WO2007008309A2 - Stem and progenitor cell expansion by evi, evi-like genes and setbp1 - Google Patents

Stem and progenitor cell expansion by evi, evi-like genes and setbp1 Download PDF

Info

Publication number
WO2007008309A2
WO2007008309A2 PCT/US2006/021413 US2006021413W WO2007008309A2 WO 2007008309 A2 WO2007008309 A2 WO 2007008309A2 US 2006021413 W US2006021413 W US 2006021413W WO 2007008309 A2 WO2007008309 A2 WO 2007008309A2
Authority
WO
WIPO (PCT)
Prior art keywords
cell
cells
gene
nucleic acid
patient
Prior art date
Application number
PCT/US2006/021413
Other languages
French (fr)
Other versions
WO2007008309A3 (en
Inventor
Christof Von Kalle
Manfred Schmidt
Manuel Grez
Original Assignee
Children's Hospital Medical Center
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Children's Hospital Medical Center filed Critical Children's Hospital Medical Center
Publication of WO2007008309A2 publication Critical patent/WO2007008309A2/en
Publication of WO2007008309A3 publication Critical patent/WO2007008309A3/en
Priority to US11/948,920 priority Critical patent/US20090028836A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0634—Cells from the blood or the immune system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/998—Proteins not provided for elsewhere
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00—Genetically modified cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2799/00—Uses of viruses
    • C12N2799/02—Uses of viruses as vector
    • C12N2799/021—Uses of viruses as vector for the expression of a heterologous nucleic acid
    • C12N2799/027—Uses of viruses as vector for the expression of a heterologous nucleic acid where the vector is derived from a retrovirus

Definitions

  • the invention relates to the field of cell biology and gene therapy.
  • the invention relates to methods of increasing cell proliferation in vivo or in culture by modulating expression of certain regulatory genes.
  • Retroviral vectors for example, have been successfully used in clinical gene therapy trials to treat severe combined immunodeficiencies (SCID), where gene correction conferred a selective advantage to lymphocytes (Cavazzana-Calvo, et al. (2000) Science 288:669-672; Aiuti, et al. (2002) Science 296:2410-2413; Gaspar, et al. (2004) Lancet 364:2181-2187, each of the foregoing which is hereby incorporated by reference in its entirety).
  • SCID severe combined immunodeficiencies
  • human gene therapy has been less effective (Kohn, et al. (1998) Nature Med. 4:775-780; Malech, et al. (1997) Proc. Natl. Acad. Sci. U.S.A. 94:12133-12138, each of the foregoing which is hereby incorporated by reference in its entirety).
  • a method of increasing cell proliferation by modulating levels of EVI and related genes is provided.
  • Activation of EVI-1, PRDMl 6, or SETBP1 can increase the proliferation rate, self renewal and/or in vitro and/or in vivo survival and/or engraftment of human cells, either in vitro or in vivo.
  • the gene modulation can be performed by various means, including traditional cloning methods and retroviral-based gene activation methods.
  • the method can also be used to more efficiently deliver gene-corrected cells to a patient in need of treatment.
  • a method of expanding cells is provided, by obtaining at least one cell from a patient, transfecting, infecting or transducing said cell with a retroviral or nonintegrating vector, such that cell entry and/ or integration of the vector promotes proliferation, persistence, or selective advantage of the cell, allowing the transfected cell to proliferate, reinfusing a plurality of proliferated transfected cells into said patient, and allowing said proliferated cells to expand further in the patient.
  • the transfected cell can have characteristics of a cell such as, for example, a hematopoietic progenitor cell, a hematopoietic stem cell, or a stem cell.
  • the method can be used to treat a patient with a hematopoietic or other treatable disease.
  • the vector can also have a sequence for correction or modification of a defective or deleterious gene.
  • a method of increasing cell proliferation in a mammalian cell by obtaining a cell, contacting the cell with a nucleic acid sequence encoding a protein selected from the group consisting of EVI-1, PRDMl 6, SETBP1, and a fragment thereof, allowing said nucleic acid to enter the cell, and allowing said cell to proliferate, where the cell having the nucleic acid proliferates at an increased rate compared to a cell that has not been contacted with the nucleic acid sequence.
  • the proliferation can occur, for example, in a cell culture, ex vivo, or in vivo.
  • the nucleic acid can integrate, for example, into the chromosomal DNA.
  • the nucleic acid can be present, for example, in the cytoplasm of the cell.
  • the nucleic acid can be operably linked to a promoter.
  • the nucleic acid can be constitutively expressed.
  • the expression of the nucleic acid can be inducible, for example, by an exogenously added agent.
  • the nucleic acid can be present in a vector, such as, for example, a viral vector.
  • the nucleic acid can be expressed for a number of division cycles such as, for example, about 1, 3, 5, 8, 10, 13, 17, or 20 division cycles, then expression can decrease or stop thereafter.
  • the cell can have characteristics of a cell selected from the group consisting of a hematopoietic stem cell, hematopoietic progenitor cell, a stem cell, an embryonic stem cell, an adult stem cell, a multipotent stem cell, and a myelopoietic stem cell.
  • a method of expansion of a gene-corrected cell by obtaining a cell in need of gene correction, transfecting the cell with a functional copy of a the gene in need of correction, transfecting the cell with a copy of a nucleic acid encoding a polypeptide sequence selected from the group consisting of EVI-1, PRDM 16, SETBP1, and a fragment thereof; and allowing the cell to proliferate in culture.
  • a method of forming a bodily tissue having gene corrected cells is provided, by obtaining a cell in need of gene correction, transfecting the cell with a functional copy of a the gene in need of correction, transfecting the cell with a copy of a nucleic acid encoding a polypeptide sequence selected from the group consisting of EVI-1, PRDMl 6, SETBP1, and a fragment thereof, allowing the cell to proliferate in culture, and treating the cell culture to allow formation of a bodily tissue.
  • a method of identifying a gene is provided, the modulation of which increases the proliferation rate of a cell, by obtaining a sample of cells from a patient having previously received a therapeutic transfection with a nucleic acid sequence, identifying positions of nucleic acid insertion in the cells from the sample, identifying a favorable insertion site based upon disproportional representation of the site in the population of transfected cells, and identifying a gene associated with the insertion site.
  • a nucleic acid integration region is provided, that, when insertionally modulated, results in increased hematopoietic cell proliferation, as is selected from the EVI-1 gene, the PRDM 16 gene, and the SETBP1 gene.
  • a nucleic acid sequence whose modulation of expression is associated with the increased proliferation of hematopoietic cells is provided, selected from the following group: MGC 10731, PADI4, CDA, CDW52, ZBTB8, AK2, FLJ32112, TACSTD2, FLJ13150, MGC24133, NOTCH2, NOHMA, EST1B, PBXl, PLA2G4A, HRPT2, ATP6V1G3, PTPRC, NUCKS, CABC1, LOC339789, PRKCE, AFTIPHILIN, NAGK, MARCH7, DHRS9, PRKRA, SESTD1, MGC42174, CMKOR1, TBC1D5, THRB, MAP4, IFRD2, ARHGEF3, FOXP1, ZBTB20, EAF2, MGLL, PLXND1, SLC9A9, SELT, CCNLl, MDS1, BCL6, MIST, STM2, TEC,
  • a method of identifying a favorable insertion site of a nucleic acid sequence in a proliferating cell culture by transfecting a cell sample with a nucleic acid sequence, allowing cell proliferation to occur, determining at least one main insertion site of the nucleic acid using linear amplification mediated PCR (LAM-PCR) over time, using the at least one main insertion site to predict the location of at least one main insertion site of another cell sample transfected with a substantially similar nucleic acid sequence over a similar time period, obtaining a sample of cells from a patient having previously received a therapeutic transfection with a nucleic acid sequence, identifying positions of nucleic acid insertion in the cells from the sample, and identifying a favorable insertion site based upon disproportional representation of the site in the population of transfected cells.
  • LAM-PCR linear amplification mediated PCR
  • a method of expansion of a cell comprising contacting the cell with a polypeptide selected from the group consisting of: an EVI-1 polypeptide, a PRDMl 6 polypeptide, a SETBP1 polypeptide, a fragment thereof, or a synthetic peptide derivative thereof.
  • a method of treating an individual having a disease caused by a mutated gene or an inappropriately expressed gene is provided, by administered cells that have been corrected for the gene of interest, where the cells also have an increased level of at least one of an EVI-1 polypeptide, a PRDM 16 polypeptide, or a SETBP1 polypeptide.
  • the disease is chronic granulomatous disease (CGD).
  • a method of improving gene therapy is provided, by treating an individual with gene-corrected cells that have also been altered to have increased levels of at least one of the following polypeptides: an EVI-1 polypeptide, a PRDMl 6 polypeptide, or a SETBP1 polypeptide.
  • Figure 1 shows hematopoietic reconstitution and gene marking in patient P1 after gene therapy.
  • Cell counts are shown both before and after gene therapy. Absolute neutrophil counts are measured against the right y-axis, while counts of helper T cells (CD4+CD3+), cytotoxic T cells (CD8+CD3+) and B cells (CD 19+) are measured against the left y-axis.
  • helper T cells CD4+CD3+
  • cytotoxic T cells CD8+CD3+
  • B cells CD 19+
  • Figure 2 shows hematopoietic reconstitution and gene marking in patient P2 after gene therapy.
  • Cell counts are shown both before and after gene therapy. Absolute neutrophil counts are measured against the right y-axis, while counts of helper T cells (CD4+CD3+), cytotoxic T cells (CD8+CD3+) and B cells (CD19+) are measured against the left y-axis.
  • helper T cells CD4+CD3+
  • cytotoxic T cells CD8+CD3+
  • B cells CD19+
  • Figure 3 illustrates quantification of gene-modified cells in peripheral blood leukocytes (PBL), granulocytes (CD 15+), T-cells (CD3+) and B cells (CD 19+) for patient P1 by quantitative PCR (QPCR).
  • PBL peripheral blood leukocytes
  • CD 15+ granulocytes
  • CD3+ T-cells
  • B cells CD 19+
  • Figure 4 illustrates quantification of gene-modified cells in peripheral blood leukocytes (PBL), granulocytes (CD 15+), T-cells (CD3+) and B cells (CD 19+) for patient P2 by quantitative PCR (QPCR).
  • PBL peripheral blood leukocytes
  • CD 15+ granulocytes
  • CD3+ T-cells
  • B cells CD 19+
  • Figure 5 shows gene marking in CFCs derived from bone marrow aspirates of patient P1 (days +122 and +381).
  • Vector-containing CFCs were detected by PCR using primers specific for cDNA encoding gp91 phox .
  • Input DNA was controlled by amplification of sequences derived from the human erythropoietin receptor (hEPO-R).
  • Figure 6 shows gene marking in CFCs derived from bone marrow aspirates of patient P2 (days +119 and +245).
  • Vector-containing CFCs were detected by PCR using primers specific for cDNA encoding gp91 phox .
  • Input DNA was controlled by amplification of sequences derived from the human erythropoietin receptor (hEPO-R).
  • Figure 7 illustrates the RIS distribution of retroviral vector insertions from 30 kb upstream to 5 kb downstream of RefSeq genes in patient P1.
  • Absolute numbers of integrations into the 3 common integration site (CIS) related RefSeq genes MDS1/EVI-1, PRDM 16 and SETBP1 are shown as black bars, while integrations into non CIS-related genes are shown in grey.
  • the insertions are listed according to their location within the affected gene expressed as the percentage of the overall length of the gene.
  • the last column summarizes all integrations up to 5 kb downstream of a gene. Up, upstream of the start of transcription; down, downstream of the RefSeq gene. TSS, transcription start site.
  • Figure 8 illustrates the RIS distribution of retroviral vector insertions from 30 kb up- to 5 kb downstream of RefSeq genes in patient P2. Absolute numbers of integrations into the 3 CIS related RefSeq genes MDS1/EVI-1, PRDM16 and SETBP1 are shown as black bars, while integrations into non CIS-related genes are shown in grey. The insertions are listed according to their location within the affected gene expressed as the percentage of the overall length of the gene. The last column summarizes all integrations up to 5 kb downstream of a gene. Up, upstream of the start of transcription; down, downstream of the RefSeq gene. TSS, transcription start site.
  • Figure 9 shows a LAM-PCR band pattern analysis of peripheral blood leukocytes and sorted CD14+, CD15+, CD3+ and CD19+ cells (purity CD3+/CD19+, >98%) derived from patient P1 from 21 to 542 days post-transplantation after undergoing CGD gene therapy as described in Example 1.
  • M 100 bp ladder; -C, 100 ng non-transduced human genomic DNA; 3' IC, 3'-LTR internal control.
  • Figure 10 shows a LAM-PCR band pattern analysis of peripheral blood leukocytes and sorted CD14+, CD15+, CD3+ and CD19+ cells (purity CD3+/CD19+, >98%) derived from patient P2 from 24 to 343 days post-transplantation after undergoing CGD gene therapy as described in Example 1.
  • M 100 bp ladder; -C, 100 ng non-transduced human genomic DNA; 3' IC, 3'-LTR internal control.
  • Figure 11 is a DNA map showing retroviral insertion site (RIS) clusters in highly active clones with integrants in the MDS1/EVI-1 gene. The insertions are tightly clustered within relevant regulatory upstream portions of the gene locus. Grey dots indicate RIS derived from P1, while white squares indicate RIS from P2.
  • RIS retroviral insertion site
  • Figure 12 is a DNA map showing RIS clusters in highly active clones with integrants in the PRDM 16 gene. The insertions are tightly clustered within relevant regulatory upstream portions of the gene locus. Grey dots indicate RIS derived from P1, while white squares indicate RIS from P2.
  • Figure 13 is a DNA map showing RIS clusters in highly active clones with integrants in the SETBP1 gene. The insertions are tightly clustered within relevant regulatory upstream portions of the gene locus. Grey dots indicate RIS derived from P1, while white squares indicate RIS from P2.
  • Figure 14 shows the long term follow up of individual clones contributing to hematopoiesis at different time points after transplantation in patient P1.
  • Each individual CIS related clone detected is represented by one line, with each column representing an individual sampling time point.
  • Grey boxes represent the detection of a specific clone at a time point via LAM-PCR, tracking PCR, and/or quantitative-competitive (QC-) PCR.
  • the white boxes indicate the lack of detection at that time point, indicating that the clone contributes no or few cells to the peripheral circulation.
  • * no LAM-PCR performed
  • ⁇ no tracking PCR performed
  • # no QC-PCR performed.
  • Figure 15 shows the long term follow up of individual clones contributing to hematopoiesis at different time points after transplantation in patient P2.
  • Each individual CIS related clone detected is represented by one line, with each column representing an individual sampling time point.
  • Grey boxes represent the detection of a specific clone at a time point via LAM-PCR, tracking PCR, and/or quantitative-competitive (QC-) PCR.
  • the white boxes indicate the lack of detection at that time point, indicating that the clone contributes no or few cells to the peripheral circulation.
  • * no LAM-PCR performed
  • ⁇ no tracking PCR performed
  • # no QC-PCR performed.
  • Figure 16 is a graph showing the overall contribution of clones with insertions in or near the three CIS-related RefSeq genes compared to all RIS locations at different time points detected in patient P1 during long-term myelopoiesis after gene modification.
  • the insertion frequencies at MDS1-EVI-1 (light gray), PRDM 16 (dark gray) and SETBP1 (black) in relation to non-CIS-related insertion frequencies (white) is illustrated as a percentage of all integration site junction sequences (entire column) detected at each specific time point.
  • the black line denotes the approximate percentage of gene marked cells containing vector gp91 phox among peripheral blood granulocytes.
  • BM bone marrow
  • G granulocytes
  • MC monocytes
  • PB peripheral blood.
  • Figure 17 is a graph showing the overall contribution of clones with insertions in or near the three CIS-related RefSeq genes compared to all RIS locations at different time points detected in patient P2 during long-term myelopoiesis after gene modification.
  • the insertion frequencies at MDS1-EVI-1 (light gray), PRDM 16 (dark gray) and SETBP1 (black) in relation to non-CIS-related insertion frequencies (white) is illustrated as a percentage of all integration site junction sequences (entire column) detected at each specific time point.
  • the black line denotes the approximate percentage of gene marked cells containing vector gp91 phox among peripheral blood granulocytes.
  • BM bone marrow
  • G granulocytes
  • MC monocytes
  • PB peripheral blood.
  • Figure 18 illustrates a series of electrophoretic separations of nucleic acid on agarose gels showing the quantitative-competitive analysis of predominant clones from patient P1.
  • the coamplification of 50 ng wild-type (WT) DNA from PB in competition with 500 copies of a 26-bp deleted internal standard (IS) allows semi-quantitative estimation of single clones.
  • Time-course analysis revealed the sustained presence of all clones after their first detection (> 3 months post-transplant). Numbers indicate days after transplantation.
  • -C 50 ng non-transduced genomic DNA.
  • Figure 19 illustrates a series of electrophoretic separations of nucleic acid on agarose gels showing the quantitative-competitive analysis of predominant clones from patient P2.
  • the coamplification of 50 ng wild-type (WT) DNA from PB in competition with 500 copies of a 26-bp deleted internal standard (IS) allows semi-quantitative estimation of single clones.
  • Time-course analysis revealed the sustained presence of all clones after their first detection (> 3 months post-transplant). Numbers indicate days after transplantation.
  • -C 50 ng non-transduced genomic DNA.
  • Figure 20 shows LAM-PCR analysis of bone-marrow derived colonies from patient P1 at days +192 and +381 after transplantation.
  • Colony numbers 1-3, 5, 7, 9-11, and 13 are colony-forming units — granulocyte-macrophage (CFU-GM)-derived colonies, whereas colonies 4, 6, 8, and 12 represent burst-forming units — erythrocyte (BFU-E) colonies.
  • Figure 21 shows LAM-PCR analysis of bone-marrow derived colonies from patient P2 at day +245 after transplantation.
  • Colony numbers 1-3 and 5 are CFU-GM- derived colonies, whereas colonies 4 and 6 represent BFU-E colonies.
  • M, 100 bp ladder; -C 100 ng nontransduced human genomic DNA.
  • FIG. 22 illustrates transcriptional activation of CIS genes by retroviral insertion.
  • RT-PCR analysis of MDS1/EVI-1 (a), PRDM16 (b) and SETBP1 (c) was performed on bone marrow from patient P1 at day +381 and on peripheral blood leukocytes from patient P2 at days +287 and +343.
  • Panel (a) shows analysis of MDS1/EVI-1 plus EVI-1 transcripts in the upper panel (PR+/PR-) and analysis of MDS1/EVI-1 only transcripts in the lower panel (PR+).
  • the primer pairs used to detected EVI-1 transcripts are located within EVI-1 (exon 5 to exon 6) and therefore also detect MDS1/EVI-1 transcripts.
  • MDS/EVI-1 transcripts were detected with primer pairs located in the second exon of MDS1 and EVI-1 (Example 6).
  • Panel (b) shows analysis of PR+/PR- in the upper panel and analysis of PR+ in the lower panel for PRDMl 6 transcripts.
  • Panel (c) illustrates analysis of SETBP1 expression level.
  • Panel (d) shows results from the ⁇ -actin RT-PCR.
  • -C H 2 O control
  • PR PR-domain
  • BM bone marrow cells
  • PB peripheral blood leukocytes
  • ND healthy donor.
  • Figure 23 illustrates expression of gp91 phox protein on transduced cells in the days after transplantation of the gene-modified cells.
  • Granulocytes (CD 15+) and T cells (CD3+) of patients P1 (a) and P2 (b) were labeled with the monoclonal antibody 7D5 and a lineage specific marker.
  • FIG. 24 show results that demonstrate continued expression of gp91 phox protein and functional reconstitution of NADPH oxidase activity in transduced cells.
  • the top panel illustrates gp91 phox expression in CD34+ bone marrow cells of patient P1 at day +381.
  • the bottom panel exhibits dithionite reduced minus oxidized differential spectra of flavocytochrome in protein extracts obtained from granulocytes.
  • the granulocytes were isolated from the peripheral blood of a healthy donor ("control"), patient P1 at day +242 (“P1") and patient P2 at day +120 (“P2”) after reinfusion of gene transduced cells.
  • Granulocytes were also obtained from an X-CGD patient ("X-CGD”) for comparison.
  • the two major absorption peaks at 426 nm ( ⁇ -peak) and 559 nm ( ⁇ -peak) correspond to the reduced heme groups within gp91 phox and are visible in granulocyte extracts from a healthy donor and P1, while these bands are completely absent in extracts obtained from cells of an untreated X-CGD patient.
  • Figure 25 illustrates functional reconstitution of NADPH oxidase activity in peripheral blood leukocytes (PBLs) and isolated granulocytes of patient P1 as revealed by oxidation of dihydrorhodamine (DHR) 123 and NBT reduction.
  • DHR dihydrorhodamine
  • Superoxide production in PBLs was measured by DHR 123 oxidation in opsonised E. coli, as indicated by black dots.
  • Superoxide production in isolated granulocytes was measured by stimulation with PMA (open dots) or by reduction of NBT to formazan (open squares).
  • Figure 26 shows an example of DHR 123 oxidation by neutrophils of patient P1 at day +473 after gene therapy both before (left panel) and after (right panel) PMA stimulation.
  • Figure 27 shows NBT reduction in single granulocytes obtained from patient P1 at day +381 after gene therapy both before (left panel) and after (right panel) stimulation with opsonised zymosan (OPZ).
  • OPOZ opsonised zymosan
  • Figure 28 illustrates functional reconstitution of NADPH oxidase activity in peripheral blood leukocytes (PBLs) and isolated granulocytes of patient P2 as revealed by oxidation of dihydrorhodamine (DHR) 123 and NBT reduction.
  • PBLs peripheral blood leukocytes
  • DHR dihydrorhodamine
  • Superoxide production in PBLs was measured by DHR 123 oxidation in opsonised E. coli, as indicated by black dots.
  • Superoxide production in isolated granulocytes was measured by stimulation with PMA (open dots) or by reduction of NBT to formazan (open squares).
  • Figure 29 shows an example of DHR 123 oxidation by neutrophils of patient P2 at day +344 after gene therapy both before (left panel) and after (right panel) PMA stimulation.
  • Figure 30 shows NBT reduction in single granulocytes obtained from patient P2 at day +245 after gene therapy both before (left panel) and after (right panel) stimulation with opsonised zymosan (OPZ).
  • OPOZ opsonised zymosan
  • Figure 31 illustrates superoxide anion production by granulocytes obtained from a healthy control (a), patient P1 at day +193 (b) and patient P2 at day +50 (c) as revealed by cytochrome c reduction after stimulation with 0.1 ⁇ g/ml PMA plus 1 ⁇ M fMLP.
