WO2007019945A2 - Method and kit for detection of components of bovine tissue in products of animal origin produced in comminuting conditions - Google Patents

Method and kit for detection of components of bovine tissue in products of animal origin produced in comminuting conditions Download PDF

Info

Publication number
WO2007019945A2
WO2007019945A2 PCT/EP2006/007305 EP2006007305W WO2007019945A2 WO 2007019945 A2 WO2007019945 A2 WO 2007019945A2 EP 2006007305 W EP2006007305 W EP 2006007305W WO 2007019945 A2 WO2007019945 A2 WO 2007019945A2
Authority
WO
WIPO (PCT)
Prior art keywords
dna
bovine
pcr
probes
control
Prior art date
Application number
PCT/EP2006/007305
Other languages
German (de)
French (fr)
Other versions
WO2007019945A3 (en
Inventor
Roger Stephan
Taurai Tasara
Original Assignee
Universität Zürich
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Universität Zürich filed Critical Universität Zürich
Publication of WO2007019945A2 publication Critical patent/WO2007019945A2/en
Publication of WO2007019945A3 publication Critical patent/WO2007019945A3/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6881—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for tissue or cell typing, e.g. human leukocyte antigen [HLA] probes

Definitions

  • the invention relates to a method and a kit for the detection of bovine tissue fractions in products of animal origin produced under decomposing conditions.
  • An essential application of the invention is the examination or certification of products for which it is to be ensured that they contain no bovine tissue components.
  • the invention relates to the study of gelatin.
  • the desire for a reliable certification of gelatin for the absence of bovine components is due to the BSE crisis.
  • the EU has issued a directive regarding the production of edible gelatine, which requires documentary evidence that the starting materials used to produce the gelatine are derived from animals suitable for human consumption.
  • This is relatively costly in the case of BSE, as bones and slaughterhouse waste from many different cattle are pooled during manufacture, which means that a corresponding number of BSE tests would need to be documented for each batch.
  • the object of the invention is to provide a detection method which also functions reliably in such products.
  • the object is achieved by a method according to claim 1 and a kit according to claim 23.
  • a DNA extract is obtained from a sample of the product.
  • the DNA extract is then processed by means of PCR, wherein the primers used in the PCR are designed so that they recognize as a target sequence a bovine-specific sequence with a length of less than 150 nucleotides. Finally, it is then checked whether an amplification has taken place during the PCR with the primers used.
  • a DNA extract is obtained from the sample to be investigated, which can be further processed by means of PCR.
  • the sample can be homogenized, for example, then incubated in the presence of a lysis buffer and / or a proteinase, in particular proteinase K, and then the DNA contained can be extracted and purified.
  • a lysis buffer and / or a proteinase in particular proteinase K
  • the DNA contained can be extracted and purified.
  • the DNA is then further extracted and purified by means of, in particular, alcoholic precipitation, if appropriate after prior precipitation of the proteins.
  • the lysate can also be applied to a DNA-binding column and the column subsequently eluted as prescribed in the kit "High Pure Template Preparation Kit Cat No. 1796 828" from Roche Diagnostics. The eluate is then further processed as a DNA extract in the PCR.
  • DNA extracts of e.g. preferably examined gelatin still contain species-specific by PCR detectable target sequences.
  • An essential aspect is that the invention uses very short target sequences, since it has been found that such short sequences are still intact after treatment under extreme conditions and are present in an amount sufficient for analysis.
  • the target sequence used is particularly preferably a boin-specific sequence which occurs several times in the genome or the mitochondrial DNA. Basically, it can be said that with the co- The number of statistical proofs increases, which can be an important argument, especially for the desired certification.
  • the work-up takes place in the presence of primers which specifically recognize the ATPase 8 subunit.
  • the ATPase 8 subunit is encoded by region 7766-7966 (SEQ ID NO 1) of bovine mitochondrial DNA.
  • SEQ ID NO 1 The entire mitochondrial genome is published under No. AF492351 in the database of EMBL-EBI.
  • primer pair having the following sequences:
  • the primer Fpc F2 corresponds to the section 7799-7823 in the mitochondrial DNA (34-58 in SEQ ID NO 1) and the region 4-24 of the primer Fpc R (SEQ ID NO 3) corresponds to Section 7898- 7918 in the mitochondrial DNA or in the section 133-154 in the ATPase 8 sequence (SEQ ID NO 1).
  • the first 3 nucleotides at the 5 'end are not complementary and have been inserted for reasons of melting behavior of the primer.
  • Target sequence primer sequence (5 ⁇ -30 position amplicon (oligonucleotides) (bp)
  • DNase 1 is added to the master mix in a particularly preferred embodiment in order to avoid potential Exclude contamination by bovine components not derived from the product. It could e.g. demonstrated that 0.2 UDNase I on 10 microliter of master mix was sufficient to exclude contaminating DNA without adversely affecting the PCR reaction.
  • a fundamental problem with PCR approaches is that, due to PCR inhibitors possibly contained in the samples examined, the reaction does not proceed or does not take place sufficiently.
  • the invention therefore provides that the PCR is carried out in the presence of an internal amplification control.
  • Suitable amplification controls may be any desired target DNA sequences (control DNA) that are appropriately designed with primers standardized and reproducible under similar conditions as the ATPase 8 subunit amplify sequences.
  • the internal amplification control is carried out in the same approach, in which the detection of the Linderspezifischen sequence is carried out.
