WO2007028655A2

WO2007028655A2 - Drug discovery for neurodevelopmental disorders and their complications

Info

Publication number: WO2007028655A2
Application number: PCT/EP2006/008889
Authority: WO
Inventors: Karen Miriam Johanna Van Loo; Gerardus Johannes Maria Martens
Original assignee: H. Lundbeck A/S
Priority date: 2005-09-09
Filing date: 2006-09-08
Publication date: 2007-03-15
Also published as: WO2007028655A3

Abstract

The invention relates to a method for identifying compounds which alter the activity of gamma-secretase, comprising provision of a collection of compounds; contacting the compounds of the collection with a cell line or organism expressing gamma-secretase; measurment of the gamma-secretase activity in the cell line or organism before and after the contact with the compound; and identification of the compounds in the collection that modulate the gamma-secretase activity of the cell line or organism. More in particular, the gamma-secretase that is expressed by the cell line or organism is a variant gamma-secretase, the activity of which is altered, in particular decreased, as compared to the gamma-secretase activity found in a human not carrying the SNP651 or carrying the wild- type Aph-lb gene.

Description

DRUG DISCOVERY FOR NEURODEVELOPMENTAL DISORDERS AND THEIR COMPLICATIONS

The present invention provides new methods and means for testing and screening compounds and materials, such as biologicals, drugs, and the like for efficacy in affecting, treating, or preventing neurodevelopmental disorders, in particular psychiatric-neurodevelopmental disorders, such as schizophrenia, autism, Attention-deficit hyperactivity disorder (ADHD), dyslexia, Rett's disorder and Asperger's, specifically schizophrenia, autism, Attention-deficit hyperactivity disorder (ADHD) and dyslexia, and for efficacy in affecting, treating, or preventing complications of these disorders, in particular epilepsy and depression. A neurodevelopmental disorder is a medical disorder that affects the neurological system, and has its origin during the period of a person's life in which they are experiencing rapid neurological development from the point of conception to early adulthood. It can be caused by genetic, environmental, or unspecified reasons, many of which are not yet known.

Common features of neurodevelopmental disorders include difficulties with motor development, sensory integration difficulties, speech and language delays and a range of cognitive difficulties including learning disabilities, poor organizational skills, poor self regulation and behavioural difficulties.

Complications or consequences of the neurodevelopmental disorder include cognitive impairment, neuromotor dysfunction, seizure, abnormal impulsive behaviour, sensory impairment (as in blindness or deafness) .

A combination of genetic factors and stressful early-life events may determine the vulnerability of an individual to develop a complex neurodevelopmental disorder. These disorders are characterized by many abnormalities, often also outside the brain, and are generally thought to be caused by multiple affected genes. A well-known example of such disorders is schizophrenia, a complex and common psychiatric disorder. Schizophrenia is a severe mental disorder, maybe the most severe of the mental illnesses, with about 1% lifetime prevalence and whose course is characterized by the onset of clinical symptoms after puberty. The etiology and pathophysiology of schizophrenia remain elusive. Much interest has centered on the molecular and cellular mechanisms of schizophrenia, including searches for neurotransmitter receptor abnormalities (number or affinity) and neuropathological alterations at the microscopic level (e.g., cell loss or reduced neuronal density in the limbic structures) .

In addition, converging evidence from epidemiological, brain imaging and neuropathological studies has led to an increasing acceptance of the notion that schizophrenia is a neurodevelopmental disorder, whereby a temporolimbic abnormality is inherited or sustained early in life but is not fully expressed until late adolescence/early adulthood. The results of recent genome-wide linkage and allele association studies have suggested a role for several candidate genes in the aetiology of schizophrenia, including the genes for proteins such as Neuregulin I (at the chromosomal location 8p) , Dysbindin (at 6p) , catechol-O-methyltransferase (at 22q) , the 5-HT2A receptor (at 13q) and G72 protein (d-amino-acid oxidase) (at 13q) . These candidate genes appear to be involved in neurodevelopment and in neurotransmitter systems, such as the serotonergic, glutamatergic and dopaminergic systems. A genome-scan meta-analysis of linkage studies has identified regions that may increase susceptibility to schizophrenia in diverse populations in many chromosomes, especially 2q, but also 5q, 3p, Hq, 6p, Iq, 22q, 8p, 2Oq, 14p, 16q, 18q, 1Op, 15q, 6q and 17q.

However, none of the above candidate genes have yet been unequivocally shown to be associated with increased risk for schizophrenia in the general population and at present there are no tests which can detect susceptibility genes for schizophrenia in clinical use.

Numerous studies point to alterations in different aspects of brain development as possible causes of schizophrenia, including defects in neuronal migration, neurotransmitter receptor expression and myelination. The morphological correlates of schizophrenia are subtle, and range from a slight reduction in brain size to localized alterations in the morphology and molecular composition of specific neuronal, synaptic, and glial populations in the hippocampus, dorsolateral prefrontal cortex, and dorsal thalamus .

These findings have fostered the view of schizophrenia as a disorder of connectivity and of the synapse. The susceptibility genes mentioned above may all converge functionally upon schizophrenia risk via an influence upon synaptic plasticity and the development and stabilization of cortical microcircuitry.

Schizophrenia is thus an aetiologically heterogeneous syndrome that usually becomes overtly manifest in adolescence and early adulthood, but in many cases subtle impairments in neurointegrative function are present from birth; hence it is considered to be a disorder with a neurodevelopmental component . The strongest risk factor that has been identified so far is familial risk with genetic loading. Nevertheless, 85% of individuals with schizophrenia have no first-degree relative with the illness. Other risk factors include pregnancy and delivery complications, infections during pregnancy, disturbances of early neuromotor and cognitive development and heavy cannabis use in adolescence.

Unfortunately, to date it has not been possible to utilize the predictors of the disorder that have been identified in primary preventative interventions in a general population.