  • the reaction was inhibited by superoxide dismutase (SOD) or specific inhibitors of the phagocytic NADPH oxidase activity, such as 4-2- Aminoethylbenzene sulfonylfluoride (AEBSF) or diphenylene iodonium (DPI).
  • SOD superoxide dismutase
  • AEBSF 4-2- Aminoethylbenzene sulfonylfluoride
  • DPI diphenylene iodonium
  • Figure 32 shows the kinetics of E. coli killing by neutrophils obtained from a healthy donor ("pos. control”), patient P1 ("P1"), patient P2 ("P2”) and an individual with X-CGD ("X-CGD”) compared to incubation of E. coli in the absence of granulocytes as a negative control (“E. coli control").
  • Figure 33 illustrates transmission electron microscopy images of opsonised E. coli strain ML-35 at 2.5 hours after phagocytosis by granulocytes from the healthy donor (d, h), the X-CGD patient (b, e), and patient P1 at day +242 (c, f, g) at a ratio of 10:1 (E. c ⁇ /z:granulocytes).
  • Black arrows in (e) and (f) denote undigested E. coli inside the phagocytic vacuole.
  • White arrows in (g) and (h) indicate E. coli degradation.
  • Inserts on the upper right hand corner show magnifications of undigested (e, f) and digested (g, h) bacteria.
  • Encircled areas in panels (b-d) indicate enlarged cells shown in panels (e-h).
  • Scale bars in panels (b-d) represent 5 ⁇ m; in panels (e-h), 2 ⁇ m.
  • Figure 34 illustrates killing of A. fumigatus hyphae by gene-modified granulocytes as revealed by mitochondrial MTT reduction (a) and transmission electron microscopy (b - d).
  • panel (a) the time course of fungus killing is shown at a ratio of 1 seeded Aspergillus spore to 20 granulocytes obtained from either a healthy donor or patient P1 at day +381 after reinfusion of gene transduced cells. MTT reduction of Aspergillus hyphae alone was normalized to 100%.
  • panels (b-d) the fate of A.
  • Figure 35 shows fused PET scans of patient P1 (b) and fused PET-CT scans of patient P2 (c,d) both before (a,c) and either 50 (b) or 53 (d) daus after gene therapy.
  • the circle in (a) denotes two active abscesses due to Staphylococcus aureus infection in the liver of patient P1
  • the circle in (c) shows 18 F-FDG uptake in the wall of a lung cavity of patient P2 due to A. fumigatus infection.
  • Figure 36 shows that immortalized bone marrow cells (SF-I cells) containing a Setbpl integration can engraft and induce myeloid leukemia with minimal to mild maturation in irradiated transplanted mice.
  • SF-I cells immortalized bone marrow cells
  • Immortalized clones usually appeared after 1 month of culturing.
  • the figure shows gates for Ly5.1 + cells from bone marrow (a, left), spleen (b, left), and thymus (c, left) from a mouse (Ly5.2) 2 months after transplantation with the immortalized clone SF-I. Staining was done with Gr-I (RB6-8C5)(a, right), CD 19 (lD3)(b, right), and Thy-1.2 (53-2. l)(c, right) antibodies and corresponding isotype control antibodies (a-c, middle lane) in combination with Ly5.2 antibody. Numbers represent the percent of gated events. Details of this protocol are described in Du et al., Blood 106:3932- 3939 (2005), herein incorporated by reference in its entirety.
  • Table 1 provides a list of proviral integration site sequences detected by LAM-PCR.
  • LAM-PCR amplicons derived from patient P1 are shown in Table l(a) while those from patient P2 are listed in Table l(b).
  • the RefSeq gene nearest to an identified integration site within a 100kb window is listed.
  • the two integrations in the most productive clone in patient P1 are defined by the "Sequence Identity” 77110 A09 (MDS1) and 75916 A08 (OSBPL6 and PRKRA).
  • MDS1 Meth A09
  • OSBPL6 and PRKRA 75916 A08
  • “Genomic Length” denotes the size of the LAM-PCR amplicon without linker- and LTR-sequences.
  • Sequnce Orientation denotes vector integration within the human genome.
  • TSS transcription start site
  • PB peripheral blood
  • BM bone marrow
  • CD15 purified granulocytes
  • Table 2 provides a list of vector integrants detected in the CIS genes MDS1/EVI-1, PRDM16 and SETBPL Data for patient P1 is listed in Table 2(a) while data for patient P2 is listed in Table 2(b).
  • Vector integration was detected by LAM-PCR (L), tracking PCR (T), and/or quantitative competitive PCR (Q).
  • LAM-PCR LAM-PCR
  • T tracking PCR
  • Q quantitative competitive PCR
  • CIS clones chosen for a specific tracking over time are marked (T and/or Q) in the column "Track.”
  • the most productive clone in P1 which was tracked using the sequence information obtained from 75916 A08 is annotated in this table by the second integration 77110 A09 (MDS 1), which is also present in this particular clone. Empty spaces define no detection.
  • CIS clones without "Integration Number” were additionally detected by tracking PCR due to their close location to other clones for which tracking PCR was performed.
  • Vector integration indicates whether vector integration took place in the same orientation or in the reverse orientation of CIS gene expression. *, no LAM-PCR performed; ⁇ , no tracking PCR performed; #, no QC-PCR performed.
  • Table 3 provides a list of primers used for specific tracking of individual CIS clones and generation of clone specific internal standard.
  • F1anking primers 1 and 2 (FP1 and FP2), in combination with vector specific primers, were used to track an individual CIS clone in patients P1 (Table 3a) and P2 (Table 3b) over time and to generate a clone specific internal standard.
  • For quantitative competitive PCR vector specific primers and flanking primers 3 and 4 were used to coamplify a particular integration site and the appropriate internal standard (as described in Example 4).
  • Table 4 provides the accompanying SEQ ID NO for each primer listed in Table 3.
  • Table 5 is a summary of clinical data showing the colony formation of bone marrow total BM mononuclear cells obtained from bone marrow aspirates of patient P1.
  • Table 6 is a summary of clinical data showing the incorporation of 3H- Thymidine into mitogen- or antigen-stimulated mononuclear cells vs. non-stimulated mononuclear cells obtained from patients P1 and P2 at different time points.
  • Table 7 is a summary of clinical data showing examples of plasma protein levels at days +546 for patient P1 and day +489 for patient P2.
  • LAM-PCR analysis is a highly sensitive method for identifying an unknown nucleic acid sequence that flanks a known sequence present in a sample.
  • the method is a powerful way to determine the insertion position of a transferred nucleic acid, such as a retroviral vector sequence, after an integration event.
  • the method can also be used to determine how the integration sites change over time in a dividing cell culture.
  • the method is particularly useful for clonal analysis of transfected hematopoietic cells or other transfected cells.
  • LAM-PCR analysis was used to examine blood samples from two patients that were successfully receiving gene therapy by retroviral-based gene correction to treat chronic granulomatous disease (CGD) in an ongoing trial as described in Example 1.
  • CGD chronic granulomatous disease
  • high efficiency transduction of autologous CD34+ bone marrow cells and busulfan conditioning were used to successfully correct the cytochrome b g ⁇ 91 p ox gene defect in two patients for more than a year.
  • a main goal of the analysis was to examine whether the retrovirus vector integration insertion site is less inert with respect to its genomic context than previously thought (Wu, et al. (2003) Science 300:1749-1751; Laufs, et al. (2003) Blood 101:2191-2198; Hematti, et al. (2004) PLoS Biol. 2:e423, each of which is hereby incorporated by reference in its entirety).
  • the repopulating cell clones contained activating insertions in three genes. These three genes are the "positive regulatory (PR) domain" zinc finger genes MDS1/EVI-1 and PRDM 16 and a SET binding protein SETBP1.
  • the activating insertions were found to drive a 3 to 5 fold expansion of gene corrected cells, and selectively proliferated and dominated (>80%) gene-corrected long term myelopoiesis in both patients.
  • Two of the three genes that were found to contain the activating insertions encode zinc finger proteins that are related PR domain proteins.
  • proteins including certain transcriptional regulatory proteins, have regions that fold around a central zinc ion, producing a compact domain termed a "zinc finger.”
  • zinc-finger motifs have been identified.
  • One group of zinc finger proteins is the "PR domain family" of transcription factor proteins, which includes, for example, the related genes EVI-1, PRDM16, and others. These PR domain family genes have been implicated, in some cases, to play a role in the development of cancer.
  • the EVI-1 protein (“ecotropic viral integration site 1”) is a zinc finger DNA-binding protein that is characterized by two domains of seven and three repeats of the Cys2-His2-type zinc finger motif (Morishita et al. (1988) Cell 54: 831-840; for a review, see Chi et al. (2003) J Biol Chem. 278:49806-49811, each of the foregoing which is hereby incorporated by reference in its entirety).
  • EVI-1 is not generally detected in normal hematopoietic organs including bone marrow, the inappropriate expression of EVI-1 is often triggered by chromosomal rearrangements that disrupt the 3q26 chromosomal region where the EVI-1 gene is located (Fichelson, et al. (1992) Leukemia 6:93-99, which is hereby incorporated by reference in its entirety). Further, EVI-1 up-regulation can occur in chronic myelogenous leukemia patients, even though chromosomes appear normal by conventional cytogenetics, indicating that the inappropriate activation of EVI-1 can occur.
  • High EVI-1 expression has been shown to predict poor survival in acute myeloid leukemia (Barjesteh van Waalwijk van Doom-Khosrovani, et al. (2003) Blood 101: 837-845, which is hereby incorporated by reference in its entirety).
  • the related zinc finger protein PRDM16 (“positive regulatory domain containing 16") has also been found to be a DNA binding protein.
  • the PR domain is characteristic for a sub-class of zinc finger genes that function as negative regulators of tumorigenesis [Fears, S. et al., 1996, Proc. Natl. Acad. ScL 93:1642-1647, herein incorporated by reference in its entirety].
  • the PR domain of MDS1/EVI-1 (alias PRDM3) is a common target for wild-type retrovirus and vector insertion induced tumorigenesis, where the disruption of the PR domain activates PR domain negative oncogene EVI-1.
  • Constitutive expression of the PR negative oncogene EVI-1 induces self- limiting myeloproliferation followed by a myelodysplastic syndrome in mice.
  • PRDM16 alias MDS1 -EVI-1 -like gene 1
  • MDS1/EVI-1 The biology of PRDM16 (alias MDS1 -EVI-1 -like gene 1) is very similar to MDS1/EVI-1.
  • translocation of MDS1/EVI-1 or PRDM16 next to Ribophorin 1 gene on chromosome 3q21 leads to overexpression of the alternatively spliced PR domain negative transcript.
  • SET is a translocation breakpoint-encoded protein in acute undifferentiated leukaemia and SET binding protein 1 (SETBP1) is assumed to play a key role in SET associated leukemogenesis.
  • the LAM-PCR analysis showed a stable highly polyclonal hematopoietic repopulation of gene-corrected cells up to 381 days in patient 1 (P1) and up to 343 days in patient 2 (P2), although the band pattern indicated the appearance of individual pre-dominant clones 5 months after therapy ( Figures 9, 10).
  • a total of 948 unique RIS patient P1: 551; patient P2: 397) were retrieved by shotgun cloning and sequencing of LAM products, of which 765 (P1: 435; P2: 330) could be mapped unequivocally to the human genome using the UCSC BLAT alignment tools. Integration preferentially occurred in gene coding regions (P1: 47%; P2: 52%) and was highly skewed to the ⁇ 5kb transcriptional start site region (P1: 20%; P2: 21%) ( Figures 7, 8).
  • RIS distribution in both patients was not stable over time and became increasingly non-random but still polyclonal in both patients.
  • the distribution also clustered to a much higher degree around particular common insertion sites (CIS) than shown by previous in vitro and in vivo integration site studies (Wu, et al. (2003) Science 300:1749- 1751; Laufs, et al. (2003) Blood 101:2191-2198; and Hematti, et al. (2004) PLoS Biol. 2:e423, each of which is hereby incorporated by reference in its entirety).
  • This clustering around common insertion sites allowed the prediction of the distribution and location of P2 insertions from the results in P1, whose gene modification procedure had been conducted 4 months earlier.
  • AU 134 detectable integrations at these three CISs occurred either in or near PR domain-containing zinc finger genes MDS1/EVI-1 or PRDM16 or in or near the SETBP1 gene. AU insertions were located in or near the upstream region of these genes, preferentially close to the transcriptional start site or internal ATG sites ( Figures 7, 8, and 11-13), exhibiting an unprecedented degree of non-random clustering.
  • Granulocytes have a life-span of 2-3 days. Therefore, the repeated detection over time of individual cell clones by retrovirus insertional marking is indicative of a repopulating progenitor cell or stem cell with long-term activity.
  • the expansion of repopulating clones with these insertions occurred in both patients P1 and P2 with significant intensity.
  • PR domain and SETBP1 related insertions comprised > 90% of all clones detected at more than three time points after treatment. The in vivo selection advantage of these clones was further underlined by the observation that of 134 hits into gene loci affected by insertions more than three times, all of these CIS were related to these 3 genes.
  • retrovirus gene activation can occur as a consequence of any retrovirus vector insertion event, and may be of influence on the biological fate of the target cell.
  • the location of an insertion defines the likelihood of whether such events lead to side effects, ultimately depending on the biological relevance of a gene for the affected cell type, in this case hematopoiesis.
  • This data is of very significant influence for the efficacy and biosafety assessment of gene therapy vectors in ongoing and future clinical trials.
  • this insertional side effect very likely favored by reinfusion of high numbers of gene corrected CD34+ BM cells containing insertion events, may have facilitated the therapeutic success observed.
  • RNA microarray analysis of the same sample using the Affymetrix HG U133_Plus_2.0 Array confirmed overexpression of MDS1/EVI-1 or EVI-1 (36-fold) and SETBP1 (32-fold). Abnormal expression of PRDM16 was not found.
  • Transduced cells were strictly dependent on growth factors for proliferation and differentiation. No colony formation was observed when bone marrow mononuclear cells (patient P1: days +122, +192 and +241) were plated on methylcellulose and cultured for 14 days in the absence of cytokines (as described in Example 7). Colony forming cells (CFCs) derived from CD34+ cells of patient P1 at day +381 were replated in the presence of cytokines into secondary and tertiary methylcellulose cultures. Few cell clusters were visible after the second replating, while no growth was observed in further replatings, indicating the absence of self-renewal capacity. Similar results were obtained with cells from patient P2 at day +245.
  • CFCs colony forming cells
  • gp91 phox was detected by FACS using the monoclonal antibody 7D5 (as described in Example 8 and Yamauchi, A. et al. Location of the epitope for 7D5, a monoclonal antibody raised against human flavocytochrome b558, to the extracellular peptide portion of primate gp91 phox . Microbiol Immunol 45, 249-257 (2001), herein incorporated by reference in its entirety). G ⁇ 91 phox was present mainly in CD 15+ cells with as many as 60% (patient P1, day +304) and 14% (patient P2, day +287) of the cells expressing the transgene.
  • total neutrophils from patient P2 at day +50 produced 2.12 nmol superoxide/ 10 6 gene-corrected cells/min.
  • X-CGD cells showed minimal ⁇ -Gal activity due to impaired perforation capacity in the absence of superoxide production ( Figure 32).
  • gene corrected granulocytes obtained from patients P1 (day +473) and P2 (day +344) showed a substantial increase in ⁇ -Gal activity, illustrating improvement in antibacterial activity in neutrophils of both patients after gene therapy.
  • Neutrophils from patient P1 consisted of a mixture of cells with clear bacterial degradation (lower circle, Figures 33c,g), and others without signs of bacterial degradation that were indistinguishable from non-corrected controls (upper circle, Figures 33c,f).
  • gene corrected granulocytes obtained from P1 at day + 381 were able to degrade Aspergillus fumigatus hyphae as demonstrated by an enzymatic assay [Rex, J.H., Bennett, J.E., Gallin, J.I., Malech, H.L. & Melnick, D.A. Normal and deficient neutrophils can cooperate to damage Aspergillus fumigatus hyphae. J Infect Dis 162, 523-528 (1990), herein incorporated by reference in its entirety] and transmission electron microscopy (Figure 34).
  • a patient in need of hematopoietic cell proliferation can be treated by retroviral insertion methods.
  • a patient cell sample can be transfected with a retroviral or other type of gene vector carrying these genes, or activating their cellular alleles, using methods known to those of skill in the art.
  • the cells can then be reinfused into the patient.
  • Cell counts can be performed periodically to determine the effectiveness of the blood cell proliferation treatment.
  • the amount of cells to be transfected, the ratio of viral vector to cells, cell growth methods, and readministration methods can be varied as needed to treat the particular disorder.
  • the progress can be followed, for example, by LAM-PCR to confirm the activation of EVI-related genes. ( Figures 9-10, 14-15)
  • the retroviral vector or other gene vector can be administered to the patient directly, rather than to cells that have been isolated from the patient.
  • the method can be used to expand any type of mammalian cell.
  • types of cell that may be expanded include but are not limited to a stem cell, an embryonic stem cell, an adult stem cell, a multipotent stem cell, a pluripotent stem cell, a hematopoietic cell, a hematopoietic stem cell, a progenitor cell, a myelopoietic stem cell, a peripheral blood cell, non-hematopoietic stem cells or progenitor cells, and the like.
  • the cells to be treated can be present in a cell culture, or can be present in the body.
  • the retroviral vector insertion or other vector transfer can be used to treat many cell-based diseases, in addition to the CGD shown herein. Any disease where an increase in cell proliferation is helpful can be treated by the method of the invention. Examples of such diseases include but are not limited to inherited diseases (severe combined immunodeficiencies, anemias like Fanconi anemia), cancer, AIDS, and the like.
  • the invention can, in some embodiments, be used to predict the insertion location of a retroviral vector insertion in one patient, by following previous insertion results of another patient or similar animal and in vivo models. For example, in the current CGD analysis, the earlier studied successfully treated patient had activating DNA insertions in similar positions as those of the later studied successful patient. This can be especially useful for early prediction of the likelihood of successful treatment. Further, a knowledge of where a successful insertion is likely to be located can make more simple assays, such as dipstick assays for EVI-1 (or related gene) gene or protein expression useful for a quick test to see if a patient is responding to treatment.
  • a patient in need of gene- correction can be treated.
  • the gene correction can be performed in an in vitro culture of cells isolated from the patient.
  • activation of the EVI-related genes can be performed. This can be done, for example, by administering a retroviral vector to the culture of gene corrected cells, allowing the cells to proliferate in vitro, then reinfusing or readministering said cells to the patient.
  • retroviral treated cells are then both gene corrected and fast growing, allowing the patient to receive the gene therapy more rapidly. Many types of gene corrections can be performed using this method.
  • suitable genes for correction include but are not limited to single gene or multiple gene inherited disorders of the blood forming and immune system or other body tissues that can be complemented, treated or stabilized by gene transfer, and the like. Examples include but are not limited to X-SCID, ADA-SCID, CGD, alpha 1 antitrypsin deficiency, and the like. Methods of treatment involving transfection of cells with EVI-related genes and SETBPl
  • a nucleic acid encoding EVI-1, PRDM 16, or SETBP1 is operably linked to a transcriptional regulatory sequence, and transfected to a cell.
  • the exogenous nucleic acid can be, for example, integrated into the genome, or can be present in the cell, for example, in the cytoplasm on a cytoplasmic vector.
  • the nucleic acid can be stably or transiently expressed, transferred in synthetic form, including nucleic acid equivalents or mRNAs.
  • the transcriptional regulator sequence such as a promoter, can be chosen, for example, so as to allow for constitutive expression, conditional expression, or inducible expression.
  • EVI-1, PRDM 16, or SETBP1 polypeptides, or fragments thereof can be administered to a cell, hi some embodiments, active synthetic peptide analogs derived from EVI-1, PRDM 16, or SETBP1 polypeptide sequences can be administered to a cell, either in culture or in a patient, to allow increased cell proliferation.
  • EVI-related and / or SETBP1 genes may be desirable to grow cells that express the EVI-related and / or SETBP1 genes for a short period of time only, in order to increase the rate of cell proliferation. This can be achieved, for example, using specific inducible promoters or transient expression methods as known in the art. In such situations, when the high rate of cell proliferation is achieved, the expression of the EVI-related and SETBP1 genes can be turned off by, for example, removing the inducing agent from the cell environment.
  • the method can be suitable for increasing the proliferation of cells that are gene-corrected, or non-corrected.
  • the method can be used for increasing the proliferation of any type of mammalian cell.
  • EVI-related and SETBP1 -related gene expressing cells can be allowed to proliferate for several cycles before being reinfused into the patient.
  • the cells can proliferate for about 1, 3, 5, 8, 10, 13, 17, or 20 or division cycles, prior to reinfusion into the patient, if desired.
  • Agents that upregulate EVI-related and SETBPl genes can be allowed to proliferate for several cycles before being reinfused into the patient.
  • the cells can proliferate for about 1, 3, 5, 8, 10, 13, 17, or 20 or division cycles, prior to reinfusion into the patient, if desired.
  • Agents that upregulate EVI-related and SETBPl genes can be allowed to proliferate for several cycles before being reinfused into the patient.
  • the cells can proliferate for about 1, 3, 5, 8, 10, 13, 17, or 20 or division cycles, prior to reinfusion into the patient, if desired.
  • cell proliferation can be increased, either in vitro or in vivo, by contacting the cells to be proliferated with agents that can upregulate or modulate endogenous EVI-related and SETBP1 genes.
  • Cell culture assays can be performed to determine candidate agents from a library of potential compounds, if desired. Test compounds that modulate EVI-related and SETBP1 gene expression are then chosen for further testing. This method can be used to find pharmaceutically valuable agents that can increase cell proliferation in vitro or in vivo.
  • EVI-related gene as described herein, such as EVI-1, PRDMl 6, or SETBP1, and the like, either constitutively or transiently, can increase the proliferation of the gene-corrected cells so that successful readministration and treatment is more likely to occur.
  • This modulation of EVI-related gene expression can be done by several means, such as simply administering the retroviral vector to gene-corrected cells, or, for example, by traditional molecular cloning methods.
  • a method of forming a bodily tissue by obtaining a desired cell type from a patient, if desired, treating the cell with a nucleic acid to accomplish a gene-correction, treating the cell to allow for increased expression of an EVI-related and/or SETBP1 gene to cause increased cell proliferation, and treating the cell so as to form a desired tissue.
  • the tissue can then be readministered into the patient as a form of gene therapy.
  • Additional embodiments of the invention provide for a method of identifying genes whose modulation (such as upregulation or downregulation) can increase the proliferation rate, selective advantage, or persistence of a stem or progenitor cell.
