a cDNA Library [0122] Construction of a cDNA library .generally entails five steps. First, first strand cDNA synthesis is initiated from a poly (A) ⁺ mRNA template using a poly(dT) primer or random hexanucleotides . Second, the resultant RNA-DNA hybrid is converted into double stranded cDNA, typically by reaction with a combination of RNAse H and DNA polymerase I (or Klenow fragment) Third, the termini of the double stranded cDNA are ligated to adaptors. Ligation of the adaptors can produce cohesive ends for cloning. Fourth, size selection of the double stranded cDNA eliminates excess adaptors and primer fragments, and eliminates partial cDNA molecules due to degradation of mRNAs or the failure of reverse transcriptase to synthesize complete first strands. Fifth, the cDNAs are ligated into cloning vectors and packaged. cDNA synthesis protocols are well known to the skilled artisan and are described in such standard references as: Plant Molecular Biology: A Laboratory Manual, Clark, Ed., Springer-Verlag, Berlin (1997); and, Current Protocols in Molecular Biology, Ausubel, et al . , Eds., Greene Publishing and Wiley-Interscience, New York (1995) . cDNA synthesis kits are available from a variety of commercial vendors such as Stratagene or Pharmacia.

[0123] A number of cDNA synthesis protocols have been described which provide substantially pure full-length cDNA libraries. Substantially pure full-length cDNA libraries are constructed to comprise at least 90%, and more preferably at least 93% or 95% full-length inserts amongst clones containing inserts. The length of insert in such libraries can be from 0 to 8, 9, 10, 11, 12, 13, or more kilobase pairs. Vectors to accommodate inserts of these sizes are known in the art and available commercially. See, e.g., Stratagene "s lambda ZAP Express (cDNA cloning vector with 0 to 12 kb cloning capacity) . [0124] An exemplary method of constructing a greater than 95% pure full-length cDNA library is described by Carninci et al., Genomics, 37:327-336 (1996). In that protocol, the cap- structure of eukaryotic mRNA .is chemically labeled with biotin. By using streptavidin-coated magnetic beads, only the full- length first-strand cDNA/mRNA hybrids are selectively recovered after RNase I treatment. The method provides a high yield library with an unbiased representation of the starting mRNA population. Other methods for producing full-length libraries are known in the art. See, e.g., Edery et al., MoI. Cell. Biol., 15(6) :3363-3371 (1995); and, PCT Application WO 96/34981.

3. Normalized or Subtracted cDNA Libraries

[0125] A non-normalized cDNA library represents the mRNA population of the tissue it was made from. Since unique clones are out-numbered by clones derived from highly expressed genes their isolation can be laborious. Normalization of a cDNA library is the process of creating a library in which each clone is more equally represented. [0126] A number of approaches to normalize cDNA libraries are known in the art. One approach is based on hybridization to genomic DNA. The frequency of each hybridized cDNA in the resulting normalized library would be proportional to that of each corresponding gene in the genomic DNA. Another approach is based on kinetics. If cDNA reannealing follows second-order kinetics, rarer species anneal less rapidly and the remaining single-stranded fraction of cDNA becomes progressively more normalized during the course of the hybridization. Specific loss of any species of cDNA, regardless of its abundance, does not occur at any Cot value. Construction of normalized libraries is described in Ko, Nucl . Acids. Res., 18(19): 5705- 5711 (1990); Patanjali et al., Proc. Natl. Acad. U.S.A., 88:1943-1947 (1991); U.S. Pat. Nos . 5,482,685, and 5,637,685. In an exemplary method described by Soares et al., normalization resulted in reduction of the abundance of clones from a range of four orders of magnitude to a narrow range of only 1 order of magnitude. Proc. Natl. Acad. Sci. USA, 91:9228- 9232 (1994) . [0127] Subtracted cDNA libraries are another means to increase the proportion of less abundant cDNA species. In this procedure, cDNA prepared from one pool of mRNA is depleted of sequences present in a second pool of mRNA by hybridization. The cDNA:mRNA hybrids are removed and the remaining un- hybridized cDNA pool is enriched for sequences unique to that pool. See, Foote et al. in, Plant Molecular Biology: A Laboratory Manual, Clark, Ed., Springer-Verlag, Berlin (1997); Kho and Zarbl, Technique, 3(2):583 (1991); Sive and St. John, Nucl. Acids Res., 16(22): 10937 (1988); Current Protocols in

Molecular Biology, Ausubel, et al . , Eds., Greene Publishing and Wiley-Interscience, New York (1995); and, Swaroop et al., Nucl. Acids Res., 19)8): 1954 (1991). cDNA subtraction kits are commercially available. See, e.g., PCR-Select (Clontech, Palo Alto, Calif. ) .

4. Construction of a Genomic Library

[0128] To construct genomic libraries, large segments of genomic DNA are generated by fragmentation, e.g. using restriction endonucleases, and are ligated with vector DNA to form concatemers that can be packaged into the appropriate vector. Methodologies to accomplish these ends, and sequencing methods to verify the sequence of nucleic acids are well known in the art. Examples of appropriate molecular biological techniques and instructions sufficient to direct persons of skill through many construction, cloning, and screening methodologies are found in Sambrook, et al . , Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory VoIs. 1-3 (1989), Methods in Enzymology, Vol. 152: Guide to Molecular Cloning Techniques, Berger and Kimmel, Eds., San Diego: Academic Press, Inc. (1987), Current Protocols in Molecular Biology, Ausubel, et al., Eds., Greene Publishing and Wiley-Interscience, New York (1995) ; Plant Molecular Biology: A Laboratory Manual, Clark, Ed., Springer-Verlag, Berlin (1997). Kits for construction of genomic libraries are also commercially available. 5. Nucleic Acid Screening and Isolation Methods [0129] The cDNA or genomic library can be screened using a probe based upon the sequence of a polynucleotide of the present invention such as those disclosed herein. Probes may be used to hybridize with genomic DNA or cDNA sequences to isolate homologous genes in the same or different plant species. Those of skill in the art will appreciate that various degrees of stringency of hybridization can be employed in the assay; and either the hybridization or the wash medium can be stringent. As the conditions for hybridization become more stringent, there must be a greater degree of complementarity between the probe and the target for duplex formation to occur. The degree of stringency can be controlled by temperature, ionic strength, pH and the presence of a partially denaturing solvent such as formamide . For example, the stringency of hybridization is conveniently varied by changing the polarity of the reactant solution through manipulation of the concentration of formamide within the range of 0% to 50%. The degree of complementarity (sequence identity) required for detectable binding will vary in accordance with the stringency of the hybridization medium and/or wash medium. The degree of complementarity will optimally be 100 percent; however, it should be understood that minor sequence variations in the probes and primers may be compensated for by reducing the stringency of the hybridization and/or wash medium.

[0130] The nucleic acids of interest can also be amplified from nucleic acid samples using amplification techniques. For instance, polymerase chain reaction (PCR) technology can be used to amplify the sequences of polynucleotides of the present invention and related genes directly from genomic DNA or cDNA libraries. PCR and other in vitro amplification methods may also be useful, for example, to clone nucleic acid sequences that code for proteins to be expressed, to make nucleic acids to use as probes for detecting the presence of the desired mRNA in samples, for nucleic acid sequencing, or for other purposes. Examples of techniques sufficient to direct persons of skill trough in vitro amplification methods are found in Berger, Sambrook, and Ausubel, as well as Mullis et at., U.S. Pat. No. 4,683,202 (1987); and, PCR Protocols A Guide to Methods and Applications, Innis et al., Eds., Academic Press Inc., San Diego, Calif. (1990) . Commercially available kits for genomic PCR amplification are known in the art. See, e.g., Advantage-GC Genomic PCR Kit (Clontech) . The T4 gene 32 protein (Boehringer Mannheim) can be used to improve yield of long PCR products. [0131] ^' PCR-based screening methods have also been described. Wilfinger et al. describe a PCR-based method in which the longest cDNA is identified in the first step so that incomplete clones can be eliminated from study. BioTechniques, 22(3): 481- 486 (1997) . In that method, a primer pair is synthesized with one primer annealing to the 5 ' end of the sense strand of the desired cDNA and the other primer to the vector. Clones are pooled to allow large-scale screening. By this procedure, the longest possible clone is identified amongst candidate clones. Further, the PCR product is used solely as a diagnostic for the presence of the desired cDNA and does not utilize the PCR product itself. Such methods are particularly effective in combination with a full-length cDNA construction methodology, above.

Synthetic Methods for Constructing Nucleic Acids [0132] The isolated nucleic acids of the present invention can also be prepared by direct chemical synthesis by methods such as the phosphotriester method of Narang et al., Meth. Enzymol. 68: 90-99 (1979); the phosphodiester method of Brown et al., Meth. Enzymol. 68: 109-151 (1979); the diethylphosphoramidite method of Beaucage et al., Tetra. Leu. 22: 1859-1862 (1981); the solid phase phosphoramidite triester method described by Beaucage and Caruthers, Tetra. Letts. 22(20): 1859-1862 (1981), e.g., using an automated synthesizer, e.g., as described in Needham-VanDevanter et al., Nucleic Acids Res., 12: 6159-6168 (1984); and, the solid support method of U.S. Pat. No. 4,458,066. Chemical synthesis generally produces a single stranded oligonucleotide. This may be converted into double stranded DNA by hybridization with a complementary sequence, or by polymerization with a DNA polymerase using the single strand as a template. One of skill will recognize that while chemical synthesis of DNA is best employed for sequences of about 100 bases or less, longer sequences may be obtained by the ligation of shorter sequences.

Recombinant Expression Cassettes

[0133] The present invention further provides recombinant expression cassettes comprising a nucleic acid of the present invention. A nucleic acid sequence coding for the desired polypeptide of the present invention, for example a cDNA or a genomic sequence encoding a full length polypeptide of the present invention, can be used to construct a recombinant expression cassette which can be introduced into the desired host cell. A recombinant expression cassette will typically comprise a polynucleotide of the present invention operably linked to transcriptional initiation regulatory sequences which will direct the transcription of the polynucleotide in the intended host cell, such as tissues of a transformed plant. [0134] For example, plant expression vectors may include (1) a cloned plant gene under the transcriptional control of 5' and 3' regulatory sequences and (2) a dominant selectable marker. Such plant expression vectors may also contain, if desired, a promoter regulatory region (e.g., one conferring inducible or constitutive, environmentally- or developmentally-regulated, or cell- or tissue-specific/selective expression) , a transcription initiation start site, a ribosome binding site, an RNA processing signal, a transcription termination site, and/or a polyadenylation signal. [0135] A plant promoter fragment can be employed which will direct expression of a polynucleotide of the present invention in all tissues of a regenerated plant. Such promoters are referred to herein as "constitutive" promoters and are active under most environmental conditions and states of development or cell .differentiation. Examples of constitutive promoters include the cauliflower mosaic virus (CaMV) 35S transcription initiation region, the 1'- or 2'- promoter derived from T-DNA of Agrobacterium tumefaciens, the ubiquitin 1 promoter, the Smas promoter, the cinnamyl alcohol dehydrogenase promoter (U.S. Pat. No. 5,683,439), the Nos promoter, the pEmu promoter, the rubisco promoter, the GRPl-8 promoter, and other transcription initiation regions from various plant genes known to those of skill. One exemplary promoter is the ubiquitin promoter, which can be used to drive expression of the present invention in plant embryos or embryogenic callus. [0136] Alternatively, the plant promoter can direct expression of a polynucleotide of the present invention in a specific tissue or may be otherwise under more precise environmental or developmental control. Such promoters are referred to here as "inducible" promoters. Environmental conditions that may effect transcription by inducible promoters include pathogen attack, anaerobic conditions, or the presence of light. Examples of inducible promoters are the Adhl promoter which is inducible by hypoxia or cold stress, the Hsp70 promoter which is inducible by heat stress, and the PPDK promoter which is inducible by light. [0137] Examples of promoters under developmental control include promoters that initiate transcription only, or preferentially, in certain tissues, such as leaves, roots, fruit, seeds, or flowers. Exemplary promoters include the anther specific promoter 5126 (U.S. Pat. Nos. 5,689,049 and 5,689,051), glob-1 promoter, and gamma-zein promoter. The operation of a promoter may also vary depending on its location in the genome. Thus, an inducible promoter may become fully or partially constitutive in certain locations. Promoters may be meiosis specific. A promoter may be DMCl. [0138] Both heterologous and non-heterologous (i.e., endogenous) promoters can be employed to direct expression of the nucleic acids of the present invention. These promoters can also be used, for example, in recombinant expression cassettes to drive expression of antisense nucleic acids to reduce, increase, or alter concentration and/or composition of the proteins of the present invention in a desired tissue. Thus, in some embodiments, the nucleic acid construct will comprise a promoter functional in a plant cell, such as in tomato, operably linked to a polynucleotide of the present invention. Promoters useful in these embodiments include the endogenous promoters driving expression of a polypeptide of the present invention.