  • the control DNA used in the invention preferably PuC 19 plasmid DNA. Details of this plasmid, in particular the sequence, are e.g. from “Yanish-Perron et al.” in “Gene 33 (1), 103-119 (1985)". PuC 19 can be obtained under No. ATCC 37254 / L09137 or from New England Biolabs (Cat. No. N3041S).
  • Suitable control primers which recognize PuC 19 may be e.g. have the following sequences:
  • Target sequence oligonucleotides sequence (5i-3 ⁇ ) position amplicon (bp)
  • PuC19 plasmid DNA PuC 19fw (SEQ ID CGG AGA CGG TCA CAG CT 49-65 400
  • the method according to the invention can use a conventional PCR by means of subsequent evaluation in the gel.
  • the work-up of the DNA extract takes place by means of real-time PCR.
  • Real-time PCR methods have been known for a long time and differ essentially from conventional PCR methods in that the PCR approach additionally contains probes which generate a changing signal correlated with the increase of amplified DNA. Furthermore, the PCR apparatus used (cycler) has a measuring device which detects the signals generated during the PCR in the approaches, so that directly, i. can still be determined during the measurement, whether an amplification of the target sequence has taken place.
  • Suitable for real-time PCR probe and cycler systems with appropriate measuring devices are offered by different manufacturers known in the art.
  • specific probes which specifically generate a signal only when amplifying bovine sequences and / or the internal control DNA sequence are particularly preferably used for detecting the amplicons generated during the PCR. It is understood that the signals generated while working up the amplification control must be differentiable in a common approach from the signals generated in amplification of the bovine sequence, which is not a problem by appropriate marker selection.
  • Specific probes typically have a portion of DNA chosen to specifically hybridize to a portion of the target DNA. The DNA segment is linked to a marker or a marker system which generates a different signal upon hybridization than in the non-hybridized state. Suitable probes have become known in the art, for example, under the term "TAQMAN probes".
  • This system uses 2 probes per target, both of which hybridize to adjacent regions of the target sequence.
  • One probe is labeled with fluorescein, the other with a fluorescent dye, e.g. LC-Red-705 or LC-Red-640 (Roche Diagnostics).
  • the fluorescein can activate the fluorescent dyes, which then generate a signal with the respective specified wavelengths 705 nm or 640 nm.
  • bovine probes with the following sequences have been found to be particularly suitable:
  • SEQ ID NO 7 (BovSP-5'LC Red 640): 5'TAT CAC AAT CCA GAA CTG ACA CCA AC 3 '
  • control DNA which can be worked up with the same primers as the ATPase 8 subunit.
  • a suitable control DNA in this context may, for example, have the following sequence:
  • SEQ ID NO 8 AT GATCTTATCA ATATTCTTGA CCCTTTTAT CATCTTTCAA CTAAAAGTTT CAAAACACAA CTTT CAGGGT
  • SEQ ID NO 8 corresponds to the region 34-153 of the bovine ATPase sequence (SEQ ID NO 1), wherein the section 67-90 in SEQ ID NO 8 was replaced by a 21 bp fragment, that of the region 355 -375 of the puC19 plasmid.
  • the main advantage of using the described control DNA according to SEQ ID NO 8 is that an amplification can be carried out with the same primers as for the bovine sequence, whereby not only a basic PCR control but also a primer control is given ,
  • control DNA according to SEQ ID 8 is used as the internal amplification control, then the further advantage is that only one control probe which binds to the PuC19 insert is required, which in turn reacts with the bovine probe according to SEQ ID NO. BovSP-3'Fluo).
  • this control probe has a sequence according to:
  • Target sequence probes oligonucleotide sequence (5-30 position de
  • the invention further relates to a kit in which the reagents required for carrying out the method are contained.
  • the kit according to the invention contains at least reagents for obtaining a DNA extract from sample material, and reagents for carrying out a PCR, in particular a real-time PCR, containing a specific for a bovine sequence primer pair, an internal amplification control and hybridizing with the bovine sequence and the internal amplification control probes each having different detectable markers.
  • Gelatin samples each weighing 500 mg, were homogenized in a Ryboly- ser (Hybaid, Ashford) in the presence of 1 ml of the lysis buffer contained in the kit and 60 ⁇ l proteinase K ( ⁇ .Smsec 1 for 45 s) and then for 30 min 70 ° C and incubated at 90 ° C for 15 minutes.
  • the genomic DNA was then treated with the appropriate column as prescribed in the kit protocol. nigt.
  • the DNA templates were then washed out with 100 ⁇ l of the elution buffer (Kit). 5 ⁇ l aliquots were then used in the PCR.
  • Real-time PCR was performed in 20 ⁇ l glass capillaries using Light Cycler 2.0 instrument (Roche Diagnostics).
  • the reaction mixture consists of QuantiTect PCR Master Mix (Qiagen), 0.5 ⁇ M of each primer (Fpc F2 / SEQ ID ID ID 1, Fpc R / SEQ NO ID 2), 0.2 ⁇ M of each probe (BovSP-3'Fluo, BovSP - 5'LC Red 640, ⁇ uC19-5'LC Red 705) and 0.008 atomol of the internal amplification control (SEQ ID NO 5).
  • Amplification started with an initial preincubation at 95 ° C for 20 minutes, followed by 55 cycles (95 ° C for 0s, 55 ° C for 30s, and 72 ° C for 30s).
  • the fluorescence was measured during the annealing phase at 55 ° C at 640 nm (channel 4) for the bovine sequence and at 705 nm (channel 6) for the amplification control.
  • the DNA was extracted and purified from mixtures (varying amounts of bovine gelatin in porcine gelatin) and the respective DNA extracts were processed by real-time PCR.
  • the results are shown in Table 4.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Analytical Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention relates to a method and a kit for detection of components of bovine tissue in products of animal origin produced in comminuting conditions, wherein a DNA extract is obtained from a sample of the product, the DNA extract is processed by means of PCR, the primer used in the PCR being designed such as to recognise a bovine-specific sequence with a length of less than 150 nucleotides and a check is carried out on whether an amplification has been carried out with the primer used during the PCR.