  • the method can involve obtaining a transfected cell, allowing it to proliferate for several cycles, then testing using LAM-PCR to determine where the successfully repopulated cells have the nucleic acid insertions. The testing can be performed, if desired, over a period of time to determine how the insertion sites change over time.
  • Candidate genes can then be chosen for further analysis. As an example of this method, Table 1 shows a list of exemplary genes found to contain retroviral insertions in at least one of the two successfully treated CGD patients.
  • genes, identified to be downstream of these insertion sites are shown in Table 1. These genes include but are not limited to MGC10731, PADI4, CDA, CDW52, ZBTB8, AK2, FLJ32112, TACSTD2, FLJ13150, MGC24133, NOTCH2, NOHMA, EST1B, PBXl, PLA2G4A, HRPT2, ATP6V1G3, PTPRC, NUCKS, CABC1, LOC339789, PRKCE, AFTffHHIN, NAGK, MARCH7, DHRS9, PRKRA, SESTD1, MGC42174, CMKOR1, TBC1D5, THRB, MAP4, IFRD2, ARHGEF3, FOXP1, ZBTB20, EAF2, MGLL, PLXND1, SLC9A9, SELT, CCNLl, MDS1, BCL6, MIST, STM2, TEC, OCIAD1, FLJ10808, SEPTIl
  • X-linked chronic granulomatous disease in patient P1 was done in 1981. He suffered from severe bacterial and fungal infections as well as granuloma of the ureter with stenosis, pyeloplastic operation (1978), liver abscesses (1980), pseudomonassepticemia (1985), candida-oesophagitis(1992), salmonellasepticemia (1993), severe osteomyelitis, spondylitis with epidural and paravertebral abscess and corporectomy (June 2002). Since 2003 severe therapy-resistant liver abscesses ⁇ Staph, aureus) were diagnosed.
  • gp91 phox expression is driven by the Friend mink cell Spleen focus-forming virus (SFFV) LTR, which has been shown to be highly active in stem and myeloid progenitor cells [Baum, C. et al. Novel retroviral vectors for efficient expression of the multidrug resistance (mdr-1) gene in early hematopoietic cells. J Virol 69, 7541-7547 (1995), herein incorporated by reference in its entirety].
  • Vector containing supernatants were obtained from a stable PG 13 packaging cell line in X-VIVO10 at a titer of 1 x 10 6 TU/ml.
  • CD34+ cells were prestimulated for 36 hours at a density of 1 x 10 6 cells/ml in X-VIVO 10 medium + 2 mM L-glutamine, supplemented with EL-3 (60 ng/ml), SCF (300 ng/ml), Flt3-L (300 ng/ml), and TPO (100 ng/ml) (Strahtman Biotech, Dengelsberg, Germany) in Lifecell Bags (Baxter). Following prestimulation, cells were adjusted to a density of 1 x 10 6 cells/ml in cytokine containing medium as described above.
  • Transduction was performed in tissue culture flasks coated with 5 ⁇ g/cm 2 of CH-296 (Retronectin, Takara, Otsu, Japan) and preloaded with retroviral vector containing supernatant as described previously [Kuhlcke, K. et al. Highly efficient retroviral gene transfer based on centrifugation-mediated vector preloading of tissue culture vessels. MoI Ther 5, 473-478 (2002), herein incorporated by reference in its entirety]. After 24 hours cells were pelleted and cell density was again adjusted to 1 x 10 6 cells/ml in cytokine containing medium. Cells were incubated on freshly coated/preloaded flasks for another round of transduction. This procedure was repeated once more for a total of three transduction rounds. 24 hours after the final transduction, cells were harvested and analyzed for phenotype and gene transfer efficiency, transported to the transplantation unit and reinfused into the patients.
  • End of production materials were also tested for the presence of replication competent retroviruses by the extended XC plaque assay [Cham, J.C. et al. Alteration of the syncytium-forming property of XC cells by productive Moloney leukemia virus infection. Cancer Res 35, 1854-1857 (1975), herein incorporated by reference in its entirety] and by a gag-specific PCR as follows: Primers 5'- AGAGGAGAACGGCCAGTATTG-S 1 (SEQ ID NO: 136) and 5 r - ACTCCACTACCTCGCAGGCATT-3' (SEQ ID NO: 137) were used to amplify a 69-bp fragment of the retroviral gag cDNA.
  • Amplification was detected with a FAM-labelled gag- probe (5 I -TGTCCGTTTCCTCCTGCGCGG-3 I ) (SEQ ID NO: 138).
  • the human EPO receptor gene was used as an internal amplification control. PCR reactions were carried out for 40 cycles in a single tube. Each reaction cycle consisted of 15 seconds at 94°C followed by 1 minute at 60°C.
  • the ABI PRISM 7700 Sequence Detection System (PE Applied Biosystems, Rothstadt, Germany) was used to determine the presence of proviral sequences in genomic DNA isolated from the blood and bone marrow cells of patients P1 and P2.
  • the exon 8 primer gp91-f (5'-GGTTTTGGCGATCTC AACAGAA-3') (SEQ ID NO: 1) and exon 9 primer gp91-r (5 I -TGTATTGTCCCACTTCCATTTTGAA-3 I ) (SEQ ID NO: 2) were used to amplify a 114-b ⁇ fragment of the gp91 phox cDNA.
  • Amplification was detected with the FAM-labelled probe gp91-p (5'-TCATCACCAAGGTGGTC ACTCACCCTTTC-S 1 ) (SEQ ID NO: 3).
  • the human EPO receptor gene was used as an internal control to quantify the gp91 phox reaction.
  • Primers hepo-f (5'-CTGCTGCCAGC TTTGAGTACACTA-S 1 ) (SEQ ID NO: 4) and hepo-r (5'-GAGATGCCAGAGTCAGATACCACAA-S') (SEQ ID NO: 5) amplified a 138-bp fragment from exon 8 of the 2£P0-receptor-gene.
  • Amplification was determined by the VIC-labelled probe hepo-p (5'-ACCCCAGCT CCCAGCTCTTGCGT-S') (SEQ ID NO: 6). Both reactions were carried out in a single tube. The amplification cycle was 15 s at 94 °C followed by 1 min at 60 °C. hi each experiment, the amplification of DNA generated from HT 1080 cells containing a single copy of a gp91 phox vector mixed with wild type HT1080 cells in defined ratios was used to quantify the percentage of SF71 gp91 phox integrations per human genome.
  • the percentage of transduced cells was estimated from the values obtained from the quantitative PCR (Q-PCR), which represent vector copies per diploid genome, after dividing by two to account for the mean of two proviral copies per transduced cell.
  • Q-PCR quantitative PCR
  • genomic DNA was isolated from individual bone marrow colonies and analyzed for the presence of vector derived sequences by nested PCR using gp91 phox specific primers.
  • the primers used for first PCR were gpforOl: (5'-TTGTACGTGGG C AGACCGC AG AGA-3') (SEQ ID NO: 7) and gprevO2: (5'- CCAAAGGGCCCATCAACCGCTATC-3') (SEQ ID NO: 8).
  • Nested PCR was done under similar conditions using the primer combination P8: (5'- GGATAGTGGGTCCCATGTTTCTG-3') (SEQ ID NO: 9) and RI l: (5'- CCGCTATCTTAGGTAG TTTCCACG-3') (SEQ ID NO: 10).
  • EPO-R gene was amplified in parallel with the primer combination hEpo-F1: (5'- GAGCCGGGGACAGATGATGAGG-S') (SEQ ID NO: 11) and hEpo-R1: (5'- GCGGCTGGGATAAGGCTGTTC-3') (SEQ ID NO: 12) for the first PCR reaction and primers hepo-f (SEQ ID NO: 4) and hepo-r (SEQ ID NO: 5) for the nested PCR primers.
  • hEpo-F1 (5'- GAGCCGGGGACAGATGATGAGG-S')
  • hEpo-R1 (5'- GCGGCTGGGATAAGGCTGTTC-3') (SEQ ID NO: 12) for the first PCR reaction and primers hepo-f (SEQ ID NO: 4) and hepo-r (SEQ ID NO: 5) for the nested PCR primers.
  • hexa- nucleotide primed double strand synthesis with Klenow polymerase, restriction digest using Msel, HinP1I, or Tsp5091 and ligation of a restriction site complementary linker cassette allowed amplification of the vector genome junctions.
  • vector specific primers LTR II (5'>GCC CTT GAT CTG AAC TTC TC ⁇ 3') (SEQ ID NO: 14) and LTR IH (5'>TTC CAT GCC TTG CAA AAT GGC ⁇ 3 ') (SEQ ID NO: 15) were used in combination with linker cassette specific primers LC I (5'>GAC CCG GGA GAT CTG AAT TC3') (SEQ ID NO: 16) and LC II (5>GAT CTG AAT TCA GTG GCA CAG ⁇ 3') (SEQ ID NO: 17), respectively.
  • LAM-PCR amplicons were purified, shotgun cloned into the TOPO TA vector (Invitrogen, Carlsbad, CA) and sequenced (GATC, Konstanz, Germany). Sequences were aligned to the human genome (hgl7, release 35, May 2004) using the UCSC BLAT genome browser (available on the world wide web at ucsc.genome.edu). (See also Table 1.) Relation to annotated genome features were studied with the same tool. Sequences that could not be mapped were either too short ( ⁇ 20 bps, 136 sequences, 15.5% of all obtained sequences), or showed no definitive hit or multiple hits on the human genome (40 sequences, 4.5% of all obtained sequences).
  • QC-PCR was performed with defined dilutions of IS (50 copies and 500 copies) added to 50ng of patient DNA.
  • vector primer LTR I SEQ ID NO: 13
  • genomic flanking primer FP2 SEQ ID NOs: See Table 4
  • the templates were coamplif ⁇ ed with 35 PCR cycles (denaturation at 95°C for 45 s, annealing at 54-60°C for 45 s, extension at 72°C for 60 s) after initial denaturation for 2 min and before final extension for 5 min.
  • a 35 cycle actin PCR was carried out as a loading control using primers actin-1 (5'- TCCTGTGGCATCCACGAAACT-3') (SEQ ID NO: 140) and actin-2 (5'- GAAGCATTTGCGGTGGAC GAT-3') (SEQ ID NO: 141) for 5 min at 95 °C, 1 min at 95 °C, 1 min at 58 °C, 1 min at 72 °C, and 10 min at 72 °C.
  • EVI-1 and MDS1-EVI-1 transcripts were detected, by ICR with primers EVT1-ex5-F2 (5'-TGGAGAAACACATGCTGTCA-3') (SEQ ID NO: 142) and EVl1-ex6-R2 (5'-ATAAAGGGCTTCACA CTGCT-3') (SEQ ID NO: 143).
  • cDNA was subjected to a 36 cycle PCR using primers MDS1-ex2-F1 (5'-GCCACATCCAGT GAAGCATT-3') (SEQ ID NO: 144) and EVl1-ex2- R1 (5 '-TGAGCCAGCTTCCAACATCT-3') (SEQ ID NO: 145).
  • PRDM16 To define the expression of PRDM16, a fragment of this PR domain was amplified using primer MEL1PR-F1 (5'-CTGACGGACGTGGAAGTGTCG-3') (SEQ ID NO: 148) with MEL1PR-F1 (5'-CAGGQGGTAGACGCCTTCCTT-3') (SEQ ID NO: 149), which hybridised in exon 3 and exon 5, respectively. 2% of the PCR product was amplified to a second PCR with primers MEL1PR-F2 (5'-TCTCCGAAGACCTGGGCAGT-3') (SEQ ID NO: 150) and MEL1PR-R2 (5'-CACCTG GCTCAATGTCCTTA-3') (SEQ ID NO: 151).
  • SETBP1 Expression level of SETBP1 was analyzed using primers SETBP-F1 (5'-TAAAAGTGGACCAGACAGCA-3') (SEQ ID NO: 156) and SETBP-R1 (5'-TCACGAAGTTG TTGCCTGTT-3') (SEQ ID NO: 157).
  • the primer U5 IV (5'>TCC GAT AGA CTG CGT CGC ⁇ 3') (SEQ ID NO: 158) together with primer EVI-ex2-R1, MDS1-ex2-F1, or MEL1N-R1.
  • Nested PCR was performed, with 2% PCR product and primer U5 VI (5 '>TCT TGC TGT TTG CAT CCG AA ⁇ 3') (SEQ ID NO: 159) was used together with primer EVI1-ex2-R2 (SEQ ID NO; 147), MDS1-ex2-F2 (SEQ ID NO: 146), or MEL1N-R2 (SEQ ID NO: 155). Additionally, nested PCR was carried out with LTR I (SEQ ID NO: 13) and MELl-PR-F1 (SEQ ID NO: 148). 2% of the product was amplified with primer LTR II (SEQ ID NO: 14) and MELlPR- F2 (SEQ ID NO: 150).
  • 36 cycle PCRs were accomplished with 3.33% of whole cDNA from patient 1 and 0.33% of whole cDNA from the normal donor for 2 minutes at 95°C, 45 seconds at 95°C, 45 seconds at 54°C, 1 minute at 72°C, and 5 minutes at 72°C.
  • a 35 cycle actin PCR was carried out as a loading control with 0.0002-0.008% of cDNA and primers actin-1 (5'TCC TGT GGC ATC CAC GAA ACT 3') (SEQ ID NO: 140) and actin-2 (5' GAA GCA TTT GCG GTG GAC GAT 3') (SEQ ID NO: 141) for 5 minutes at 95°C, 1 minute at 95°C, 1 minute at 58°C, 1 minute at 72°C, and 10 minutes at 72°C.
  • actin-1 5'TCC TGT GGC ATC CAC GAA ACT 3'
  • actin-2 5' GAA GCA TTT GCG GTG GAC GAT 3'
  • Bone marrow mononuclear cells (l-5xl ⁇ 4 ) or CD34+ purified cells (1- 5x10 3 ) were plated on methylcellulose in the presence or absence of cytokines (50 ng/ml hSCF, 10 ng/ml GM-CSF, 10 ng/m hIL3 and 3 U/ml hEpo) (MethoCult, Stem Cell Technologies, Vancouver, Canada). Colony growth was evaluated after 14 days.
  • cytokines 50 ng/ml hSCF, 10 ng/ml GM-CSF, 10 ng/m hIL3 and 3 U/ml hEpo
  • coli/ml were opsonized with 20% (v/v) Octaplas® (Octapharma AG, Lachen, Switzerland) for 5 min at 37°C.
  • Opsonized E. coli final concentration 0.9x10 8 /ml
  • granulocytes obtained from healthy donors or X-CGD patients after gene therapy.
  • saponin Calbiochem, Darmstadt, Germany
  • samples were incubated with ImM ortho- nitrophenyl- ⁇ D-galactopyranoside (Sigma-Aldrich, Seelze, Germany) at 37 °C for 30 min.
  • ⁇ -galactosidase activity was followed by standard procedures at 420 nm.
  • Aspergillus fumigatus killing assay was conducted as described by Rex et al. [Rex, J.H. et al. Normal and deficient neutrophils can cooperate to damage Aspergillus fumigatus hyphae. J Infect Dis 162, 523-528 (1990), herein incorporated by reference in its entirety] with minor modifications. Briefly, Aspergillus spores were seeded in 12 well plates at a density of 5x10 4 spores per well in Yeast nitrogen with amino acids (Sigma-Aldrich, Seelze, Germany). Hyphae were opsonized with 8% Octaplas® (Octapharma AG, Lachen, Switzerland) for 5 min at room temperature.
  • E. coli killing 5x10 7 opsonized E. coli were incubated with 5x10 6 granulocytes in HBSS+Ca/Mg containing 2% human albumin in a water bath shaker at 37 °C for 2.5 h. The cells were harvested by centrifugation and fixed in 2.5% glutaraldehyde in PBS at room temperature for 30 min.
  • Aspergillus fumigatus killing 3x10 5 Aspergillus spores were seeded in a 4 cm petri dish in Yeast Nitrogen Base with amino acids (Sigma). Germination was induced by 6 h incubation at 37 °C followed by decelerated growth at room temperature over night.
  • Hyphae were washed in HBSS+Ca/Mg and opsonized with 8% Octaplas® (Octapharma AG, Lachen, Switzerland) in HBSS+Ca/Mg containing 0.5% human albumin for 5 min at room temperature.
  • the opsonized hyphae were incubated with 3 ⁇ 10 6 granulocytes in HBSS+Ca/Mg containing 0.5% human albumin for 2 h at 37 °C. Fixation was carried out by direct addition of glutaraldehyde to a final concentration of 2.5%.
  • Glutaraldehyde fixed samples were washed three times in PBS, fixed in 2% osmium tetroxide in PBS for 30 minutes, and dehydrated in ethanol followed by embedding in Epon and polymerization at 60 °C for 2 days.
  • Ultrathin sections of 60 nm were prepared using an Ultramicrotome (Ultracut E, Reichert). The sections were then post-stained with 5% aqueous uranyl acetate for 30 min and lead citrate for 4 min, and examined on a Philips CM 12 transmission electron microscope.
  • Bone marrow aspirates of both patients were routinely examined at several time points (P1: days +122, +192, +241, +381; P2: days +84, +119, +245). The following analyses were done: morphology (Pappenheim staining) was normal at all time points and showed a completely normal hematopoiesis, normal cellularity, normal megakaryo-, erythro- and granulopoiesis and no signs of leukemia.
  • P1 day +381 megakaropoiesis normal, X-cell 1%, promyelocytes 8%, myelocytes 16%, metamyelocytes and bands 14%, segmented 15%, eosinophils 6%, basophils 1%, monocyte 3%, erythroblasts 21%, plasma cells 2%, lymphoids 12%.
  • P2 day +245 megakaryopoiesis normal, promyelocytes 10%, myelocytes 19%, metamyelocytes and bands 12%, segmented 11%, eosinophils 4%, basophils 1%, monocytes 3%, erythroblast 26%, plasma cells 4%, lymphoids 10%.
  • Bone marrow aspirates were taken at days +122, +192, +241 and +381 for P1 and at days +84, +119 and +245 for P2.
  • a bone marrow total BM mononuclear cells were plated on methylcellulose (Methocult, Stem Cells Technologies) and colony formation was assessed 14 days later. Table 5 shows a summary of these data.
  • CD3 and CD20 was performed at day +381 (P1) and day +491 (P2). No infiltration of blast
  • Cytogenetic analysis were performed at the Department of Molecular Pathology, University Medical School, Hannover, Germany under the direction of Prof. Dr. med. B. Schlegelberger. The following samples were analyzed: P1: day +241 (16 metaphases), day +381 (18 metaphases); P2 day +119 (15 metaphases), day +245 (21 metaphases). In all cases a normal karyotype was observed.
  • T-CeIl Function Analysis Mononuclear cells obtained at different time points from P1 and P2 were stimulated with diverse mitogens and antigens. Proliferative responses were assayed by 3 H- Thymidine incorporation. The ratio of 3 H-Thymidine incorporation in mitogen- or antigen stimulated vs. non-stimulated cells is given in Table 6 as a quotient, hi all cases, robust incorporation of 3 H-Thymidine were observed, indicating that the mitogen and antigen responses of patient lymphocytes are within the range of age-matched healthy individuals. Also, immunoscope analysis of V ⁇ T lymphocytes at day +245 (P1) and day +491 (P2) showed normal T cell receptor repertoires in both patients. Table 6.
  • IgG antibodies against Tetanus Toxoid (610 U/l), Diphteria Toxoid (270 U/l) and Hemophilus influenzae Type B (3.10 ⁇ g/ml) were detected at day 597 in serum samples of P1.
  • bone marrow cells obtained from C57EL/6-Ly5.1 + mice were expanded for 2 days in the presence of DMEM plus 15% heat- inactivated FBS, 10ng/ml IL-6, 6ng/ml IL-3, and 100ng/ml SCF. Expanded cells were subsequently transduced by co-culture on top of GP+E86 cells stably expressing MSCVneo. After transduction, cells were cultured in IMDM with 20% heat-inactivated horse serum plus 100 ng/ml SCF and 10 ng/ml IL-3, or 100 ng/ml SCF and 30 ng/ml FLT3L.
  • More than 80 immortal cell clones were generated after retroviral transduction of murine bone marrow cells in the presence of SCF and IL3, of which some have been maintained in culture for more than 1.5 years. The majority of these clones had a phenotype similar to committed immature myeloid progenitors and were still IL-3 dependent. All karyotypes were found to be normal. Spontaneous differentiation of the cultures yielded neutrophils (10-40%) and macrophages (1-5%). 95% of cells could be differentiated into neutrophils in response to G-CSF, whereas GM-CSF treatment induced differentiation into macrophages (30%) and neutrophils (70%). Addition of PMA induced 50-70% of cells to differentiate into macrophages.
  • SF-I SF-I- revealed a very immature phenotype (Sca-1-, 50% c-kit+) with lymphomyeloid differentiation capacity and an integration in Setbpl.
  • transplantation of 2.5-5.6x10 6 Ly5.1 + SF- 1 cells resulted in a leukemic phenotype.
  • All eleven hosts died of leukemia 56-118 days post transplant.
  • Secondary recipients of IxIO 6 leukemic cells developed leukemias 30 days after transplantation.
  • This SF-I cell line revealed two integrants, one located at an unknown gene locus (without abnormal gene expression) and one in intron 1 of Setbpl.
  • the leukemic potential of SF-I cells is very likely related to the immature phenotype of the clone (engraftment and self-renewal capacity).
  • This knowledge can be used to develop assays that evaluate the therapeutic value of gene-modified cells against its potential risks in clinical use. For example, such assays can be used to screen gene-modified cells in order to eliminate those clones that exceed a specified risk threshold for clinical therapies.
  • immortalized early hematopoietic progenitor cells induced leukemias in transplanted hosts whereas immortalized immature myeloid cells did not.
  • G-CSF mobilized peripheral blood CD34+ cells were collected from two X-CGD patients aged 26 (patient P1) and 25 years (patient P2), transduced with a monocistronic gammaretroviral vector expressing gp91 phox (SF71gp91 phox ) and reinfused 5 days later (Example 1). Transduction efficiency was 45% for P1 and 39.5% for P2 as estimated by gp91 phox expression (Example 2). The proviral copy number was 2.6 (P1) and 1.5 (P2) per transduced cell. The number of reinfused CD34+/gp91+ cells per kg was 5.IxIO 6 for P1 and 3.6 x10 6 for P2.
  • liposomal busulfan Prior to reinfusion, liposomal busulfan (L-Bu) was administered intravenously on days -3 and -2 every 12 hours at a dose of 4 mg/kg/day. Liposomal busulfan conditioning was well tolerated by both patients P1 and P2. With the exception of a grade I mucositis from day +11 to day +17 observed in P1, no other non-hematological toxicities were observed.