[0139] In some embodiments, isolated nucleic acids which serve as promoter or enhancer elements can be introduced in the appropriate position (generally upstream) of a non-heterologous form of a polynucleotide of the present invention so as to up or down regulate expression of a polynucleotide of the present invention. For example, endogenous promoters can be introduced in vivo by mutation, deletion, and/or substitution (see, Kmiec, U.S. Pat. No. 5,565,350; Zarling et at., PCT/US93/03868) , or isolated promoters can be introduced into a plant cell in the proper orientation and distance from a gene of the present invention so as to control the expression of the gene. Gene expression can be modulated under conditions suitable for plant growth so as to alter the total concentration and/or alter the composition of the polypeptides of the present invention in plant cell. Thus, the present invention provides compositions, and methods for making, heterologous promoters and/or enhancers operably linked to a native, endogenous (i.e., non- heterologous) form of a polynucleotide of the present invention. [0140] Methods for identifying promoters with a particular expression pattern, in terms of, e.g., tissue type, cell type, stage of development, and/or environmental conditions, are well known in the art. See, e.g., The Maize Handbook, Chapters 114- 115, Freeling and Walbot, Eds., Springer, N. Y. (1994); Corn and Corn Improvement, 3^rd edition, Chapter β, Sprague and Dudley, Eds., American Society of Agronomy, Madison, Wis. (1988). A typical step in promoter isolation methods is identification of gene products that are expressed with some degree of specificity in the target tissue. Amongst the range of methodologies are: differential hybridization to cDNA libraries; subtractive hybridization; differential display; differential 2-D protein gel electrophoresis; DNA probe arrays; and isolation of proteins known to be expressed with some specificity in the target tissue. Such methods are well known to those of skill in the art. Commercially available products for identifying promoters are known in the art such as Clontech's (Palo Alto, Calif.) Universal GenomeWalker Kit. [0141] For the protein-based methods, it is helpful to obtain the amino acid sequence for at least a portion of the identified protein, and then to use the protein sequence as the basis for preparing a nucleic acid that can be used as a probe to identify either genomic DNA directly, or preferably, to identify a cDNA clone from a library prepared from the target tissue. Once such a cDNA clone has been identified, that sequence can be used to identify the sequence at the 5 ' end of the transcript of the indicated gene. For differential hybridization, subtractive hybridization and differential display, the nucleic acid sequence identified as enriched in the target tissue is used to identify the sequence at the 5' end of the transcript of the indicated gene. Once such sequences are identified, starting either from protein sequences or nucleic acid sequences, any of these sequences identified as being from the gene transcript can be used to screen a genomic library prepared from the target organism. Methods for identifying and confirming the transcriptional start site are well known in the art. [0142] In the process of isolating promoters expressed under particular environmental conditions or stresses, or in specific tissues, or at particular developmental stages, a number of genes are identified that are expressed under the desired circumstances, in the desired tissue, or at the desired stage. Further analysis will reveal expression of each particular gene in one or more other tissues of the plant. One can identify a promoter with activity in the desired tissue or condition but that does not have activity in any other common tissue. [0143] To identify the promoter sequence, the 5' portions of the clones described here are analyzed for sequences characteristic of promoter sequences. For instance, promoter sequence elements include the TATA box consensus sequence (TATAAT) , which is usually an AT-rich stretch of 5-10 bp located approximately 20 to 40 base pairs upstream of the transcription start site. Identification of the TATA box is well known in the art. For example, one way to predict the location of this element is to identify the transcription start site using standard RNA-mapping techniques such as primer extension, Sl analysis, and/or RNase protection. To confirm the presence of the AT-rich sequence, a structure-function analysis can be performed involving mutagenesis of the putative region and quantification of the mutation's effect on expression of a linked downstream reporter gene. See, e.g., The Maize Handbook, Chapter 114, Freeling and Walbot, Eds., Springer, N. Y., (1994). [0144] In plants, further upstream from the TATA box, at positions -80 to -100, there is typically a promoter element (i.e., the CAAT box) with a series of adenines surrounding the trinucleotide G (or T) N G. J. Messing et al . , in Genetic Engineering in Plants, Kosage, Meredith and Hollaender, Eds., pp. 221-227 (1983) . [0145] Once promoter and/or gene sequences are known, a region of suitable size is selected from the genomic DNA that is 5' to the transcriptional start, or the translational start site, and such sequences are then linked to a coding sequence. If the transcriptional start site is used as the point of fusion, any of a number of possible 5' untranslated regions can be used in between the transcriptional start site and the partial coding sequence. If the translational start site at the 3' end of the specific promoter is used, then it is linked directly to the methionine start codon of a coding sequence. [0146] If polypeptide expression is desired, it is generally desirable to include a polyadenylation region at the 3' end of a polynucleotide coding region. The polyadenylation region can be derived from the natural gene, from a variety of other plant genes, or from T-DNA. The 3' end sequence to be added can be derived from, for example, the nopaline synthase or octopine synthase genes, or alternatively from another plant gene, or less preferably from any other eukaryotic gene. [0147] An intron sequence can be added to the 5' untranslated region or the coding sequence of the partial coding sequence to increase the amount of the mature message that accumulates in the cytosol. Inclusion of a spliceable intron in the transcription unit in both plant and animal expression constructs has been shown to increase gene expression at both the mRNA and protein levels up to 1000-fold. Buchmah and Berg, MoI. Cell Biol. 8: 4395-4405 (1988); Callis et al., Genes Dev. 1: 1183-1200 (1987). Such intron enhancement of gene expression is typically greatest when placed near the 5' end of the transcription unit.

[0148] The vector comprising the sequences from a polynucleotide of the present invention will typically comprise a marker gene which confers a selectable phenotype on plant cells. Usually, the selectable marker gene will encode antibiotic resistance, with suitable genes including genes coding for resistance to the antibiotic spectinomycin (e.g., the aada gene) , the streptomycin phosphotransferase (SPT) gene coding for streptomycin resistance, the neomycin phosphotransferase (NPTII) gene encoding kanamycin or geneticin resistance, the hygromycin phosphotransferase (HPT) gene coding for hygromycin resistance, genes coding for resistance to herbicides which act to inhibit the action of acetolactate synthase (ALS) , in particular the sulfonylurea-type herbicides (e.g., the acetolace synthase (ALS) gene containing mutations leading to such resistance in particular the S4 and/or Hra mutations), genes coding for resistance to herbicides which act to inhibit action of glutamine synthase, such as phosphinothricin or basta (e.g., the bar gene), or other such genes known in the art. The bar gene encodes resistance to the herbicide basta, the nptll gene encodes resistance to the antibiotics kanamycin and geneticin, and the ALS gene encodes resistance to the herbicide chlorsulfuron. [0149] Typical vectors useful for expression of genes in higher plants are well known in the art and include vectors derived from the tumor-inducing (Ti) plasmid of Agrobacterium tumefaciens described by Rogers et al., Meth. in Enzymol., 153:253-277 (1987). These vectors are plant integrating vectors in that on transformation, the vectors integrate a portion of vector DNA into the genome of the host plant. Exemplary A. tumefaciens vectors useful herein are plasmids pKYLXβ and pKYLX7 of Schardl et al . , .Gene, 61:1-11 (1987) and Berger et al., Proc. Natl. Acad. Sci. U.S.A., 86:8402-8406 (1989). Another useful vector herein is plasmid pBI101.2 that is available from Clontech Laboratories, Inc. (Palo Alto, Calif.).. [0150] ^• A polynucleotide of the present invention can .be expressed in either sense or anti-sense orientation as desired. It will be appreciated that control of gene expression in either sense or anti-sense orientation can have a direct impact on the observable plant characteristics. Antisense technology can be conveniently used to inhibit gene expression in plants. To accomplish this, a nucleic acid segment from the desired gene is cloned and operably linked to a promoter such that the anti-sense strand of RNA will be transcribed. The construct is then transformed into plants and the antisense strand of RNA is produced. In plant cells, it has been shown that antisense RNA inhibits gene expression by preventing the accumulation of mRNA which encodes the enzyme of interest, see, e.g., Sheehy et al . , Proc. Nat'l. Acad. Sci. (USA) 85: 8805-8809 (1988); and Hiatt et al., U.S. Pat. No. 4,801,340. [0151] Another method of suppression is sense suppression. Introduction of nucleic acid configured in the sense orientation has been shown to be an effective means by which to block the transcription of target genes. For an example of the use of this method to modulate expression of endogenous genes see, Napoli et al., The Plant Cell 2: 279-289 (1990) and U.S. Pat. No. 5,034,323.

[0152] Catalytic RNA molecules or ribozymes can also be used to inhibit expression of plant genes. It is possible to .design ribozymes that specifically pair with virtually any target RNA and .cleave the phosphodiester backbone at a specific location, thereby functionally inactivating the target RNA. In carrying out this cleavage, the ribozyme is not itself altered, and is thus capable of recycling and cleaving other molecules, making it a true enzyme. The inclusion of ribozyme sequences within antisense RNAs confers RNA-cleaving activity upon them, thereby increasing the activity of the constructs. The design and use of target RNA-specific ribozymes is described in Haseloff et al., Nature 334: 585-591 (1988).

[0153] A variety of cross-linking agents, alkylating agents and radical generating species as pendant groups on polynucleotides of the present invention can be used to bind, label, detect, and/or cleave nucleic acids. For example, Vlassov, V. V., et al., Nucleic Acids Res (1986) 14:4065-4076, describe covalent bonding of a single-stranded DNA fragment with allylating derivatives of nucleotides complementary to target sequences. A report of similar work by the same group is that by Knorre, D. G., et al . , Biochimie (1985) 67:785-789. Iverson and Dervan also showed sequence-specific cleavage of single-stranded DNA mediated by incorporation of a modified nucleotide which was capable of activating cleavage (J Am Chem Soc (1987) 109:1241-1243). Meyer, R. B., et al., J Am Chem Soc (1989) 111:8517-8519, effect covalent crosslinking to a target nucleotide using an alkylating agent complementary to the single-stranded target nucleotide sequence. A photoactivated crosslinking to single-strain oligonucleotides mediated by psoralen was disclosed by Lee, B. L., et al., Biochemistry (1988) 27:3197-3203. Use of crosslinking in triple-helix forming probes was also disclosed by Home, et al . , J Am Chem Soc (1990) 112:2435-2437. Use of N4, N4-eocytosine as an alkylating agent to crosslink to single-stranded oligonucleotides has also been described by Webb and Matteucci, J Am Chem Soc (1986) 108:2764-2765; Nucleic Acids Res (1986) 14:7661-7674; Feteritz et al . , J. Am Chem. Soc. 113:4000

(1991) . Various compounds to bind, detect, label, and/or cleave nucleic acids are known in the art. See, for example, U.S. Pat. Nos. 5,543,507; 5,672,593; 5,484,908; 5,256,648; and, 5,681941.