In clinical settings, it would be helpful to map out possible early risk factors, at least familial risk for psychosis, especially in child, adolescent and young adult mental patients. An early diagnosis of schizophrenia is beneficial regarding the treatment outcome. Furthermore, in the future predictive models may be combined with data from genetic factors for schizophrenia, antenatal risk factors, childhood and adolescent development and clinical symptomatology, as well as brain structural and functional abnormalities .

Autism is a pervasive developmental disorder with onset by 3 years of age and is defined by the presence of a triad of social and communication impairments with restricted, repetitive or stereotyped behaviors. Autism is the result of a neurological disorder that affects the normal functioning of the brain, impacting development in the areas of social interaction and communication skills. Both children and adults with autism typically show difficulties in verbal and non-verbal communication, social interactions, and leisure or play activities. The first report of a full genome linkage screen for autism identified three chromosomal regions showing evidence suggestive of linkage. The most significant of these was on the long arm of chromosome 7. Another locus was found on chromosome 2. No clear genetic risk factors were identified yet .

Dyslexia is a specific learning disability that is neurological in origin. It is characterized by difficulties with accurate and/or fluent word recognition and by poor spelling and decoding abilities. These difficulties typically result from a deficit in the phonological component of language that is often unexpected in relation to other cognitive abilities and the provision of effective classroom instruction. Secondary consequences may include problems in reading comprehension and reduced reading experience that can impede the growth of vocabulary and background knowledge.

Familial transmission of reading disability has been recognized for a long time and twin studies demonstrate a substantial heritable component, estimated to be between 50% and 70%. Linkage mapping showed considerable evidence for a gene in the chromosome 6 region, with a moderate to strong influence on reading ability. Further evidence for chromosome 6 and chromosome 15 loci from an analysis of six large families wherein it was found that these loci were linked to two distinct reading-related phenotypes: phonological awareness with chromosome 6, and single-word reading with chromosome 15. A genetic risk marker has not been identified.

Attention-deficit hyperactivity disorder is characterized by a persistent pattern of overactivity, inattention and impulsivity which is pervasive across social situations and accompanied by substantial social impairments. The disorder is common, occurring in 2-5% of children, affecting boys 2-3 times more frequently than girls, and is one of the major causes of childhood behavioral problems. Hyperactivity is known to aggregate within families and twin studies have consistently shown it to be among the most highly heritable behaviors in childhood. Like in the other neurodevelopmental disorders described above it is not yet possible to predict susceptibility for the disorder based on a genetic risk factor.

Neurodevelopmental disorders may be associated with certain complications that are not in themselves classified as neurodevelopmental disorder but may occur in individuals suffering from these disorders. Examples of such complications are epilepsy and depression.

Epilepsy (Seizure Disorder) is a physical condition that occurs when there is a sudden, brief change in how the brain works. When brain cells are not working properly, a person's consciousness, movement or actions may be altered for a short time. These physical changes are called epileptic seizures. Epilepsy is therefore sometimes called a seizure disorder. As indicated above seizure is one of the consequences of a neurodevelopmental disorder.

Some genetic defects underlying different epilepsy syndromes have been identified. Mutations in the cholinergic receptor, nicotinic, alpha polypeptide 4 (CHRNA4) and/or CHRNB genes were found in familial nocturnal frontal lobe epilepsy. CHRNA4 and CHRNB encode subunits of the neuronal nicotinic acetylcholine ion-channel receptor. Since the discovery of CHRNA4 mutations several ion channel genes, mostly causing primarily generalized epilepsy, have been identified. Defects in the voltage-gated potassium channels potassium voltage-gated channel, subfamily Q, member 2

(KCNQ2) and KCNQ3 have recently been identified in benign familial neonatal convulsions. Mutations affecting the voltage-gated sodium channel subunits SCNlB and SCNlA or the gamma 2-subunit of the GABA(A) receptor can cause generalized epilepsy with febrile seizures plus severe myoclonic epilepsy of infancy. Chloride and calcium channel mutations are also found in rare families with the common syndromes childhood absence epilepsy and juvenile myoclonic epilepsy.

These findings suggest the involvement of brain channel defects in the pathogenesis of certain types of epilepsy. Although these ion channel defects have been identified, they generally account for only a minority of families and sporadic cases with the syndrome in question. The data suggest that ion channel mutations of large effect are a common cause of rare monogenic idiopathic epilepsies, but these are rare causes of common epilepsies.

More recently, another focal (temporal lobe) onset epilepsy gene, leucine-rich, glioma inactivated 1 (LGIl), was discovered. The function of LGIl is unknown.

Although some genes underlying seizure disorders in humans have been identified, these, however, still account for a mere fraction of the genetic contribution to epilepsy and do not offer the possibility to predict susceptibility for the disorder based on a genetic risk factor.

Depressive disorders represent a prevalent (1 to 2%) and major illness characterized by episodes of dysphoria that are associated with somatic symptoms. A major depressive episode is characterized by at least 2 weeks during which there is a new onset or clear worsening of either depressed mood or loss of interest or pleasure in nearly all activities. In addition, changes in appetite, weight, sleep, and psychomotor activity; decreased energy; feelings of worthlessness or guilt; difficulty thinking, concentrating, or making decisions; or recurrent thoughts of death or suicidal ideation, plans, or attempts occur. The episode is accompanied by distress or impairment in social, occupational, or other important areas of functioning. Depressive disorders may have a manic-depressive (bipolar) or purely depressive (unipolar) course. If untreated, manic-depressive illness is associated with a suicide rate of approximately 20%.

Depressed patients have decreased activity in the prefrontal cortex, corresponding to a reduction in cortical volume. This region had previously been implicated in the mediation of emotional and autonomic responses to socially significant or provocative stimuli, and in the modulation of the neurotransmitter systems targeted by antidepressant drugs .