  • CFU-GM colony-forming units- granulocyte-macrophage
  • BFU-E burst-forming units-erythrocyte
  • HSCs hematopoietic stem cells
  • Cells are isolated from a cell sample taken from a patient in need of blood cells.
  • a retroviral vector is prepared.
  • a cell culture is prepared in the presence of permissive cytokines. The cells are allowed to proliferate.
  • cells are kept in culture in the presence of the same or a different set of cytokines or growth factors, e.g. to induce proliferation only at the stem cell stage, or only at a lineage differentiated stage, e.g. myelopoiesis or thrombopoiesis.
  • the cells are prepared for reinfusion to the patient by washing in PBS to remove cell culture components, followed by sorting of cells according to phenotype.
  • the cells are reinfused to the patient.
  • the patient's cell count is taken weekly. By this method, the patient's blood cell count improves.
  • EXAMPLE 25 Expansion of Hematopoietic Cells in vitro by Upregulating
  • the human EVI-1 nucleic acid sequence operably linked to a tetracycline- inducible promoter, is inserted into a plasmid vector sequence using known molecular techniques, and is then transfected to a hematopoietic cell culture.
  • the cell culture is allowed to proliferate as described in Example 24 for a 2 week period in the presence of the inducer agent.
  • the cells are then counted and characterized using cell-type specific markers.
  • Cells are reinfused intravenously, directly into the bone marrow or delivered to specific target tissues by direct application or injection in appropriate media, e.g. PBS.
  • a patient in need of expansion of hematopoietic cells is treated with an injection of purified nucleic acid vector containing a nucleic acid sequence encoding EVI-1, operably linked to an inducible promoter.
  • the nucleic acid integrates into the chromosomal DNA of the patient and/or is transcribed after the inducing agent is provided to the patient orally for 1 year.
  • the hematopoietic cells are capable of in vivo expansion by this method, and the patient health improves.
  • EXAMPLE 28 Administration of an Agent that Upregulates EVI-related Genes in a Cell Culture
  • Cells are isolated from a patient in need of treatment.
  • An agent that upregulates endogenous EVI-1 expression is added to a cell culture, such as an upstream regulator of EVI-1 expression. Cell count is measured daily. After several days, the agent is removed from the culture, the expanded cells are washed and reinfused into the patient.
  • the human SETBP1 nucleic acid sequence operably linked to a steroid hormone inducible promoter, is inserted into an integrating vector sequence using known molecular techniques, and is then transfected to a hematopoietic cell culture.
  • the cell culture is allowed to proliferate as described in Example 6 for one week in the presence of a steroid inducer agent.
  • the cells are then counted and characterized using cell-type specific markers.
  • the desired cells are isolated from the culture described in Example 11, and are washed in PBS. The cells are then reinfused directly into the bone marrow of the patient. By use of this method, the patient hematopoietic cell count improves, and the patient health improves.
  • a patient in need of expansion of hematopoietic cells is treated with an injection of purified nucleic acid vector containing a nucleic acid sequence encoding PRDM 16, operably linked to an inducible promoter.
  • the nucleic acid integrates into the chromosomal DNA of the patient and/or gets transcribed after the inducing agent is provided to the patient orally for 1 year.
  • the hematopoietic cells are capable of in vivo expansion by this method, and the patient health improves.

Abstract

A method of increasing cell proliferation by modulating levels of EVI and related genes. Activation of EVI-1, PRDM16, or SETBP1 can increase the proliferation rate, self renewal and/or in vitro and/or in vivo survival and/or engraftment of human cells, either in vitro or in vivo. The gene modulation can be performed by various means, including traditional cloning methods and retroviral-based gene activation methods. The method can also be used to more efficiently deliver gene-corrected cells to a patient in need of treatment.

Description

STEM AND PROGENITOR CELL EXPANSION BY EVI, EVI-LIKE GENES AND SETBPl
FIELD OF THE INVENTION
[0001] The invention relates to the field of cell biology and gene therapy. In particular, the invention relates to methods of increasing cell proliferation in vivo or in culture by modulating expression of certain regulatory genes.
BACKGROUND OF THE INVENTION
[0002] Gene therapy methods are currently being pursued for the treatment of a variety of human diseases. Retroviral vectors, for example, have been successfully used in clinical gene therapy trials to treat severe combined immunodeficiencies (SCID), where gene correction conferred a selective advantage to lymphocytes (Cavazzana-Calvo, et al. (2000) Science 288:669-672; Aiuti, et al. (2002) Science 296:2410-2413; Gaspar, et al. (2004) Lancet 364:2181-2187, each of the foregoing which is hereby incorporated by reference in its entirety). However, in inherited leukocyte disorders without a selective advantage by gene correction, human gene therapy has been less effective (Kohn, et al. (1998) Nature Med. 4:775-780; Malech, et al. (1997) Proc. Natl. Acad. Sci. U.S.A. 94:12133-12138, each of the foregoing which is hereby incorporated by reference in its entirety).
[0003] While insertion induced oncogenesis has been reported for wild type retroviruses (Hayward, et al. (1981) Nature 290:475-480; Selten, et al. (1984) Embo J. 3:3215-22, each of the foregoing which is hereby incorporated by reference in its entirety) and related replication competent vectors (Dudley, J. P. (2003) Trends MoI Med 9:43-45, which is hereby incorporated by reference in its entirety), retrovirus vector based gene therapy with non-replicating vectors was thought to lead to random monoallelic integration without relevant biological consequences (Coffin, et al. (1997) Retroviruses. Plainview, New York: Cold Spring Harbor Laboratory Press; Moolten, et al. (1992) Hum Gene Ther 3:479- 486, each of the foregoing which is hereby incorporated by reference in its entirety). [0004] Although gene therapy methods, in theory, should provide useful methods for the treatment of many types of human diseases, several problems currently exist. One problem with current gene therapy methods is that gene-corrected cells growing in culture or in vivo, often do not expand rapidly. If these cultures could be treated so as to expand more rapidly, the gene therapy process could become more efficient and more likely to succeed. Thus, methods that are capable of increasing the rate of expansion of cells, such as mammalian hematopoietic cells, either in vitro or in vivo, would be useful to improve the effectiveness of a variety of gene therapy methods. Likewise, increasing the rate of expansion, and/or favoring the persistence of mammalian hematopoietic stem cells or progenitor cells, in vitro or in vivo, would be of great value independently of gene therapy methods and indications, including, but not restricted to, stem cell transplantation with and without ex vivo modification.
SUMMARY OF THE INVENTION
[0005] In some embodiments of the present invention, a method of increasing cell proliferation by modulating levels of EVI and related genes is provided. Activation of EVI-1, PRDMl 6, or SETBP1 can increase the proliferation rate, self renewal and/or in vitro and/or in vivo survival and/or engraftment of human cells, either in vitro or in vivo. The gene modulation can be performed by various means, including traditional cloning methods and retroviral-based gene activation methods. The method can also be used to more efficiently deliver gene-corrected cells to a patient in need of treatment.
[0006] In some embodiments of the present invention, a method of expanding cells is provided, by obtaining at least one cell from a patient, transfecting, infecting or transducing said cell with a retroviral or nonintegrating vector, such that cell entry and/ or integration of the vector promotes proliferation, persistence, or selective advantage of the cell, allowing the transfected cell to proliferate, reinfusing a plurality of proliferated transfected cells into said patient, and allowing said proliferated cells to expand further in the patient. The transfected cell can have characteristics of a cell such as, for example, a hematopoietic progenitor cell, a hematopoietic stem cell, or a stem cell. The method can be used to treat a patient with a hematopoietic or other treatable disease. The vector can also have a sequence for correction or modification of a defective or deleterious gene.
[0007] In additional embodiments of the present invention, a method of increasing cell proliferation in a mammalian cell is provided, by obtaining a cell, contacting the cell with a nucleic acid sequence encoding a protein selected from the group consisting of EVI-1, PRDMl 6, SETBP1, and a fragment thereof, allowing said nucleic acid to enter the cell, and allowing said cell to proliferate, where the cell having the nucleic acid proliferates at an increased rate compared to a cell that has not been contacted with the nucleic acid sequence. The proliferation can occur, for example, in a cell culture, ex vivo, or in vivo. The nucleic acid can integrate, for example, into the chromosomal DNA. The nucleic acid can be present, for example, in the cytoplasm of the cell. The nucleic acid can be operably linked to a promoter. The nucleic acid can be constitutively expressed. The expression of the nucleic acid can be inducible, for example, by an exogenously added agent. The nucleic acid can be present in a vector, such as, for example, a viral vector. The nucleic acid can be expressed for a number of division cycles such as, for example, about 1, 3, 5, 8, 10, 13, 17, or 20 division cycles, then expression can decrease or stop thereafter. The cell can have characteristics of a cell selected from the group consisting of a hematopoietic stem cell, hematopoietic progenitor cell, a stem cell, an embryonic stem cell, an adult stem cell, a multipotent stem cell, and a myelopoietic stem cell.
[0008] m a further embodiment of the present invention, a method of expansion of a gene-corrected cell is provided, by obtaining a cell in need of gene correction, transfecting the cell with a functional copy of a the gene in need of correction, transfecting the cell with a copy of a nucleic acid encoding a polypeptide sequence selected from the group consisting of EVI-1, PRDM 16, SETBP1, and a fragment thereof; and allowing the cell to proliferate in culture.
[0009] In a further embodiment of the present invention, a method of forming a bodily tissue having gene corrected cells is provided, by obtaining a cell in need of gene correction, transfecting the cell with a functional copy of a the gene in need of correction, transfecting the cell with a copy of a nucleic acid encoding a polypeptide sequence selected from the group consisting of EVI-1, PRDMl 6, SETBP1, and a fragment thereof, allowing the cell to proliferate in culture, and treating the cell culture to allow formation of a bodily tissue.
[0010] In a further embodiment of the present invention, a method of identifying a gene is provided, the modulation of which increases the proliferation rate of a cell, by obtaining a sample of cells from a patient having previously received a therapeutic transfection with a nucleic acid sequence, identifying positions of nucleic acid insertion in the cells from the sample, identifying a favorable insertion site based upon disproportional representation of the site in the population of transfected cells, and identifying a gene associated with the insertion site.
[0011] In a yet further embodiment of the present invention, a nucleic acid integration region is provided, that, when insertionally modulated, results in increased hematopoietic cell proliferation, as is selected from the EVI-1 gene, the PRDM 16 gene, and the SETBP1 gene.
[0012] In a further embodiment of the present invention, a nucleic acid sequence whose modulation of expression is associated with the increased proliferation of hematopoietic cells is provided, selected from the following group: MGC 10731, PADI4, CDA, CDW52, ZBTB8, AK2, FLJ32112, TACSTD2, FLJ13150, MGC24133, NOTCH2, NOHMA, EST1B, PBXl, PLA2G4A, HRPT2, ATP6V1G3, PTPRC, NUCKS, CABC1, LOC339789, PRKCE, AFTIPHILIN, NAGK, MARCH7, DHRS9, PRKRA, SESTD1, MGC42174, CMKOR1, TBC1D5, THRB, MAP4, IFRD2, ARHGEF3, FOXP1, ZBTB20, EAF2, MGLL, PLXND1, SLC9A9, SELT, CCNLl, MDS1, BCL6, MIST, STM2, TEC, OC1AD1, FLJ10808, SEPTIl, PRKG2, MLLT2, PGDS, MANBA, SRYl, SET7, MAML3, DCTD, CARF, IRF2, AHRR, POLS, ROPN1L, FLJ10246, IPOIl, C2GNT3, SSBP2, EDIL3, SIAT8D, FLJ20125, GNB2L1, C6orfl05, JARID2, C6orf32, HCG9, MGC57858, TBCC, SENP6, BACH2, REPS1, HDAC9, OSBPL3, H0XA7, CALN1, FKBP6, NCF1, HEPl, GNAI7, ZKSCAN1, MGC50844, LOC346673, CHRM2, ZH3HAV1, REPIN1, SMARCD3, CTSB, ADAM28, LYN, YTHDF3, SMARCA2, C9orf93, NPR2, BTEBl, ALDHlAl, AUH, C9orf3, WDR31, CEP1, GSN, RABGAP1, ZNF79, CUGBP2, C10orf7, PTPLA, PLXD2, ACBD5, PRKGl, MYST4, IFIT1, C10orfl29, CUEDC2, FAM45A, GRK5, OR52NI, OR2AG2, ZNF143, C1 lorffi, LM02, NGL-I, DGKZ, NR1H3, KBTBD4, C1QTNF4, MGC5395, ARRBl, FLJ23441, FGIF, MAML2, LOC196264, HSPC063, ELKS, CACNA2D4, CHD4, EPS8, LRMP, NEUROD4, RNF41, FAM19A2, RASSF3, PAMC1, PLXNC1, DAP13, MGC4170, FLJ40142, JIK, CDK2AP1, GPR133, PCDH9, C13or£25, ABHD4, AP4S1, MIA2, RPS29, PSMC6, RTN1, MED6, C14orf43, C14orfll8, RPS6KA5, GNG2, PAK6, B2M, ATP8B4, TRIP4, CSK, MESDC1, RKHD3, AKAP13, DET1, DKFZp547K1113, SV2B, LRRKl, CHSYl, TRAF7, ZNF205, ABCC1, THUMPD1, IL21R, MGC2474, N4BP1, SLIC1, CDH9, GPR56, ATBF1, ZNRF1, CMIP, MGC22001, C17orf31, SAT2, ADORA2B, TRPV2, NF1, LOC117584, MLLT6, STAT5A, STAT3, HOXB3, HLF, MAP3K3, SCN4A, ABCA10, EPB41L3, ZNF521, RNF125, SETBP1, FLJ20071, CDH7, MBP, MBP, NFATC1, GAMT, MOBKL2A, NFIC, CALR, GPSN2, ZNF382, EGLN2, PNKP, LAIR1, ZNF579, SOX12, C20orD0, PLCBl, SNX5, LOC200261, ZNF336, BAKl, SPAG4L, EPB411L1, NCOA3, KIAA1404, STIMN3, CBR3, DYRKlA, CSTB, C22orfl4, UPBl, MN1, XBP1, C22orfl9, RBM9, MYH9, TXN2, PSCD4, UNC84B, FLJ2544, ZCCHC5, MST4, IDS, UTY, SKI, PRDM16, PARK7, CHC1, ZMYMl, INPP5B, GLIS1, SLC27A3, ASHlL, SLAMF1, PBXl, CGI-49, ELYS, RNF144, FAM49A, FLJ21069, SFRS7, SPTBN1 , TMEM17, ARHGAP25, FLJ20558, CAPG, PTPN18, RBMS1, LOC91526, KLF7, FLJ23861, CMKOR1, CRBN, ITPR1, RAFTLIN, TNA, CCDC12, FHIT, VGL-3, PPMlL, EVI-1, MDS1, HDSH3TC1, DHX15, TMEM33, CXCL3, EPGN, LRBA, FLJ25371, CPE, POLS, PTGER4, LHFPL2, C5orfl2, CETN3, PHF15, PFDN1, KIAA0555, GNB2L1, HLA-E, SLC17A5, UBE2J1, BACH2, HIVEP2, SNX8, TRIAD3, RAC1, ARL4A, ELMOl, BLVRA, SUNC1, ABCA13, GTF2IRD1, RSBN1L, ADAM22, MLL5, IMMP2L, SEC8L1, FLJ12571, CULl, ANGPT1, DEPDC6, EPPKl, MLANA, MLLT3, SMUl, TLE4, C9orf3, ABCAl, STOM, RABGAP1, NEK6, NR5A1, MGC20262, FLJ20433, MAP3K8, ARHGAP22, C10orf72, TACR2, NKX2, OBFC1, VTIlA, ABLFMl, FLJ14213, MS4A3, B3GNT6, NADSYN1, CENTD2, MAML2, ATP5L, FLIl, CACNAlC, HEBP1, MLSTD1, IPO8, ARID2, SLC38A1, KRT7, USP15, KIAA1040, WIF1, CGI-119, DUSP6, FLJl 1259, CMKLR1, SSHl, TPCN1, FLJ42957, JIK, FLT3, TPT1, FNDC3, ARHGAP5, ARF6, GPHN, C14orf4, STN2, PPP2R5C, CDC42BPB, CEP152, 0AZ2, AKAP13, CHSYl, CRAMP1L, MHC2TA, NPP, SPN, MMP2, DKFZp434I099, SIAT4B, PLCG2, MYOlC, C17orBl, MGC51025, WSBl, TRAF4, SSH2, HCA66, RFFL, DUSP14, TCF2, ZNF652, STXBP4, HLF, MSE, VMP1, HELZ, TREM5, RAB37, SEC 14Ll, SEPT9, BIRC5, PSCD1, MGC4368, NDUFV2, C18orf25, ATP8B1, CDH7, FLJ44881, NFATC1, C19orf35, GNG7, MATK, C3, ZNF358, LYLl, F2RL3, ZNF253, ZNF429, KIAA1533, U2AF1L3, GMFG, BC-2, C20orf30, PLCBl, LOC200261, C20orfll2, ADA, PREXl, C21orB4, C21orf42, ERG, ABCGl, MN1, HORMAD2, LOC113826, C22orfl, EFHC2, SYLT4, MGC27005, FHLl, GAB3, and CSF2RA.
[0013] In a further embodiment of the present invention, a method of identifying a favorable insertion site of a nucleic acid sequence in a proliferating cell culture is provided, by transfecting a cell sample with a nucleic acid sequence, allowing cell proliferation to occur, determining at least one main insertion site of the nucleic acid using linear amplification mediated PCR (LAM-PCR) over time, using the at least one main insertion site to predict the location of at least one main insertion site of another cell sample transfected with a substantially similar nucleic acid sequence over a similar time period, obtaining a sample of cells from a patient having previously received a therapeutic transfection with a nucleic acid sequence, identifying positions of nucleic acid insertion in the cells from the sample, and identifying a favorable insertion site based upon disproportional representation of the site in the population of transfected cells.
[0014] In a further embodiment of the present invention, a method of expansion of a cell is provided, comprising contacting the cell with a polypeptide selected from the group consisting of: an EVI-1 polypeptide, a PRDMl 6 polypeptide, a SETBP1 polypeptide, a fragment thereof, or a synthetic peptide derivative thereof.
[0015] In a further embodiment of the present invention, a method of treating an individual having a disease caused by a mutated gene or an inappropriately expressed gene is provided, by administered cells that have been corrected for the gene of interest, where the cells also have an increased level of at least one of an EVI-1 polypeptide, a PRDM 16 polypeptide, or a SETBP1 polypeptide. In additional embodiments of the present invention, the disease is chronic granulomatous disease (CGD).
[0016] In additional embodiments of the present invention, a method of improving gene therapy is provided, by treating an individual with gene-corrected cells that have also been altered to have increased levels of at least one of the following polypeptides: an EVI-1 polypeptide, a PRDMl 6 polypeptide, or a SETBP1 polypeptide.
BRIEF DESCRIPTION OF THE DRAWINGS
[0017] Figure 1 shows hematopoietic reconstitution and gene marking in patient P1 after gene therapy. Cell counts are shown both before and after gene therapy. Absolute neutrophil counts are measured against the right y-axis, while counts of helper T cells (CD4+CD3+), cytotoxic T cells (CD8+CD3+) and B cells (CD 19+) are measured against the left y-axis.
[0018] Figure 2 shows hematopoietic reconstitution and gene marking in patient P2 after gene therapy. Cell counts are shown both before and after gene therapy. Absolute neutrophil counts are measured against the right y-axis, while counts of helper T cells (CD4+CD3+), cytotoxic T cells (CD8+CD3+) and B cells (CD19+) are measured against the left y-axis.
[0019] Figure 3 illustrates quantification of gene-modified cells in peripheral blood leukocytes (PBL), granulocytes (CD 15+), T-cells (CD3+) and B cells (CD 19+) for patient P1 by quantitative PCR (QPCR).
[0020] Figure 4 illustrates quantification of gene-modified cells in peripheral blood leukocytes (PBL), granulocytes (CD 15+), T-cells (CD3+) and B cells (CD 19+) for patient P2 by quantitative PCR (QPCR).
[0021] Figure 5 shows gene marking in CFCs derived from bone marrow aspirates of patient P1 (days +122 and +381). Vector-containing CFCs were detected by PCR using primers specific for cDNA encoding gp91phox. Input DNA was controlled by amplification of sequences derived from the human erythropoietin receptor (hEPO-R).
[0022] Figure 6 shows gene marking in CFCs derived from bone marrow aspirates of patient P2 (days +119 and +245). Vector-containing CFCs were detected by PCR using primers specific for cDNA encoding gp91phox. Input DNA was controlled by amplification of sequences derived from the human erythropoietin receptor (hEPO-R).
[0023] Figure 7 illustrates the RIS distribution of retroviral vector insertions from 30 kb upstream to 5 kb downstream of RefSeq genes in patient P1. Absolute numbers of integrations into the 3 common integration site (CIS) related RefSeq genes MDS1/EVI-1, PRDM 16 and SETBP1 are shown as black bars, while integrations into non CIS-related genes are shown in grey. The insertions are listed according to their location within the affected gene expressed as the percentage of the overall length of the gene. The last column summarizes all integrations up to 5 kb downstream of a gene. Up, upstream of the start of transcription; down, downstream of the RefSeq gene. TSS, transcription start site.
[0024] Figure 8 illustrates the RIS distribution of retroviral vector insertions from 30 kb up- to 5 kb downstream of RefSeq genes in patient P2. Absolute numbers of integrations into the 3 CIS related RefSeq genes MDS1/EVI-1, PRDM16 and SETBP1 are shown as black bars, while integrations into non CIS-related genes are shown in grey. The insertions are listed according to their location within the affected gene expressed as the percentage of the overall length of the gene. The last column summarizes all integrations up to 5 kb downstream of a gene. Up, upstream of the start of transcription; down, downstream of the RefSeq gene. TSS, transcription start site.
[0025] Figure 9 shows a LAM-PCR band pattern analysis of peripheral blood leukocytes and sorted CD14+, CD15+, CD3+ and CD19+ cells (purity CD3+/CD19+, >98%) derived from patient P1 from 21 to 542 days post-transplantation after undergoing CGD gene therapy as described in Example 1. M, 100 bp ladder; -C, 100 ng non-transduced human genomic DNA; 3' IC, 3'-LTR internal control.
[0026] Figure 10 shows a LAM-PCR band pattern analysis of peripheral blood leukocytes and sorted CD14+, CD15+, CD3+ and CD19+ cells (purity CD3+/CD19+, >98%) derived from patient P2 from 24 to 343 days post-transplantation after undergoing CGD gene therapy as described in Example 1. M, 100 bp ladder; -C, 100 ng non-transduced human genomic DNA; 3' IC, 3'-LTR internal control.