Proteins

[0154] The isolated proteins of the present invention comprise a polypeptide having at least 10 amino acids encoded by any one of the polynucleotides of the present invention as discussed more fully, above, or polypeptides which are conservatively modified variants thereof. The proteins of the present invention or variants thereof can comprise any number of contiguous amino acid residues from a polypeptide of the present invention, wherein that number is selected from the group of integers consisting of from 1 to the number of residues in a full-length polypeptide of the present invention. Optionally, this subsequence of contiguous amino acids is at least 15, 20, 25, 30, 35, or 40 amino acids in length, often at least 50, 60, 70, 80, or 90 amino acids in length. Further, the number of such subsequences can be any integer selected from the group consisting of from 1 to 20, such as 2, 3, 4, or 5. [0155] The present invention further provides a protein comprising a polypeptide having a specified sequence identity with a polypeptide of the present invention. The percentage of sequence identity is an integer selected from the group consisting of from 50 to 99. Exemplary sequence identity values include 60%, 65%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% and 99%. Sequence identity can be determined using, for example, the GAP or BLAST algorithms .

[0156] As those of skill will appreciate, the present invention includes catalytically active polypeptides of the present invention (i.e., enzymes). Catalytically active polypeptides have a specific activity of at least 20%, 30%, or 40%, and preferably at least 50%, 60%, or 70%, and most preferably at least 80%, 90%, or 95% that of the native (non- synthetic), endogenous polypeptide. Further, the substrate specificity (kcat/Km) is optionally substantially similar to the native (non-synthetic), endogenous polypeptide. Typically, the Km will be at least 30%, 40%, or 50%, that of the native (non-synthetic) , endogenous polypeptide; and more preferably at least 60%, 70%, 80%, or 90%. Methods of assaying and quantifying measures of enzymatic activity and substrate specificity (kcat/Km) are well known to those of skill in the art. [0157] Generally, the proteins of the present invention will, when presented as an immunogen, elicit production of an antibody specifically reactive to a polypeptide of the present invention. Further, the proteins of the present invention will not bind to antisera raised against a polypeptide of the present invention which has been fully immunosorbed with the same polypeptide. Immunoassays for determining binding are well known to those of skill in the art. A preferred immunoassay is a competitive immunoassay as discussed, infra. Thus, the proteins of the present invention can be employed as immunogens for constructing antibodies immunoreactive to a protein of the present invention for such exemplary utilities as immunoassays or protein purification techniques.

Expression of Proteins in Host Cells

[0158] Using the nucleic acids of the present invention, one may express a protein of the preset invention in a recombinantly engineered cell such as bacteria, yeast, insect, mammalian, or preferably plant cells. The cells produce the protein in a non-natural condition (e.g., in quantity, composition, location, and/or time) , because they have been genetically altered through human intervention to do so. [0159] It is expected that those of skill in the art are knowledgeable in the numerous expression systems available for expression of a nucleic acid encoding a protein of the present invention. No attempt to describe in detail the various methods known for the expression of proteins in prokaryotes or eukaryotes will be made. [0160] In brief summary, the expression of isolated nucleic acids encoding a protein of the present invention will typically be achieved by operably linking, for example, the DNA or cDNA to a promoter (which is either constitutive or regulatable) , followed by incorporation into an expression vector. The vectors can be suitable for replication and integration in either prokaryotes or eukaryotes. Typical expression vectors contain transcription and translation terminators, initiation sequences, and promoters useful for regulation of the expression of the DNA encoding a protein of the present invention. To obtain high level expression of a cloned gene, it is desirable to construct expression vectors which contain, at the minimum, a strong promoter to direct transcription, a ribosome binding site for translational initiation, and a transcription/translation terminator. One of skill would recognize that modifications can be made to a protein of the present invention without diminishing its biological activity. Some modifications may be made to facilitate the cloning, expression, or incorporation of the targeting molecule into a fusion protein. Such modifications are well known to those of skill in the art and include, for example, a methionine added at the amino terminus to provide an initiation site, or additional amino acids (e.g., poly His) placed on either terminus to create conveniently located purification sequences. Restriction sites or termination codons can also be introduced.

Expression in Prokaryotes [0161] Prokaryotic cells may be used as hosts for expression. Prokaryotes most frequently are represented by various strains of E. coli; however, other microbial strains may also be used. Commonly used prokaryotic control sequences which are defined herein to include promoters for transcription initiation, optionally with an operator, along with ribosome binding site sequences, include such commonly used promoters as the beta lactamase (penicillinase) and lactose (lac) promoter systems (Chang et al . , Nature 198:1056 (1977)), the tryptophan (trp) promoter system (Goeddel et al . , Nucleic Acids Res. 8:4057 (1980)) and the lambda derived P L promoter and N-gene ribosome binding site (Shimatake e al., Nature 292:128 (1981)). The inclusion of selection markers in DNA vectors transfected in E. coli is also useful. Examples of such markers include genes specifying resistance to ampicillin, tetracycline, or chloramphenicol.

[0162] The vector is selected to allow introduction into the appropriate host cell. Bacterial vectors are typically of plasmid or phage origin. Appropriate bacterial cells are infected with phage vector particles or transfected with naked phage vector DNA. If a plasmid vector is used, the bacterial cells are transfected with the plasmid vector DNA. Expression systems for expressing a protein of the present invention are available using Bacillus sp. and Salmonella (Palva, et al., Gene 22: 229-235 (1983); Mosbach, et al., Nature 302: 543-545 (1983)) .

Expression in Eukaryotes

[0163] A variety of eukaryotic expression systems such as yeast, insect cell lines, plant and mammalian cells, are known to those of skill in the art. As explained briefly below, a polynucleotide of the present invention can be expressed in these eukaryotic systems. In some embodiments, transformed/transfected plant cells, as discussed infra, are employed as expression systems for production of the proteins of the instant invention. [0164] Synthesis of heterologous proteins in yeast is well known. Sherman, F., et al., Methods in Yeast Genetics, Cold Spring Harbor Laboratory (1982) is a well recognized work describing the various methods available to produce the protein in yeast. Two widely utilized yeast for production of eukaryotic proteins are Saccharonzyces cerevisiae and Pichia pastoris. Vectors, strains, and protocols for expression in Saccharomyces and Pichia are known in the art and available from commercial suppliers (e.g., Invitrogen) . Suitable vectors usually have expression control sequences, such as promoters, including 3-phosphoglycerate kinase or alcohol oxidase, and an origin of replication, termination sequences and the like as desired.

[0165] A protein of the present invention, once expressed, can be isolated from yeast by lysing the cells and applying standard protein isolation techniques to the lysates. The monitoring of the purification process can be accomplished by using Western blot techniques or radioimmunoassays of other standard immunoassay techniques. [0166] The sequences encoding proteins of the present invention can also be ligated to various expression vectors for use in transfecting cell cultures of, for instance, mammalian, insect, or plant origin. Illustrative of cell cultures useful for the production of the peptides are mammalian cells.

Mammalian cell systems often will be in the form of monolayers of cells although mammalian cell suspensions may also be used. A number of suitable host cell lines capable of expressing intact proteins have been developed in the art, and include the HEK293, BHK21, and CHO cell lines. Expression vectors for these cells can include expression control sequences, such as an origin of replication, a promoter (erg., the CMV promoter, a HSV tk promoter or pgk (phosphoglycerate kinase) promoter) , an enhancer (Queen et al . , Immunol. Rev. 89: 49 (1986)), and necessary processing information sites, such as ribosome binding sites, RNA splice sites, polyadenylation sites (e.g., an SV40 large T Ag poly A addition site) , and transcriptional terminator sequences. Other animal cells useful for production of proteins of the present invention are available, for instance, from the American Type Culture Collection.

[0167] Appropriate vectors for expressing proteins of the present invention in insect cells are usually derived from the SF9 baculovirus. Suitable insect cell lines include mosquito larvae, silkworm, armyworm, moth and Drosophila cell lines such as a Schneider cell line (See, Schneider, J. Embryol. Exp. Morphol. 27: 353-365 (1987).

[0168] As with yeast, when higher animal or plant host cells are employed, polyadenlyation or transcription terminator sequences are typically incorporated into the vector. An example of a terminator sequence is the polyadenlyation sequence from the bovine growth hormone gene. Sequences for accurate splicing of the transcript may also be included. An example of a splicing sequence is the VPl intron from SV40 (Sprague, et al., J. Virol. 45: 773-781 (1983)). Additionally, gene sequences to control replication in the host cell may be incorporated into the vector such as those found in bovine papilloma virus type-vectors. Saveria-Campo, M., Bovine Papilloma Virus DNA a Eukaryotic Cloning Vector in DNA Cloning Vol. II a Practical Approach, D. M. Glover, Ed., IRL Press, Arlington, Va. pp. 213-238 (1985) .

Transfection/Transformation of Cells

[0169] The method of transformation/transfection is not critical to the instant invention; various methods of transformation or transfection are currently available. As newer methods are available to transform crops or other host cells they may be directly applied. Accordingly, a wide variety of methods have been developed to insert a DNA sequence into the genome of a host cell to obtain the transcription and/or translation of the sequence to effect phenotypic changes in the organism. Thus, any method which provides for effective transformation/transfection may be employed.

Plant Transformation

[0170] A DNA sequence coding for the desired polynucleotide of the present invention, for example a cDNA or a genomic sequence encoding a full length protein, will be used to construct a recombinant expression cassette which can be introduced into the desired plant.

[0171] Isolated nucleic acids of the present invention can be introduced into plants according to techniques known in the art. Generally, recombinant expression cassettes as described above and suitable for transformation of plant cells are prepared. The isolated nucleic acids of the present invention can then be used for transformation. In this manner, genetically modified plants, plant cells, plant tissue, seed, and the like can be obtained. Transformation protocols may vary depending on the type of plant cell, i.e. monocot or dicot, targeted for transformation. Suitable methods of transforming plant cells include microinjection (Crossway et al. (1986) Biotechniques 4:320-334), electroporation (Riggs et a" (1986) Proc. Natl. Acad. Sci. USA 83:5602-5606, Agrobacterinum mediated transformation (see for example, Zhao et al. U.S. Pat. No. 5,981,840; Hinchee et al . (1988) Biotechnology 6:915-921), direct gene transfer (Paszkowski et al (1984) EMBO J. 3:2717- 2722), and balistic particle acceleration (see, for example, Sanford et al . U.S. Pat. No. 4,945,050; Tomes et al . "Direct DNA Transfer into Intact Plant Cells via Microprojectile Bombardment" In Gamborg and Phillips (Eds.) Plant Cell, Tissue and Organ Culture: Fundmental Methods, Springer-Verlag, Berlin (1995); and McCabe et al. (1988) Biotechnology 6:923-926). Also see, Weissinger et al . (1988) Annual Rev. Genet. 22:421-477; Sanford. et al. (1987) Particulate Science and Technology 5:27- 37 (onion); Christou et al. (1988) Plant Phisiol. 87:671-674 (soybean); McCabe et al . (1988) Bio/Technology 6:923-926 (soybean); Datta et al (1990) Biotechnology 8:736-740 (rice); Klein et al . (1988) Proc. Natl. Acad Sci. USA 85:4305-4309 (maize); Klein et al . (1988) Biotechnology 6:559-563 (maize); Tomes et al. "Direct DNA Transfer into Intact Plant Cells via Microprojectile Bombardment" In Gamborg and Phillips (Eds.) Plant Cell, Tissue and Organ Culture: Fundamental Methods, Springer-Verlag, Berlin (1995) (maize); Klein et al . (1988) Plant Physiol. 91:440-444 (maize) Fromm et al . (1990) Biotechnology 8:833-839 (maize); Hooykaas-Van Slogteren & Hooykaas (1984) Nature (London) 311:763-764; Bytebier et al (1987) Proc. Natl. Acad. Sci. USA 84:5345-5349 (Liliaceae) ; De Wet et al. (1985) In The Experimental Manipulation of Ovule Tissues ed. G. P. Chapman et al. pp. 197-209. Longman, N. Y. (pollen); Kaeppler et al. (1990) Plant Cell Reports 9:415-418; and Kaeppler et al . (1992) Theor. Appl. Genet. 84:560-566 (whisker-mediated transformation); D'Halluin et al. (1992) Plant Cell 4:1495-1505 (electroporation) ; LI et at. (1993) Plant Cell Reports 12:250-255 and Christou and Ford (1995) Annals of Botany 75:745-750 (maize via Agrobacterium tumefaciens) ; all of which are herein incorporated by reference .