Description

Verfahren und Kit zur Detektion von Anteilen bovinen Gewebes in unter zersetzenden Bedingungen hergestellten Produkten tierischen Ursprungs.Method and kit for detecting bovine tissue content in products of animal origin produced under degradative conditions.
Die Erfindung bezieht sich auf ein Verfahren und einen Kit zur Detektion von Anteilen bovinen Gewebes in unter zersetzenden Bedingungen hergestellten Produkten tierischen Ursprungs.The invention relates to a method and a kit for the detection of bovine tissue fractions in products of animal origin produced under decomposing conditions.
Wesentlicher Anwendungsfall der Erfindung ist die Untersuchung bzw. Zertifizierung von Produkten, für die sichergestellt werden soll, dass sie keine Anteile bovinen Gewebes enthalten.An essential application of the invention is the examination or certification of products for which it is to be ensured that they contain no bovine tissue components.
Insbesondere bezieht sich die Erfindung auf die Untersuchung von Gelatine. Der Wunsch nach einer verläßlichen Zertifizierung von Gelatine bezüglich der Abwesenheit boviner Anteile geht auf die BSE-Krise zurück. In diesem Zusammenhang wurde z.B. von der EU eine Direktive bezüglich der Herstellung von eßbarer Gelatine erlassen, die einen dokumentarischen Nachweis vorschreibt, dass die zur Herstellung der Gelatine verwendeten Ausgangsmaterialien von Tieren stammen, die für den menschlichen Verzehr geeignet sind. Dies ist im Falle von BSE relativ aufwändig, da Knochen und Schlachtabfälle vieler unterschiedlicher Rinder bei der Herstellung gepoolt werden, was bedeutet, dass für jede Charge eine entsprechende Anzahl an BSE-Tests dokumentiert werden müsste. Hier wäre es ggf. einfacher, auf die Verwendung von Ausgangsmaterialien aus Rindern ganz zu verzichten und dies zu zertifizieren. Bislang gibt es keine verläßlichen Methoden, mit denen sich insbesondere z.B. in Gelatine die Herkunft bzw. Spezieszugehörigkeit der zur Herstellung verwendeten tierischen Gewebe bestimmen läßt. Dies ist im Wesentlichen darauf zurückzuführen, dass die extremen Temperatur- und pH-Bedingungen während der Herstellung von Gelatine die Ausgangsgewebe so weitgehend zersetzen, dass eine speziesspezifische Bestimmung nicht möglich ist.In particular, the invention relates to the study of gelatin. The desire for a reliable certification of gelatin for the absence of bovine components is due to the BSE crisis. In this context, for example, the EU has issued a directive regarding the production of edible gelatine, which requires documentary evidence that the starting materials used to produce the gelatine are derived from animals suitable for human consumption. This is relatively costly in the case of BSE, as bones and slaughterhouse waste from many different cattle are pooled during manufacture, which means that a corresponding number of BSE tests would need to be documented for each batch. Here, it may be easier to completely dispense with the use of bovine raw materials and to certify this. To date, there are no reliable methods with which, for example, in gelatine, the origin or species affiliation of the animal tissues used for the production can be determined. This is mainly due to the fact that the extreme temperature and pH conditions during the production of gelatin decompose the starting tissues to such an extent that a species-specific determination is not possible.
Aufgabe der Erfindung ist, ein auch in solchen Produkten zuverlässig funktionierendes Nachweisverfahren bereitzustellen.The object of the invention is to provide a detection method which also functions reliably in such products.
Gelöst wird die Aufgabe mit einem Verfahren gemäß Anspruch 1 sowie einem Kit gemäß Anspruch 23.The object is achieved by a method according to claim 1 and a kit according to claim 23.
Bei dem erfindungsgemäßen Verfahren wird zunächst ein DNA-Extrakt aus einer Probe des Produkts gewonnen. Der DNA-Extrakt wird dann mittels PCR aufgearbeitet, wobei die bei der PCR eingesetzten Primer so designt sind, dass sie als Targetsequenz eine bovinspezifische Sequenz mit einer Länge von weniger als 150 Nukleotiden erkennen. Abschließend wird dann geprüft, ob während der PCR mit den eingesetzten Primern eine Amplifikation stattgefunden hat.In the method according to the invention, first of all a DNA extract is obtained from a sample of the product. The DNA extract is then processed by means of PCR, wherein the primers used in the PCR are designed so that they recognize as a target sequence a bovine-specific sequence with a length of less than 150 nucleotides. Finally, it is then checked whether an amplification has taken place during the PCR with the primers used.
In einem ersten Schritt des erfindungsgemäßen Verfahrens wird wie erwähnt aus der zu untersuchenden Probe ein DNA-Extrakt gewonnen, der mittels PCR weiter aufgearbeitet werden kann.As mentioned, in a first step of the method according to the invention, a DNA extract is obtained from the sample to be investigated, which can be further processed by means of PCR.
Zur Gewinnung des DNA-Extrakts kann die Probe z.B. homogenisiert, dann in Gegenwart eines Lysis-Puffers und/oder einer Proteinase, insbesondere Proteinase K, inkubiert und dann die enthaltene DNA extrahiert und aufgereinigt werden. In einer Ausgestaltung der Erfindung ist vorgesehen, dass dann mittels insbesondere alkoholischer Fällung die DNA weiter extrahiert und aufgereinigt wird, ggf. nach vorheriger Ausfällung der Proteine.To obtain the DNA extract, the sample can be homogenized, for example, then incubated in the presence of a lysis buffer and / or a proteinase, in particular proteinase K, and then the DNA contained can be extracted and purified. In one embodiment of the invention, it is provided that the DNA is then further extracted and purified by means of, in particular, alcoholic precipitation, if appropriate after prior precipitation of the proteins.
Als besonders geeignet hat sich in diesem Zusammenhang ein Kit und das entsprechende dazugehörige Aufarbeitungsprotokoll der Firma GEN-IAL (All-tissue DNA-extraction Kit Cat. No. D0502000) gezeigt.In this context, a kit and the corresponding corresponding work-up protocol from GEN-IAL (All-tissue DNA-extraction Kit Cat No. D0502000) has proven particularly suitable.
Gemäß einer zweiten Ausgestaltung kann das Lysat auch auf eine DNA-bindende Säule gegeben und die Säule anschließend wie in dem Kit "High pure template preparation Kit Cat. No. 1796 828" der Firma Roche Diagnostics vorgeschrieben eluiert werden. Das Eluat wird dann als DNA-Extrakt in der PCR weiter verarbeitet.According to a second embodiment, the lysate can also be applied to a DNA-binding column and the column subsequently eluted as prescribed in the kit "High Pure Template Preparation Kit Cat No. 1796 828" from Roche Diagnostics. The eluate is then further processed as a DNA extract in the PCR.
Bezüglich der Details der bevorzugt eingesetzten Methoden wird auf die dem Fachmann zugänglichen Protokolle der erwähnten Kits verwiesen.With regard to the details of the methods preferably used, reference is made to the protocols of the mentioned kits which are available to the person skilled in the art.
Im Rahmen der Erfindung konnte erstmals gezeigt werden, dass DNA-Extrakte der z.B. bevorzugt untersuchten Gelatine noch speziespezifische mittels PCR nachweisbare Targetsequenzen enthalten. Ein wesentlicher Aspekt ist, dass die Erfindung sehr kurze Targetsequenzen verwendet, da wie sich gezeigt hat, solche kurzen Sequenzen nach Behandlung unter Extrembedingungen noch intakt sind und in einer für eine Analyse ausreichenden Menge vorliegen.Within the scope of the invention, it was possible for the first time to show that DNA extracts of e.g. preferably examined gelatin still contain species-specific by PCR detectable target sequences. An essential aspect is that the invention uses very short target sequences, since it has been found that such short sequences are still intact after treatment under extreme conditions and are present in an amount sufficient for analysis.