[0027] Figure 11 is a DNA map showing retroviral insertion site (RIS) clusters in highly active clones with integrants in the MDS1/EVI-1 gene. The insertions are tightly clustered within relevant regulatory upstream portions of the gene locus. Grey dots indicate RIS derived from P1, while white squares indicate RIS from P2.
[0028] Figure 12 is a DNA map showing RIS clusters in highly active clones with integrants in the PRDM 16 gene. The insertions are tightly clustered within relevant regulatory upstream portions of the gene locus. Grey dots indicate RIS derived from P1, while white squares indicate RIS from P2.
[0029] Figure 13 is a DNA map showing RIS clusters in highly active clones with integrants in the SETBP1 gene. The insertions are tightly clustered within relevant regulatory upstream portions of the gene locus. Grey dots indicate RIS derived from P1, while white squares indicate RIS from P2.
[0030] Figure 14 shows the long term follow up of individual clones contributing to hematopoiesis at different time points after transplantation in patient P1. Each individual CIS related clone detected is represented by one line, with each column representing an individual sampling time point. Grey boxes represent the detection of a specific clone at a time point via LAM-PCR, tracking PCR, and/or quantitative-competitive (QC-) PCR. The white boxes indicate the lack of detection at that time point, indicating that the clone contributes no or few cells to the peripheral circulation. *, no LAM-PCR performed; §, no tracking PCR performed; #, no QC-PCR performed.
[0031] Figure 15 shows the long term follow up of individual clones contributing to hematopoiesis at different time points after transplantation in patient P2. Each individual CIS related clone detected is represented by one line, with each column representing an individual sampling time point. Grey boxes represent the detection of a specific clone at a time point via LAM-PCR, tracking PCR, and/or quantitative-competitive (QC-) PCR. The white boxes indicate the lack of detection at that time point, indicating that the clone contributes no or few cells to the peripheral circulation. *, no LAM-PCR performed; §, no tracking PCR performed; #, no QC-PCR performed.
[0032] Figure 16 is a graph showing the overall contribution of clones with insertions in or near the three CIS-related RefSeq genes compared to all RIS locations at different time points detected in patient P1 during long-term myelopoiesis after gene modification. The insertion frequencies at MDS1-EVI-1 (light gray), PRDM 16 (dark gray) and SETBP1 (black) in relation to non-CIS-related insertion frequencies (white) is illustrated as a percentage of all integration site junction sequences (entire column) detected at each specific time point. The black line denotes the approximate percentage of gene marked cells containing vector gp91phox among peripheral blood granulocytes. BM, bone marrow; G, granulocytes; MC, monocytes; PB, peripheral blood.
[0033] Figure 17 is a graph showing the overall contribution of clones with insertions in or near the three CIS-related RefSeq genes compared to all RIS locations at different time points detected in patient P2 during long-term myelopoiesis after gene modification. The insertion frequencies at MDS1-EVI-1 (light gray), PRDM 16 (dark gray) and SETBP1 (black) in relation to non-CIS-related insertion frequencies (white) is illustrated as a percentage of all integration site junction sequences (entire column) detected at each specific time point. The black line denotes the approximate percentage of gene marked cells containing vector gp91phox among peripheral blood granulocytes. BM, bone marrow; G, granulocytes; MC, monocytes; PB, peripheral blood.
[0034] Figure 18 illustrates a series of electrophoretic separations of nucleic acid on agarose gels showing the quantitative-competitive analysis of predominant clones from patient P1. The coamplification of 50 ng wild-type (WT) DNA from PB in competition with 500 copies of a 26-bp deleted internal standard (IS) allows semi-quantitative estimation of single clones. Time-course analysis revealed the sustained presence of all clones after their first detection (> 3 months post-transplant). Numbers indicate days after transplantation. -C, 50 ng non-transduced genomic DNA.
[0035] Figure 19 illustrates a series of electrophoretic separations of nucleic acid on agarose gels showing the quantitative-competitive analysis of predominant clones from patient P2. The coamplification of 50 ng wild-type (WT) DNA from PB in competition with 500 copies of a 26-bp deleted internal standard (IS) allows semi-quantitative estimation of single clones. Time-course analysis revealed the sustained presence of all clones after their first detection (> 3 months post-transplant). Numbers indicate days after transplantation. -C, 50 ng non-transduced genomic DNA.
[0036] Figure 20 shows LAM-PCR analysis of bone-marrow derived colonies from patient P1 at days +192 and +381 after transplantation. Colony numbers 1-3, 5, 7, 9-11, and 13 are colony-forming units — granulocyte-macrophage (CFU-GM)-derived colonies, whereas colonies 4, 6, 8, and 12 represent burst-forming units — erythrocyte (BFU-E) colonies. M, 100 bp ladder; -C, 100 ng nontransduced human genomic DNA. [0037] Figure 21 shows LAM-PCR analysis of bone-marrow derived colonies from patient P2 at day +245 after transplantation. Colony numbers 1-3 and 5 are CFU-GM- derived colonies, whereas colonies 4 and 6 represent BFU-E colonies. M, 100 bp ladder; -C, 100 ng nontransduced human genomic DNA.
[0038] Figure 22 illustrates transcriptional activation of CIS genes by retroviral insertion. RT-PCR analysis of MDS1/EVI-1 (a), PRDM16 (b) and SETBP1 (c) was performed on bone marrow from patient P1 at day +381 and on peripheral blood leukocytes from patient P2 at days +287 and +343. Panel (a) shows analysis of MDS1/EVI-1 plus EVI-1 transcripts in the upper panel (PR+/PR-) and analysis of MDS1/EVI-1 only transcripts in the lower panel (PR+). The primer pairs used to detected EVI-1 transcripts are located within EVI-1 (exon 5 to exon 6) and therefore also detect MDS1/EVI-1 transcripts. In contrast, MDS/EVI-1 transcripts were detected with primer pairs located in the second exon of MDS1 and EVI-1 (Example 6). Panel (b) shows analysis of PR+/PR- in the upper panel and analysis of PR+ in the lower panel for PRDMl 6 transcripts. Panel (c) illustrates analysis of SETBP1 expression level. Panel (d) shows results from the β-actin RT-PCR. -C, H2O control; PR, PR-domain; BM, bone marrow cells; PB, peripheral blood leukocytes; ND, healthy donor.
[0039] Figure 23 illustrates expression of gp91phox protein on transduced cells in the days after transplantation of the gene-modified cells. Granulocytes (CD 15+) and T cells (CD3+) of patients P1 (a) and P2 (b) were labeled with the monoclonal antibody 7D5 and a lineage specific marker.
[0040] Figure 24 show results that demonstrate continued expression of gp91phox protein and functional reconstitution of NADPH oxidase activity in transduced cells. The top panel illustrates gp91phox expression in CD34+ bone marrow cells of patient P1 at day +381. The bottom panel exhibits dithionite reduced minus oxidized differential spectra of flavocytochrome in protein extracts obtained from granulocytes. The granulocytes were isolated from the peripheral blood of a healthy donor ("control"), patient P1 at day +242 ("P1") and patient P2 at day +120 ("P2") after reinfusion of gene transduced cells. Granulocytes were also obtained from an X-CGD patient ("X-CGD") for comparison. The two major absorption peaks at 426 nm (γ-peak) and 559 nm (α-peak) correspond to the reduced heme groups within gp91phox and are visible in granulocyte extracts from a healthy donor and P1, while these bands are completely absent in extracts obtained from cells of an untreated X-CGD patient.
[0041] Figure 25 illustrates functional reconstitution of NADPH oxidase activity in peripheral blood leukocytes (PBLs) and isolated granulocytes of patient P1 as revealed by oxidation of dihydrorhodamine (DHR) 123 and NBT reduction. Superoxide production in PBLs was measured by DHR 123 oxidation in opsonised E. coli, as indicated by black dots. Superoxide production in isolated granulocytes was measured by stimulation with PMA (open dots) or by reduction of NBT to formazan (open squares).
[0042] Figure 26 shows an example of DHR 123 oxidation by neutrophils of patient P1 at day +473 after gene therapy both before (left panel) and after (right panel) PMA stimulation.
[0043] Figure 27 shows NBT reduction in single granulocytes obtained from patient P1 at day +381 after gene therapy both before (left panel) and after (right panel) stimulation with opsonised zymosan (OPZ).
[0044] Figure 28 illustrates functional reconstitution of NADPH oxidase activity in peripheral blood leukocytes (PBLs) and isolated granulocytes of patient P2 as revealed by oxidation of dihydrorhodamine (DHR) 123 and NBT reduction. Superoxide production in PBLs was measured by DHR 123 oxidation in opsonised E. coli, as indicated by black dots. Superoxide production in isolated granulocytes was measured by stimulation with PMA (open dots) or by reduction of NBT to formazan (open squares).
[0045] Figure 29 shows an example of DHR 123 oxidation by neutrophils of patient P2 at day +344 after gene therapy both before (left panel) and after (right panel) PMA stimulation.
[0046] Figure 30 shows NBT reduction in single granulocytes obtained from patient P2 at day +245 after gene therapy both before (left panel) and after (right panel) stimulation with opsonised zymosan (OPZ).
[0047] Figure 31 illustrates superoxide anion production by granulocytes obtained from a healthy control (a), patient P1 at day +193 (b) and patient P2 at day +50 (c) as revealed by cytochrome c reduction after stimulation with 0.1 μg/ml PMA plus 1 μM fMLP. The reaction was inhibited by superoxide dismutase (SOD) or specific inhibitors of the phagocytic NADPH oxidase activity, such as 4-2- Aminoethylbenzene sulfonylfluoride (AEBSF) or diphenylene iodonium (DPI). In panel (a), IxIO6 cells/ml were used in the reaction, while in panels (b) and (c) 5*106 cells/ml were used.
[0048] Figure 32 shows the kinetics of E. coli killing by neutrophils obtained from a healthy donor ("pos. control"), patient P1 ("P1"), patient P2 ("P2") and an individual with X-CGD ("X-CGD") compared to incubation of E. coli in the absence of granulocytes as a negative control ("E. coli control").
[0049] Figure 33 illustrates transmission electron microscopy images of opsonised E. coli strain ML-35 at 2.5 hours after phagocytosis by granulocytes from the healthy donor (d, h), the X-CGD patient (b, e), and patient P1 at day +242 (c, f, g) at a ratio of 10:1 (E. cø/z:granulocytes). Black arrows in (e) and (f) denote undigested E. coli inside the phagocytic vacuole. White arrows in (g) and (h) indicate E. coli degradation. Inserts on the upper right hand corner show magnifications of undigested (e, f) and digested (g, h) bacteria. Encircled areas in panels (b-d) indicate enlarged cells shown in panels (e-h). Scale bars in panels (b-d) represent 5 μm; in panels (e-h), 2 μm.
[0050] Figure 34 illustrates killing of A. fumigatus hyphae by gene-modified granulocytes as revealed by mitochondrial MTT reduction (a) and transmission electron microscopy (b - d). In panel (a), the time course of fungus killing is shown at a ratio of 1 seeded Aspergillus spore to 20 granulocytes obtained from either a healthy donor or patient P1 at day +381 after reinfusion of gene transduced cells. MTT reduction of Aspergillus hyphae alone was normalized to 100%. In panels (b-d), the fate of A. fumigatus hyphae after engulfment by healthy (b), non-corrected X-CGD (c) and functionally corrected (d) granulocytes is illustrated. Intact hyphae engulfed by phagocytes are marked with a black arrows (c, d), while hyphae with cytoplasmic disintegration entangled by phagocytes are marked with a white arrows (b, d). Bars in (b-d) represent 5 μm.
[0051] Figure 35 shows fused PET scans of patient P1 (b) and fused PET-CT scans of patient P2 (c,d) both before (a,c) and either 50 (b) or 53 (d) daus after gene therapy. The circle in (a) denotes two active abscesses due to Staphylococcus aureus infection in the liver of patient P1, and the circle in (c) shows 18F-FDG uptake in the wall of a lung cavity of patient P2 due to A. fumigatus infection. [0052] Figure 36 shows that immortalized bone marrow cells (SF-I cells) containing a Setbpl integration can engraft and induce myeloid leukemia with minimal to mild maturation in irradiated transplanted mice. Immortalized clones usually appeared after 1 month of culturing. The figure shows gates for Ly5.1+ cells from bone marrow (a, left), spleen (b, left), and thymus (c, left) from a mouse (Ly5.2) 2 months after transplantation with the immortalized clone SF-I. Staining was done with Gr-I (RB6-8C5)(a, right), CD 19 (lD3)(b, right), and Thy-1.2 (53-2. l)(c, right) antibodies and corresponding isotype control antibodies (a-c, middle lane) in combination with Ly5.2 antibody. Numbers represent the percent of gated events. Details of this protocol are described in Du et al., Blood 106:3932- 3939 (2005), herein incorporated by reference in its entirety.
Brief Description of the TABLES
[0053] Table 1 provides a list of proviral integration site sequences detected by LAM-PCR. LAM-PCR amplicons derived from patient P1 are shown in Table l(a) while those from patient P2 are listed in Table l(b). The RefSeq gene nearest to an identified integration site within a 100kb window is listed. The two integrations in the most productive clone in patient P1 are defined by the "Sequence Identity" 77110 A09 (MDS1) and 75916 A08 (OSBPL6 and PRKRA). "Genomic Length" denotes the size of the LAM-PCR amplicon without linker- and LTR-sequences. "Sequence Orientation" denotes vector integration within the human genome. TSS, transcription start site; PB, peripheral blood; BM, bone marrow; CD15, purified granulocytes; CD14-15, monocytes; In, intron; Ex, exon.
[0054] Table 2 provides a list of vector integrants detected in the CIS genes MDS1/EVI-1, PRDM16 and SETBPL Data for patient P1 is listed in Table 2(a) while data for patient P2 is listed in Table 2(b). Vector integration was detected by LAM-PCR (L), tracking PCR (T), and/or quantitative competitive PCR (Q). CIS clones chosen for a specific tracking over time are marked (T and/or Q) in the column "Track." The most productive clone in P1 which was tracked using the sequence information obtained from 75916 A08 is annotated in this table by the second integration 77110 A09 (MDS 1), which is also present in this particular clone. Empty spaces define no detection. CIS clones without "Integration Number" were additionally detected by tracking PCR due to their close location to other clones for which tracking PCR was performed. "Vector integration" indicates whether vector integration took place in the same orientation or in the reverse orientation of CIS gene expression. *, no LAM-PCR performed; §, no tracking PCR performed; #, no QC-PCR performed.
[00S5] Table 3 provides a list of primers used for specific tracking of individual CIS clones and generation of clone specific internal standard. F1anking primers 1 and 2 (FP1 and FP2), in combination with vector specific primers, were used to track an individual CIS clone in patients P1 (Table 3a) and P2 (Table 3b) over time and to generate a clone specific internal standard. For quantitative competitive PCR vector specific primers and flanking primers 3 and 4 (FP3 and FP4) were used to coamplify a particular integration site and the appropriate internal standard (as described in Example 4).
[0056] Table 4 provides the accompanying SEQ ID NO for each primer listed in Table 3.
[0057] Table 5 is a summary of clinical data showing the colony formation of bone marrow total BM mononuclear cells obtained from bone marrow aspirates of patient P1.
[0058] Table 6 is a summary of clinical data showing the incorporation of 3H- Thymidine into mitogen- or antigen-stimulated mononuclear cells vs. non-stimulated mononuclear cells obtained from patients P1 and P2 at different time points.
[0059] Table 7 is a summary of clinical data showing examples of plasma protein levels at days +546 for patient P1 and day +489 for patient P2.
DETAILED DESCRIPTION OF THE INVENTION
[0060] LAM-PCR analysis, described in U.S. Patent No. 6,514,706, hereby incorporated by reference in its entirety, is a highly sensitive method for identifying an unknown nucleic acid sequence that flanks a known sequence present in a sample. The method is a powerful way to determine the insertion position of a transferred nucleic acid, such as a retroviral vector sequence, after an integration event. In addition to the use of LAM-PCR to determine target site selection of an integrated nucleic acid species, the method can also be used to determine how the integration sites change over time in a dividing cell culture. Thus, the method is particularly useful for clonal analysis of transfected hematopoietic cells or other transfected cells.
CGD patient analysis using LAM-PCR
[0061] LAM-PCR analysis was used to examine blood samples from two patients that were successfully receiving gene therapy by retroviral-based gene correction to treat chronic granulomatous disease (CGD) in an ongoing trial as described in Example 1. In the CGD gene therapy trial, high efficiency transduction of autologous CD34+ bone marrow cells and busulfan conditioning were used to successfully correct the cytochrome b gρ91p ox gene defect in two patients for more than a year. A main goal of the analysis was to examine whether the retrovirus vector integration insertion site is less inert with respect to its genomic context than previously thought (Wu, et al. (2003) Science 300:1749-1751; Laufs, et al. (2003) Blood 101:2191-2198; Hematti, et al. (2004) PLoS Biol. 2:e423, each of which is hereby incorporated by reference in its entirety).
[0062] To determine whether an in vivo selective advantage of gene-modified myeloid cells capable of long term engraftment, proliferation and in vivo expansion, may be related to vector integration into particular genome regions, blood samples were taken from the two patients that achieved successful gene-corrected myelopoiesis in the CGD trial. A large-scale mapping analysis of retrovirus integration sites in the patient cells was then undertaken, using LAM-PCR as described in Example 3.
[0063] It was found that there is a significant influence of genomic vector integration on engraftment and proliferation of transduced hematopoietic cells. As shown herein, LAM-PCR based large-scale mapping of retrovirus integration sites (RIS) derived from the two successfully treated CGD patients shows that distribution of RIS became non- random starting about 3 months after reinfusion of gene corrected CD34+cells.
[0064] The repopulating cell clones contained activating insertions in three genes. These three genes are the "positive regulatory (PR) domain" zinc finger genes MDS1/EVI-1 and PRDM 16 and a SET binding protein SETBP1. The activating insertions were found to drive a 3 to 5 fold expansion of gene corrected cells, and selectively proliferated and dominated (>80%) gene-corrected long term myelopoiesis in both patients. These surprising results are in contrast to other research suggesting that retrovirus-based gene therapy would result in random monoallelic integration without relevant biological consequences (Coffin, et al. (1997), supra, which is hereby incorporated by reference in its entirety).
EVI-I. PRDM16. and SETBPl
[0065] Two of the three genes that were found to contain the activating insertions encode zinc finger proteins that are related PR domain proteins. Several types of proteins, including certain transcriptional regulatory proteins, have regions that fold around a central zinc ion, producing a compact domain termed a "zinc finger." Several classes of zinc-finger motifs have been identified. One group of zinc finger proteins is the "PR domain family" of transcription factor proteins, which includes, for example, the related genes EVI-1, PRDM16, and others. These PR domain family genes have been implicated, in some cases, to play a role in the development of cancer.
[0066] The EVI-1 protein ("ecotropic viral integration site 1") is a zinc finger DNA-binding protein that is characterized by two domains of seven and three repeats of the Cys2-His2-type zinc finger motif (Morishita et al. (1988) Cell 54: 831-840; for a review, see Chi et al. (2003) J Biol Chem. 278:49806-49811, each of the foregoing which is hereby incorporated by reference in its entirety). Although EVI-1 is not generally detected in normal hematopoietic organs including bone marrow, the inappropriate expression of EVI-1 is often triggered by chromosomal rearrangements that disrupt the 3q26 chromosomal region where the EVI-1 gene is located (Fichelson, et al. (1992) Leukemia 6:93-99, which is hereby incorporated by reference in its entirety). Further, EVI-1 up-regulation can occur in chronic myelogenous leukemia patients, even though chromosomes appear normal by conventional cytogenetics, indicating that the inappropriate activation of EVI-1 can occur. High EVI-1 expression has been shown to predict poor survival in acute myeloid leukemia (Barjesteh van Waalwijk van Doom-Khosrovani, et al. (2003) Blood 101: 837-845, which is hereby incorporated by reference in its entirety). The related zinc finger protein PRDM16 ("positive regulatory domain containing 16") has also been found to be a DNA binding protein.
[0067] The PR domain is characteristic for a sub-class of zinc finger genes that function as negative regulators of tumorigenesis [Fears, S. et al., 1996, Proc. Natl. Acad. ScL 93:1642-1647, herein incorporated by reference in its entirety]. The PR domain of MDS1/EVI-1 (alias PRDM3) is a common target for wild-type retrovirus and vector insertion induced tumorigenesis, where the disruption of the PR domain activates PR domain negative oncogene EVI-1. Constitutive expression of the PR negative oncogene EVI-1 induces self- limiting myeloproliferation followed by a myelodysplastic syndrome in mice. The biology of PRDM16 (alias MDS1 -EVI-1 -like gene 1) is very similar to MDS1/EVI-1. In patients with myeloid malignancies, translocation of MDS1/EVI-1 or PRDM16 next to Ribophorin 1 gene on chromosome 3q21 leads to overexpression of the alternatively spliced PR domain negative transcript.
[0068] SET is a translocation breakpoint-encoded protein in acute undifferentiated leukaemia and SET binding protein 1 (SETBP1) is assumed to play a key role in SET associated leukemogenesis.
[0069] In experimental results, the LAM-PCR analysis showed a stable highly polyclonal hematopoietic repopulation of gene-corrected cells up to 381 days in patient 1 (P1) and up to 343 days in patient 2 (P2), although the band pattern indicated the appearance of individual pre-dominant clones 5 months after therapy (Figures 9, 10). A total of 948 unique RIS (patient P1: 551; patient P2: 397) were retrieved by shotgun cloning and sequencing of LAM products, of which 765 (P1: 435; P2: 330) could be mapped unequivocally to the human genome using the UCSC BLAT alignment tools. Integration preferentially occurred in gene coding regions (P1: 47%; P2: 52%) and was highly skewed to the ± 5kb transcriptional start site region (P1: 20%; P2: 21%) (Figures 7, 8).
[0070] RIS distribution in both patients was not stable over time and became increasingly non-random but still polyclonal in both patients. The distribution also clustered to a much higher degree around particular common insertion sites (CIS) than shown by previous in vitro and in vivo integration site studies (Wu, et al. (2003) Science 300:1749- 1751; Laufs, et al. (2003) Blood 101:2191-2198; and Hematti, et al. (2004) PLoS Biol. 2:e423, each of which is hereby incorporated by reference in its entirety). This clustering around common insertion sites allowed the prediction of the distribution and location of P2 insertions from the results in P1, whose gene modification procedure had been conducted 4 months earlier. The clonal contribution pattern turned into a less diverse pattern with distinct bands starting 5 months after therapy (Figures 9, 10), indicating the appearance of multiple predominant progenitor cell clones which subsequently contributed substantially to the proportion of gene-corrected granulocytes. Sequencing of insertion loci revealed that these pattern changes were due to the emergence of clones containing an insertion in one of 3 genetic loci, or CISs [Suzuki, T. et al. New genes involved in cancer identified by retroviral tagging. Nature Genet 32, 166-174 (2004), herein incorporated by reference in its entirety]. (Tables 1-3). AU 134 detectable integrations at these three CISs occurred either in or near PR domain-containing zinc finger genes MDS1/EVI-1 or PRDM16 or in or near the SETBP1 gene. AU insertions were located in or near the upstream region of these genes, preferentially close to the transcriptional start site or internal ATG sites (Figures 7, 8, and 11-13), exhibiting an unprecedented degree of non-random clustering.