[0172] The cells which have been transformed may be grown into plants in accordance with conventional ways. See, for example, McCormick et al . (1986) Plant Cell Reports, 5:81-84. These plants may then be grown, and either pollinated with the same transformed strain or different strains, and the resulting hybrid having the desired phenotypic characteristic identified. Two or more generations may be grown to ensure that the subject phenotypic characteristic is stably maintain and inherited and then seeds harvested to ensure the desired phenotype or other property has been achieved.

Transfection of Prokaryotes, Lower Eukaryotes , and Animal Cells [0173] Animal and lower eukaryotic (e.g., yeast) host cells are competent or rendered competent for transfection by various means. There are several well-known methods of introducing DNA into animal cells. These include: calcium phosphate precipitation, fusion of the recipient cells with bacterial protoplasts containing the DNA, treatment of the recipient cells with liposomes containing the DNA, DEAE dextran, electroporation, a biolistics, and microinjection of the DNA directly into the cells. The transfected cells are cultured by means well known in the art. Kuchler, R. J., Biochemical Methods in Cell Culture and Virology, Dowden, Hutchinson and Ross, Inc. (1977) .

Synthesis of Proteins

[0174] The proteins of the present invention can be constructed using non-cellular synthetic methods. Solid phase synthesis of proteins of less than about 50 amino acids in length may be accomplished by attaching the C-terminal amino acid of the sequence to an insoluble support followed by sequential addition of the remaining amino acids in the sequence. Techniques for solid phase synthesis are described by Barany and Merrifield, Solid-Phase Peptide Synthesis, pp. 3-284 in The Peptides: Analysis, Synthesis, Biology. Vol. 2: Special Methods in Peptide Synthesis, Part A.; Merrifield, et al., J. Am. Chem. Soc. 85: 2149-2156 (1963), and Stewart et al., Sold Phase Peptide Synthesis, 2nd ed., Pierce Chem. Co., Rockford, 111. (1984). Proteins of greater length may be synthesized by condensation of the amino and carboxy termini of shorter fragments. Methods of forming peptide bonds by activation of a carboxy terminal end (e.g., by the use of the coupling reagent IN^N'-dicycylohexylcarbodiimide) ) is known to those of skill.

Purification of Proteins [0175] The proteins of the present invention may be purified by standard techniques well known to those of skill in the art. Recombinantly produced proteins of the present invention can be directly expressed or expressed as a fusion protein. The recombinant protein is purified by a combination of cell lysis (e.g., sonication, French press) and affinity chromatography. For fusion products, subsequent digestion of the fusion protein with an appropriate proteolytic enzyme releases the desired recombinant protein. [0176] The proteins of this invention, recombinant or synthetic, may be purified to substantial purity by standard techniques well known in the art, including detergent solubilization, selective precipitation with such substances as ammonium sulfate, column chromatography, immunopurification methods, and others. See, for instance, R. Scopes, Protein Purification: Principles and Practice, Springer-Verlag: New

York (1982); Deutscher, Guide to Protein Purification, Academic Press (1990) . For example, antibodies may be raised to the proteins as described herein. Purification from E. coli can be achieved following procedures described in U.S. Pat. No. 4,511,503. The protein may then be isolated from cells expressing the protein and further purified by standard protein chemistry techniques as described herein. Detection of the expressed protein is achieved by methods known in the art and include, for example, radioimmunoassays, Western blotting techniques or immunoprecipitation.

Transgenic Plant Regeneration

[0177] Plants cells transformed with a plant expression vector can be regenerated, e.g., from single cells, callus tissue or leaf discs according to standard plant tissue culture techniques. It is well known in the art that various cells, tissues, and organs from almost any plant can be successfully cultured to regenerate an entire plant. Plant regeneration from cultured protoplasts is described in Evans et al., Protoplasts Isolation and Culture, Handbook of Plant Cell Culture, Macmillilan Publishing Company, New York, pp. 124-176 (1983) ; and Binding, Regeneration of Plants, Plant Protoplasts, CRC Press, Boca Raton, pp. 21-73 (1985) .

[0178] The regeneration of plants containing the foreign gene introduced by Agrobacterium from leaf explants can be achieved as described by Horsch et at., Science, 227:1229-1231 (1985) . In this procedure, transformants are grown in the presence of a selection agent and in a medium that induces the regeneration of shoots in the plant species being transformed as described by Fraley et al., Proc. Natl. Acad. Sci. (U.S.A.), 80:4803 (1983). This procedure typically produces shoots within two to four weeks and these transformant shoots are then transferred to an appropriate root-inducing medium containing the selective agent and an antibiotic to prevent bacterial growth. Transgenic plants of the present invention may be fertile or sterile. [0179] Regeneration can also be obtained from plant callus, explants, organs, or parts thereof. Such regeneration techniques are described generally in Klee et al . , Ann. Rev. of Plant Phys. 38: 467-486 (1987). The regeneration of plants from either single plant protoplasts or various explants is well known in the art. See, for example, Methods for Plant Molecular Biology, A. Weissbach and H. Weissbach, eds., Academic Press, Inc., San Diego, Calif. (1988). This regeneration and growth process includes the steps of selection of transformant cells and shoots, rooting the transformant shoots and growth of the plantlets in soil.

[0180] One of skill will recognize that after the recombinant expression cassette is stably incorporated in transgenic plants and confirmed to be operable, it can be introduced into other plants by sexual crossing. Any of a number of standard breeding techniques can be used, depending upon the species to be crossed. [0181] In vegetatively propagated crops, mature transgenic plants can be propagated by the taking of cuttings or by tissue culture techniques to produce multiple identical plants. Selection of desirable transgenics is made and new varieties are obtained and propagated vegetatively for commercial use. In seed propagated crops, mature transgenic plants can be self crossed to produce a homozygous inbred plant. The inbred plant produces seed containing the newly introduced heterologous nucleic acid. These seeds can be grown to produce plants that would produce the selected phenotype .

[0182] Parts obtained from the regenerated plant, such as flowers, seeds, leaves, branches, fruit, and the like are included in the invention, provided that these parts comprise cells comprising the isolated nucleic acid of the present invention. Progeny and variants, and mutants of the regenerated plants arc also included within the scope of the invention, provided that these parts comprise the introduced nucleic acid sequences . [0183] Transgenic plants expressing the selectable marker can be screened for transmission of the nucleic acid of the present invention by, for example, standard immunoblot and DNA detection techniques. Transgenic lines are also typically evaluated on levels of expression of the heterologous nucleic acid. Expression at the RNA level can be determined initially to identify and quantitate expression-positive plants. Standard techniques for RNA analysis can be employed and include PCR amplification assays using oligonucleotide primers designed to amplify only the heterologous RNA templates and solution hybridization assays using heterologous nucleic acid-specific probes. The RNA-positive plants can then analyzed for protein expression by Western immunoblot analysis using the specifically reactive antibodies of the present invention. In addition, in situ hybridization and immunocytochemistry according to standard protocols can be done using heterologous nucleic acid specific polynucleotide probes and antibodies, respectively, to localize sites of expression within transgenic tissue. Generally, a number of transgenic lines are usually screened for the incorporated nucleic acid to identify and select plants with the most appropriate expression profiles. [0184] A preferred embodiment is a transgenic plant that is homozygous for the added heterologous nucleic acid; i.e., a transgenic plant that contains two added nucleic acid sequences, one gene at the same locus on each chromosome of a chromosome pair. A homozygous transgenic plant . can be obtained by sexually mating (selfing) a heterozygous transgenic plant that contains a single added heterologous nucleic acid, germinating some of the seed produced and analyzing the resulting plants produced for altered expression of a polynucleotide of the present invention relative to a control plant (i.e., native, non-transgenic) . Back-crossing to a parental plant and out-crossing with a non- transgenic plant are also contemplated.

Modulating Polypeptide Levels and/or Composition [0185] The present invention further provides a method for modulating (i.e., increasing or decreasing) the concentration or ratio of the polypeptides of the present invention in a plant or part thereof. Modulation can be effected by increasing or decreasing the concentration and/or the ratio of the polypeptides of the present invention in a plant. The method comprises introducing into a plant cell with a recombinant expression cassette comprising a polynucleotide of the present invention as described above to obtain a transformed plant cell, culturing the transformed plant cell under plant cell growing conditions, and inducing or repressing expression of a polynucleotide of the present invention in the plant for a time sufficient to modulate concentration and/or the ratios of the polypeptides in the plant or plant part.

[0186] In some embodiments, the concentration and/or ratios of polypeptides of the present invention in a plant may be modulated by altering, in vivo or in vitro, the promoter of a gene to up- or down-regulate gene expression. In some embodiments, the coding regions of native genes of the present invention can be altered via substitution, addition, insertion, or deletion to decrease activity of the encoded enzyme. See, e.g., Kmiec, U.S. Pat. No. 5,565,350; Zarling et al . , PCT/US93/03868. And in some embodiments, an isolated nucleic acid (e.g., a vector) comprising a promoter sequence is transfected into a plant cell. Subsequently, a plant cell comprising the promoter operably linked to a polynucleotide of the present invention is selected for by means known to those of skill in the art such as, but not limited to, Southern blot, DNA sequencing, or PCR analysis using primers specific to the promoter and to the gene and detecting amplicons produced therefrom. A plant or plant part altered or modified by the foregoing embodiments is grown under plant forming conditions for a time sufficient to modulate the concentration and/or ratios of polypeptides of the present invention in the plant. Plant forming conditions are well known in the art and discussed briefly, supra.

[0187] In general, concentration or the ratios of the polypeptides is increased or decreased by at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% relative to a native control plant, plant part, or cell lacking the aforementioned recombinant expression cassette. Modulation in the present invention may occur during and/or subsequent to growth of the plant to the desired stage of development. Modulating nucleic acid expression temporally and/or in particular tissues can be controlled by employing the appropriate promoter operably linked to a polynucleotide of the present invention in, for example, sense or antisense orientation as discussed in greater detail, supra. Induction of expression of a polynucleotide of the present invention can also be controlled by exogenous administration of an effective amount of inducing compound. Inducible promoters and inducing compounds which activate expression from these promoters are well known in the art. In preferred embodiments, the polypeptides of the present invention are modulated in dicots, particularly in tomato.

Molecular Markers [0188] The present invention provides a method of genotyping a plant comprising a polynucleotide of the present invention. Genotyping provides a means of distinguishing homologs of a chromosome pair and can be used to differentiate segregants in a plant population. Molecular marker methods can be used for phylogenetic studies, characterizing genetic relationships among crop varieties, identifying crosses or somatic hybrids, localizing chromosomal segments affecting monogenic traits, map based cloning, and the study of quantitative inheritance. See, e.g., Plant Molecular Biology; A Laboratory Manual, Chapter 7, Clark, Ed., Springer-Verlag, Berlin (1997). For molecular marker methods, see generally, The DNA Revolution by Andrew H. Paterson 1996 (Chapter 2) in: Genome Mapping in Plants (ed. Andrew H. Paterson) by Academic Press/R. G. Landis Company, Austin, Tex., pp.7-21.