Besonders bevorzugt wird im Rahmen der Erfindung als Targetsequenz eine bo- vinspezifische Sequenz ausgewählt, die mehrfach in dem Genom oder der mitochondrialen DNA vorkommt. Grundsätzlich lässt sich sagen, dass mit der Ko- pienzahl die statistische Nachweissicherheit steigt, was insbesondere bei der gewünschten Zertifizierung ein wesentliches Argument sein kann.Within the scope of the invention, the target sequence used is particularly preferably a boin-specific sequence which occurs several times in the genome or the mitochondrial DNA. Basically, it can be said that with the co- The number of statistical proofs increases, which can be an important argument, especially for the desired certification.
In einer besonders bevorzugten Ausgestaltung ist vorgesehen, dass die Aufarbeitung in Gegenwart von Primern erfolgt, die spezifisch die ATPase 8 Untereinheit erkennen. Die ATPase 8 Untereinheit wird durch die Region 7766-7966 (SEQ ID NO 1) der bovinen mitochondrialen DNA kodiert. Das gesamte mitochondriale Genom ist unter der Nr. AF492351 in der Datenbank von EMBL-EBI veröffentlicht.In a particularly preferred embodiment, it is provided that the work-up takes place in the presence of primers which specifically recognize the ATPase 8 subunit. The ATPase 8 subunit is encoded by region 7766-7966 (SEQ ID NO 1) of bovine mitochondrial DNA. The entire mitochondrial genome is published under No. AF492351 in the database of EMBL-EBI.
Besonders bevorzugt ist ein Primerpaar mit folgenden Sequenzen:Particularly preferred is a primer pair having the following sequences:
SEQ ID NO 2 (Fpc F2): 5'ATG ATC TTA TCA ATA TTC TTG ACC C 3' und SEQ ID NO 3 (Fpc R): 5'CCT TCA AGG GGT GTT TTG TTT TAA 3'SEQ ID NO 2 (Fpc F2): 5'ATG ATC TTA TCA ATA TTC TTG ACC C 3 'and SEQ ID NO 3 (Fpc R): 5'CCT TCA AGG GGT GTT TTG TTT TAA 3'
Der Primer Fpc F2 (SEQ ID NO 2) entspricht dem Abschnitt 7799-7823 in der mitochondrialen DNA (34-58 in SEQ ID NO 1) und der Bereich 4-24 des Primers Fpc R (SEQ ID NO 3) dem Abschnitt 7898-7918 in der mitochondrialen DNA bzw. dem Abschnitt 133-154 in der ATPase 8-Sequenz (SEQ ID NO 1). Die ersten 3 Nukleotide am 5' Ende sind nicht komplementär und wurden aus Gründen des Schmelzverhaltens des Primers eingefügt.The primer Fpc F2 (SEQ ID NO 2) corresponds to the section 7799-7823 in the mitochondrial DNA (34-58 in SEQ ID NO 1) and the region 4-24 of the primer Fpc R (SEQ ID NO 3) corresponds to Section 7898- 7918 in the mitochondrial DNA or in the section 133-154 in the ATPase 8 sequence (SEQ ID NO 1). The first 3 nucleotides at the 5 'end are not complementary and have been inserted for reasons of melting behavior of the primer.
Einzelheiten der eingesetzten Primer sind in der Tabelle 1 zusammengefasst.Details of the primers used are summarized in Table 1.
Tabelle 1:Table 1:
Zielsequenz Primer Sequenz (5ϊ- 30 Position Amplikon (Oligonucleotide) (bp)Target sequence primer sequence (5ϊ-30 position amplicon (oligonucleotides) (bp)
ATPase 8 Un- Fpc F2 (SEQ ID NO 2) ATG ATC TTA TCA ATA TTC 34-58 126 tereinheit TTG ACC CATPase 8 Un- Fpc F2 (SEQ ID NO 2) ATG ATC TTA TCA ATA TTC 34-58 126 terein TTG ACC C
ATPase 8 Un- Fpc R (SEQ ID NO 3) CCT TCA AGG GGT GTT TTG 133-154 tereinheit TTT TAA Es konnte gezeigt werden, dass das beschriebene Primerpaar hochspezifisch und verläßlich Anteile bovinen Materials auch in geringsten Konzentrationen in Gelatine nachweisen konnte.ATPase 8 Un-Fpc R (SEQ ID NO 3) CCT TCA AGG GGT GTT TTG 133-154 tTT TAA It could be shown that the described primer pair was able to detect highly specific and reliable levels of bovine material in even the lowest concentrations in gelatine.
Im Hinblick auf die Tatsache, dass in den meisten PCR-Kits zur Stabilisierung der Enzyme BSA zugesetzt ist, die gegebenenfalls im Rahmen des erfindungsgemäßen Nachweises zu einem falsch positiven Nachweis führen könnte, wird in einer besonders bevorzugten Ausgestaltung dem Mastermix DNase 1 zugesetzt, um eventuelle Verunreinigungen durch nicht aus dem Produkt stammende bovine Anteile auszuschließen. Es konnte z.B. gezeigt werden, dass 0,2 UDNase I auf 10 Mikroliter Mastermix ausreichend waren, um kontaminierende DNA auszuschließen, ohne dass dadurch die PCR-Reaktion nachteilig beeinflusst wurde.In view of the fact that in most PCR kits for stabilizing the enzymes BSA is added, which could possibly lead to a false positive detection in the context of the detection according to the invention, DNase 1 is added to the master mix in a particularly preferred embodiment in order to avoid potential Exclude contamination by bovine components not derived from the product. It could e.g. demonstrated that 0.2 UDNase I on 10 microliter of master mix was sufficient to exclude contaminating DNA without adversely affecting the PCR reaction.
Falsch positive Ergebnisse können also im Rahmen der Erfindung mit großer Sicherheit ausgeschlossen werden.False positive results can thus be excluded within the scope of the invention with great certainty.
Ein weiteres Problem stellt sich jedoch mit eventuellen falsch negativen Ergebnissen.However, another problem arises with possible false negative results.
Ein grundsätzliches Problem bei PCR- Ansätzen ist, dass auf Grund eventuell in den untersuchten Proben enthaltener PCR-Inhibitoren die Reaktion nicht oder nicht ausreichend abläuft. In einer bevorzugten weiteren Ausgestaltung sieht die Erfindung daher vor, dass die PCR in Gegenwart einer internen Amplifikations- kontrolle durchgeführt wird.A fundamental problem with PCR approaches is that, due to PCR inhibitors possibly contained in the samples examined, the reaction does not proceed or does not take place sufficiently. In a preferred further embodiment, the invention therefore provides that the PCR is carried out in the presence of an internal amplification control.
Geeignete Amplifikationskontrollen können dabei beliebige Target-DNA- Sequenzen (Kontroll-DNA) sein, die sich mit entsprechend designten Primern standardisiert und reproduzierbar unter ähnlichen Bedingungen wie die ATPase 8 Untereinheit Sequenzen amplifizieren lassen.Suitable amplification controls may be any desired target DNA sequences (control DNA) that are appropriately designed with primers standardized and reproducible under similar conditions as the ATPase 8 subunit amplify sequences.
Besonders bevorzugt wird die interne Amplifikationskontrolle im gleichen Ansatz durchgeführt, in dem auch der Nachweis der linderspezifischen Sequenz erfolgt.Particularly preferably, the internal amplification control is carried out in the same approach, in which the detection of the Linderspezifischen sequence is carried out.
Als Kontroll-DNA wird im Rahmen der Erfindung bevorzugt PuC 19 Plasmid- DNA eingesetzt. Einzelheiten zu diesem Plasmid, insbesondere zu der Sequenz sind z.B. von "Yanisch-Perron et al." in "Gene 33(1), 103-119 (1985)" veröffentlicht worden. PuC 19 kann unter der Nr. ATCC 37254/L09137 oder bei New England Biolabs (Kat. Nr. N3041S) bezogen werden.The control DNA used in the invention preferably PuC 19 plasmid DNA. Details of this plasmid, in particular the sequence, are e.g. from "Yanish-Perron et al." in "Gene 33 (1), 103-119 (1985)". PuC 19 can be obtained under No. ATCC 37254 / L09137 or from New England Biolabs (Cat. No. N3041S).
Geeignete Kontroll-Primer, die PuC 19 erkennen, können z.B. die folgenden Sequenzen aufweisen:Suitable control primers which recognize PuC 19 may be e.g. have the following sequences:
SEQIDNO4: 5' CGGAGA CGGTCA CAGCT 3' SEQIDNO 5: 5' TTGCAT GCC TGC AGGT 3'SEQ ID NO 4: 5 'CGGAGA CGGTCA CAGCT 3' SEQ ID NO 5: 5 'TTGCAT GCC TGC AGGT 3'
Die genannten Primer hybridisieren mit den Abschnitten 49 -65 (SEQ ID NO 4) beziehungsweise 433-448 (SEQ ID NO 5) der genannten PuC19Plasmid-DNA. Einzelheiten der eingesetzten Primer sind in der folgenden Tabelle 2 zusammen- gefasst:The primers mentioned hybridize with the sections 49-65 (SEQ ID NO 4) or 433-448 (SEQ ID NO 5) of said PuC19 plasmid DNA. Details of the primers used are summarized in the following Table 2:
Tabelle 2:Table 2:
Zielsequenz Oligonucleotide Sequenz (5i- 3ι) Position Amplikon (bp)Target sequence oligonucleotides sequence (5i-3ι) position amplicon (bp)
PuC19 plasmid DNA PuC 19fw (SEQ ID CGG AGA CGG TCA CAG CT 49-65 400PuC19 plasmid DNA PuC 19fw (SEQ ID CGG AGA CGG TCA CAG CT 49-65 400
(accession: L09137) NO 4)(accession: L09137) NO 4)
PuC19rv (SEQ ID TTG CAT GCC TGC AGG T 433-448PuC19rv (SEQ ID TTG CAT GCC TGC AGG T 433-448
NO 5) Das erfindungsgemäße Verfahren kann eine konventionelle PCR mittels anschließender Auswertung im Gel verwenden.NO 5) The method according to the invention can use a conventional PCR by means of subsequent evaluation in the gel.
Bevorzugt ist jedoch vorgesehen, dass die Aufarbeitung des DNA-Extrakts mittels Realtime PCR erfolgt.However, it is preferably provided that the work-up of the DNA extract takes place by means of real-time PCR.
Realtime-PCR- Verfahren sind seit längerem bekannt und unterscheiden sich im wesentlichen von konventionellen PCR- Verfahren dadurch, dass in dem PCR- Ansatz zusätzlich Sonden enthalten sind, die ein mit der Zunahme von amplifi- zierter DNA korreliertes, sich veränderndes Signal erzeugen. Weiterhin weist die eingesetzte PCR- Apparatur (Cycler) eine Messeinrichtung auf, die die erzeugten Signale während der PCR in den Ansätzen erfasst, so dass unmittelbar, d.h. noch während der Messung festgestellt werden kann, ob eine Amplifikation der Target-Sequenz stattgefunden hat.Real-time PCR methods have been known for a long time and differ essentially from conventional PCR methods in that the PCR approach additionally contains probes which generate a changing signal correlated with the increase of amplified DNA. Furthermore, the PCR apparatus used (cycler) has a measuring device which detects the signals generated during the PCR in the approaches, so that directly, i. can still be determined during the measurement, whether an amplification of the target sequence has taken place.
Für Realtime-PCR geeignete Sonden- und Cyclersysteme mit entsprechenden Messeinrichtungen werden von unterschiedlichen, dem Fachmann bekannten Herstellern angeboten.Suitable for real-time PCR probe and cycler systems with appropriate measuring devices are offered by different manufacturers known in the art.
Besonders bevorzugt werden im Rahmen der Erfindung zum Nachweis der während der PCR erzeugten Amplifikate spezifische Sonden eingesetzt, die gezielt ein Signal nur bei Amplifikation von bovinen Sequenzen und/oder der internen Kontroll-DNA-Sequenz erzeugen. Es versteht sich, dass die erzeugten Signale bei gleichzeitiger Aufarbeitung der Amplifikationskontrolle in einem gemeinsamen Ansatz von den bei Amplifikation der bovinen Sequenz erzeugten Signalen differenzierbar sein müssen, was durch entsprechende Markerwahl kein Problem darstellt. Spezifische Sonden weisen in der Regel einen DNA-Abschnitt auf, der so gewählt ist, das er spezifisch mit einem Abschnitt der Target-DNA hybridisieren kann. An den DNA- Abschnitt ist ein Marker oder ein Markersystem gekoppelt, welche bei Hybridisierung ein anderes Signal erzeugen als im nichthybridisierten Zustand. Geeignete Sonden sind in der Fachwelt z.B. unter dem Begriff "TAQMAN-Sonden" bekannt geworden.Within the scope of the invention, specific probes which specifically generate a signal only when amplifying bovine sequences and / or the internal control DNA sequence are particularly preferably used for detecting the amplicons generated during the PCR. It is understood that the signals generated while working up the amplification control must be differentiable in a common approach from the signals generated in amplification of the bovine sequence, which is not a problem by appropriate marker selection. Specific probes typically have a portion of DNA chosen to specifically hybridize to a portion of the target DNA. The DNA segment is linked to a marker or a marker system which generates a different signal upon hybridization than in the non-hybridized state. Suitable probes have become known in the art, for example, under the term "TAQMAN probes".
In dem erfindungsgemäßen Verfahren wird besonders bevorzugt ein anderes, das sogenannte "Light-Cycler System" von "Roche-Diagnostics" eingesetzt. Dieses System arbeitet mit 2 Sonden pro Target, die beide mit benachbarten Bereichen der Target-Sequenz hybridisieren. Die eine Sonde ist mit Fluorescein markiert, die andere mit einem Fluoreszenzfarbstoff, z.B. LC-Red-705 oder LC-Red-640 (Roche-Diagnostics). Bei räumlicher Nähe, die sich nach Hybridisierung der beiden Sonden an der Target-DNA einstellt, kann das Fluorescein die Fluoreszenzfarbstoffe aktivieren, die dann ein Signal mit den jeweils angegebenen Wellenlängen 705 nm oder 640 nm erzeugen.In the method according to the invention, it is particularly preferred to use another, the so-called "Light Cycler System" of "Roche Diagnostics". This system uses 2 probes per target, both of which hybridize to adjacent regions of the target sequence. One probe is labeled with fluorescein, the other with a fluorescent dye, e.g. LC-Red-705 or LC-Red-640 (Roche Diagnostics). In close proximity, which occurs after hybridization of the two probes to the target DNA, the fluorescein can activate the fluorescent dyes, which then generate a signal with the respective specified wavelengths 705 nm or 640 nm.
Bei dem erfindungsgemäßen Verfahren haben sich bovine Sonden mit den folgenden Sequenzen als besonders geeignet gezeigt:In the method according to the invention bovine probes with the following sequences have been found to be particularly suitable:
SEQ ID NO 6 (BovSP-3'Fluo): 5'CAT CTT TCA ACT AAA AGT TTC AAA ACA CAA CT 3'undSEQ ID NO 6 (BovSP-3'Fluo): 5'CAT CTT TCA ACT AAA AGT TTC AAA ACA CAA CT 3'and
SEQ ID NO 7 (BovSP-5'LC Red 640): 5'TAT CAC AAT CCA GAA CTG ACA CCA AC 3'SEQ ID NO 7 (BovSP-5'LC Red 640): 5'TAT CAC AAT CCA GAA CTG ACA CCA AC 3 '
Als interne Amplifikationskontrolle wird besonders bevorzugt eine Kontroll- DNA eingesetzt, die mit denselben Primern wie die ATPase 8 Untereinheit aufgearbeitet werden kann. Eine in diesem Zusammenhang geeignete Kontroll-DNA kann z.B. folgende Sequenz aufweisen:As internal amplification control, it is particularly preferable to use a control DNA which can be worked up with the same primers as the ATPase 8 subunit. A suitable control DNA in this context may, for example, have the following sequence:
SEQ ID NO 8: AT GATCTTATCA ATATTCTTGA CCCTTTTTAT CATCTTTCAA CTAAAAGTTT CAAAACACAA CTTT CAGGGTSEQ ID NO 8: AT GATCTTATCA ATATTCTTGA CCCTTTTAT CATCTTTCAA CTAAAAGTTT CAAAACACAA CTTT CAGGGT
TTTCCCAGTCACGAC CAAAAATATTA AAACAAAACA CCCCTTGATTTCCCAGTCACGAC CAAAATATTA AAACAAAACA CCCCTTGA
Die gezeigte Sequenz (SEQ ID NO 8) entspricht der Region 34-153 der bovinen ATPase Sequenz (SEQ ID NO 1), wobei der Abschnitt 67-90 in SEQ ID NO 8 ersetzt wurde durch ein 21 bp großes Fragment, das der Region 355-375 des puC19 Plasmids entspricht.The sequence shown (SEQ ID NO 8) corresponds to the region 34-153 of the bovine ATPase sequence (SEQ ID NO 1), wherein the section 67-90 in SEQ ID NO 8 was replaced by a 21 bp fragment, that of the region 355 -375 of the puC19 plasmid.