[0071] Multiple clones with insertion sites in or near 2 particular positive regulatory (PR) domain zinc finger genes and SETBP1 began to emerge almost 3 months (patient P1: day 84; patient P2: day 80) after treatment, continuously developing to sustained clonal domination within the next 2 months after treatment (P1: day 157, P2: day 149) in both patients. Of 134 PR domain and SETBP1 CIS that have been detected, 91 distinct integrants were found in or near MDS1/EVI-1 (patient P1: 42; patient P2: 49), 36 in PRDM16 (P1: 18; P2:18) and 7 in SETBP1 (P1: 7; P2: 0).
Selective advantage of EVI-L PRDM 16. and SETBPl integrants
[0072] Granulocytes have a life-span of 2-3 days. Therefore, the repeated detection over time of individual cell clones by retrovirus insertional marking is indicative of a repopulating progenitor cell or stem cell with long-term activity. The expansion of repopulating clones with these insertions occurred in both patients P1 and P2 with significant intensity. PR domain and SETBP1 related insertions comprised > 90% of all clones detected at more than three time points after treatment. The in vivo selection advantage of these clones was further underlined by the observation that of 134 hits into gene loci affected by insertions more than three times, all of these CIS were related to these 3 genes. Within these gene loci, insertion events were highly non-randomly distributed and clustered near the transcriptional start site and internal ATG sites, strongly suggesting that a vector induced change of gene expression conferred a selective advantage to these clones (Figures 7,8, and 11-13).
[0073] In addition to the three genes discussed above, other gene insertion locations were found to be present. A summary list of the other LAM-PCR retrieved RIS and CIS is provided in Table 1.
Figure imgf000023_0001
Table 1a
Figure imgf000024_0001
Figure imgf000025_0001
Figure imgf000026_0001
Figure imgf000027_0001
Figure imgf000028_0001
Figure imgf000029_0001
Figure imgf000030_0001
Figure imgf000031_0001
Figure imgf000032_0001
Figure imgf000033_0001
Figure imgf000034_0001
Figure imgf000035_0001
Table 1a
Figure imgf000036_0001
Figure imgf000037_0001
Figure imgf000038_0001
Figure imgf000039_0001
Figure imgf000040_0001
Figure imgf000041_0001
Figure imgf000042_0001
Figure imgf000043_0001
Figure imgf000044_0001
Figure imgf000045_0001
Table 1b
Figure imgf000046_0001
Table 1b
Figure imgf000047_0001
Analysis of insertion location changes over time using LAM-PCR
[0074] To assess the overall contribution of PR domain (PR+) clones and SETBP1 clones to myelopoiesis over time, the retrieval frequency of unique insertions in shot-gun cloned and sequenced LAM-PCR amplicons was determined from the two patients. After the first appearance of PR+ and SETBP1 RIS on day 84 (patient P1) and day 80 (patient P2), their proportional contribution successively increased to more than 80% of insertions retrieved from circulating transduced cells within the next 100-150 days. The levels of contribution from the 3 CIS then stabilized, matching the 3- to 4-fold expansion of gene- modified myelopoiesis, and plateaued without abnormal elevation of total leukocyte or neutrophil numbers (Figures 16,17). Individual clones showed substantial differences in their quantitative myeloid contribution over time. PCR tracking (as described in Example 4) of the 3 CIS clones confirmed the presence of some insertions that were only detectable in one sample as well as other more dominant clones that persistently accounted for substantial percentages of peripheral blood myeloid cells without evidence of exhaustion (Figures 14, 15 and Table 2). Dominant clones were further analyzed by quantitative-competitive (QC) PCR (as described in Example 5), which confirmed their stability for a period of between 5 to 14 months after the initial expansion (Figures 18, 19).
Figure imgf000049_0001
Figure imgf000050_0001
Table 2b
Figure imgf000051_0001
Figure imgf000052_0001
[0075] Quantitative-competitive PCR was then used to further analyze the dominant clones (as described in Example 5). A spiked internal standard was used to test for clinically relevant continued proliferation. Stable activity was observed for a period of between 5 to 14 months (Figures 14, 15, 18, and 19). The most productive clone in patient P1 contained two insertions, one in intron 2 of the MDS1 gene locus and the other one in an intergenic DNA region. This clone's quantitative contribution to the transduced cell pool was first detected by LAM-PCR at +122 days post transplant. From day +122 on, it then increased until it peaked at about 80% of gene-modified cells present in the peripheral blood at day +381. So far, it has remained at this level until the last time point analyzed (day +542). Detection of this clone was also conducted by QC-PCR in sorted granulocytes, B and T cells at day +542 indicating the multilineage potential of the initial transduced cells (Table 2). The increasing dominance of this clone was also documented by integration site analysis and locus specific PCR of bone marrow progenitors (CFU-GM and BFU-E). Although at day +192 only 3 out of 6 (3 out of 11 by locus specific PCR) vector-containing colonies contained the same two insertion bands, the dominant clone contributed to 6 out of 7 (28 out of 36 by locus specific PCR) colonies at day +381 (Figure 20). Analysis of five additional clones revealed shared integration sites between CD3+ cells, CD 19+ cells and CD 15+ cells obtained from P1 at days +381 and +542, again suggesting effective gene transduction of hematopoietic stem cells (HSC) (Figures 9, 18, and Table 2). In P2, no single clone had a strong dominance, up to day +343 (Figure 21). Approximately 1.5 to 2.6 insertions are thought to be present in the gene modified cell transplants based on the average copy number per CD34 cell transplanted and its relation to the percentage of gp91phox protein expression in CD34 cells infused. In line with this average, LAM-PCR analysis of colonies sampled from long-term repopulating cells demonstrated that the CFU colonies contained between 1 and 4 integrants per cell (Figures 20, 21).
[0076] The highest frequency of PRDM 16 related integration sites retrieved from patient P1 by LAM-PCR was obtained at day +157 (30% of the transduced cell pool) and then continuously decreased until day +542 (1.1%). In patient P2, the frequency of PRDM16 inserted clones decreased from day +175 (23.7%) to day +343 (12.8%). Conversely, during the same time period, the frequency of MDS1/EVI-1 integrants increased in P1 from 12% to 90.1% and in P2 from 20.6% to 64.9%. On day +304, SETBP1 insertions accounted for 8.4% of all integrants in P1, but from day +339 no further SETBP1 insertions were detected by LAM-PCR. Residual activity of individual SETBP1 clones could be detected by tracking PCR on days +381, +416, +472 and +542 (Table 2).
[0077] The mechanistic relevance of these insertions can be demonstrated by the detection of specific mRNA transcripts in bone marrow (BM) from P1. Elevated levels (>1 log) of PR domain positive MDS1/EVI-1, PRDM 16 and of SETBP1 mRNA transcripts were found by RT-PCR.
[0078] As demonstrated herein, retrovirus gene activation can occur as a consequence of any retrovirus vector insertion event, and may be of influence on the biological fate of the target cell. The location of an insertion defines the likelihood of whether such events lead to side effects, ultimately depending on the biological relevance of a gene for the affected cell type, in this case hematopoiesis. This data is of very significant influence for the efficacy and biosafety assessment of gene therapy vectors in ongoing and future clinical trials. Depending on the clinical outcome, this insertional side effect, very likely favored by reinfusion of high numbers of gene corrected CD34+ BM cells containing insertion events, may have facilitated the therapeutic success observed.
[0079] The above described analysis demonstrates a previously unknown role of PR domain genes and SETBP1 in the proliferation of morphologically normal long-term repopulating progenitor cells. This finding can be used to treat a number of mammalian diseases, as described below.
Functional properties of MDSl/EVI-1. PRDM 16. and SETBPl clones
[0080] To confirm the functional influence of these insertions via gene activation, specific mRNA transcripts were analyzed by RT-PCR (as described in Example 6). At day +381 bone marrow cells from patient P1 contained substantially elevated levels of both MDS1/EVI-1 and of SETBP1 mRNA transcripts, whereas PRDM 16 transcripts were present at levels comparable to control bone marrow (Figure 22). RNA microarray analysis of the same sample using the Affymetrix HG U133_Plus_2.0 Array confirmed overexpression of MDS1/EVI-1 or EVI-1 (36-fold) and SETBP1 (32-fold). Abnormal expression of PRDM16 was not found. RT-PCR performed on RNA samples obtained from peripheral blood leukocytes from patient P2 at days +287 and +343 showed overexpression of MDS1/EVI-1 and PRDM 16, while SETBP1 transcripts were not detected. A microarray analysis of the same samples revealed a 74-fold overexpression of MDS1/EVI-1.
[0081] Transduced cells were strictly dependent on growth factors for proliferation and differentiation. No colony formation was observed when bone marrow mononuclear cells (patient P1: days +122, +192 and +241) were plated on methylcellulose and cultured for 14 days in the absence of cytokines (as described in Example 7). Colony forming cells (CFCs) derived from CD34+ cells of patient P1 at day +381 were replated in the presence of cytokines into secondary and tertiary methylcellulose cultures. Few cell clusters were visible after the second replating, while no growth was observed in further replatings, indicating the absence of self-renewal capacity. Similar results were obtained with cells from patient P2 at day +245. Furthermore, 1000 human CD34+ cells derived from patient P1 at day +381 were injected into each of two nude nonobese diabetic-severe combined immunodefϊcient (NOD-SCID) B2m~/~ mice. No engraftment of CD45+ cells in these mice were observed.
Functional reconstitution of phagocytic killing activity
[0082] Expression of gp91phox was detected by FACS using the monoclonal antibody 7D5 (as described in Example 8 and Yamauchi, A. et al. Location of the epitope for 7D5, a monoclonal antibody raised against human flavocytochrome b558, to the extracellular peptide portion of primate gp91phox. Microbiol Immunol 45, 249-257 (2001), herein incorporated by reference in its entirety). Gρ91phox was present mainly in CD 15+ cells with as many as 60% (patient P1, day +304) and 14% (patient P2, day +287) of the cells expressing the transgene. Correctly assembled flavocytochrome_b558 heterodimers were found by spectroscopy in cell membrane extracts from granulocytes obtained from P1 and P2. Gp91phox expression was also detected in bone marrow derived CD34+ cells from P1 +381 days posttransplantation (Figures 23,24).
[0083] Functional reconstitution of respiratory burst activity in peripheral blood leukocytes (PBLs) was assayed after stimulation with opsonized E. coli by the dihydrorhodamine (DHR) 123 assay (Figures 25,28) (as described in Example 12). NADPH oxidase activity was detected in 10% to 20% of P1 leukocytes until day +122. Thereafter, a strong increase in the number of oxidase positive cells was observed. As many as 57% of patient Pi's leukocytes tested positive for superoxide production at day +304, followed by a decrease to 34.4% at day +542 (Figure 25). Similar results were obtained with purified granulocytes after stimulation with phorbol 12-myristate 13 -acetate (Figure 26) or by monitoring the reduction of nitroblue tetrazolium (NBT) to formazan in gene corrected neutrophils (Figure 27).
[0084] The time course of superoxide production was very similar in patient P2. The number of oxidase positive cells was high (>35%) shortly after infusion of gene- transduced cells, but decreased to 9.6% at day +149 post-transplantation. Subsequently, an increase in the number of oxidase positive cells of up to 24% (day +245) was observed (Figures 28, 29). This value decreased to 15.3% at day +287 and fluctuated thereafter between 19.8% (day +413) and 15% (day +491). These results were confirmed by the NBT assay on individual neutrophils (Figure 30).
[0085] Superoxide production was quantified in patient neutrophils by the cytochrome C reduction assay [Mayo, L.A. & Curnutte, J.T. Kinetic microplate assay for superoxide production by neutrophils and other phagocytic cells. Methods Enzymol 186, 567- 575 (1990), herein incorporated by reference in its entirety]. Total neutrophils obtained from patient P1 at day +193 produced 1.23 nmol superoxide/ 106 cells/min, which corresponds to 4.13 nmol/106 cells/min after correction for the number of oxidase positive cells at this time point (33%). Similarly, total neutrophils from patient P2 at day +50 produced 2.12 nmol superoxide/ 106 gene-corrected cells/min. In comparison, the amount of superoxide produced by wild type neutrophils was 14.35 ±6.28 nmol superoxide/106 cells/min (n=10; Figure 31).
[0086] Since the level of superoxide production in gene-corrected cells was at most one-third to one-seventh of the level measured in wild type cells, these cells were tested to determine whether they could kill ingested microorganisms. Bacterial killing was measured by monitoring β-galactosidase activity released by engulfed and perforated E. coli (as described in Example 9 and by Hamers, M.N., Bot, A.A., Weening, R.S., Sips, HJ. & Roos, D. Kinetics and mechanism of the bactericidal action of human neutrophils against Escherichia coli. Blood 64, 635-641 (1984), herein incorporated by reference in its entirety). In this assay, X-CGD cells showed minimal β-Gal activity due to impaired perforation capacity in the absence of superoxide production (Figure 32). In contrast, gene corrected granulocytes obtained from patients P1 (day +473) and P2 (day +344) showed a substantial increase in β-Gal activity, illustrating improvement in antibacterial activity in neutrophils of both patients after gene therapy.
[0087] These results were confirmed by electron microscopy visualization of bacterial killing by healthy, X-CGD or gene corrected neutrophils from patient P1 (as described in Example 10 and illustrated in Figure 33). Phagocytosis of E. coli was observed in all samples. However, the morphology of E. coli inside of the phagocytic vacuole differed drastically between specimens. While the vast majority of E. coli ingested by X-CGD granulocytes were not degraded (Figures 33b,e), E. coli ingested by wild type granulocytes showed clear signs of degradation as revealed by necrotic microorganisms with irregular morphology (Figures 33 d,h). Neutrophils from patient P1 consisted of a mixture of cells with clear bacterial degradation (lower circle, Figures 33c,g), and others without signs of bacterial degradation that were indistinguishable from non-corrected controls (upper circle, Figures 33c,f). Similarly, gene corrected granulocytes obtained from P1 at day + 381 were able to degrade Aspergillus fumigatus hyphae as demonstrated by an enzymatic assay [Rex, J.H., Bennett, J.E., Gallin, J.I., Malech, H.L. & Melnick, D.A. Normal and deficient neutrophils can cooperate to damage Aspergillus fumigatus hyphae. J Infect Dis 162, 523-528 (1990), herein incorporated by reference in its entirety] and transmission electron microscopy (Figure 34).
Clinical resolution of infection
[0088] Prior to gene therapy, the combination of whole body positron emission tomography (PET) and computed tomography (CT) scanning (as described in Example 13) revealed an active bacterial or fungal infection in each of the two patients. For patient P1, a high focal uptake of fluorine-18-fluoro-2-deoxy-D-glucose (18F-FDG) was observed in two hypodense lesions in liver segments VD/VIII and VTfI, representing Staphylococcus aureus abscesses (Fig. 35a, circle). Similarly, patient P2 had suffered from severe invasive pulmonary aspergillosis due to A. fumigatus, visualized by 18F-FDG uptake in PET/CT scanning as a cavernous cavity extending from the apical to the posterior segment of the superior lobe on the right side (Fig. 35c, circle). Repeat scans performed 50 days after administration of gene-transduced cells showed no evidence of lesions in the liver of patient P1 (Figure 35b), while only minimal 18F-FDG activity was evident at day +53 post therapy in the cavity wall of patient P2 (Figure 35d). Follow-up analysis of the patients has not revealed any reappearance of these lesions. These and other clinical parameters (as described in Examples 14-20) demonstrate that gene therapy provided a therapeutic benefit to both patients.
Treatment to increase cell proliferation by administering a retroviral vector
[0089] In some embodiments of the invention, a patient in need of hematopoietic cell proliferation can be treated by retroviral insertion methods. For example, a patient cell sample can be transfected with a retroviral or other type of gene vector carrying these genes, or activating their cellular alleles, using methods known to those of skill in the art. The cells can then be reinfused into the patient. Cell counts can be performed periodically to determine the effectiveness of the blood cell proliferation treatment. The amount of cells to be transfected, the ratio of viral vector to cells, cell growth methods, and readministration methods can be varied as needed to treat the particular disorder. The progress can be followed, for example, by LAM-PCR to confirm the activation of EVI-related genes. (Figures 9-10, 14-15)
[0090] If desired, the retroviral vector or other gene vector can be administered to the patient directly, rather than to cells that have been isolated from the patient.
[0091] The method can be used to expand any type of mammalian cell. Examples of the types of cell that may be expanded include but are not limited to a stem cell, an embryonic stem cell, an adult stem cell, a multipotent stem cell, a pluripotent stem cell, a hematopoietic cell, a hematopoietic stem cell, a progenitor cell, a myelopoietic stem cell, a peripheral blood cell, non-hematopoietic stem cells or progenitor cells, and the like. The cells to be treated can be present in a cell culture, or can be present in the body. [0092] The retroviral vector insertion or other vector transfer can be used to treat many cell-based diseases, in addition to the CGD shown herein. Any disease where an increase in cell proliferation is helpful can be treated by the method of the invention. Examples of such diseases include but are not limited to inherited diseases (severe combined immunodeficiencies, anemias like Fanconi anemia), cancer, AIDS, and the like.
[0093] The invention can, in some embodiments, be used to predict the insertion location of a retroviral vector insertion in one patient, by following previous insertion results of another patient or similar animal and in vivo models. For example, in the current CGD analysis, the earlier studied successfully treated patient had activating DNA insertions in similar positions as those of the later studied successful patient. This can be especially useful for early prediction of the likelihood of successful treatment. Further, a knowledge of where a successful insertion is likely to be located can make more simple assays, such as dipstick assays for EVI-1 (or related gene) gene or protein expression useful for a quick test to see if a patient is responding to treatment.
[0094] In some embodiments of the invention, a patient in need of gene- correction can be treated. The gene correction can be performed in an in vitro culture of cells isolated from the patient. To increase the proliferation of the gene-corrected cells, activation of the EVI-related genes can be performed. This can be done, for example, by administering a retroviral vector to the culture of gene corrected cells, allowing the cells to proliferate in vitro, then reinfusing or readministering said cells to the patient. These retroviral treated cells are then both gene corrected and fast growing, allowing the patient to receive the gene therapy more rapidly. Many types of gene corrections can be performed using this method. Examples of suitable genes for correction include but are not limited to single gene or multiple gene inherited disorders of the blood forming and immune system or other body tissues that can be complemented, treated or stabilized by gene transfer, and the like. Examples include but are not limited to X-SCID, ADA-SCID, CGD, alpha 1 antitrypsin deficiency, and the like. Methods of treatment involving transfection of cells with EVI-related genes and SETBPl
[0095] Because of the surprising finding that the repopulated cells of the successfully treated CGD patients had activating insertions in the EVI-related genes and SETBP1, it is likely that other methods of increasing levels of EVI-related and SETBP1- related gene products can increase proliferation rates. Accordingly, in some embodiments of the invention, a nucleic acid encoding EVI-1, PRDM 16, or SETBP1 is operably linked to a transcriptional regulatory sequence, and transfected to a cell. The exogenous nucleic acid can be, for example, integrated into the genome, or can be present in the cell, for example, in the cytoplasm on a cytoplasmic vector. Thus, the nucleic acid can be stably or transiently expressed, transferred in synthetic form, including nucleic acid equivalents or mRNAs. The transcriptional regulator sequence, such as a promoter, can be chosen, for example, so as to allow for constitutive expression, conditional expression, or inducible expression.
[0096] Further, EVI-1, PRDM 16, or SETBP1 polypeptides, or fragments thereof, can be administered to a cell, hi some embodiments, active synthetic peptide analogs derived from EVI-1, PRDM 16, or SETBP1 polypeptide sequences can be administered to a cell, either in culture or in a patient, to allow increased cell proliferation.
[0097] It may be desirable to grow cells that express the EVI-related and / or SETBP1 genes for a short period of time only, in order to increase the rate of cell proliferation. This can be achieved, for example, using specific inducible promoters or transient expression methods as known in the art. In such situations, when the high rate of cell proliferation is achieved, the expression of the EVI-related and SETBP1 genes can be turned off by, for example, removing the inducing agent from the cell environment.
[0098] The method can be suitable for increasing the proliferation of cells that are gene-corrected, or non-corrected. The method can be used for increasing the proliferation of any type of mammalian cell.
[0099] Depending on the desired effect, EVI-related and SETBP1 -related gene expressing cells can be allowed to proliferate for several cycles before being reinfused into the patient. For example, the cells can proliferate for about 1, 3, 5, 8, 10, 13, 17, or 20 or division cycles, prior to reinfusion into the patient, if desired. Agents that upregulate EVI-related and SETBPl genes
[0100] In additional embodiments of the invention, cell proliferation can be increased, either in vitro or in vivo, by contacting the cells to be proliferated with agents that can upregulate or modulate endogenous EVI-related and SETBP1 genes. Cell culture assays can be performed to determine candidate agents from a library of potential compounds, if desired. Test compounds that modulate EVI-related and SETBP1 gene expression are then chosen for further testing. This method can be used to find pharmaceutically valuable agents that can increase cell proliferation in vitro or in vivo.
Expansion of gene-corrected cells
[0101] Many gene therapy methods involve obtaining a cell from a patient in need of gene correction, then transforming the cell to add a corrected copy of a gene. The cell is then proliferated and eventually the patient is readministered with a large amount of corrected cells. One common problem with such a gene-corrected cells may grow slowly, and may not be able to repopulate the patient adequately for a noticeable improvement to occur.
[0102] In such situations, the addition of an EVI-related gene as described herein, such as EVI-1, PRDMl 6, or SETBP1, and the like, either constitutively or transiently, can increase the proliferation of the gene-corrected cells so that successful readministration and treatment is more likely to occur. This modulation of EVI-related gene expression can be done by several means, such as simply administering the retroviral vector to gene-corrected cells, or, for example, by traditional molecular cloning methods.
[0103] In some embodiments of the invention, a method of forming a bodily tissue is provided, by obtaining a desired cell type from a patient, if desired, treating the cell with a nucleic acid to accomplish a gene-correction, treating the cell to allow for increased expression of an EVI-related and/or SETBP1 gene to cause increased cell proliferation, and treating the cell so as to form a desired tissue. The tissue can then be readministered into the patient as a form of gene therapy.