[0189] The particular method of genotyping in the present invention may employ any number of molecular marker analytic techniques such as, but not limited to, restriction fragment length polymorphisms (RFLPs) or AFLPs. RFLPs are the product of allelic differences between DNA restriction fragments resulting from nucleotide sequence variability. As is well known to those of skill in the art, RFLPs are typically detected by extraction of genomic DNA and digestion with a restriction enzyme. Generally, the resulting fragments are separated according to size and hybridized with a probe; single copy probes are preferred. Restriction fragments from homologous chromosomes are revealed. Differences in fragment size among alleles represent an RFLP. [0190] One DNA-fingerprinting technique -which is advantageous in that it requires no prior knowledge .of the sequence to be analysed- is selective restriction fragment amplification or AFLP. In general, AFLP comprises the steps of: [0191] digesting a nucleic acid, in particular a DNA or cDNA, with one or more specific restriction endonucleases, to fragment the DNA into a corresponding series of restriction fragments; [0192] ligating the restriction fragments thus obtained with a double-stranded synthetic oligonucleotide adapter, one end of which is compatible with one or both of the ends of the restriction fragments, to thereby produce tagged restriction fragments of the starting DNA;

[0193] contacting the tagged restriction fragments under hybridizing conditions with one or more oligonucleotide primers; [0194] amplifying the tagged restriction, fragment hybridised with the primers by PCR or a similar technique so as to cause further elongation of the hybridised primers along the restriction fragments of the starting DNA to which the primers hybridised; and [0195] detecting, identifying or recovering the amplified or elongated DNA fragment thus obtained.

[0196] The AFLP-fingerprint thus obtained provides information on sequence variation in (subsets of) the restriction enzyme sites used for preparation of the AFLP template and the nucleotide (s) immediately adjacent to these restriction enzyme sites in the starting DNA. By comparing AFLP- fingerprints from related individuals, again polymorphic fragments (also referred to as AFLP-markers) can be detected/identified, e.g. for the purposes mentioned hereinabove. For a further description of AFLP, its advantages, its embodiments, as well as the techniques, enzymes, adapters, primers and further compounds and tools used therein, reference is made to US 6,045,994, EP-B-O 534 858, EP 976835 and EP 974672, WO01/88189 and Vos et al . Nucleic Acids Research, 1995, 23, 4407-4414. [0197] Thus, the present invention further provides a means to follow segregation of a gene or nucleic acid of the present invention as well as chromosomal sequences genetically linked to these genes or nucleic acids using such techniques as RFLP analysis. Linked chromosomal sequences are within 50 centiMorgans (cM) , often within 40 or 30 cM, preferably within 20 or 10 cM, more preferably within 5, 3, 2, or 1 cM of a gene of the present invention. [0198] In the present invention, the nucleic acid probes employed for molecular marker mapping of plant nuclear genomes selectively hybridize, under selective hybridization conditions, to a gene encoding a polynucleotide of the present invention. In preferred embodiments, the probes are selected from polynucleotides of the present invention. Typically, these probes are cDNA probes or restriction-enzyme treated (e.g., Pst I) genomic clones. The length of the probes is discussed in greater detail, supra, but are typically at least 15 bases in length, more preferably at least 20, 25, 30, 35, 40, or 50 bases in length. Generally, however, the probes are less than about 1 kilobase in length. Preferably, the probes are single copy probes that hybridize to a unique locus in a haploid chromosome complement. Some exemplary restriction enzymes employed in RFLP mapping are EcoRI, EcoRv, and Sstl. As used herein the term "restriction enzyme" includes reference to a composition that recognizes and, alone or in conjunction with another composition, cleaves at a specific nucleotide sequence. [0199] The method of detecting an RFLP comprises the steps of (a) digesting genomic DNA of a plant with a restriction enzyme; (b) hybridizing a nucleic acid probe, under selective hybridization conditions, to a sequence of a polynucleotide of the present of said genomic DNA; (c) detecting therefrom a RFLP. Other methods of differentiating polymorphic (allelic) variants of polynucleotides of the present invention can be had by utilizing molecular marker techniques well known to those of skill in the art including such techniques as: 1) single stranded conformation analysis (SSCA); 2) denaturing gradient gel electrophoresis (DGGE) ; 3) RNase protection assays; 4) allele-specific oligonucleotides (ASOs) ; 5) the use of proteins which recognize nucleotide mismatches, such as the E. coli mutS protein; and 6) allele-specific PCR. Other, approaches based on the detection of mismatches between the two complementary DNA strands include clamped denaturing gel electrophoresis (CDGE) ; heteroduplex analysis (HA) ; and chemical mismatch cleavage

(CMC) . Thus, the present invention further provides a method of genotyping comprising the steps of contacting, under stringent hybridization conditions, a sample suspected of comprising a polynucleotide of the present invention with a nucleic acid probe. Generally, the sample is a plant sample; preferably, a sample suspected of comprising a maize polynucleotide of the present invention (e.g., gene, mRNA) . The nucleic acid probe selectively hybridizes, under stringent conditions, to a subsequence of a polynucleotide of the present invention comprising a polymorphic marker. Selective hybridization of the nucleic acid probe to the polymorphic marker nucleic acid sequence yields a hybridization complex. Detection of the hybridization complex indicates the presence of that polymorphic marker in the sample. In preferred embodiments, the nucleic acid probe comprises a polynucleotide of the present invention.

UTRs and Codon Preference

[0200] In general, translational efficiency has been found to be regulated by specific sequence elements in the 5 ' non- coding or untranslated region (5¹ UTR) of the RNA. Positive sequence motifs include translational initiation consensus sequences (Kozak, Nucleic Acids Res. 15:8125 (1987)) and the 7- methylguanosine cap structure (Drummond et al., Nucleic Acids Res. 13:7375 (1985)). Negative elements include stable intramolecular 5' UTR stem-loop structures (Muesing et al . , Cell 48:691 (1987)) and AUG sequences or short open reading frames preceded by an appropriate AUG in the 5' UTR (Kozak, supra, Rao et al . , MoI. and Cell. Biol. 8:284 (1988)). Accordingly, the present invention provides 5' and/or.3' UTR regions for modulation of translation of heterologous coding sequences.

[0201] Further, the polypeptide-encoding segments of the polynucleotides of the present invention can be modified to alter codon usage. Altered codon usage can be employed to alter translational efficiency and/or to optimize the coding sequence for expression in a desired host such as to optimize the codon usage in a heterologous sequence for expression in maize. Codon usage in the coding regions of the polynucleotides of the present invention can be analyzed statistically using commercially available software packages such as "Codon Preference" available from the University of Wisconsin Genetics Computer Group (see Devereaux et al . , Nucleic Acids Res. 12: 387-395 (1984)) or MacVector 4.1 (Eastman Kodak Co., New Haven, Conn.). Thus, the present invention provides a ^• codon usage frequency characteristic of the coding region of at least one of the polynucleotides of the present invention. The number of polynucleotides that can be used to determine a^' codon usage frequency can be any integer from 1 to the number of polynucleotides of the present invention as provided herein. Optionally, the polynucleotides will be full-length sequences. An exemplary number of sequences for statistical analysis can be at least 1, 5, 10, 20, 50, or 100.

Sequence Shuffling

[0202] The present invention provides methods for sequence shuffling using polynucleotides of the present invention, and compositions resulting therefrom. Sequence shuffling is described in PCT publication No. WO 97/20078. See also, Zhang, J.- H., er al. Proc. Natl. Acad. Sci . USA 94:4504-4509 (1997). Generally, sequence shuffling provides a means for generating libraries of polynucleotides having a desired characteristic which can be selected or screened for. Libraries of^• recombinant polynucleotides are generated from a population of related sequence polynucleotides which comprise sequence regions which have substantial sequence identity and can be homologously recombined in vitro or in vivo. The population of sequence- recombined polynucleotides comprises a subpopulation of polynucleotides which possess desired or advantageous characteristics and which can be selected by a suitable selection or screening method. The characteristics can be any property or attribute capable of being selected for or detected in a screening system, and may include properties of: an encoded protein, a transcriptional element, a sequence controlling transcription, RNA processing, RNA stability, chromatin conformation, translation, or other expression property of a gene or transgene, a replicative element, a protein-binding element, or the like, such as any feature which confers a selectable or detectable property. In some embodiments, the selected characteristic will be a decreased Km and/or increased Kcat over the wild-type protein as provided herein. In other embodiments, a protein or polynucleotide generated from sequence shuffling will have a ligand binding affinity greater than the non-shuffled wild-type polynucleotide. The increase in such properties can 'be at least 110%, 120%, 130%, 140% or at least 150% of the wild-type value.

Generic and Consensus Sequences

[0203] Polynucleotides and- polypeptides of the present invention further include those having: (a) a generic sequence of at least two homologous polynucleotides or polypeptides, respectively, of the present invention; and, (b) a consensus sequence of at least three homologous polynucleotides or polypeptides, respectively, of the present invention. The generic sequence of the present invention comprises each species of polypeptide or polynucleotide embraced by the generic polypeptide or polynucleotide, sequence, respectively. The individual species encompassed by a polynucleotide having an amino acid or nucleic acid consensus sequence can be used to generate antibodies or produce nucleic acid probes or primers to screen for homologs in other species, genera, families, orders, classes, phylums, or kingdoms. For example, a polynucleotide having a consensus sequences from a gene family of tomato can be used to generate antibody or nucleic acid probes or primers to other solanum species such as eggplant. Alternatively, a polynucleotide having a consensus sequence generated from orthologous genes can be used to identify or isolate orthologs of other taxa. Typically, a polynucleotide having a consensus sequence will be at least 9, 10, 15, 20, 25, 30, or 40 amino acids in length, or 20, 30, 40, 50, 100, or 150 nucleotides in length. As those of skill in the art are aware, a conservative amino acid substitution can be used for amino acids which differ amongst aligned sequence but are from the same conservative substitution group as discussed above. Optionally, no more than 1 or 2 conservative amino acids are substituted for each 10 amino acid length of consensus sequence. [0204] Similar sequences used for generation of a consensus or generic sequence include any number and combination of allelic variants of the same gene, orthologous, or paralogous sequences as provided herein. Optionally, similar sequences used in generating a consensus or generic sequence are identified using the BLAST algorithm's smallest sum probability (P(N)). Various suppliers of sequence-analysis software are listed in chapter 7 of Current Protocols in Molecular Biology, F. M. Ausubel et al . , Eds., Current Protocols, a joint venture between Greene Publishing Associates, Inc. and John Wiley & Sons, Inc. (Supplement 30). A polynucleotide sequence is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.1, more preferably less than about 0.01, or 0.001, and most preferably less than about 0.0001, or 0.00001. Similar polynucleotides can be aligned and a consensus or generic sequence generated using multiple sequence alignment software available from a number of commercial suppliers such as the Genetics Computer Group's (Madison, Wis.) PILEUP software, Vector NTI ' s (North Bethesda, Md.) ALIGNX, or Genecode's (Ann Arbor, Mich.) SEQUENCHER.

Conveniently, default parameters of such software can be used to generate consensus or generic sequence.

Assays for Compounds that Modulate Enzymatic Activity or Expression

[0205] The present invention also provides means for identifying compounds that bind to (e.g., substrates), and/or increase or decrease (i.e., modulate) the enzymatic activity of, catalytically active polypeptides of the present invention. The method comprises contacting a polypeptide of the present invention with a compound whose ability to bind to or modulate enzyme activity is to be determined. The polypeptide employed will have at least 20%, preferably at least 30% or 40%, more preferably at least 50% or 60%, and most preferably at least 70% or 80% of the specific activity of the native, full-length polypeptide of the present invention (e.g., enzyme). Generally, the polypeptide will be present in a range sufficient to determine the effect of the compound, typically about 1 nM to 10 μM. Likewise, the compound will be present in a concentration of from about 1 nM to 10 μM. Those of skill will understand that such factors as enzyme concentration, ligand concentrations (i.e., substrates, products, inhibitors, activators), pH, ionic strength, and temperature will be controlled so as to obtain useful kinetic data and determine the presence of absence of a compound that binds or modulates polypeptide activity. Methods of measuring enzyme kinetics is well known in the art. See, e.g., Segel, Biochemical

Calculations, 2^nd ed. , John Wiley and Sons, New York (1976).

The sequences of the invention may also find use in the development of silencing constructs, as RNAi or for use in transposon knock out or mutagenesis such as Tilling.

[0206] Although the present invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be obvious that certain changes and modifications may be practised within the scope of the appended claims.