Although epidemiologic studies indicate an environmental component in the etiology of major depressive disorder, a genetic component has also been found. Twin studies estimate the heritability of major depressive disorder at 0.36 to 0.70, and multiple genetic loci are involved in the causation of this complex trait. One susceptibility locus for major depressive disorder (MDDl) has been mapped to chromosome 12q22-q23.2, whereas another susceptibility locus for major depressive disorder (MDD2) has been mapped to 15q25.3-q26.2. Recently, a genome-wide linkage survey for genetic loci that influence the development of unipolar mood disorders was conducted by screening 389 highly informative simple sequence tandem repeat polymorphisms (SSTRPs) . Out of the nineteen chromosomal regions containing linkage peaks, ten 'highly significant¹ chromosomal regions reached genome-wide statistical significance. Furthermore, the CREBl gene was identified as a likely sex-limited susceptibility gene for unipolar mood disorders, and implicating the cAMP signaling pathway in the pathophysiology of mood disorders and related conditions .

Hashimoto et al . (Biol Psychiatry 57 ( 10) : 1097-102 (2005) ) found a significant association with major depression for 6 polymorphisms in the breakpoint cluster region gene on chromosome 22qll, by genotyping 171 patients with bipolar disorder, 329 patients with major depressive disorder, and 351 controls.

Lopez Leon et al. (Biol Psychiatry 57 (9) : 999-1003 (2005)) conducted a meta-analysis to reevaluate the role of the 48-bp repeat polymorphism in the dopamine D4 receptor (DRD4) gene on chromosome Ilpl5 in mood disorders. An association was found between the DRD4 2-repeat (2R) allele and unipolar depression (p less than 0.001) and unipolar and bipolar depression combined (p less than 0.001) in 917 patients with unipolar or bipolar affective disorder and 1,164 control subjects from 12 samples.

Caspi et al. (Science 301 (5631) : 386-9 (2003)) tested why stressful experiences led to depression in some people but not in others. A functional polymorphism in the promoter region of the SLC6A4 gene was found to moderate the influence of stressful life events on depression. Individuals with 1 or 2 copies of the short allele of the promoter polymorphism exhibited more depressive symptoms, diagnosable depression, and suicidality in relation to stressful life events than individuals homozygous for the long allele.

Taylor et al . (Arch. Gen. Psychiat. 62: 537-544, (2005)) concluded that later age of depression onset was associated with smaller hippocampal volumes in individuals with the L/L genotype of a serotonin transporter promoter polymorphism. In the same line is the data of Willeit et al. (Molec. Psychiat. 8: 942-946 (2003)), who genotyped 138 patients with seasonal affective disorder (SAD) , which is usually a variant of major depressive disorder, and 146 healthy volunteers for the long/short promoter polymorphism of serotonin transporter. It was concluded that the promoter region of the serotonin transporter influences phenotypic expression of disease.

The 1463A SNP allele found in the rate-limiting enzyme of neuronal serotonin synthesis, tryptophan 15 hydroxylase-2 (TPH2) gene, on chromosome 12q21, resulted in about 80% loss of function in serotonin production in vitro. In addition, the SNP analysis in a cohort of 87 patients with unipolar major depression revealed that 9 patients carried the mutant (1463A) allele, while among 219 controls, 3 subjects carried this mutation. In addition, this functional SNP was not found in a cohort of 60 bipolar disorder patients. It was concluded that a defect in brain serotonin synthesis may represent an important risk factor for unipolar major depression.

A polymorphism in the HTR2A gene, which encodes the serotonin 2A receptor, has been associated with citalopram treatment outcome in major depressive disorder.

Polymorphism in the FKBP5 gene, which plays a role in the stress hormone-regulating hypothalamic-pituitary-adrenal axis, has been found to be related to a faster response to antidepressant drug treatment and to increased recurrence of depressive episodes.

In the research that led to the present invention it was found that a single-nucleotide polymorphism (SNP) in the human gene Aph-lb is associated with the susceptibility of an individual for neurodevelopmental disorders, in particular psychiatric-neurodevelopmental disorders, including schizophrenia, autism, ADHD and dyslexia, and their complications, in particular epilepsy and depression. Aph-lb is known as a component of the gamma-secretase complex. Subtle alterations in gamma-secretase subunit composition may lead to a variety of affected

(neuro) developmental signalling pathways and, consequently, a complex neurodevelopmental disorder.

SNP651 (T>G) in exon 6 of the Aph-lb gene showed a highly significant difference in the frequency of its genotype and allele between the schizophrenic patient and control group. The frequency was found to be about 7-8% in the patient group against about 3% in controls (Table Ib) .

Similar results were found in patients suffering from autism, ADHD and dyslexia and in patients suffering from epilepsy and depression (Table Ib) .

Table Ia

Aph-lb SNP651 t>g genotype and allele distribution in patients and controls

SNP = Single-Nucleotide Polymorphism

Table Ib

This T>G substitution leads to a change in amino acid residue 217 from phenylalanine to leucine (Phe/Leu) . Amino acid residue 217 is conserved among all known Aph-lb sequences and also among all sequences of its paralogue Aph- Ia from man to worm (either Phe or Tyr) .

The altered genotype leads to an altered gamma- secretase activity. In individuals with the SNP651 T>G mutation, this mutation is the cause of a change in a normally conservative amino acid. About 10% of the Caucasian population is affected by or susceptible to neurodevelopmental diseases. 8% of the individuals within this group have this mutation. Others not having the mutation are however still affected. The inventors have thus hypothesized that there may be other causes that affect the activity of gamma-secretase, possibly in a similar manner. Gamma-secretase is the protease responsible for amyloid beta peptide release and is needed for Notch, N-Cadherin, and possibly other signaling pathways. The protease complex consists of at least four subunits, i.e. presenilin, Aphl, Pen2, and Nicastrin. Two different genes encode Aph-la and Aph-lb in humans.

It is the object of the present invention to provide a method for drug discovery that is based on an altered gamma-secretase activity.