Use of LAM-PCR to identify genes that increase cell proliferation using LAM-PCR
[0104] Additional embodiments of the invention provide for a method of identifying genes whose modulation (such as upregulation or downregulation) can increase the proliferation rate, selective advantage, or persistence of a stem or progenitor cell. The method can involve obtaining a transfected cell, allowing it to proliferate for several cycles, then testing using LAM-PCR to determine where the successfully repopulated cells have the nucleic acid insertions. The testing can be performed, if desired, over a period of time to determine how the insertion sites change over time. Candidate genes can then be chosen for further analysis. As an example of this method, Table 1 shows a list of exemplary genes found to contain retroviral insertions in at least one of the two successfully treated CGD patients.
Insertion sites for nucleic acid insertion that allow for increasing cell proliferation
[0105] As shown herein, integration of an exogenous sequence into specific regions of the genome resulted in an increase in cell proliferation, selective advantage, or persistence. A representative example of such integration site sequences (50bp genomic DNA in bold and 50bp vector DNA underlined) is shown below:
5 ' CTTCTCTGGAAAATTCCTCATAAGAAAACTGiVAATTCAAGCTCCTGCTCGTGAAAGACCC CACCTGTAGGTTTGGCAAGCTAGCTGCAGTAACGCCATTT 3 '
[0106] Many other insertion sites, as well as genes, identified to be downstream of these insertion sites, are shown in Table 1. These genes include but are not limited to MGC10731, PADI4, CDA, CDW52, ZBTB8, AK2, FLJ32112, TACSTD2, FLJ13150, MGC24133, NOTCH2, NOHMA, EST1B, PBXl, PLA2G4A, HRPT2, ATP6V1G3, PTPRC, NUCKS, CABC1, LOC339789, PRKCE, AFTffHHIN, NAGK, MARCH7, DHRS9, PRKRA, SESTD1, MGC42174, CMKOR1, TBC1D5, THRB, MAP4, IFRD2, ARHGEF3, FOXP1, ZBTB20, EAF2, MGLL, PLXND1, SLC9A9, SELT, CCNLl, MDS1, BCL6, MIST, STM2, TEC, OCIAD1, FLJ10808, SEPTIl, PRKG2, MLLT2, PGDS, MANBA, SRYl, SET7, MAML3, DCTD, CARF, IRF2, AHRR, POLS, ROPN1L, FLJ10246, POl 1, C2GNT3, SSBP2, EDIL3, SIAT8D, FLJ20125, GNB2L1, C6orfl05, JARID2, C6orf32, HCG9, MGC57858, TBCC, SENP6, BACH2, REPS1, HDAC9, OSBPL3, H0XA7, CALN1, FKBP6, NCF1, HIP1, GNAI7, ZKSCAN1, MGC50844, LOC346673, CHRM2, ZH3HAV1, REPIN1, SMARCD3, CTSB, ADAM28, LYN, YTHDF3, SMARCA2, C9orf93, NPR2, BTEBl, ALDHlAl, AUH, C9orf3, WDR31, CEP1, GSN, RABGAP1, ZNF79, CUGBP2, C10orf7, PTPLA, PLXD2, ACBD5, PRKGl, MYST4, IFIT1, C10orfl29, CUEDC2, FAM45A, GRK5, OR52NI, OR2AG2, ZNF143, C1lorfB, LM02, NGL-I, DGKZ, NR1H3, KBTBD4, C1QTNF4, MGC5395, ARRBl, FLJ23441, FGIF, MAML2, LOC196264, HSPC063, ELKS, CACNA2D4, CHD4, EPS8, LRMP, NEUR0D4, RNF41, FAM19A2, RASSF3, PAMC1, PLXNC1, DAP13, MGC4170, FLJ40142, JIK, CDK2AP1, GPR133, PCDH9, C13orf25, ABHD4, AP4S1, MIA2, RPS29, PSMC6, RTN1, MED6, C14orf43, C14orfll8, RPS6KA5, GNG2, PAK6, B2M, ATP8B4, TRIP4, CSK, MESDC1, RKHD3, AKAP13, DET1, DKFZp547K1113, SV2B, LRRKl, CHSYl, TRAF7, ZNF205, ABCC1, THUMPD1, IL21R, MGC2474, N4BP1, SLIC1, CDH9, GPR56, ATBF1, ZNRF1 , CMIP, MGC22001, C17orβl, SAT2, AD0RA2B, TRPV2, NF1, LOCI 17584, MLLT6, STAT5A, STAT3, HOXB3, HLF, MAP3K3, SCN4A, ABCA10, EPB41L3, ZNF521, RNF125, SETBP1, FLJ20071, CDH7, MBP, MBP, NFATC1, GAMT, MOBKL2A, NFIC, CALR, GPSN2, ZNF382, EGLN2, PNKP, LAIR1, ZNF579, SOX12, C20orG0, PLCBl, SNX5, LOC200261, ZNF336, BAKl, SPAG4L, EPB411L1, NCOA3, KIAA1404, STMN3, CBR3, DYRKlA, CSTB, C22orfl4, UPBl, MN1, XBP1, C22orfl9, RBM9, MYH9, TXN2, PSCD4, UNC84B, FLJ2544, ZCCHC5, MST4, EDS, UTY, SKI, PRDM16, PARK7, CHC1, ZMYMl, INPP5B, GLIS1, SLC27A3, ASHlL, SLAMF1, PBXl, CGI-49, ELYS, RNF144, FAM49A, FLJ21069, SFRS7, SPTBN1, TMEM17, ARHGAP25, FLJ20558, CAPG, PTPN18, RBMS1, LOC91526, KLF7, FLJ23861, CMKOR1, CRBN, ITPR1, RAFTLIN, TNA, CCDC12, FHIT, VGL-3, PPMlL, EVI-1, MDS1, HDSH3TC1, DHX15, TMEM33, CXCL3, EPGN, LRBA, FLJ25371, CPE, POLS, PTGER4, LHFPL2, C5orfl2, CETN3, PHF15, PFDN1, KIAA0555, GNB2L1, HLA-E, SLC17A5, UBE2J1, BACH2, HIVEP2, SNX8, TRIAD3, RAC1, ARL4A, ELMOl, BLVRA, SUNC1, ABCA13, GTF2IRD1, RSBN1L, ADAM22, MLL5, IMMP2L, SEC8L1, FLJ12571, CULl, ANGPT1, DEPDC6, EPPKl, MLANA, MLLT3, SMUl, TLE4, C9orf3, ABCAl, STOM, RABGAP1, NEK6, NR5A1, MGC20262, FLJ20433, MAP3K8, ARHGAP22, C10orf72, TACR2, NKX2, OBFC1, VTIlA, ABLMl, FLJ14213, MS4A3, B3GNT6, NADSYN1, CENTD2, MAML2, ATP5L, FLIl, CACNAlC, HEBP1, MLSTD1, IPO8, ARID2, SLC38A1, KRT7, USP15, KIAA1040, WIF1, CGI-119, DUSP6, FLJl 1259, CMKLR1, SSHl, TPCN1, FLJ42957, JIK, FLT3, TPT1, FNDC3, ARHGAP5, ARF6, GPHN, C14orf4, STN2, PPP2R5C, CDC42BPB, CEP152, OAZ2, AKAP13, CHSYl, CRAMP1L, MHC2TA, NPIP, SPN, MMP2, DKFZp434I099, SIAT4B, PLCG2, MYOlC, C17orf31, MGC51025, WSBl, TRAF4, SSH2, HCA66, RPFL, DUSP14, TCF2, ZNF652, STXBP4, HLF, MSI2, VMP1, HELZ, TREM5, RAB37, SEC14L1, SEPT9, BIRC5, PSCD1, MGC4368, NDUFV2, C18orf25, ATP8B1, CDH7, FLJ44881, NFATC1, C19orf35, GNG7, MATK, C3, ZNF358, LYLl, F2RL3, ZNF253, ZNF429, KIAA1533, U2AF1L3, GMFG, BC-2, C20orf30, PLCBl, LOC200261, C20orfll2, ADA, PREXl, C21orf34, C21orf42, ERG, ABCGl, MN1, HORMAD2, LOCI 13826, C22orfl, EFHC2, SYLT4, MGC27005, FHLl, GAB3, and CSF2RA.
EXAMPLES
[0107] The following examples are offered to illustrate, but not to limit, the claimed invention.
Background: Clinical history of Patient Pl and Patient P2 Before and After Gene Therapy
[0108] First diagnosis of X-linked chronic granulomatous disease (X-CGD) in patient P1 was done in 1981. He suffered from severe bacterial and fungal infections as well as granuloma of the ureter with stenosis, pyeloplastic operation (1978), liver abscesses (1980), pseudomonassepticemia (1985), candida-oesophagitis(1992), salmonellasepticemia (1993), severe osteomyelitis, spondylitis with epidural and paravertebral abscess and corporectomy (June 2002). Since 2003 severe therapy-resistant liver abscesses {Staph, aureus) were diagnosed. On admission to the hospital in Frankfurt, the patient was treated with clindamycin, cefalexin, cotrimoxazol and itraconazol, the later two as standard long- term prophylaxis. Treatment was changed from clindamycin to rifanipicin orally. After gene therapy and resolution of the liver abscesses, rifampicin was removed (day +65) and the patient was kept under standard prophylactic care with itraconazol. During the follow-up and concomitant increase in gene marked cells with effective killing of Aspergillus fumigatus, itraconazol was also removed (day +381). No reappearance of liver abscesses and no positive bacterial culture were observed until the last monitoring time point. The patient had a net weight gain of 10 kg since transplantation and a marked decrease of lung granulomas in the CT scan. Lung function was stable.
[0109] First diagnosis of X-CGD for patient P2 was in 1979. He suffered from cervical lymph node abscesses (1983), meningitis (1985), parotis abscesses (1990), two liver abscesses, cervical lymph node abscesses (1991 and 1992), sinusitis maxillaris (1995), bilateral hidradenitis axillaris and pneumonia (2000). Since 2002 he was suffering from bilateral lung aspergillosis with cerebral emboli and formation of a lung cavity. The patient was admitted to the hospital treated by voriconazol and cotrimoxazol. After gene therapy a complete resolution of the aspergillosis was observed, but no improvement in lung function was observed due to excess abuse of nicotine. The patient developed a mycoplasma pneumonia (positive serological IgM titers, no antigen positivity in serum and sputum, negative culture after bronchoalveolar lavage) and sinusitis maxillaris on day +149. He was treated with oral clindamycin for 3 weeks. During gene therapy and busulfan treatment, the voriconazol treatment was changed to liposomal amphotericin B until day +23. Voriconazol treatment was restarted on day +24. No hospital admissions after gene therapy and no positive bacterial cultures were observed. P2 is currently still under cotrimoxazole/voriconazole prophylaxis because the number of oxidase positive cells and the amount of superoxide production per cell were less than 20%. Furthermore, killing of A. fumigatus could not be demonstrated in vitro.
EXAMPLE l Description of the Vector and Gene Transfer Protocol for Treatment of the
2 Successfully-Treated CGD Patients Receiving Gene Therapy [0110] For the construction of the retroviral vector SF71gp91phox the pSF71 backbone [Hildinger, M. et al. FMEV vectors: both retroviral long terminal repeat and leader are important for high expression in transduced hematopoietic cells. Gene Ther 5, 1575-1579 (1998), herein incorporated by reference in its entirety] was used, in which the coding region of gρ91phox was inserted by standard molecular cloning. In this vector, gp91phox expression is driven by the Friend mink cell Spleen focus-forming virus (SFFV) LTR, which has been shown to be highly active in stem and myeloid progenitor cells [Baum, C. et al. Novel retroviral vectors for efficient expression of the multidrug resistance (mdr-1) gene in early hematopoietic cells. J Virol 69, 7541-7547 (1995), herein incorporated by reference in its entirety]. Vector containing supernatants were obtained from a stable PG 13 packaging cell line in X-VIVO10 at a titer of 1 x 106 TU/ml. CD34+ cells were prestimulated for 36 hours at a density of 1 x 106 cells/ml in X-VIVO 10 medium + 2 mM L-glutamine, supplemented with EL-3 (60 ng/ml), SCF (300 ng/ml), Flt3-L (300 ng/ml), and TPO (100 ng/ml) (Strahtman Biotech, Dengelsberg, Germany) in Lifecell Bags (Baxter). Following prestimulation, cells were adjusted to a density of 1 x 106 cells/ml in cytokine containing medium as described above. Transduction was performed in tissue culture flasks coated with 5 μg/cm2 of CH-296 (Retronectin, Takara, Otsu, Japan) and preloaded with retroviral vector containing supernatant as described previously [Kuhlcke, K. et al. Highly efficient retroviral gene transfer based on centrifugation-mediated vector preloading of tissue culture vessels. MoI Ther 5, 473-478 (2002), herein incorporated by reference in its entirety]. After 24 hours cells were pelleted and cell density was again adjusted to 1 x 106 cells/ml in cytokine containing medium. Cells were incubated on freshly coated/preloaded flasks for another round of transduction. This procedure was repeated once more for a total of three transduction rounds. 24 hours after the final transduction, cells were harvested and analyzed for phenotype and gene transfer efficiency, transported to the transplantation unit and reinfused into the patients.
[0111] End of production materials were also tested for the presence of replication competent retroviruses by the extended XC plaque assay [Cham, J.C. et al. Alteration of the syncytium-forming property of XC cells by productive Moloney leukemia virus infection. Cancer Res 35, 1854-1857 (1975), herein incorporated by reference in its entirety] and by a gag-specific PCR as follows: Primers 5'- AGAGGAGAACGGCCAGTATTG-S1 (SEQ ID NO: 136) and 5r- ACTCCACTACCTCGCAGGCATT-3' (SEQ ID NO: 137) were used to amplify a 69-bp fragment of the retroviral gag cDNA. Amplification was detected with a FAM-labelled gag- probe (5I-TGTCCGTTTCCTCCTGCGCGG-3I) (SEQ ID NO: 138). The human EPO receptor gene was used as an internal amplification control. PCR reactions were carried out for 40 cycles in a single tube. Each reaction cycle consisted of 15 seconds at 94°C followed by 1 minute at 60°C.
[0112] The pretreatment preparation, treatment, and clinical examination of the 2 successfully treated CGD patients is described further in Ott, M. G. et al. Correction of X- linked chronic granulomatous disease by gene therapy, augmented by insertional activation of MDS1-EVl, PRDM16 or SETBP1. Nat Med 12(4):401-409, (2006), hereby incorporated by reference in its entirety.
EXAMPLE 2
Description of the Gp91phox PCR Method
[0113] The ABI PRISM 7700 Sequence Detection System (PE Applied Biosystems, Weiterstadt, Germany) was used to determine the presence of proviral sequences in genomic DNA isolated from the blood and bone marrow cells of patients P1 and P2. The exon 8 primer gp91-f (5'-GGTTTTGGCGATCTC AACAGAA-3') (SEQ ID NO: 1) and exon 9 primer gp91-r (5I-TGTATTGTCCCACTTCCATTTTGAA-3I) (SEQ ID NO: 2) were used to amplify a 114-bρ fragment of the gp91phox cDNA. Amplification was detected with the FAM-labelled probe gp91-p (5'-TCATCACCAAGGTGGTC ACTCACCCTTTC-S1) (SEQ ID NO: 3). The human EPO receptor gene was used as an internal control to quantify the gp91phox reaction. Primers hepo-f (5'-CTGCTGCCAGC TTTGAGTACACTA-S1) (SEQ ID NO: 4) and hepo-r (5'-GAGATGCCAGAGTCAGATACCACAA-S') (SEQ ID NO: 5) amplified a 138-bp fragment from exon 8 of the 2£P0-receptor-gene. Amplification was determined by the VIC-labelled probe hepo-p (5'-ACCCCAGCT CCCAGCTCTTGCGT-S') (SEQ ID NO: 6). Both reactions were carried out in a single tube. The amplification cycle was 15 s at 94 °C followed by 1 min at 60 °C. hi each experiment, the amplification of DNA generated from HT 1080 cells containing a single copy of a gp91phox vector mixed with wild type HT1080 cells in defined ratios was used to quantify the percentage of SF71 gp91phox integrations per human genome. The percentage of transduced cells was estimated from the values obtained from the quantitative PCR (Q-PCR), which represent vector copies per diploid genome, after dividing by two to account for the mean of two proviral copies per transduced cell. Similarly, genomic DNA was isolated from individual bone marrow colonies and analyzed for the presence of vector derived sequences by nested PCR using gp91phox specific primers. The primers used for first PCR (95 °C, for 5 min, 95 °C for 1 min, 56 °C for 1 min, 72 °C for 1 min, for 30 cycles) were gpforOl: (5'-TTGTACGTGGG C AGACCGC AG AGA-3') (SEQ ID NO: 7) and gprevO2: (5'- CCAAAGGGCCCATCAACCGCTATC-3') (SEQ ID NO: 8). Nested PCR was done under similar conditions using the primer combination P8: (5'- GGATAGTGGGTCCCATGTTTCTG-3') (SEQ ID NO: 9) and RI l: (5'- CCGCTATCTTAGGTAG TTTCCACG-3') (SEQ ID NO: 10). As an internal control the EPO-R gene was amplified in parallel with the primer combination hEpo-F1: (5'- GAGCCGGGGACAGATGATGAGG-S') (SEQ ID NO: 11) and hEpo-R1: (5'- GCGGCTGGGATAAGGCTGTTC-3') (SEQ ID NO: 12) for the first PCR reaction and primers hepo-f (SEQ ID NO: 4) and hepo-r (SEQ ID NO: 5) for the nested PCR primers.
EXAMPLE 3 Integration Site Analysis by the Linear Amplification Mediated (LAMVPCR Method
[0114] 100 ng of DNA from peripheral blood leukocytes was used for integration site analysis that was performed by LAM PCR as previously described (Schmidt, et al. (2002) Blood 100:2737-2743; Schmidt, et al. (2003) Nature Med. 9:463-468, each of the foregoing which is hereby incorporated by reference in its entirety) but biotinylated primer LTR I (5'XϊTT TGG CCC AAC GTT AGC TAT T<3') (SEQ ID NO: 13) was used for the initial linear amplification of the vector genome junctions. Following magnetic capture, hexa- nucleotide primed double strand synthesis with Klenow polymerase, restriction digest using Msel, HinP1I, or Tsp5091 and ligation of a restriction site complementary linker cassette allowed amplification of the vector genome junctions. For the 1st and 2nd exponential PCR amplification, vector specific primers LTR II (5'>GCC CTT GAT CTG AAC TTC TC<3') (SEQ ID NO: 14) and LTR IH (5'>TTC CAT GCC TTG CAA AAT GGC<3 ') (SEQ ID NO: 15) were used in combination with linker cassette specific primers LC I (5'>GAC CCG GGA GAT CTG AAT TC3') (SEQ ID NO: 16) and LC II (5>GAT CTG AAT TCA GTG GCA CAG<3') (SEQ ID NO: 17), respectively. LAM-PCR amplicons were purified, shotgun cloned into the TOPO TA vector (Invitrogen, Carlsbad, CA) and sequenced (GATC, Konstanz, Germany). Sequences were aligned to the human genome (hgl7, release 35, May 2004) using the UCSC BLAT genome browser (available on the world wide web at ucsc.genome.edu). (See also Table 1.) Relation to annotated genome features were studied with the same tool. Sequences that could not be mapped were either too short (< 20 bps, 136 sequences, 15.5% of all obtained sequences), or showed no definitive hit or multiple hits on the human genome (40 sequences, 4.5% of all obtained sequences).
EXAMPLE 4
Qualitative Tracking of Individual Common Insertion Site CCIS) Clones [0115] Individual MDS1/EVI-1, PRDMl 6, and SETBP1 related insertions were followed over time using clone specific nested primer sets (Perkins, A. S. et al. Evi-1, a murine zinc finger proto-oncogene, encodes a sequence-specific DNA-binding protein. MoI Cell Biol 11, 2665-2674 (1991), hereby incorporated by reference in its entirety). To identify clones with possible predominance, PCR tracking was performed on 10 ng of GenomiPhi™ DNA Amplification Kit (Amersham) pre-amplified DNA from patient peripheral blood leukocytes. 0.5% of the pre-amplified DNA served as template for an initial amplification by PCR with the genomic flanking primer FP1 (SEQ ID NOs: See Table 4) and the vector specific primer LTR I (SEQ ID NO: 13). 2% of this product was applied to a nested PCR with FP2 (SEQ ID NOs: See Table 4) and LTR II (SEQ ID NO: 14) using the same conditions. The products were separated on a 2% agarose gel. Individual ones were purified and sequenced (GATC) (Table 2). Clone specific genomic flanking primers are listed in Tables 3 and 4 (SEQ ID NO: 18 through SEQ ID NO: 135, Table 4). PCR cycling conditions were performed for 35 cycles of denaturation at 95°C for 45 s, annealing at 56-58°C for 45 s and extension at 72°C for 60 s, after initial denaturation for 2 min and before final extension for 5 min.
Table 3a
Figure imgf000070_0001
Table 3b
Figure imgf000071_0001
TABLE 4
Figure imgf000072_0001
TABLE 4
Figure imgf000073_0001
TABLE 4
Figure imgf000074_0001
EXAMPLE 5
Quantitative Competitive (QC) PCR Analysis
[0116] To calculate the proportional contribution of individual predominant clones to gene corrected myelopoiesis, an internal standard (IS) PCR template revealing a 26- bp deletion within the 5'LTR vector sequence was generated for each vector genome junction of interest [Hoyt, P.R. et al. The Evil proto-oncogene is required at midgestation for neural, heart, and paraxial mesenchyme development. Mech Dev 65, 55-70 (1997), hereby incorporated by reference in its entirety]. The coamplification of a certain amount of 'wild- type' (WT) patient DNA with a defined copy number of IS allowed estimation of the abundance of the specific integrant in the patient DNA. QC-PCR was performed with defined dilutions of IS (50 copies and 500 copies) added to 50ng of patient DNA. Using vector primer LTR I (SEQ ID NO: 13) and genomic flanking primer FP2 (SEQ ID NOs: See Table 4), the templates were coamplifϊed with 35 PCR cycles (denaturation at 95°C for 45 s, annealing at 54-60°C for 45 s, extension at 72°C for 60 s) after initial denaturation for 2 min and before final extension for 5 min. 0.1-2% of the reaction product was used as template for a second nested PCR, which was performed for 35 cycles with the same parameters as for the first PCR with primers LTR H (SEQ ID NO: 14) and FP3 (SEQ DD NOs: See Table 4). QC- PCR products were separated on a 2% agarose gel (Figures 18, 19 and Table 2). Primers used for the generation of IS and further QC-PCR are listed in Tables 3 and 4 (SEQ ID NO: 18 through SEQ ID NO: 135, Table 4).