[0207] The examples below are provided to illustrate the invention but not to limit its scope. Other variants of the invention will be readily apparent to one of ordinary skill in the art and are encompassed by the appended claims. All publications, patents, patent applications, and computer programs cited herein are hereby incorporated by reference.

BRIEF DESCRIPTION OF THE DRAWINGS

[0208] Fig IA: Arabidopsis RuvX sequence, Seq. ID No. 5, identified in EXAMPLE 1 (ϋniprot number Q9LFA0), clone name: ATF8J2 Genbank Accession number: AL132969. Translated coding sequence with highlighted active site residues Seq. ID No. 6.

[0209] FIG IB: Arabidopsis RuvX sequence, Seq. ID No. 7 identified in EXAMPLE 1 (Uniprot number Q8GYR7) .Gene name: At3g52910/F8J2_80. Translated Coding sequence with highlighted active site residues (UniProt number Q8GYR7) Hypothetical protein At3g52910/F8J2_80. Seq. ID No. 8

[0210] FIG 1C: Oryza sativa sequence, Seq. ID No. 9 containing RuvX family domain. (Uniprot number Q9AV16) Gene name: OSJNBb0014Ill .5. Hypothetical protein Seq. ID No. 10

[0211] FIG ID: Oryza sativa sequence, Seq. ID No. 11 containing RuvX family domain. (Uniprot number Q94DX3) . Clone number: P0403C05.13 cDNA number: AK071863. The cDNA is generated from the genomic sequence by joining nucleotides 53942..54170,54489..54659,55573..55630,56104..56175,56264..5635 9, 56503..56595, and 56759..57277 to get the coding sequence.

[0212] FIG 2: Displays the phylogenetic distribution of sequences from Example 1. ClustalW was used to generate a tree description and the tree was visualized with the Forester -1.92 ATV program.

[0213] Fig 3: Alignment of the RuvX family of resolvases and the identification of the conserved sites and active sites

(indicated with *) . This example displays the comparison of amino acid sequences of the HJ Resolvases showing conserved catalytic sites. D and E starting at residues 406 of Ath_Q9LFA0.

[0214] Fig 4: This figure shows the alignment of Arabidopsis RuvX-like protein (Swiss-Prot ID no. Q9LFA0) and tomato EST sequences . [0215] Fig 5A: Schematic representation of the products of branch migration and Holliday junction resolution.

[0216] FIG 5B: Branch migration and Holliday junction resolution catalysed by E. coli RuvABC. As indicated, ATP was present or omitted from the reaction buffer. RuvA (20 nM) , RuvB (600 nM) , and/or RuvC (10 nM in lanes 5 and 6, or 100 nM in lane 2) were present as indicated. Schematic representation of the products of branch migration and Holliday junction resolution are shown on the right side of the gel.

[0217] FIG 6A: Schematic representation of the products of branch migration and Holliday junction resolution. Branch migration activities translocate the junction back through

[0218] Fig 6B. A representative branch migration as diagrammed above in Figure A. The reaction catalysed by RuvAB

(20 nM RuvA and 600 nM RuvB) is shown in lane 2.

[0219] ■ Resolution in orientation (1/3) yields ³²P-labeled nicked circle and gapped linear DNA products, whereas resolution in orientation (2/4) produces ³²P-labeled linear dimer molecules. A representative resolution reaction catalysed by RuvC (100 nM) is shown in lane 4) .

[0220] 2.7 kb of homology to dissociate the recombination intermediate (α-structure) into 32P-labeled linear duplex and unlabeled gapped DNA. RuvX as a true Holliday junction resolution enzyme shows the same results as seen for RuvC in lanes 3 and 4.

[0221] Fig 6C: Schematic full length genomic tomato sequence, SGN-U225077 EST bp 1-1028.

[0222] Fig 7: Various RuvX sequences and proteins in different plant species, primers and synthetic probes.

Examples

EXAMPLE 1

Identification of RuvX from homology

[0223] This example describes identification of the RuvX gene in Arabidopsis from a computer homology search. A putative RuvX protein from Salmonella typhimurim (Uniprot ID RUVX_SALTY) was used as an example of the YqgF group of enzymes to search a non-redundant database described below and to perform a Smith- Waterman search. [0224] A Smith-Waterman search (Smith and Waterman, 1981) was performed against a database containing 128 complete bacterial and archaeal genomes as well as the genomes of 13 eukaryotic species Chlamydomonas reinhardtii) , Arabidopsis thaliana, Saccharomyces cerevisiae, Schizosaccharromyces pombe, Candida albicans, Neurospora crassa, Encephalotozoon cuniculi, Plasmodium falciparum, Caenorhabditis elegans, Drosophila melanogaster, Anopheles gambiae, Mus musculus and Homo sapiens. Predicted proteomes were screened to retrieve a set of homologous proteins with a significant similarity (E<0.01) and a region of similarity covering more than 50% of the query sequence. The sets of homologous sequences were aligned using ClustalW (Thompson et al . , 1994).

[0225] Hidden Markov models (HMMs) were created from the above-mentioned alignments using the HMMER program (Eddy, 1998) . HMMs were subsequently used to screen the proteome database to recover more distantly related homologues potentially missed by the Smith-Waterman search. All sequences recovered by the HMMs screens were added to the initial sets of homologous proteins and new alignments were created with ClustalW and MUSCLE (Edgar, 2004) . Neighbor-Joining trees were derived from these alignments using both Kimura distances and the Dayhoff matrix as implemented in ClustalW and Phylip packages (Thompson et al., 2004 and Felsenstein , 1993 respectively) . A bootstrap analysis using 1000 samples was conducted for each phylogenetic tree. The search resulted in the Arabidopsis thaliana SEQ ID ID. 6, 8, 10 (Figure la-c) and a Seq. ID. 11 (Figure Id) from Oryza sativa.

EXAMPLE 2

Phylogenetic characterisation of RuvX family of predicted

Holliday junction resolvases [0226] This example displays the phylogenetic distribution of sequences from Example 1. ClustalW was used to generate a tree description and the tree was visualised with the Forester -1.92 ATV program. The resulting tree (Figure 2) indicates that Arabidopsis SEQ ID. β, (Uniprot seq. Q9LFA0) , SEQ ID. 8 (ϋniprot seq. Q8GYR7) and Oryza SEQ ID. 11 group together. The remaining grouping of Arabidopsis sequences shown in the tree are from a group with a bootstrapping value of 964 and is a family of transcription factors. SEQ ID. 6 shares domains in common with the growth factors, but these transcription factors do not share the RuvX domain found in Seq. ID. 6. Oryza . SEQ ID. 10 rice groups with the alpha-proteobacteria indicating that it may be of mitochondrial origin.

EXAMPLE 3 [0227] This example displays the comparison of amino acid sequences of the RuvX family of predicted Holliday junction resolvases (Bateman et al._r 2004) showing conserved catalytic sites at aspartic acid (D) and glutamine (E) residues 406 and 497 of SEQ ID NO: 6, Arabidopsis_Q9LFΑ0 , SEQ ID NO: 8, Arabidopsis_Q8GYR7, residues 28 and 119, and residues 79 and 178 for SEQ ID NO: 10, Oryza_Q9AVl6, respectively (Figure 3) . These sites fall within the domain common to RuvX family members and is located between residues 400-537 for SEQ ID NO: 6, residues 22-159 for SEQ ID NO: 8, and residues 74-208 for SEQ ID NO: 10, respectively.

EXAMPLE 4

Alignment of Arabidopsis RαvX-like protein (Uniprot ID no. Q9LFA0) and tomato EST sequences (Seq nos. 4,5,6) ('Figure 4a) . A BLAST search of the SGN database (http: //www. sgn. Cornell . edu/cgi-bin/tools/blast/simple .pi) resulted in three matches over the length of the Arabidopsis clone (Figure 4b) . The three ESTs are SGN-U220986, SGN-U220985, and SGN-U225077 (Figure 4c, EXAMPLE4) . The EST sequences were used in primer design for extracting the full length tomato sequence (Figure 7 SEQ ID 60) . The primers used are depicted in Fig 7, SEQ ID 39-59:

EXAMPLE 5 Generation and screening of plant cDNA [0228] Total DNA is extracted from plant tissues using the Genelute Plant Genomic DNA kit (Sigma-Aldrich, Zwijndrecht, The Netherlands) . The PCR reaction was carried out using a total amount of 30 ng DNA after which the reaction products were analyzed on a 1% agarose gel. Total RNA is extracted from plant tissues using the commercially available RNeasy Mini Kit from Qiagen (Valencia, CA, USA) . The purified RNA is subsequently treated with 1 μl of 10 units/ul Rnase-free DNase (Roche Diagnostics, Mannheim, Germany) in order to remove any residual DNA. The RT-PCR reaction is carried out using Superscript™ One- Step RT-PRC with platinum® Taq from Invitrogen (Breda, The Netherlands) , after which the reaction products are analyzed on a 1% agarose gel. PCR products are cloned using the TOPO TA Cloning® system- of Invitrogen (pCR®2.1-TOPO®) which is based on TA cloning and blue white colony screening.

EXAMPLE 6

Expression and Purification of AtRuvX and LeRuvX [0229] For expression of AtRuvX and LeRuvX in bacteria, the genes were ligated into the bacterial expression vector pBAD/glllA (Invitrogen Corp., Carlsbad, California) and electroporated in competent TOPlO E. coli cells (Invitrogen Corp., Carlsbad, California). A single recombinant E. coli colony was used to inoculate 250 mL of LB medium containing 50μ/mL ampicillin which was grown at 37° C. Protein production was induced at log phase by adding 0.002% arabinose. After an incubation of 6 hr, the cells were harvested by centrifugation at 8,000xg. Protein extraction was carried out accourding to Qiagen "batch purification under denaturing conditions" protocol. Samples were resuspended in 5 mL.g of lysis buffer:

100 rtiM NaH₂PO₄, 10 mM Tris-CL, 6M GuHCL, pH8.0, and incubated at RT for 1 hour following centrifugation at 10,000xg for 30 min. The cleared lysate was bound to Ni-NTA resin (Qiagen, Valencia, California, Cat. #30210) for 40 min. at RT with gentle agitation. The column was washed with 20 bed volumes of 100 InMNaH₂PO₄, 10 mM Tris-CL, 8 M Urea, 10% glycerol, 15 mM β- mercaptoethanol adjusted to pH 6.3. Recombinant protein was collected with 0.5 ml of elution buffer (as above but pH 5.5 and pH4.5). Purified RuvX was dialyzed using a linear 6M-IM uread gradient in 50 mM Tris-HCl-7.5, 5OmM NaCl, 15 mM β- mercaptoethanol, 10% glycerol containing protease inhibitors and stored at -80° C.

EXAMPLE 7

Production of Antibodies Directed against RuvX proteins of tomato and Arabidopsis [0230] Purified protein was subjected to SDS-PAGE electrophoresis and RecA was excised from the gels and used for the production of rabbit anti-AtRuvX and anti-LeRuvX antibodies (COVANCE Research Products, Inc.). Antibody titer and specificity were determined through western analysis using standard procedures. Ruther purification of anti-AtRecA and anti-LeRecA was performed using an ImmunoPure IgG (Protein A) Purification Kit, according to the manufacturer's recommendations (Pierce) .

EXAMPLE 8

Determination of branch migration versus resolvase activity of RuvX.

[0231] To distinguish between branch migration or true resolution activities, in vitro assays were conducted using synthetic Holliday junctions. Branch migration activities translocated the junction through the terminal regions of heterology and dissociated the substrate into splayed are products (FIG 5A) Holliday junction resolution introduces symmetrically related nicks in two strands of like polarity to yield nicked duplex products.