The present invention provides a new method for testing and screening compounds and materials, such as biologicals which can be proteins, peptides, antibodies or fragments thereof, liposomes, hormones, vectors, viral vectors, nucleic acid molecules, anti-sense RNA, si-RNA, drugs, and the like for efficacy in affecting, treating, or preventing neurodevelopmental disorders, in particular psychiatric-neurodevelopmental disorders, such as schizophrenia, autism, Attention-deficit hyperactivity disorder (ADHD), dyslexia, Rett's disorder and Asperger's, specifically schizophrenia, autism, Attention-deficit hyperactivity disorder (ADHD) and dyslexia, or for efficacy in affecting, treating, or preventing complications of neurodevelopmental disorders, in particular epilepsy and depression. For treatment, these compounds can be combined with any other compound used in the art for treating the above disorders or complications, suitably formulated into a pharmaceutical composition comprising the compound and a pharmaceutically acceptable carrier, diluent and/or excipient .

The method comprises: a) providing a collection of compounds; b) contacting the compounds of the collection with a cell line or organism expressing gamma-secretase; c) measuring the gamma-secretase activity in the cell line or organism before and after the contact with the compound; and d) identifying the compounds in the collection that modulate the gamma-secretase activity of the cell line or organism.

In a particular embodiment of the invention, the gamma-secretase that is expressed by the cell line or organism is a variant gamma-secretase, the activity of which is altered as compared to the gamma-secretase activity found in a human not carrying the SNP651 or carrying the wild-type Aph-lb gene. In a further embodiment the gamma-secretase activity is decreased as compared to the gamma-secretase activity found in a human not carrying the SNP651 or carrying the wild-type Aph-lb gene.

In a specific embodiment, the phenylalanine at position 217 of the Aph-lb component of the gamma-secretase is replaced by an aliphatic amino acid, preferably leucine.

After one or more candidate compounds have been identified they have to be produced for further testing or used in treatment or prophylaxis of a patient suffering from neurodevelopmental disorders, preferably psychiatric- neurodevelopmental disorders, more preferably schizophrenia, autism, Attention-deficit hyperactivity disorder (ADHD) , dyslexia, Rett's disorder and Asperger's, and most preferably schizophrenia, autism, Attention-deficit hyperactivity disorder (ADHD) and dyslexia, or in the treatment or prophylaxis of complications of neurodevelopmental disorders, in particular epilepsy and depression. This treatment or prophylaxis is preferably performed in the early stages of brain development starting from fetal development until adolescence. The method in a specific embodiment thus further comprises purifying or producing the identified compound.

In principle the method of the invention can also be performed with only one compound. Suitably however libraries of compounds are used. Such a collection may include small molecules as well as macromolecules, such as nucleic acids or proteins .

The invention further relates to the compounds identified by the method, to compositions comprising one or more of such compounds together with an acceptable carrier and to pharmaceutical compositions or formulations comprising the composition.

The invention relates to any therapeutical or prophylactic use of compounds identified by the method, and in particular for the treatment or prophylaxis of neurodevelopmental disorders, in particular psychiatric- neurodevelopmental disorders, such as schizophrenia, autism, Attention-deficit hyperactivity disorder (ADHD) , dyslexia, Rett's disorder and Asperger's, specifically schizophrenia, autism, Attention-deficit hyperactivity disorder (ADHD) and dyslexia, or in the treatment or prophylaxis of complications of neurodevelopmental disorders, in particular epilepsy and depression.

The invention further provides a cell line for use in the method, which cell line produces a human gamma-secretase .

In a particular embodiment of the cell line, the gamma-secretase that is produced is a variant gamma- secretase, the activity of which is altered as compared to the gamma-secretase activity found in a human not carrying the SNP651 or carrying the wild-type Aph-lb gene. Suitably the gamma-secretase activity is decreased as compared to the gamma-secretase activity found in a human not carrying the SNP651 or carrying the wild-type Aph-lb gene. In a specific embodiment the variant gamma-secretase is a gamma-secretase wherein the phenylalanine at position 217 of the Aph-lb component of the gamma-secretase is replaced by a leucine. To achieve this the cell line is constructed such that the Aph-lb component of the gamma- secretase is expressed from a Aph-lb gene harboring the SNP651 polymorphism. In a further embodiment the Aph-lb component of the gamma-secretase is expressed from a nucleic acid molecule comprising a variant of the human Aph-lb gene as depicted in Fig. 1 (SEQ ID NO:1) that causes the amino acid residue in position 217 of the encoded gamma-secretase component Aph-lb to be an aliphatic amino acid, in particular a leucine.

Alternatively, the variant Aph-lb gene has the nucleotide sequence as depicted in any one of the Figs. 2A-F (SEQ ID NOS: 3-8), or a fragment thereof that comprises the codon encoding amino acid residue 217 of the encoded gamma- secretase component Aph-lb.

The variant Aph-lb gene may also have a nucleotide sequence encoding a polypeptide having the amino acid sequence as depicted in Fig. 4 (SEQ ID NO: 9).

In another embodiment, the variant Aph-lb gene hybridizes under high stringency conditions to a nucleotide sequence selected from the group consisting of the sequences as shown in any one of the Figs. 2A-F (SEQ ID NOS:2-7) and the complement of the sequence as shown in any one of the Figs. 2A-F (SEQ ID NOS: 2-7), with the proviso that the nucleic acid has a codon selected from TTA, TTG, CTT, CTC, CTA, CTG in the position encoding the amino acid residue in position 217 of the encoded gamma-secretase component Aph-lb.

The skilled person knows how to define "high stringency" conditions for the different hybridisation techniques that are generally available. In general stringency is determined by various factors, among which the temperature, the solvent (i.e. aqueous or with formamide) , the volume of the hybridisation solution and length of hybridisation and the salt concentration. High stringency is usually a temperature above 5O⁰C and a salt concentration of at least 2x SSC.