Der wesentliche Vorteil bei der Verwendung der beschriebenen Kontroll-DNA gemäß SEQ ID NO 8 besteht darin, dass eine Amplifizierung mit denselben Primern erfolgen kann wie für die bovine Sequenz, wodurch nicht nur eine grundsätzliche PCR-Kontrolle sondern zusätzlich auch eine Primer-Kontrolle gegeben ist.The main advantage of using the described control DNA according to SEQ ID NO 8 is that an amplification can be carried out with the same primers as for the bovine sequence, whereby not only a basic PCR control but also a primer control is given ,
Wird als interne Amplifikationskontrolle die oben beschriebene Kontroll-DNA gemäß SEQ ID 8 eingesetzt, so ergibt sich als weiterer Vorteil, dass nur eine an das PuC19-Insert bindende Kontroll-Sonde erforderlich ist, die ihrerseits mit der bovinen Sonde gemäß SEQ ID NO 6 (BovSP-3'Fluo) zusammenwirkt.If the above-described control DNA according to SEQ ID 8 is used as the internal amplification control, then the further advantage is that only one control probe which binds to the PuC19 insert is required, which in turn reacts with the bovine probe according to SEQ ID NO. BovSP-3'Fluo).
Diese Kontroll-Sonde hat in einer bevorzugten Ausgestaltung eine Sequenz gemäß:In a preferred embodiment, this control probe has a sequence according to:
SEQ ID NO 9 (PuC 19-5'LC Red 705): 5' CAG GGT TTT CCC AGT CAC GAC 3'SEQ ID NO 9 (PuC 19-5'LC Red 705): 5 'CAG GGT TTT CCC AGT CAC GAC 3'
Einzelheiten der erwähnten Sonden sind in Tabelle 3 zusammengefasst: Tabelle 3:Details of the probes mentioned are summarized in Table 3: Table 3:
Zielsequenz Sonden Oligonucleoti- Sequenz (5i- 30 Position deTarget sequence probes oligonucleotide sequence (5-30 position de
ATPase 8 Unterein- BovSp-3"Fluo (SEQ ID CATCTTTCAACTAAAAGTTTCAAAAC 7831- heit NO 6) ACAACT 7862ATPase 8 subunit BovSp-3 "Fluo (SEQ ID CATCTTTCAACTAAAAGTTTCAAAAC 7831- NO 6) ACAACT 7862
ATPase 8 Unterein- BovSp-5"LC Red 640 TATCACAATCCAGAACTGACACCAAC 7865- heit (SEQ ID NO 7) 7890ATPase 8 subunit BovSp-5 "LC Red 640 TATCACAATCCAGAACTGACACCAAC 7865 (SEQ ID NO 7) 7890
SEQ ID NO 5 PuClQ-S1LC Red 705 CAGGGTTTTCCCAGTCACGAC (SEQ ID NO 8)SEQ ID NO 5 PuClQ-S 1 LC Red 705 CAGGGTTTTCCCAGTCACGAC (SEQ ID NO 8)
Die Erfindung betrifft weiterhin ein Kit, in dem die zur Durchführung des Verfahrens erforderlichen Reagenzien enthalten sind.The invention further relates to a kit in which the reagents required for carrying out the method are contained.
Der erfindungsgemäße Kit enthält mindestens Reagenzien zur Gewinnung eines DNA-Extrakts aus Probematerial, und Reagenzien zur Durchführung einer PCR, insbesondere einer Realtime PCR, enthaltend ein für eine bovine Sequenz spezifisches Primerpaar, eine interne Amplifikationskontrolle sowie mit der bovinen Sequenz und der internen Amplifikationskontrolle hybridisierende Sonden, die jeweils unterschiedliche detektierbare Marker aufweisen.The kit according to the invention contains at least reagents for obtaining a DNA extract from sample material, and reagents for carrying out a PCR, in particular a real-time PCR, containing a specific for a bovine sequence primer pair, an internal amplification control and hybridizing with the bovine sequence and the internal amplification control probes each having different detectable markers.
Im Folgenden soll die Erfindung anhand von Beispielen näher erläutert werden.In the following, the invention will be explained in more detail by way of examples.
Beispiel 1example 1
Probenbehandlung und DNA-Extraktion unter Verwendung des "Qiagen tissue extraction kits" (Qiagen AG, Schweiz)Sample treatment and DNA extraction using the Qiagen tissue extraction kit (Qiagen AG, Switzerland)
Gelatineproben mit jeweils einem Gewicht von 500 mg wurden in einem Ryboly- ser (Hybaid, Ashford) in Gegenwart von 1 ml des in dem Kit enthaltenen Lysis- Puffers und 60μl Proteinase K homogenisiert (ό.Smsec 1 für 45s) und dann 30 min bei 70C° und 15 min bei 90C° inkubiert. Die genomische DNA wurde dann wie in dem Kit-Protokoll vorgeschrieben mit der vorgesehenen Säule aufgerei- nigt. Die DNA Templates wurden dann mit lOOμl des Elutionspuffers (Kit) ausgewaschen. 5μl Aliquots wurden anschließend in die PCR eingesetzt.Gelatin samples, each weighing 500 mg, were homogenized in a Ryboly- ser (Hybaid, Ashford) in the presence of 1 ml of the lysis buffer contained in the kit and 60 μl proteinase K (ό.Smsec 1 for 45 s) and then for 30 min 70 ° C and incubated at 90 ° C for 15 minutes. The genomic DNA was then treated with the appropriate column as prescribed in the kit protocol. nigt. The DNA templates were then washed out with 100 μl of the elution buffer (Kit). 5 μl aliquots were then used in the PCR.
Beispiel 2 PCR Konditionen:Example 2 PCR conditions:
Die Realtime PCR wurde in 20 μl Glaskapillaren mittels Light Cycler 2.0 Instrument (Roche Diagnostics) durchgeführt. Das Reaktionsgemisch besteht aus QuantiTect PCR Master Mix (Qiagen), 0,5μM von jedem Primer (Fpc F2/SEQ NO ID 1, Fpc R/SEQ NO ID 2), 0,2μM von jeder Sonde (BovSP-3'Fluo, BovSP- 5'LC Red 640, ρuC19-5'LC Red 705) und 0,008 atomol der internen Amplifikati- onskontrolle (SEQ ID NO 5). Die Amplifikation startete mit einer initialen Vorinkubation bei 95°C für 20 Minuten, gefolgt von 55 Zyklen (95°C für 0s, 55°C für 30s und 72°C für 30s). Die Fluoreszenzmessung erfolgte während der Annea- ling-Phase bei 55C° bei 640nm (Kanal 4) für die bovine Sequenz und bei 705 nm (Kanal 6) für die Amplifikationskontrolle.Real-time PCR was performed in 20 μl glass capillaries using Light Cycler 2.0 instrument (Roche Diagnostics). The reaction mixture consists of QuantiTect PCR Master Mix (Qiagen), 0.5 μM of each primer (Fpc F2 / SEQ ID ID 1, Fpc R / SEQ NO ID 2), 0.2 μM of each probe (BovSP-3'Fluo, BovSP - 5'LC Red 640, ρuC19-5'LC Red 705) and 0.008 atomol of the internal amplification control (SEQ ID NO 5). Amplification started with an initial preincubation at 95 ° C for 20 minutes, followed by 55 cycles (95 ° C for 0s, 55 ° C for 30s, and 72 ° C for 30s). The fluorescence was measured during the annealing phase at 55 ° C at 640 nm (channel 4) for the bovine sequence and at 705 nm (channel 6) for the amplification control.
Beispiel 3Example 3
Gemäß obiger Beispiele wurde die DNA aus Gemischen (unterschiedliche mengenmäßige Anteile von Rindergelatine in Schweinegelatine) extrahiert und aufgereinigt und die jeweiligen DNA-Extrakte wurden mittels Realtime PCR aufgearbeitet. Die Ergebnisse sind in Tabelle 4 wiedergegeben.According to the above examples, the DNA was extracted and purified from mixtures (varying amounts of bovine gelatin in porcine gelatin) and the respective DNA extracts were processed by real-time PCR. The results are shown in Table 4.
Tabelle 4:Table 4:
Hintergrund versetzt mit PCR LC-PCRBackground offset with PCR LC-PCR
Gewebe Gelatine Gewebe GelatineTissue gelatin tissue gelatin
Schwein Rind 0.01% 0.1% 0.0001% 0.001% Fisch Rind 0.01% 0.1% 0.0001% 0.001% Geflügel Rind 0.01% n/t1 0.0001% n/t2 n/t = nicht getestet Mit dem erfindungsgemäßen Verfahren lassen sich demzufolge mittels PCR bis zu 0,01% bovine Anteile in Geweben bzw. 0,1% in Gelatineproben nachweisen, die zusätzlich Schwein, Fisch oder Geflügel enthalten. Wird mittels LC-PCR gemessen, so steigt die Nachweisempfindlichkeit um einen Faktor 10. Pig Beef 0.01% 0.1% 0.0001% 0.001% Fish Beef 0.01% 0.1% 0.0001% 0.001% Poultry Beef 0.01% n / t 1 0.0001% n / t 2 n / t = not tested Accordingly, with the method according to the invention, it is possible by PCR to detect up to 0.01% of bovine components in tissues or 0.1% in gelatin samples which additionally contain pork, fish or poultry. If measured by LC-PCR, the detection sensitivity increases by a factor of 10.