Substrate preparation

[0232] A synthetic Holliday junction can be formed using four complementary oligonucleotides. This junction is formed (as described in Constantinou and West (2004) by annealing: oligonucleotide 1 (5'-

CCGCTACCAGTGATCACCAATGGATTGCTAGGACATCTTTGCCCACCTGCAGGTTCACCC- 3' ) SEQ ID NO: 1; oligonucleotide 2 (5'- TGGGTGAACCTGCAGGTGGGCAAAGATGTCCTAGCAATCCATTGTCTATGACG-S') SEQ ID NO: 2 ; oligonucleotide 3 (5'-

CGTCATAGACAATGGATTGCTAGGACATCTTTGCCGTCTTGTCAATATCGGC-S' ) ; SEQ ID NO: 3 oligonucleotide 4 (5'-

TCGGCATATTGACAAGACGGCAAAGATGTCCTAGCAATCCATTGGTGATCACTGGTAGCGG- 3' ) SEQ ID NO: 4.

[0233] The reaction is carried out as described by Constantinou and West (2004) namely using the following steps for preparation of the synthetic junction:

1. One of the four oligonucleotides is 5 ' -³²P-end-labeled using T4 polynucleotide kinase and a ³²P-ATP (Prior to labelling, full-length oligonucleotides are purified from truncated products by denaturing polyacrylamide gel electrophoresis). Typical labelling reactions (10 μL) contain 10 pmol oligonucleotide, 25 μCi [α³²P]ATP, and 10 U of T4 polynucleotide kinase. After 30 min of incubation at 37 °C in One-Phor-All buffer, the reaction is stopped by addition of 25 mM EDTA, and the kinase is inactivated by incubation at 65⁰C for 15 min.

2. Add a fivefold excess (50 pmol) of the three partially complementary oligonucleotides and anneal by heating for 3 min at 95°C, followed by 10 min at 65°C, 10 min at 37°C, and 10 min at room temperature. 3. The 32P-labeled Holliday junctions are then separated from incomplete products on a 10% neutral polyacrylamide gel.

Electrophoresis is carried out for 1-2 h at 200 V.

4. The wet gel is covered with plastic wrap and the annealed products are visualised by autoradiography. Typical exposure times are for 1-2 min. With the help of phosphorescent tape (TrackerTape™) , the autoradiograph is aligned precisely with the gel, allowing excision of the band corresponding to the Holliday junctions.

5. The junctions are electroeluted from the gel slice by- placing the slice in a 1.5-mL Eppendorf tube and cover it with 0.5 mL TMN buffer and rotating slowly overnight at 4⁰C. The supernatant containing the DNA is removed the following day.

In vitro assays [0234] Holliday junction resolution activities are typically assayed in 20-μL reactions containing approx 1 nM ³²P-end- labeled synthetic Holliday junction DNA (prepared above) and optimized protein concentrations, salt, buffer, and pH conditions have to be determined experimentally for each activity to be analyzed, here: 0.5 μl aliquots of the indicated fractions in phosphate buffer (60 mM Na₂HPO₄ZNaH₂PO₄PH 7.4, 5 mM MgCl₂, 1 mM DTT, 100 μg/ml BSA) supplemented with 2 mM ATP where indicated.

[0235] Incubations occurred with the indicated amount of enzyme RuvA (20 nM) , RuvB (600 nM) , and/or RuvC (10 nM in lanes 5 and 6, or 100 nM in lane 2) were present as indicated.

2. Reactions are incubated for 30 min at 37⁰C.

3. Reactions are stopped and the DNA de-proteinized by addition of 0.8% (w/v) SDS and 1.6 mg/mL proteinase K for 15 min at 37°C. 4. The labeled Holliday junctions, splayed arm and/or nicked duplex products of branch migration and resolution, respectively, are separated by electrophoresis through a 10% neutral polyacrylamide gel (FIG 5B) .

5. Labeled products are revealed by autoradiography. FIG 5B illustrates the processing of synthetic Holliday junction

X26 by the E. coll RuvA, RuvB, and RuvC proteins. RuvC resolves Holliday junctions (lanes 2, 5, and 6) , whereas RuvABpromotes ATP-dependent branch migration (lanes 4 and 6).]

EXAMPLE 9

Determination of RuvX processing specificities [0236] Processing specificity can be shown using α- structures (a labelled piece of circular DNA with an attached linear duplex (FIG 6A) . Branch migration activities translocate the junction back through a region of homology (heterologous regions indicated with striations) to dissociate the recombination intermediate (α-structure) into ³²P-labeled linear duplex and unlabeled gapped DNA (FIG 6A) .

In vitro assays [0237] Preparation of α-structure substrate is prepared as (is meticulously) described in Constantinou and West (2004). Briefly, branch migration and/or resolution reactions (20 μL) usually contain ³²P-end-labeled α-structures (0.1 nM) and buffers similar to those used for assays with synthetic Holliday junctions in Example 8. Reactions are incubated for 90 min at 37 °C and then deproteinised by addition of 0.8% (w/v) SDS and 1.6 mg/mL proteinase K and incubated further for 15 min at 37⁰C. DNA products are separated by electrophoresis on a 1% agarose gel in TAE buffer containing 0.5 μg/mL ethidium bromide as described, and ³²P-labeled products are detected by autoradiography. Complete branch migration results in the dissociation of the recombination intermediate, giving rise to ³²P-labeled linear and unlabeled gapped duplex DNA. Resolution can occur in two possible orientations to produce either ³²P- labeled linear dimers or gapped linear and nicked circle molecules, as illustrated in Fig 6A and the results seen as documented in FIG 6B.

EXAMPLE 10 Over expression RuvX in Arabidopsis

[0238] Constructs for plant transformation experiments are created in which the AtRuvX gene is inserted behind an Arabidopsis DMCl Promoter (Klimyuk and Jones, The Plant Journal 1997 (11) : 1-14) (Patent WO 98/28431) .

[0239] A vector containing the Arabidopsis AtDMCl promotor, a polylinker (Spel, Xmal, Notl, Apal, Xhol) and NOS terminator is developed for further cloning of Arabidopsis genes. A PCR modified AtRuvX gene is inserted.

[0240] Agrobacterium tumefaciens strain GC2260 containing the plant vector is grown over night in LB medium containing streptomycin (100 mg/L) and spectinomycin (300 mg/L) to select for the vectors and rifampicin (100 mg/L) to select for the Agrobacterium tumefaciens GV2260 at 28° C. [0241] In order to produce transgenic Arabidopsis plants (ecotype Cloumbia and Fl hybrid of ecotype Columbia x Landsberg erecta) , the floral dip method is used, as described by Desfeux et al. (2000) Plant Physiology 123, 985-904. The bacterial cells are resuspended in floral dip solution (50 g sucrose + 500 μl Silwett L-77 surfactant (Helena Chemical Comp. Fresno, CA, USA) per liter MulliQ™ (Millipore, Etten-Leur, the

Netherlands)). Bolting plants, containing multiple floral buds, are submerged into the dipping solution containing the Agrobacterium cells at an optical density (OD) between 1.0 and 1.5 during 5-10 seconds with gentle agitation. [0242] After inoculation, the plants are contained in a plastic container to keep high humidity under low light conditions for a day and subsequently, seeds are grown on the plants. [0243] Transformants are selected by germinating surface sterilized seeds in 0.1% agarose layered upon half-strength MS plates containing 50 mg/L kanamycin. Kanamycin resistant seedlings are transferred to soil in a greenhouse. [0244] Kanamycin resistant seedlings/constructs are grown to mature plants which are analyzed by PCR for the presence of the AtDMCl: : RuvX construct. Primer combinations are designed which specifically amplify either the nptll gene (NEO-FORW + NEO- REV) , the region from DMCl promoter to the RuvX (DMCl-Fl + RuvX-Rl) , and the region from RuvX to the nos terminator (RuvX- Fl + Nos-Rl) . The result of this analysis showed that in all plants specific amplification signals are obtained for the mentioned primer combinations which confirms the transgenic status of the kanamycin resistant seedlings and which shows the presence of the DMCl::RuvX over expression construct. Primary transformants with this pAtDMCl : :RuvX fusion are obtained and analyzed for RuvX overexpression by RT-PCR.

EXAMPLE 11

Meiotic expression construct with RuvX for crop plants [0245] The construct described in Example 10 is used for the transformation of various crop plants by means of Agrobacterium. Arabidopsis constructs can be used in Brassica. Optionally, the Arabidopsis DMCl promoter and/or RuvX can be exchanged with the homologous endogenous promoter/gene of the relevant crop as given in the description. In addition, functional homologues can be used.

EXAMPLE 12

Over expression RuvX in tomato

[0246] Transformation of an AtDMCl : :LeRuvX construct is performed according the protocol described by Koornneef et al.

1986. For the transformation cotyledons of a cherry hybrid are used.

EXAMPLE 13

Analysis meiotic HR in Arabidopsis using SNPs [0247] The plants generated in Example 10 are cultivated in a climate controlled chamber and upon flowering self pollinated (selfed), generating Sl seeds, or crossed with one of the parents (back cross), generating BCl seeds. The Sl seeds and BCl seeds are selected by germinating surface sterilized seeds in 0.1% agarose layered upon half-strength MS plates containing 50 mg/L kanamycin. Kanamycin resistant seedlings are transferred to soil.

[0248] Leaf samples are collected from 48 seedlings per cross, followed by DNA isolation using the Genelute Plant Genomic DNA kit ( Sigma-Aldrich, Zwijndrecht, The Netherlands) . [0249] For marker analysis the Keygene SNPWaveTM assay is applied to the DNA samples as described by Van Eijk et al . Nucl. (2004) Acids Res. 32(4) :e47 resulting in SNP marker segregation data for each seedling (10 SNPs per chromosome arm) . The data are analyzed to determine the number of recombination events that had occurred in the meiotic cells of the Fl. These data are compared with a SNPWave analysis of a wild type Fl hybrid (ecotype Columbia x ecotype Landsberg erecta) selfing or back cross. [0250] The results are analyzed for altered meiotic homologous recombination frequency in a RuvX over expressing plant compared to a wild-type plant.

EXAMPLE 14 Analysis meiotic HR in Arabldopsls using AFLP

[0251] DNA from Sl seedlings and BCl seedlings as described in example 5 are also analyzed using the AFLP method (EP534858) as described in Vos et al, Nucl. Acids res. 1995, 23(21) 4407ff. A number of primer ^• combinations are applied to DNA of 48 seedlings per cross. As a control, the same wild-type Sl and BCl are used as in example 12.

[0252] The floral dip method is used (as described in Example 10 on Fl hybrids of ecotype Colombia x ecotype Landsberg resulted in the selection of 8 primary transformants (F2 plants) . AFLP analysis using 4 primer combinations enabled the selection of the 3 most heterozygous F2 primary tranformants . For these 3, the recombination frequency was analysed in an F3 population of 45v individuals. The results thereof showed for all three families an increased level (50- 100%) of recombination compared to wild type control. [0253] The results are analyzed for altered meiotic homologous recombination frequency in a RuvX over expressing plant compared to a wild-type plant as described in Example 10.

EXAMPLE 15

Analysis meiotic HR in tomato using AFLP [0254] The plants generated in Example 1 are cultivated and upon flowering self pollinated (selfed) , generating Sl seeds, or crossed with one of the parents (back cross), generating BCl seeds. The Sl seeds and BCl seeds are selected by germinating surface sterilized seeds in 0.1% agarose layered upon half- strength MS plates containing 50 mg/L kanamycin. Kanamycin resistant seedlings are transferred to soil.

[0255] Leaf samples are collected from 48 seedlings per cross, followed by DNA isolation using the Genelute Plant Genomic DNA kit (Sigma-Aldrich, Zwijndrecht, The Netherlands) .

[0256] DNA from Sl seedlings and BCl seedlings are analyzed using the AFLP method as described in Example 14. As a control, the wild-type Sl and BCl are used.

[0257] The results are analyzed for altered meiotic homologous recombination frequency in a RuvX over expressing plant compared to a wild-type plant.