According to a further aspect thereof the invention relates to the use of the cell line for identification of compounds that alter the gamma-secretase activity. The cell line is either a transgenic cell line or a cell line derived from an individual that has the polymorphism.

The results of the method of the invention can further be used in combination with the outcome of a diagnostic test determining the presence of SNP651.

The presence of SNP651 in an individual is indicative for the development of or an increased susceptibility for neurodevelopmental disorders, preferably psychiatric- neurodevelopmental disorders, more preferably schizophrenia, autism, Attention-deficit hyperactivity disorder (ADHD) , dyslexia, Rett's disorder and Asperger's, and most preferably schizophrenia, autism, Attention-deficit hyperactivity disorder (ADHD) and dyslexia, or for complications of neurodevelopmental disorders, in particular epilepsy and depression. This presence of SNP651 defines a novel subgroup in the group of patients suffering from these disorders or complications and thereby, as a logical consequence, at least one causative factor responsible for development of the disease in this subgroup. Specific targeting of this factor using the compounds according to the present invention offers the possibility to provide to this subgroup of patients an improved, possibly additional, treatment protocol specifically designed to target the causative factor.

The invention can thus be used in combination with a method of diagnosing neurodevelopmental disorders or their complications or a susceptibility to neurodevelopmental disorders or their complications in an individual, comprising screening for the presence of SNP651 (SEQ ID NO: 10) in the gene encoding the human gamma-secretase component Aph-lb, which SNP651 is more frequently present in a population of individuals suffering from or susceptible to neurodevelopmental disorders or their complications than in the general population, and wherein the presence of SNP651 is indicative of the existence of neurodevelopmental disorders or their complications or susceptibility to neurodevelopmental disorders or their complications.

The SNP651 is "more frequently present" when there is a significant increase in its occurrence as compared to the normal population. In a specific embodiment the normal population and the patient are Caucasian. SNP651 is a single nucleotide polymorphism in which the T in position 651 of the coding part of the gene (wherein the start codon ATG represent positions 1-3) is changed into G.

This method of diagnosis is in particular suitable for neurodevelopmental disorders, in particular psychiatric- neurodevelopmental disorders, more in particular schizophrenia, autism, Attention-deficit hyperactivity disorder (ADHD), dyslexia, Rett's disorder and Asperger's, and most preferably schizophrenia, autism, Attention-deficit hyperactivity disorder (ADHD) and dyslexia and their complications, in particular epilepsy and depression. These disorders and complications are intended to be disclosed also alone or in combination. Diagnosis of a susceptibility to neurodevelopmental disorders, such as schizophrenia, autism, ADHD or dyslexia, or complications thereof such as depression and epilepsy, is thus made by detecting the SNP651 polymorphism in the Aph-lb gene. The polymorphism is the change of one nucleotide, resulting in a change in the encoded amino acid.

In a first method of diagnosing a susceptibility to neurodevelopmental disorders or their complications, hybridization methods, such as Southern analysis, Northern analysis, or in situ hybridizations are used. These techniques are well known in the art and are for example disclosed in Current Protocols in Molecular Biology, Ausubel, F. et al., eds . , John Wiley & Sons, including all supplements . For example, a biological sample from a test subject (a "test sample") of genomic DNA, RNA, or cDNA, is obtained from an individual suspected of having, being susceptible to or predisposed for, or carrying a defect for, a neurodevelopmental disorder (the "test individual"). The individual can be an adult, child, or fetus. The test sample can be from any source which contains genomic DNA, such as a blood sample, sample of amniotic fluid, sample of cerebrospinal fluid, or tissue sample from skin, muscle, buccal or conjunctival mucosa, placenta, gastrointestinal tract a or other organs. A test sample of DNA from fetal cells or tissue can be obtained by appropriate methods, such as by amniocentesis or chorionic villus sampling.

The DNA, RNA, or cDNA sample is then examined to determine whether the polymorphism in Aph-lb is present. The presence of the polymorphism can be indicated by hybridization of the gene in the genomic DNA, RNA, or cDNA to a nucleic acid probe. A "nucleic acid probe", as used herein, can be a DNA probe or an RNA probe; the nucleic acid probe contains the SNP651 polymorphism in Aph-lb. The probe can be any of the nucleic acid molecules described above (e.g., the gene, a fragment, a vector comprising the gene, a probe or primer, etc . ) To diagnose a susceptibility to a neurodevelopmental disease such as schizophrenia, autism, ADHD or dyslexia, or a complication thereof, such as depression or epilepsy, a hybridization sample is formed by contacting the test sample containing the Aph-lb gene, with at least one nucleic acid probe. A preferred probe for detecting mRNA or genomic DNA is a labeled nucleic acid probe capable of hybridizing to mRNA or genomic DNA sequences described herein. The nucleic acid probe can be, for example, a full-length nucleic acid molecule, or a portion thereof, such as an oligonucleotide of at least 15, 30, 50, 100, 250 or 500 nucleotides in length and sufficient to specifically hybridize under stringent conditions to appropriate mRNA or genomic DNA. For example, the nucleic acid probe can be all or a portion of the sequence shown in Figs. 2A-F (SEQ ID NOS: 2-7), or the complement thereof, or a portion thereof, or can be a nucleic acid encoding all or a portion of the amino acid sequence shown in Fig. 4 (SEQ ID NO: 9). Suitable probes for use in the diagnostic assays of the invention comprise a nucleotide that is complementary to position 651 of the Aph-lb gene or variant thereof.

The hybridization sample is maintained under conditions which are sufficient to allow specific hybridization of the nucleic acid probe to the Aph-lb gene. "Specific hybridization", as used herein, indicates exact hybridization (e.g., with no mismatches). Specific hybridization can be performed under high stringency conditions or moderate stringency conditions. In a particularly preferred embodiment, the hybridization conditions for specific hybridization are high stringency.