Claims

Verfahren und Kit zur Detektion von Anteilen bovinen Gewebes in unter zersetzenden Bedingungen hergestellten Produkten tierischen Ursprungs.Patentansprüche: Method and kit for the detection of bovine tissue fractions in products of animal origin produced under decomposing conditions.Patent claims:
1. Verfahren zur Detektion von Anteilen bovinen Gewebes in unter zersetzenden Bedingungen hergestellten Produkten tierischen Ursprungs, bei dem ein DNA-Extrakt aus einer Probe des Produkts gewonnen wird, der DNA-Extrakt mittels PCR aufgearbeitet wird, wobei die bei der PCR eingesetzten Primer so designt sind, dass sie eine bovinspezifische Sequenz mit einer Länge von weniger als 150 Nukleotiden erkennen, und geprüft wird, ob während der PCR mit den eingesetzten Primern eine Amplifikation stattgefunden hat.1. A method for detecting bovine tissue components in products of animal origin produced under decomposing conditions, in which a DNA extract is obtained from a sample of the product, the DNA extract is processed by PCR, the primers used in the PCR being so designed are that they recognize a bovine-specific sequence with a length of less than 150 nucleotides, and it is checked whether an amplification has taken place during the PCR with the primers used.
2. Verfahren nach einem der Anspruch 1, dadurch gekennzeichnet, dass es sich bei dem Produkt um Gelatine handelt.2. The method according to any one of claim 1, characterized in that it is the product is gelatin.
3. Verfahren nach einem der Ansprüche 1 oder 2, dadurch gekennzeichnet, dass zur Gewinnung des DNA-Extrakts die Probe homogenisiert, dann in Gegenwart eines Lysis-Puffers und/oder einer Proteinase, insbesondere Proteinase K, inkubiert und dann die enthaltene DNA extrahiert und aufgereinigt wird.3. The method according to any one of claims 1 or 2, characterized in that for obtaining the DNA extract, the sample homogenized, then incubated in the presence of a lysis buffer and / or a proteinase, in particular proteinase K, and then extracted the contained DNA and is cleaned up.
4. Verfahren nach Anspruch 3, dadurch gekennzeichnet, dass die Extraktion der DNA mittels alkoholischer Fällung erfolgt. 4. The method according to claim 3, characterized in that the extraction of the DNA by means of alcoholic precipitation.
5. Verfahren nach Anspruch 4, dadurch gekennzeichnet, dass die Extraktion der DNA mittels einer DNA-bindenden Säule erfolgt.5. The method according to claim 4, characterized in that the extraction of the DNA by means of a DNA-binding column.
6. Verfahren nach einem der vorhergehenden Ansprüche, dadurch gekennzeichnet, dass die von den Primern erkannte bovinspezifische Sequenz mehrfach in dem Genom oder der mitochondrialen DNA vorkommt.6. The method according to any one of the preceding claims, characterized in that the bovine-specific sequence recognized by the primers occurs multiple times in the genome or the mitochondrial DNA.
7. Verfahren nach Anspruch 6, dadurch gekennzeichnet, dass die Primer Sequenzabschnitte erkennen, die spezifisch für ATPase 8 Untereinheit von Rindern sind.7. The method according to claim 6, characterized in that the primers recognize sequence sections which are specific for ATPase 8 subunit of cattle.
8. Verfahren nach Anspruch 7 dadurch gekennzeichnet, dass die Primer- Sequenzen SEQ ID NO 1 und SEQ ID NO 2 entsprechen.8. The method according to claim 7, characterized in that the primer sequences SEQ ID NO 1 and SEQ ID NO 2 correspond.
9. Verfahren nach einem der vorhergehenden Ansprüche, dadurch gekennzeichnet, dass die PCR in Gegenwart einer internen Amplifikationskontrolle (Kontroll-DNA) durchgeführt wird.9. The method according to any one of the preceding claims, characterized in that the PCR is carried out in the presence of an internal amplification control (control DNA).
10. Verfahren nach Anspruch 9, dadurch gekennzeichnet, dass das Plasmid PuC 19 als Amplifikationskontrolle dient.10. The method according to claim 9, characterized in that the plasmid PuC 19 serves as an amplification control.
11. Verfahren nach Anspruch 9, dadurch gekennzeichnet, dass ein in das Plasmid PuC 19 klonierter Sequenzabschnitt als Kontroll DNA dient.11. The method according to claim 9, characterized in that a cloned into the plasmid PuC 19 sequence section serves as a control DNA.
12. Verfahren nach Anspruch 11, dadurch gekennzeichnet, dass die Kontroll DNA so designt ist, dass sie von denselben Primern erkannt wird, die auch die bovine DNA erkennen 12. The method according to claim 11, characterized in that the control DNA is designed so that it is recognized by the same primers that recognize the bovine DNA
13. Verfahren nach Anspruch 12, dadurch gekennzeichnet, dass die Kontroll DNA eine Sequenz gemäß SEQ ID NO 5 aufweist.13. The method according to claim 12, characterized in that the control DNA has a sequence according to SEQ ID NO 5.
14. Verfahren nach einem der vorhergehenden Ansprüche, dadurch gekennzeichnet, dass die PCR in Gegenwart von Sonden durchgeführt wird, die Signale mit von der Menge an amplifizierter DNA abhängiger Stärke erzeugen, und die erzeugten Signale kontinuierlich oder zu unterschiedlichen Zeitpunkten während der PCR gemessen werden.14. The method according to any one of the preceding claims, characterized in that the PCR is carried out in the presence of probes which generate signals with dependent on the amount of amplified DNA starch, and the generated signals are measured continuously or at different times during the PCR.
15. Verfahren nach Anspruch 14, dadurch gekennzeichnet, dass Sonden eingesetzt werden, die einen mit bovinspezifische DNA-Sequenzabschnitte (bovine Sonden) und/oder Kontroll-DNA-Gensequenzen (Kontroll-Sonden) hybridisierenden DNA- Abschnitt aufweisen und einen mit dem DNA- Abschnitt gekoppelten Marker, der im hybridisierten Zustand des DNA-Abschnitts ein anderes Signal abgibt als im nicht hybridisierten Zustand.15. The method according to claim 14, characterized in that probes are used which have a bovine-specific DNA sequence sections (bovine probes) and / or control DNA gene sequences (control probes) hybridizing DNA section and one with the DNA Section coupled marker that emits a different signal in the hybridized state of the DNA segment than in the unhybridized state.
16. Verfahren nach Anspruch 15, dadurch gekennzeichnet, dass zwei bovine Sonden mit zusammenwirkenden Markern eingesetzt werden, die bei benachbarter Hybridisierung an der bovinspezifischen Sequenz ein Signal erzeugen.16. The method according to claim 15, characterized in that two bovine probes are used with cooperating markers which generate a signal upon adjacent hybridization to the bovine-specific sequence.
17. Verfahren nach Anspruch 16, dadurch gekennzeichnet, dass die DNA- Abschnitte der beiden bovinspezifischen Sonden Sequenzen gemäß SEQ ID NO 6 und SEQ ID NO 7 aufweisen.17. The method according to claim 16, characterized in that the DNA sections of the two bovine-specific probes sequences according to SEQ ID NO 6 and SEQ ID NO 7 have.
18. Verfahren nach einem der Ansprüche 15 bis 17, dadurch gekennzeichnet, dass zwei Kontroll-Sonden mit zusammenwirkenden Markern eingesetzt werden, die bei benachbarter Hybridisierung an der Kontroll-DNA ein Signal erzeugen. 18. The method according to any one of claims 15 to 17, characterized in that two control probes are used with cooperating markers which generate a signal upon adjacent hybridization to the control DNA.
19. Verfahren nach Anspruch 18, dadurch gekennzeichnet, dass eine der Kontrollsonden mit einer der bovinen Sonden identisch ist.19. The method according to claim 18, characterized in that one of the control probes with one of the bovine probes is identical.
20. Verfahren nach Anspruch 19, dadurch gekennzeichnet, dass der DNA- Abschnitt der anderen Kontrollsonde eine Sequenz gemäß SEQ ID NO 8 aufweist.20. The method according to claim 19, characterized in that the DNA portion of the other control probe has a sequence according to SEQ ID NO 8.
21. Verfahren nach einem der Ansprüche 15-20, dadurch gekennzeichnet, dass die mit den DNA- Abschnitten gekoppelten Marker von bovinen Sonden und die von Kontroll-Sonden voneinander differenzierbare Signale erzeugen.21. The method according to any one of claims 15-20, characterized in that the coupled with the DNA sections markers of bovine probes and generate the control probes from each other differentiable signals.
22. Verfahren nach Anspruch 21, dadurch gekennzeichnet, dass die mit den DNA- Abschnitten gekoppelten Marker Fluoreszenzfarbstoffe sind.22. The method according to claim 21, characterized in that the coupled with the DNA segments markers are fluorescent dyes.
23. Kit zur Durchführung des Verfahrens gemäß einem der vorhergehenden Ansprüche, mit23. Kit for carrying out the method according to one of the preceding claims, with
Reagenzien zur Gewinnung eines DNA-Extrakts aus Proben, und Reagenzien zur Durchführung einer PCR, insbesondere einer Realtime PCR, enthaltend ein für eine bovine Sequenz spezifisches Primerpaar, eine interne Amplifikationskontrolle sowie mit der bovinen Sequenz und der internen Amplifikationskontrolle hybridisierende Sonden, die jeweils unterschiedliche detektierbare Marker aufweisen. Reagents for obtaining a DNA extract from samples, and reagents for performing a PCR, in particular a real-time PCR, containing a specific for a bovine sequence primer pair, an internal amplification control and hybridizing with the bovine sequence and the internal amplification control probes, each of which different detectable Have marker.
PCT/EP2006/007305 2005-08-12 2006-07-25 Method and kit for detection of components of bovine tissue in products of animal origin produced in comminuting conditions WO2007019945A2 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DE200510038214 DE102005038214A1 (en) 2005-08-12 2005-08-12 Method and kit for detecting bovine tissue content in products of animal origin produced under degradative conditions
DE102005038214.2 2005-08-12