Example 16 [0258] An Arabidopsis thaliana RuvX T-DNA insertional mutant (SALK_077829 N577829, ecotype Columbia), which is mutated at bp 19628572 of SEQ ID 8 (Uniprot seq. Q8GRY7) was selected for being homozygous for the T-DNA insertion. This homozygous T-DNA insertional mutant was crossed to ecotype Landsberg and the obtained FIs were grown to F2 seeds. PCR analyses on 20 F2 seedlings resulted in the selection of 5 F2s homozygous for the T-DNA in RuvX, 9 F2s heterozygous for this mutation and 6 F2s being wt (no T-DNA in RuvX) . AFLP analyses using 4 primer combinations enabled selection of one F2 plant which was homozygous for the T-DNA in RuvX but heterozygous (regarding Columbia versus Landsberg) for 3 chromosomes or chromosomal regions. In addition, we selected by AFLP one F2 plant which was representing the wt situation (no T-DNA in RuvX) and which was as heterozygous as the selected T-DNA mutated F2. For these 2 F2 ' s the recombination frequency was analyzed in an F3 population of 45 individuals. The results showed for the T-DNA insertional mutant a decreased level of recombination compared the wild type control. References

[0259] Aravind L, Makarova KS, Koonin EV. 2000. SURVEY AND SUMMARY: Holliday junction resolvases and related nucleases: identification of new families, phyletic distribution and evolutionary trajectories .Nucleic Acids Res. 28(18): 3417-32. [0260] Bateman A, Coin L, Durbin R, Finn RD, Hollich V, Griffiths-Jones S, Khanna A, Marshall M, Moxon S, Sonnhammer EL, Studholme DJ, Yeats C, Eddy SR. 2004.

(a) The Pfam protein families database. Nucleic Acids Res. 32 Database issue : D138-41.

[0261] Ciccia A, Constantinou A, West SC. 2003. Identification and characterization of the human musδl-emel endonuclease. J Biol Chem. 278(27): 25172-8.

[0262] Constantinou A, West SC. 2004. Holliday junction branch migration and resolution assays. Methods MoI Biol. 262:239-53.

[0263] Constantinou A, Chen XB, McGowan CH, West SC. 2002. Holliday junction resolution in human cells: two junction endonucleases with distinct substrate specificities. EMBO J. 21(20) :5577-85.

[0264] Constantinou A, Davies AA, West SC. 2001. Branch migration and Holliday junction resolution catalyzed by activities from mammalian cells. Cell. 104 (2) :259-68. [0265] Doe, CL. , Ahn, J. S., Dixon, J., and Whitby, M. C. 2002. Mus81-Emel and Rqhl involvement in processing stalled and collapsed replication forks. J. Biol. Chem. 277, 32753-32759. [0266] Dudas A, Markova E, Vlasakova D, Kolman A, Bartosova Z, Brozmanova J, Chovanec M. 2003. The Escherichia coli RecA protein complements recombination defective phenotype of the Saccharomyces cerevisiae rad52 mutant cells. Yeast 20(5) :389-96.

[0267] Edgar, R. C. 2004. MUSCLE: a multiple sequence alignment method with reduced time and space complexity BMC Bioinformatics 5, 2004. 113. [0268] Elborough KM, West SC. Resolution of synthetic

Holliday junctions in DNA by an endonuclease activity from calf thymus. EMBO J. ( 9) : 2931-6.1990. [0269] Felsenstein, J. 1993. Distributed by the author. Dept . of Genetics, University of Washington, Seattle (USA) [0270] Heyer WD, Ehmsen KT, Solinger JA. 2003. Holliday junctions in the eukaryotic nucleus: resolution in sight? Trends Biochem Sci. 2003 Oct; 28(10): 548-57.

[0271] Hishida T, Iwasaki H, Ohno T, Morishita T, Shinagawa H. 2001. A yeast gene, MGSl, encoding a DNA-dependent AAA (+) ATPase is required to maintain genome stability. Proc Natl Acad Sci U S A. 98 (15) : 8283-9. [0272] Kaliraman, V., Mullen, J. R., Fricke, W.M., Bastin- Shanower, S.A., and Brill, S.J. 2001. Functional overlap between Sgsl-Top3 and the Mms4-Mus81 endonuclease . Genes Dev. 15, 2730-2740. [0273] Holliday, R. A.1964 A mechanism for gene conversion in fungi. Genet. Res. Camb. 5, 282-304.

[0274] Kvaratskhelia,M. and White, M. F. 2000. Two Holliday junction resolving enzymes in Sulfolobus solfataricus . J. MoI. Biol., 297: 923-932. [0275] Lilley,D.M. and White, M. F. ( (2001) ) The junction- resolving enzymes. Nature Rev. MoI. Cell Biol., 2, 433-443.

[0276] Middleton,C.L. , Parker, J. L., Richard, D. J. , White, M. F. and Bond, C. S. 2003. Crystallization and preliminary X-ray diffraction studies of Hje, a Holliday junction resolving enzyme from Sulfolobus solfataricus . Acta Crystallogr. D Biol. Crystallogr., 59, , 171-173. [

[0277] Middleton CL, Parker JL, Richard DJ, White MF, Bond CS. 2004. Substrate recognition and catalysis by the Holliday junction resolving enzyme Hje. Nucleic Acids Res. 2004 Oct 12;32 (18) : 5442-51. [0278] White, M. F. & Lilley, D. M. J. (1997) J. MoI. Biol. 266, 122-134

[0279] Osman F., Dixon, J., Doe, C, and Whitby, M. C. 2003. Generating Crossovers by Resolution of Nicked Holliday Junctions: A Role for Musδl-Emel in Meiosis., Molecular Cell 12, 761-774.

[0280] Postow L, Crisona NJ, Peter BJ, Hardy CD, Cozzarelli NR. 2001. Topological challenges to DNA replication: conformations at the fork. Proc Natl Acad Sci U S A. ;98 (15) :8219-2β.

[0281] Sekiguchi, J, Seeman, NC, Shuman S., 1996, Resolution of Holliday junctions by eukaryotic DNA topoisomerase I. Proc Natl Acad Sci U S A. Jan 23; 93(2):785-9. [0282] Smith ,T.F. and Waterman, M.S. 1981. Identification of common molecular subsequences. J MoI Biol 147, 195-7. [0283] Thompson, J. D. Higgins, D. G. and Gibson, T.J. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position- specific gap penalties and weight matrix choice Nucleic Acids Res 22:4673-80.

[0284] West, S. 1997. Processing of recombination intermediates by the RuvABC proteins .Annu. Rev. Genet. 31:213- 44.

[0285] White, M. F., Giraud-Panis,M. J. , Pohler,J.R. and Lilley,D.M. 1997. Recognition and manipulation of branched DNA structure by junction-resolving enzymes. J. MoI. Biol. 269, 647-664. [0286] Whitby, M. C. & Dixon, J. (1997) J. MoI. Biol. 272, 509-522.

Claims

1. Use of isolated nucleic acid molecule comprising a nucleotide sequence selected from the group consisting of:

(a) the nucleotide sequence shown in SEQ ID NO: 60, 5, 7, 9, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38; (b) a nucleotide sequence that encodes a polypeptide comprising the amino acid sequence of SEQ ID NO: 6, 8, 10, 11, 12, 13, 14, 15, 16 ,17, 18, 19, 20, 21, 22, 23, 24, 25, 26;

(d) a nucleotide sequence encoding an RuvX polypeptide, said sequence having at least about 75% sequence identity to the nucleotide sequence shown in SEQ ID NO: 60, 5, 7, 9, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38;

(e) a nucleotide sequence encoding an RuvX polypeptide having at least about 75% sequence identity to the polypeptide encoded by the cDNA corresponding to (a) ;

(f) a nucleotide sequence encoding an RuvX polypeptide having at least about 75% sequence identity to the polypeptide sequence shown in SEQ ID NO: 6, 8, 10, 11, 12, 13, 14, 15, 16 ,17, 18, 19, 20, 21, 22, 23, 24, 25, 26; (g) a nucleotide sequence comprising an antisense sequence corresponding to the nucleotide sequence in (a) , (b) , (c) , (d), (e); in a method for modifying the process of homologous recombination in a plant cell.

2. An isolated nucleic acid molecule comprising a nucleotide sequence selected from the group consisting of:

(a) the nucleotide sequence shown in SEQ ID NO: 60, 5, 7, 9, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38; (b) a nucleotide sequence that encodes a polypeptide comprising the amino acid sequence of SEQ ID NO: 6, 8, 10, 11, 12, 13, 14, 15, 16 ,17, 18, 19, 20, 21, 22, 23, 24, 25, 26; (c) a nucleotide sequence encoding an RuvX polypeptide, wherein said nucleotide sequence hybridizes to the nucleotide sequence shown in SEQ ID NO: 60, 5, 7, 9, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38 under stringent conditions; (d) a nucleotide sequence encoding an RuvX polypeptide, said sequence having at least about 75% sequence identity to the nucleotide sequence shown in SEQ ID NO: 60, 5, 7, 9, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38;

3. An expression cassette comprising a nucleic acid molecule of claim 2, wherein said nucleotide sequence is operably linked to a promotor that drives expression in a plant cell.

4. The expression cassette of claim 3, wherein said promotor is selected from the group consisting of constitutive, chemically regulatable and tissue preferred promoters.

5. An isolated nucleic acid comprising a fragment of SEQ ID NO: 60, 5, 7, 9, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, said fragment comprising at least 15 contiguous nucleotides of the nucleotide sequence of SE SEQ ID NO: 60, 5, 7, 9, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38.

6. An isolated nucleic acid comprising a nucleotide sequence comprising at least 15 nucleotides that encodes a fragment of the amino acid sequence set forth in SEQ ID NO: 6, 8, 10, 11, 12, 13, 14, 15, 16 ,17, 18, 19, 20, 21, 22, 23, 24, 25, 26.

7. A host cell engineered to express any one of the nucleic acids of claims 1, 4 or 5.

8. An isolated polypeptide comprising an amino acid sequence selected from the group consisting of:

(a) the amino acid sequence set forth in SEQ ID NO: 6, 8, 10, 11, 12, 13, 14, 15, 16 ,17, 18, 19, 20, 21, 22, 23, 24, 25, 26;

(b) an amino acid sequence having at least 75%, preferably at least 80 %, more preferably at least 85

%, particularly preferable 90 %, especially preferred at least 95%, and most preferred at least 99% sequence identity to the amino acid sequence set forth in (a) and (c) an amino acid sequence comprising at least 10 consecutive amino acids of the amino acid sequence set forth in (a) or (b) •■

9. A genetically modified plant comprising in its genome an endogenous RuvX gene having a mutation within said gene, wherein said endogenous RuvX gene corresponds to the cDNA corresponding to the polynucleotide sequence of SEQ ID NO: 60, 5, 7, 9, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38.

10. Genetically modified seed of said plant of claim 9.

11. A transformed plant comprising in its genome at least one stably incorporated expression cassette comprising a nucleotide sequence operably linked to a promoter that drives expression in said plant cell, wherein said nucleotide sequence is defined in claim 2.

12. A transformed plant . comprising in its genome at least one stably incorporated expression cassette, wherein said expression cassette comprises a nucleotide sequence operably linked to a promoter that drives expression in said plant cell, wherein said nucleotide sequence encodes a mutated RuvX polypeptide which is capable of modifying the process of homologous recombination in a plant cell due to mutagenesis of at least one amino acid residue necessary for normal homologous recombination in a plant cell wherein said mutated RuvX polypeptide binds substrate with an affinity similar to that observed for a corresponding non-mutated endogenous RuvX enzyme .

13. Transformed seed of the plant of any one of claims 11 or 12.

14. The transformed plant of any one of the claims 1-13, wherein said plant is a dicot, preferably tomato or tobacco.

15. A method of modulating the level of RuvX in a plant, wherein the method comprises:

(a) introducing into a plant cell a recombinant expression cassete comprising the nucleotide sequence of claim 1 operably linked to a promotor,

(b) culturing the plant cell; and

(c) regenerating a whole plant, wherein the plant expresses said nucleotide sequence, thereby moduilating the level of RuvX in the plant.