Specific hybridization, if present, is then detected using standard methods. If specific hybridization occurs between the nucleic acid probe and the Aph-lb gene in the test sample, then the Aph-lb gene has the polymorphism, that is present in the nucleic acid probe. Specific hybridization of the nucleic acid probe is indicative of a polymorphism in the Aph-lb gene, and is therefore diagnostic for a susceptibility to a neurodevelopmental disorder such as schizophrenia .

In Northern analysis (see for example Current

Protocols in Molecular Biology, Ausubel, F. et al, eds., John Wiley & Sons, supra) , the hybridization methods described above are used to identify the presence of the SNP651 polymorphism, associated with a susceptibility to schizophrenia or another neurodevelopmental disorder or a complication thereof. For Northern analysis, a test sample of RNA is obtained from the individual by appropriate means. Specific hybridization of a nucleic acid probe, as described above, to RNA from the individual is indicative of the SNP651 polymorphism in the Aph-lb gene, and is therefore diagnostic for a susceptibility to schizophrenia or another neurodevelopmental disorder or a complication thereof. Alternatively, a peptide nucleic acid (PNA) probe can be used instead of a nucleic acid probe in the hybridization methods described above. PNA is a DNA mimic having a peptide-like, inorganic backbone, such as N- (2-aminoethyl ) glycine units, with an organic base (A, G, C, T or U) attached to the glycine nitrogen via a methylene carbonyl linker (see, for example, Nielsen, P. E. et al . , Bioconjugate Chemistry, 1994, 5, American Chemical Society, p. 1 (1994) . The PNA probe can be designed to specifically hybridize to the Aph-lb gene having the SNP651 polymorphism associated with a susceptibility to schizophrenia. Hybridization of such PNA probe to the Aph-lb gene is diagnostic for a susceptibility to a neurodevelopmental disorder, such as schizophrenia, or a complication of a neurodevelopmental disorder .

Sequence analysis can also be used to detect the SNP651 polymorphism in the Aph-lb gene. A test sample of DNA or RNA is obtained from the test individual. PCR or other appropriate methods can be used to amplify the gene, and/or its flanking sequences, if desired. The sequence of the Aph- lb gene, or a fragment of the gene, or cDNA, or fragment of the cDNA, or mRNA, or fragment of the mRNA, is determined, using standard methods. The sequence of the gene, gene fragment, cDNA, cDNA fragment, mRNA, or mRNA fragment is compared with the known nucleic acid sequence of the gene, cDNA (e.g., Fig. 1 (SEQ ID NO: 1), or a nucleic acid sequence encoding the amino acid sequence of Fig. 4 (SEQ ID NO: 9), or a fragment thereof) or mRNA, as appropriate. The presence of a polymorphism at 651 in the coding sequence of the Aph-lb gene or an amino acid substitution at position 217 of the encoded Aph-lb protein indicates that the individual has a susceptibility to schizophrenia or other neurodevelopmental disorder or a complication thereof. Allele-specific oligonucleotides can also be used to detect the presence of the SNP651 polymorphism in Aph-lb, through the use of dot-blot hybridization of amplified oligonucleotides with allele-specific oligonucleotide (ASO) probes (see, for example, Saiki, R. et al . , (1986), Nature (London) 324:163-166). An "allele-specific oligonucleotide" (also referred to herein as an "allele-specific oligonucleotide probe") is an oligonucleotide of approximately 10-50 base pairs, preferably approximately 15-30 base pairs, that specifically hybridizes to Aph-lb, and that contains a polymorphism associated with a susceptibility to schizophrenia or another neurodevelopmental disorder. An allele-specific oligonucleotide probe that is specific for the SNP651 polymorphism in Aph-lb can be prepared, using standard methods (see Current Protocols in Molecular Biology, supra) . To identify the SNP651 polymorphism in the Aph-lb gene that is associated with a susceptibility to schizophrenia or another neurodevelopmental disorder or complication thereof, a test sample of DNA is obtained from the individual. PCR can be used to amplify all or a fragment of Aph-lb, and its flanking sequences. The DNA containing the amplified Aph-lb (or fragment of the gene) is dot-blotted, using standard methods (see Current Protocols in Molecular Biology, supra) , and the blot is contacted with the oligonucleotide probe. The presence of specific hybridization of the probe to the amplified Aph-lb is then detected. Specific hybridization of an allele-specific oligonucleotide probe to DNA from the individual is indicative of the SNP651 polymorphism in Aph-lb, and is therefore indicative of a susceptibility to schizophrenia or another neurodevelopmental disorder or complication thereof.

In another embodiment, arrays of oligonucleotide probes that are complementary to target nucleic acid sequence segments from an individual, can be used to identify the SNP651 polymorphism in Aph-lb. For example, in one embodiment, an oligonucleotide array can be used. Oligonucleotide arrays typically comprise a plurality of different oligonucleotide probes that are coupled to a surface of a substrate in different known locations. One such oligonucleotide probe could be used to detect the presence of SNP651 in the target nucleic acid sequence segments from an individual. These oligonucleotide arrays, also described as "Genechips™, " have been generally described in the art, for example, U.S. Pat. No. 5,143,854 and PCT patent publication Nos. WO 90/15070 and 92/10092. These arrays can generally be produced using mechanical synthesis methods or light directed synthesis methods which incorporate a combination of photolithographic methods and solid phase oligonucleotide synthesis methods. See Fodor et al., Science, 251:767-777 (1991), Pirrung et al., U.S. Pat. No. 5,143,854 (see also PCT Application No. WO 90/15070) and Fodor et al., PCT Publication No. WO 92/10092 and U.S. Pat. No. 5,424,186, the entire teachings of each of which are incorporated by reference herein. Techniques for the synthesis of these arrays using mechanical synthesis methods are described in, e.g., U.S. Pat. No. 5,384,261, the entire teachings of which are incorporated by reference herein.

Once an oligonucleotide array is prepared, a nucleic acid of interest is hybridized with the array and scanned for polymorphisms. Hybridization and scanning are generally carried out by methods described in, e.g., Published PCT Application Nos. WO 92/10092 and WO 95/11995, and U.S. Pat.