Publications (2)

Publication Number Publication Date
WO2007019945A2 true WO2007019945A2 (en) 2007-02-22
WO2007019945A3 WO2007019945A3 (en) 2007-07-12

Family

ID=37681100

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2006/007305 WO2007019945A2 (en) 2005-08-12 2006-07-25 Method and kit for detection of components of bovine tissue in products of animal origin produced in comminuting conditions

Country Status (2)

Country Link
DE (1) DE102005038214A1 (en)
WO (1) WO2007019945A2 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106987647A (en) * 2017-05-25 2017-07-28 上海瑞丰农业科技有限公司 A kind of RPA primers, kit and detection method for detecting pig derived component

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2003164287A (en) * 2001-11-30 2003-06-10 Fertilizer & Feed Inspection Station Primer sequence
US6756495B1 (en) * 1997-05-05 2004-06-29 Centre National De La Recherche Scientifique Method for detecting the presence of biological matters of bovine origin, and oligonucleotides for its implementation

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8158772B2 (en) * 2004-04-16 2012-04-17 National Institute Of Agrobiological Sciences Oligonucleotide sequences that identify species of animal

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6756495B1 (en) * 1997-05-05 2004-06-29 Centre National De La Recherche Scientifique Method for detecting the presence of biological matters of bovine origin, and oligonucleotides for its implementation
JP2003164287A (en) * 2001-11-30 2003-06-10 Fertilizer & Feed Inspection Station Primer sequence

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
AU - Tasara, T. and Stephan, R. PGF - (Poster NO: 54 of conference / meeting) PD - 28.09. - 01.10.2004 PDY - 2004 PDM - 01.10.2004 CONF- 45. AT des Arbeitsgebietes "Lebensmittelhygiene", Teil 2 - Poster ISBN- 3-938026-37-5 PUBP- Garmisch-Partenkirchen XP008077333 *
CASTELLO ANNA ET AL: "Identification of bovine material in porcine spray-dried blood derivatives using the Polymerase Chain Reaction technique" BIOTECHNOLOGIE AGRONOMIE SOCIETE ET ENVIRONNEMENT, Bd. 8, Nr. 4, 2004, Seiten 267-273, XP008077375 ISSN: 1370-6233 *
KRCMAR P ET AL: "IDENTIFICATION OF BOVINE-SPECIFIC DNA IN FEEDSTUFFS" JOURNAL OF FOOD PROTECTION, DES MOINES, IO, US, Bd. 64, Nr. 1, Januar 2001 (2001-01), Seiten 117-119, XP009014319 ISSN: 0362-028X *
LAHIFF S ET AL: "Real-time polymerase chain reaction detection of bovine DNA in meat and bone meal samples." JOURNAL OF FOOD PROTECTION JUL 2002, Bd. 65, Nr. 7, Juli 2002 (2002-07), Seiten 1158-1165, XP008077372 ISSN: 0362-028X *
STEFANO BELLORINI ET AL: "Discriminating animal fats and their origins: assessing the potentials of Fourier transform infrared spectroscopy, gas chromatography, immunoassay and polymerase chain reaction techniques" ANALYTICAL AND BIOANALYTICAL CHEMISTRY, SPRINGER-VERLAG, BE, Bd. 382, Nr. 4, 1. Juni 2005 (2005-06-01), Seiten 1073-1083, XP019327417 ISSN: 1618-2650 & GIZZI G ET AL: "An overview of tests for animal tissues in feeds applied in response to public health concerns regarding bovine spongiform encephalopathy" REVUE SCIENTIFIQUE ET TECHNIQUE - OFFICE INTERNATIONAL DES PIZOOTIES / SCIENTIFIC AND TECHNICAL REVIEW - INTERNATIONAL OFFICE OF EPIZOOTICS, OFFICE INTERNATIONAL DES EPIZOOTIES, PARIS, FR, Bd. 22, Nr. 1, April 2003 (2003-04), Seiten 311-331, XP002358770 ISSN: 0253-1933 *
TARTAGLIA MARCO ET AL: "Detection of bovine mitochondrial DNA in ruminant feeds: A molecular approach to test for the presence of bovine-derived materials" JOURNAL OF FOOD PROTECTION, Bd. 61, Nr. 5, Mai 1998 (1998-05), Seiten 513-518, XP001153765 ISSN: 0362-028X *
TASARA TAURAI ET AL: "Conventional and real-time PCR-based approaches for molecular detection and quantitation of bovine species material in edible gelatin" JOURNAL OF FOOD PROTECTION, Bd. 68, Nr. 11, November 2005 (2005-11), Seiten 2420-2426, XP008077373 ISSN: 0362-028X *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106987647A (en) * 2017-05-25 2017-07-28 上海瑞丰农业科技有限公司 A kind of RPA primers, kit and detection method for detecting pig derived component

Also Published As

Publication number Publication date
WO2007019945A3 (en) 2007-07-12
DE102005038214A1 (en) 2007-02-15

Similar Documents

Publication Publication Date Title
EP0438512B1 (en) Process for analysing length polymorphisms in dna domains
DE69233458T2 (en) NUCLEIC ACIDIFYING BY POLYMERASE EXTENSION OF OLIGONUCLEOTIDES USING TERMINATOR MIXTURES
DE69029105T2 (en) Rapid method for the detection and / or identification of a single base in a nucleic acid sequence and its uses
DE10061348C2 (en) Method for the quantification of cytosine methylations in complex amplified genomic DNA
DE69308381T2 (en) Probes for mycobacteria
EP0714988B1 (en) Method for quantifying nucleic acids
DE69003477T2 (en) Methods for the detection of nucleic acids.
DE69917303T2 (en) Genomic multi-loci analysis by a method of improved cyclic sequencing
DE60030811T2 (en) Method for the amplification of RNA
DE112013004650T5 (en) Multiplex pyrosequencing using non-interfering, noise-blocking polynucleotide identification tags
WO1993024652A1 (en) Process for preparing and hybridizing specific probes
EP3488012B1 (en) Dna probes for in situ hybridization on chromosomes
DE3838269A1 (en) IDENTIFYING HUMAN PAPILLOMAVIRUS DNA AND ITS EXPRESSION IN ZERVIX SLICES
WO2006074878A2 (en) Method and kit for detecting mycobacterium avium subsp. paratuberculosis (map) in samples of faeces, body tissues or milk
EP1389242B1 (en) Detecting microorganisms of the yersinia pestis/yersinia pseudotuberculosis species and/or differentiating between yersinia pestis and yersinia pseudotuberculosis
DE69121791T2 (en) Procedure for the quantitative determination of DNA sequences
WO2004044238A1 (en) Agents and methods for detecting human adenoviruses
DE69823346T2 (en) METHOD FOR DETECTING AND IDENTIFYING BIOLOGICAL SUSPENSIONS FROM THE BEE UNDER USE OF OLIGON NUCLEOTIDES
WO2008119332A2 (en) Method for the detection of paratuberculosis
WO2007019945A2 (en) Method and kit for detection of components of bovine tissue in products of animal origin produced in comminuting conditions
DE102017124998B3 (en) Method and device for determining the blood type of a cat in the AB blood group system
DE69533670T2 (en) METHOD FOR REDUCING BACKGROUND SIGNALS IN DNA REPLICATION / DETECTION TESTS
DE60116500T2 (en) DNA / RNA IMMERSION MEDIUM AND METHOD OF USE
EP1702078B1 (en) Animal species-specific and quantitative detection of central nervous system tissue in meat and meat products
DE20315159U1 (en) Kit for diagnostic detection of severe acute respiratory syndrome-associated virus, comprises primers and probes for a real-time reverse transcription polymerase chain reaction

Legal Events

Date Code Title Description
NENP Non-entry into the national phase

Ref country code: DE

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 06776388

Country of ref document: EP

Kind code of ref document: A2

122 Ep: pct application non-entry in european phase

Ref document number: 06776388

Country of ref document: EP

Kind code of ref document: A2