No. 5,424,186, the entire teachings of which are incorporated by reference herein. In brief, a target nucleic acid sequence which includes one or more previously identified polymorphic markers is amplified by well known amplification techniques, e.g., PCR. Typically, this involves the use of primer sequences that are complementary to the two strands of the target sequence both upstream and downstream from the polymorphism. Asymmetric PCR techniques may also be used. Amplified target, generally incorporating a label, is then hybridized with the array under appropriate conditions. Upon completion of hybridization and washing of the array, the array is scanned to determine the position on the array to which the target sequence hybridizes. The hybridization data obtained from the scan is typically in the form of fluorescence intensities as a function of location on the array.

Other methods of nucleic acid analysis can be used to detect the SNP651 polymorphism in Aph-lb. Representative methods include direct manual sequencing (Church and Gilbert, (1988), Proc. Natl. Acad. Sci. USA 81:19911995; Sanger, F. et al. (1977) Proc. Natl. Acad. Sci. 74:5463-5467; Beavis et al.

U.S. Pat. No. 5,288,644); automated fluorescent sequencing; single-stranded conformation polymorphism assays (SSCP) ; clamped denaturing gel electrophoresis (CDGE) ; denaturing gradient gel electrophoresis (DGGE) (Sheffield, V. C. et al.

(19891) Proc. Natl. Acad. Sci. USA 86:232-236), mobility shift analysis (Orita, M. et al . (1989) Proc. Natl. Acad. Sci. USA 86:2766-2770), restriction enzyme analysis (Flavell et al. (1978) Cell 15:25; Geever, et al . (1981) Proc. Natl.

Acad. Sci. USA 78:5081); heteroduplex analysis; chemical mismatch cleavage (CMC) (Cotton et al . (1985) Proc. Natl.

Acad. Sci. USA 85:4397-4401); RNase protection assays (Myers, R. M. et al. (1985) Science 230:1242); use of polypeptides which recognize nucleotide mismatches, such as E. coli mutS protein; allele-specific PCR, for example.

In a particularly practical embodiment of a method for diagnosing neurodevelopmental disorders, the screening for the presence of SNP651 (SEQ ID NO: 1) in the gene encoding the human gamma-secretase component Aph-lb comprises the steps of: a) provision of nucleic acid from the individual to be tested; b) amplification of part of the nucleic acid of the individual to be tested with a primer comprising a contiguous nucleotide sequence, which is at least partially complementary to a part of the nucleotide sequence of said Aph-lb nucleic acid and which is capable of acting as a primer for said Aph-lb nucleic acid when maintained under conditions for primer extension; c) determining whether the amplification product is formed.

This embodiment is particularly advantageous when the primer is complementary to a stretch of nucleic acid located immediately upstream from the position of SNP651, and ends with an A or a C. When the genomic DNA of the individual contains a T at position 651, the primer with the 3¹ A (A- primer) will result in primer extension, whereas the primer with the C at the end (C-primer) will not be extended. When both primers are used, the PCR reaction on the nucleic acid sample of an individual having T/T at position 651 will not produce an amplification product with the C-primer but will result in an amplification product with the A-primer. An individual having the SNP651 mutation at both alleles will produce a product with the C-primer but not with the A- primer. The sample of a heterozygous individual will show a product with both primers.

Although, two PCR' s with the two primers has the additional advantage of obtaining information about the homozygosity or heterozygosity of the individual, one PCR with one primer will also give the indication whether or not the individual has the genetic risk factor. Instead of PCR any other amplification technique, such as NASBA or LCR, can be used.

Figures Figure 1 shows the 905 bp cDNA sequence of the known human Aph-lb gene (accession AL136671 from GenBank) encoding the variant component Aph-lb of the human gamma-secretase gene as identified according to the invention. SNP651 is the nucleotide at position 651 of the coding sequence in which the ATG corresponds to positions 1-3.

Figures 2A-F show examples of variant Aph-lb genes.

Figure 3 shows the known amino acid sequence of the human Aph-lb component of γ-secretase as found in the

UniProtKB/Swiss-Prot at entry Q8WW43. The length is 257 amino acids, the molecular weight is 28460 Da. In this application the amino acid in position 217 in this figure will always be designated as "the amino acid residue in position 217" thus referring to the protein that naturally occurs in humans, even when the actual position of that amino acid in an amino acid sequence is not position 217.

Figure 4 shows the amino acid sequence of an example of a variant Aph-lb protein.

List of Sequence ID numbers

SEQ ID NOS

Fig. 1 SEQ ID N0:l known Aph-lb gene

Fig. 2A SEQ ID NO : 2 novel Aph-lb variant

Fig. 2B SEQ ID NO: 3 novel Aph-lb variant

Fig. 2C SEQ ID NO: 4 novel Aph-lb variant

Fig. 2D SEQ ID NO: 5 novel Aph-lb variant

Fig. 2E SEQ ID NO: 6 novel Aph-lb variant

Fig. 2F SEQ ID NO: 7 novel Aph-lb variant Fig. 3 SEQ ID NO: 8 known Aph-lb protein

Fig. 4 SEQ ID NO: 9 novel Aph-lb protein

Fig. 5 SEQ ID NO: 10 SNP651

The present invention will be further illustrated in the Example that follow and that is in no way intended to limit the invention in any way.

EXAMPLE Cell line

A cell line expressing a variant gamma-secretase was prepared transforming the cells with the Aph-lb gene as depicted in Fig. 2A. Transformed clones were identified by means of markers. Insertion of the correct gene was determined by means of PCR with the following primers: forward primer: 5'- AATAAACCTGGCGTCAGCATTG -3' reversed primer: 5'- AGTCGGCTTTACACTGTCCCA -3'.

One of the transformed clones harbouring the gene of Fig. 2A was selected for the production of a cell line Aph- lb/T>G.

Gamma-secretase assay

The basal level of the gamma-secretase of cell line Aph-lb/T>G was determined by measuring the levels of cleavage products of various gamma-secretase substrates by Western blot analysis using antibodies directed against the C-terminal regions of the substrates. In general, the proteolytic processing of a gamma-secretase substrate starts with shedding of its extracellular domain, leaving a C-terminal fragment (CTF) that is subsequently cleaved by gamma-secretase to its ICD. One of the best known substrates of gamma-secretase is the Alzheimer' s disease-linked APP protein. APP is part of the APP superfamily that in mammals includes the two APP-like proteins APLPl and APLP2. In addition, the gamma-secretase cleavage activity toward p75, ErbB4, and NRG2 was determined. Statistical analysis of the levels of direct gamma-secretase substrates (CTFs) was performed using a univariate ANOVA and a one-way ANOVA analysis. Screening

The cell line was subsequently contacted with a collection of chemical compounds and the gamma-secretase activity again determined. Compounds that were capable of increasing the gamma-secretase activity were selected as leads .

Claims

1. A method for identifying compounds which alter the activity of gamma-secretase, comprising: a) providing a collection of compounds; b) contacting the compounds of the collection with a cell line or organism expressing gamma-secretase; c) measuring the gamma-secretase activity in the cell line or organism before and after the contact with the compound; and d) identifying the compounds in the collection that modulate the gamma-secretase activity of the cell line or organism.

2. The method as claimed in claim 1, wherein the gamma-secretase that is expressed by the cell line or organism is a variant gamma-secretase, the activity of which is altered as compared to the gamma-secretase activity found in a human not carrying the SNP651 or carrying the wild-type Aph-lb gene.

3. The method as claimed in claim 2, wherein the gamma-secretase activity is decreased as compared as compared to the gamma-secretase activity found in a human not carrying the SNP651 or carrying the wild-type Aph-lb gene.

4. The method as claimed in claim 1, 2 or 3, wherein the phenylalanine at position 217 of the Aph-lb component of the gamma-secretase is replaced by a leucine.

5. The method as claimed in any one of the claims 1-

4, further comprising purifying or producing the identified compound.

6. The method as claimed in any one of the claims 1-

5, wherein the collection includes small molecules as well as macromolecules, such as nucleic acids or proteins.

7. A compound identified by the method of any one of the claims 1-6.

8. A composition comprising a compound identified by the method of any one of the claims 1-6 and an acceptable carrier.

9. A pharmaceutical composition or formulation comprising the composition of claim 8.

10. Use of a compound identified by the method of any of claims 1-6 for the treatment of disorders of the brain.

11. Use as claimed in claim 10, wherein the disorders are neurodevelopmental disorders.

12. Use as claimed in claim 11, wherein the disorders are neurodevelopmental psychiatric disorders.

13. Use as claimed in claim 11, wherein the disorders are schizophrenia, autism, Attention-deficit hyperactivity disorder (ADHD), dyslexia, Rett's disorder and Asperger's, preferably schizophrenia, autism, Attention-deficit hyperactivity disorder (ADHD) and dyslexia.

14. Use as claimed in claim 11, wherein the disorders are complications of neurodevelopmental disorders.

15. Use as claimed in claim 14, wherein the complications are depression and epilepsy.

16. A cell line for use in the method as claimed in any one of the claims 1-6, which cell line produces a human gamma-secretase .

17. The cell line as claimed in claim 16, wherein the gamma-secretase that is produced is a variant gamma- secretase, the activity of which is altered as compared to the gamma-secretase activity found in a human not carrying the SNP651 or carrying the wild-type Aph-lb gene.

18. The cell line as claimed in claim 17, wherein the gamma-secretase activity is decreased as compared to the gamma-secretase activity found in a human not carrying the SNP651 or carrying the wild-type Aph-lb gene.

19. The cell line as claimed in claims 16 or 17, wherein the phenylalanine at position 217 of the Aph-lb component of the gamma-secretase is replaced by a leucine.

20. The cell line as claimed in claim 18, wherein the the Aph-lb component of the gamma-secretase is expressed from a Aph-lb gene harboring the SNP651 polymorphism.

21. Cell line as claimed in claim 20, wherein the Aph- Ib component of the gamma-secretase is expressed from a nucleic acid molecule comprising a variant of the human Aph-lb gene as depicted in Fig. 1 (SEQ ID N0:l) that causes the amino acid residue in position 217 of the encoded gamma- secretase component Aph-lb to be an aliphatic amino acid, in particular a leucine.

22. The cell line as claimed in claim 21, wherein the variant Aph-lb gene has the nucleotide sequence as depicted in any one of the Figs. 2A-F (SEQ ID NOS: 3-8), or a fragment thereof that comprises the codon encoding amino acid residue 217 of the encoded gamma-secretase component Aph-lb.

23. The cell line as claimed in claim 21, wherein the variant Aph-lb gene has a nucleotide sequence encoding a polypeptide having the amino acid sequence as depicted in Fig. 4 (SEQ ID NO: 9) .

24. The cell line as claimed in claim 21, wherein the variant Aph-lb gene hybridizes under high stringency conditions to a nucleotide sequence selected from the group consisting of the sequences as shown in any one of the Figs. 2A-F (SEQ ID NOS: 2-7) and the complement of the sequence as shown in any one of the Figs. 2A-F (SEQ ID NOS:2-7), with the proviso that the nucleic acid has a codon selected from TTA, TTG, CTT, CTC, CTA, CTG in the position encoding the amino acid residue in position 217 of the encoded gamma-secretase component Aph-lb.

25. Use of the cell line as claimed in any one of the claims 14-22 or the animal model as claimed in any one of the claims 23-31 for identification of compounds that alter the gamma-secretase activity as compared to the gamma-secretase activity found in a human not carrying the SNP651 or carrying the wild-type Aph-lb gene.