EXAMPLE 6
Methods of RNA Extraction and Analysis
[0117] Total RNA was extracted from bone marrow derived from patient 1 and a healthy donor with the RNeasy Mini Kit (Qiagen). cDNA was synthesized using the First Strand cDNA Synthesis Kit (Amersham) with whole RNA extracted and 0.2 μg of Not I d(T)18 primer (5'>AAC TGG AAG AAT TCG CGG CCG CAG GAA<3') (SEQ ID NO: 139). A 35 cycle actin PCR was carried out as a loading control using primers actin-1 (5'- TCCTGTGGCATCCACGAAACT-3') (SEQ ID NO: 140) and actin-2 (5'- GAAGCATTTGCGGTGGAC GAT-3') (SEQ ID NO: 141) for 5 min at 95 °C, 1 min at 95 °C, 1 min at 58 °C, 1 min at 72 °C, and 10 min at 72 °C.
[0118] EVI-1 and MDS1-EVI-1 transcripts were detected, by ICR with primers EVT1-ex5-F2 (5'-TGGAGAAACACATGCTGTCA-3') (SEQ ID NO: 142) and EVl1-ex6-R2 (5'-ATAAAGGGCTTCACA CTGCT-3') (SEQ ID NO: 143). To amplify only PR domain positive MDS1-EVI-1 transcripts, cDNA was subjected to a 36 cycle PCR using primers MDS1-ex2-F1 (5'-GCCACATCCAGT GAAGCATT-3') (SEQ ID NO: 144) and EVl1-ex2- R1 (5 '-TGAGCCAGCTTCCAACATCT-3') (SEQ ID NO: 145). 2% of the PCR product was introduced into a second PCR using nested primers MDS1-ex2-F2 (5'- AGGAGGGTTCTCCTTACAAA-3') (SEQ ID NO: 146) and EVl1-ex2-R2 (5'- TGACTGGCATCTATG CAGAA-3') (SEQ ID NO: 147).
[0119] To define the expression of PRDM16, a fragment of this PR domain was amplified using primer MEL1PR-F1 (5'-CTGACGGACGTGGAAGTGTCG-3') (SEQ ID NO: 148) with MEL1PR-F1 (5'-CAGGQGGTAGACGCCTTCCTT-3') (SEQ ID NO: 149), which hybridised in exon 3 and exon 5, respectively. 2% of the PCR product was amplified to a second PCR with primers MEL1PR-F2 (5'-TCTCCGAAGACCTGGGCAGT-3') (SEQ ID NO: 150) and MEL1PR-R2 (5'-CACCTG GCTCAATGTCCTTA-3') (SEQ ID NO: 151). Fragments of both the PR-containing and the non PR-domain containing form of PRDM16 were amplified using primer MEL1N-F1 (5'-CCCCAGATCAGCCAACTCACCA-3') (SEQ ID NO: 152) and MEL1N-R1 (5'-GGTGCCGGTCCAGGT TGGTC-3') (SEQ ID NO: 153). Nested PCR was performed with 2% of the product and primer MEL1N-F2 (5'- ACACCTGAGGACGCACACTG-3') (SEQ ID NO: 154) and MEL1N-R2 (5'- GGTTGCACAGGT GGCACTTG-3') (SEQ ID NO: 155). Expression level of SETBP1 was analyzed using primers SETBP-F1 (5'-TAAAAGTGGACCAGACAGCA-3') (SEQ ID NO: 156) and SETBP-R1 (5'-TCACGAAGTTG TTGCCTGTT-3') (SEQ ID NO: 157).
[0120] To assign whether there are fusion transcripts between the vector LTR and MDS1, EVI-1, or PRDM16, the primer U5 IV (5'>TCC GAT AGA CTG CGT CGC<3') (SEQ ID NO: 158) together with primer EVI-ex2-R1, MDS1-ex2-F1, or MEL1N-R1. Nested PCR was performed, with 2% PCR product and primer U5 VI (5 '>TCT TGC TGT TTG CAT CCG AA<3') (SEQ ID NO: 159) was used together with primer EVI1-ex2-R2 (SEQ ID NO; 147), MDS1-ex2-F2 (SEQ ID NO: 146), or MEL1N-R2 (SEQ ID NO: 155). Additionally, nested PCR was carried out with LTR I (SEQ ID NO: 13) and MELl-PR-F1 (SEQ ID NO: 148). 2% of the product was amplified with primer LTR II (SEQ ID NO: 14) and MELlPR- F2 (SEQ ID NO: 150). 36 cycle PCRs were accomplished with 3.33% of whole cDNA from patient 1 and 0.33% of whole cDNA from the normal donor for 2 minutes at 95°C, 45 seconds at 95°C, 45 seconds at 54°C, 1 minute at 72°C, and 5 minutes at 72°C. A 35 cycle actin PCR was carried out as a loading control with 0.0002-0.008% of cDNA and primers actin-1 (5'TCC TGT GGC ATC CAC GAA ACT 3') (SEQ ID NO: 140) and actin-2 (5' GAA GCA TTT GCG GTG GAC GAT 3') (SEQ ID NO: 141) for 5 minutes at 95°C, 1 minute at 95°C, 1 minute at 58°C, 1 minute at 72°C, and 10 minutes at 72°C.
EXAMPLE 7 Colony Assay Methods
[0121] Bone marrow mononuclear cells (l-5xlθ4) or CD34+ purified cells (1- 5x103) were plated on methylcellulose in the presence or absence of cytokines (50 ng/ml hSCF, 10 ng/ml GM-CSF, 10 ng/m hIL3 and 3 U/ml hEpo) (MethoCult, Stem Cell Technologies, Vancouver, Canada). Colony growth was evaluated after 14 days.
EXAMPLE 8
Method to Detect gp91phox Cell Surface Expression
[0122] Heparinized whole blood (100 μl) was incubated with the murine monoclonal antibody 7D5 [Nakamura, M. et al. Monoclonal antibody 7D5 raised to cytochrome b558 of human neutrophils: immunocytochemical detection of the antigen in peripheral phagocytes of normal subjects, patients with chronic granulomatous disease, and their carrier mothers. Blood 69, 1404-1408 (1987), herein incorporated by reference in its entirety] or an IgGl isotype control (Becton Dickinson, San Jose, CA) for 20 minutes. After washing, samples were stained with FITC-goat (Jackson ImmunoResearch, West Grove, PA,) or APC-goat (Caltag Laboratories, Burlingame, CA) anti-mouse antibodies. Lineage markers were determined using monoclonal antibodies against CD3 (HIT3a), CD 15 (HI98) and CD 19 (4G7). After erythrocyte lysis, stained cells were washed, fixed, and analyzed on a FACSCalibur (Becton Dickinson, San Jose, CA). EXAMPLE 9 Killing Assay Methods
[0123] Neutrophils obtained either from an untreated CGD patient, or healthy donors were incubated with the E. coli strain ML-35, which lacks the membrane transport protein lactose permease and constitutively expresses β-galactosidase (β-Gal). Engulfment of E. coli ML-35 by wild type neutrophils is followed by perforation of the bacterial cell wall and accessibility to β-Gal, which is subsequently inactivated by reactive oxygen species [Hamers, M.N. et al. Kinetics and mechanism of the bactericidal action of human neutrophils against Escherichia coli. Blood 64, 635-641 (1984), herein incorporated by reference in its entirety]. 2x109 E. coli/ml were opsonized with 20% (v/v) Octaplas® (Octapharma AG, Lachen, Switzerland) for 5 min at 37°C. Opsonized E. coli (final concentration 0.9x108/ml) were added to granulocytes (0.9x107/ml) obtained from healthy donors or X-CGD patients after gene therapy. At defined time points granulocytes were lysed with 0.05% saponin (Calbiochem, Darmstadt, Germany) and samples were incubated with ImM ortho- nitrophenyl- βD-galactopyranoside (Sigma-Aldrich, Seelze, Germany) at 37 °C for 30 min. β-galactosidase activity was followed by standard procedures at 420 nm.
[0124] The Aspergillus fumigatus killing assay was conducted as described by Rex et al. [Rex, J.H. et al. Normal and deficient neutrophils can cooperate to damage Aspergillus fumigatus hyphae. J Infect Dis 162, 523-528 (1990), herein incorporated by reference in its entirety] with minor modifications. Briefly, Aspergillus spores were seeded in 12 well plates at a density of 5x104 spores per well in Yeast nitrogen with amino acids (Sigma-Aldrich, Seelze, Germany). Hyphae were opsonized with 8% Octaplas® (Octapharma AG, Lachen, Switzerland) for 5 min at room temperature. Subsequently, 1x 106 healthy granulocytes or 4x106 neutrophils from patient P1 were added. Following incubation at 37 °C, granulocytes were lysed at defined time points in 0.5% aqueous sodium deoxycholate solution for 5 min at room temperature. The mitochondrial activity of the remaining adherent hyphae was monitored by an MTT assay as described [Rex et al. 1990, supra, herein incorporated by reference in its entirety]. EXAMPLE 10
Transmission Electron Microscopy Methods
[0125] For evaluation of E. coli killing 5x107 opsonized E. coli were incubated with 5x106 granulocytes in HBSS+Ca/Mg containing 2% human albumin in a water bath shaker at 37 °C for 2.5 h. The cells were harvested by centrifugation and fixed in 2.5% glutaraldehyde in PBS at room temperature for 30 min. For the evaluation of Aspergillus fumigatus killing, 3x105 Aspergillus spores were seeded in a 4 cm petri dish in Yeast Nitrogen Base with amino acids (Sigma). Germination was induced by 6 h incubation at 37 °C followed by decelerated growth at room temperature over night. Hyphae were washed in HBSS+Ca/Mg and opsonized with 8% Octaplas® (Octapharma AG, Lachen, Switzerland) in HBSS+Ca/Mg containing 0.5% human albumin for 5 min at room temperature. The opsonized hyphae were incubated with 3×106 granulocytes in HBSS+Ca/Mg containing 0.5% human albumin for 2 h at 37 °C. Fixation was carried out by direct addition of glutaraldehyde to a final concentration of 2.5%. Glutaraldehyde fixed samples were washed three times in PBS, fixed in 2% osmium tetroxide in PBS for 30 minutes, and dehydrated in ethanol followed by embedding in Epon and polymerization at 60 °C for 2 days. Ultrathin sections of 60 nm were prepared using an Ultramicrotome (Ultracut E, Reichert). The sections were then post-stained with 5% aqueous uranyl acetate for 30 min and lead citrate for 4 min, and examined on a Philips CM 12 transmission electron microscope.
EXAMPLE Il
Immune Reconstitution Assay Methods
[0126] Immune reconstitution was monitored by four-color-flow cytometric assessment of T cell subsets, NK cells and B cells in peripheral blood (PB) samples on a Coulter Epics XL. Samples were labelled with the 45/4/8/3 or 45/56/19/3 tetraChrome reagents from Coulter (Krefeld, Germany). All antibodies were obtained from Coulter Immunotech (Marseilles, France). The percentages of cell subtypes determined in these analyses were used to calculate the absolute cell counts in a dual-platform approach. EXAMPLE 12
Assay Methods for Granulocyte Function
[0127] Reconstitution of NADPH oxidase activity in neutrophils after gene therapy was assessed by oxidation of dihydrorhodamine 123 [Vowells, S.J., Sekhsaria, S., Malech, H.L., Shalit, M, & Fleisher, T.A. F1ow cytometric analysis of the granulocyte respiratory burst: a comparison study of fluorescent probes. J Immunol Methods 178, 89-97 (1995), herein incorporated by reference in its entirety], reduction of nitrobluetetrazolium13, reduction of cytochrome C [Mayo, L.A. & Curnutte, J.T. Kinetic microplate assay for superoxide production by neutrophils and other phagocytic cells. Methods Enzymol 186, 567-575 (1990), herein incorporated by reference in its entirety] and flavocytochrome b spectral analysis [Bohler, M.C. et al. A study of 25 patients with chronic granulomatous disease: a new classification by correlating respiratory burst, cytochrome b, and flavoprotein. J Clin Immunol 6, 136-145 (1986), herein incorporated by reference in its entirety] according to standard protocols.
EXAMPLE 13 PET/CT-Scanning Methods
[0128] Whole body positron emission tomography (PET) using fluorine-18- fluoro-2-deoxy-D-glucose (FDG) was performed simultaneously and fused with computed tomography (CT) scans. Transmission scanning began immediately after the administration of at least 350 MBq of FDG, emission scanning followed 40 min later.
EXAMPLE 14
Clinical Parameters After Gene Therapy: BM Cellularity
[0129] Bone marrow aspirates of both patients were routinely examined at several time points (P1: days +122, +192, +241, +381; P2: days +84, +119, +245). The following analyses were done: morphology (Pappenheim staining) was normal at all time points and showed a completely normal hematopoiesis, normal cellularity, normal megakaryo-, erythro- and granulopoiesis and no signs of leukemia. One example each is described as such: P1 day +381: megakaropoiesis normal, X-cell 1%, promyelocytes 8%, myelocytes 16%, metamyelocytes and bands 14%, segmented 15%, eosinophils 6%, basophils 1%, monocyte 3%, erythroblasts 21%, plasma cells 2%, lymphoids 12%. P2 day +245: megakaryopoiesis normal, promyelocytes 10%, myelocytes 19%, metamyelocytes and bands 12%, segmented 11%, eosinophils 4%, basophils 1%, monocytes 3%, erythroblast 26%, plasma cells 4%, lymphoids 10%.
EXAMPLE 15
Clinical Parameters After Gene Therapy: CFU-C Content
[0130] Bone marrow aspirates were taken at days +122, +192, +241 and +381 for P1 and at days +84, +119 and +245 for P2. On each occasion a bone marrow total BM mononuclear cells were plated on methylcellulose (Methocult, Stem Cells Technologies) and colony formation was assessed 14 days later. Table 5 shows a summary of these data.
Table 5.
Figure imgf000081_0001
[0131] Immunophenotyping of bone marrow cells performed by FACS analysis with antibodies against CD19, CD10, CD10/CD19, CD34, CD33 and CD34/CD33 showed no abnormal expression profile or cell counts in either patient at any time. EXAMPLE 17
Clinical Parameters After Gene Therapy: Immuno staining Methods [0132] Immunohistostaining of bone marrow biopsies for CD10, CD34, CD117,
CD3, and CD20 was performed at day +381 (P1) and day +491 (P2). No infiltration of blast
(' cells, no myelo- or lymphoproliferative disease and no myelodyplastic syndrome were seen in these preparations.
EXAMPLE 18
Clinical Parameters After Gene Therapy: BM Cytogenetics Analysis [0133] Cytogenetic analysis were performed at the Department of Molecular Pathology, University Medical School, Hannover, Germany under the direction of Prof. Dr. med. B. Schlegelberger. The following samples were analyzed: P1: day +241 (16 metaphases), day +381 (18 metaphases); P2 day +119 (15 metaphases), day +245 (21 metaphases). In all cases a normal karyotype was observed.
EXAMPLE 19
Clinical Parameters After Gene Therapy: T-CeIl Function Analysis [0134] Mononuclear cells obtained at different time points from P1 and P2 were stimulated with diverse mitogens and antigens. Proliferative responses were assayed by 3H- Thymidine incorporation. The ratio of 3H-Thymidine incorporation in mitogen- or antigen stimulated vs. non-stimulated cells is given in Table 6 as a quotient, hi all cases, robust incorporation of 3H-Thymidine were observed, indicating that the mitogen and antigen responses of patient lymphocytes are within the range of age-matched healthy individuals. Also, immunoscope analysis of Vβ T lymphocytes at day +245 (P1) and day +491 (P2) showed normal T cell receptor repertoires in both patients. Table 6.
Figure imgf000083_0001
EXAMPLE 20
Clinical Parameters After Gene Therapy: Antibody Production Analysis [0135] Among others normal levels of IgG, IgA, IgM, IgG1, IgG2, IgG3 and IgG4 were found. Examples of plasma protein levels are shown below at days +546 (P1) and day +489 (P2) in Table 7.
Table 7.
Figure imgf000083_0002
[0136] Similarly, IgG antibodies against Tetanus Toxoid (610 U/l), Diphteria Toxoid (270 U/l) and Hemophilus influenzae Type B (3.10 μg/ml) were detected at day 597 in serum samples of P1.
EXAMPLE 21 Mouse Integration and Transplantation Data Related to the Clinical Study
[0137] To create immortal mouse cell clones, bone marrow cells obtained from C57EL/6-Ly5.1+ mice were expanded for 2 days in the presence of DMEM plus 15% heat- inactivated FBS, 10ng/ml IL-6, 6ng/ml IL-3, and 100ng/ml SCF. Expanded cells were subsequently transduced by co-culture on top of GP+E86 cells stably expressing MSCVneo. After transduction, cells were cultured in IMDM with 20% heat-inactivated horse serum plus 100 ng/ml SCF and 10 ng/ml IL-3, or 100 ng/ml SCF and 30 ng/ml FLT3L. More than 80 immortal cell clones were generated after retroviral transduction of murine bone marrow cells in the presence of SCF and IL3, of which some have been maintained in culture for more than 1.5 years. The majority of these clones had a phenotype similar to committed immature myeloid progenitors and were still IL-3 dependent. All karyotypes were found to be normal. Spontaneous differentiation of the cultures yielded neutrophils (10-40%) and macrophages (1-5%). 95% of cells could be differentiated into neutrophils in response to G-CSF, whereas GM-CSF treatment induced differentiation into macrophages (30%) and neutrophils (70%). Addition of PMA induced 50-70% of cells to differentiate into macrophages. Integration sites were analyzed in 37 clones, demonstrating between 1 to 7 integrants per cell. 7 cell clones showed integrants in the Evil gene locus, 13 in the Prdmlό gene region and 1 in Setbpl. Northern analysis showed that expression of Evil and Prdmlό was mutually exclusive [Du, Y., Jenkins, N.A. & Copeland, N.G. Insertional mutagenesis identifies genes that promote the immortalization of primary bone marrow progenitor cells. Blood 106, 3932-3939 (2005), herein incorporated by reference in its entirety].
[0138] The engraftment potential of these immortalized cell lines was also tested. 2-8xl06 Ly5.1+ cells from Evil (two clones), Prdmlό (one) and Setbpl (one) immortalized cell lines, together with 5x105 unirradiated C57BL/6-Ly5.2+ supporting bone marrow cells, failed to engraft lethally irradiated C57BL/6-Ly5.2+ mice. [0139] Further, 10 immortalized early hematopoietic progenitor cell clones were produced by retroviral transduction in the presence of SCF and FLT3 ligand. Of these, one (SF-I) revealed a very immature phenotype (Sca-1-, 50% c-kit+) with lymphomyeloid differentiation capacity and an integration in Setbpl. In contrast to the immortalized clones with the committed myeloid progenitor phenotype, transplantation of 2.5-5.6x106 Ly5.1+ SF- 1 cells resulted in a leukemic phenotype. All eleven hosts died of leukemia 56-118 days post transplant. Secondary recipients of IxIO6 leukemic cells developed leukemias 30 days after transplantation. This SF-I cell line revealed two integrants, one located at an unknown gene locus (without abnormal gene expression) and one in intron 1 of Setbpl. The leukemic potential of SF-I cells is very likely related to the immature phenotype of the clone (engraftment and self-renewal capacity). This knowledge can be used to develop assays that evaluate the therapeutic value of gene-modified cells against its potential risks in clinical use. For example, such assays can be used to screen gene-modified cells in order to eliminate those clones that exceed a specified risk threshold for clinical therapies. In summary, immortalized early hematopoietic progenitor cells induced leukemias in transplanted hosts whereas immortalized immature myeloid cells did not.
[0140] In the clinical study, no SETBP1 integrant was detected in patient P2 (and no SETBP1 overexpression). In contrast, seven integrants in SETBP1, six located about 20kb upstream and one in intron 1 of the gene, were detected in patient P1. The position of the integrant in intron 1 was similar to the two integrants found in the mouse study. This particular clone (77509D02) was detected only once by LAM-PCR in peripheral blood of P1 at day +241, but was not detected at any other time point by tracking PCR (Tables 1 and 2).
EXAMPLE 22
Transduction and Busulfan Conditioning of Patients
[0141] G-CSF mobilized peripheral blood CD34+ cells were collected from two X-CGD patients aged 26 (patient P1) and 25 years (patient P2), transduced with a monocistronic gammaretroviral vector expressing gp91phox (SF71gp91phox) and reinfused 5 days later (Example 1). Transduction efficiency was 45% for P1 and 39.5% for P2 as estimated by gp91phox expression (Example 2). The proviral copy number was 2.6 (P1) and 1.5 (P2) per transduced cell. The number of reinfused CD34+/gp91+ cells per kg was 5.IxIO6 for P1 and 3.6 x106 for P2. Prior to reinfusion, liposomal busulfan (L-Bu) was administered intravenously on days -3 and -2 every 12 hours at a dose of 4 mg/kg/day. Liposomal busulfan conditioning was well tolerated by both patients P1 and P2. With the exception of a grade I mucositis from day +11 to day +17 observed in P1, no other non-hematological toxicities were observed.
[0142] Both patients experienced a period of myelosuppression (neutrophil nadir for P1: day +14 and for P2: day +15) with absolute neutrophil counts (ANC) below 500 cells per μl between days +12 and +21 (P1) and days +13 and +18 (P2) (Figures 1,2). Severe lymphopenia (CD4+ counts <200/μl) was observed in P1 between days +21 and +32, while lymphopenia in P2 was observed only at day +17 (Figures 1,2). Cell counts recovered gradually to the normal values observed prior to busulfan conditioning (P1: 476 CD4+ cells/μl, age 19; P2: 313 CD4+ cells/μl, day -28). Similar results were observed for CD8+ and CD19+ cells (Figures 1,2) (Example 11).
EXAMPLE 23 Engraftment of Gene-modified Cells
[0143] Gene-modified cells were detected in peripheral blood leukocytes (PBL) from patient P1 at levels between 21% (day +21) and 13% (day +80) (Example 2). From day 157, a continuous increase in gene-marked cells was observed until day +241. At this point, 46% of total leukocytes were positive for vector encoded gp91phox. The percentage of gene- marked cells remained at this level until day +381 and decreased thereafter to 27% at day 542 (Figure 3). A similar result was observed in patient P2. The level of gene marked leukocytes fluctuated between 31% (day +35) and 12% (day +149). Thereafter, an increase in gene- marked cells was observed with 53% of the patient leukocytes containing vector-derived sequences at day +413, which decreased again to 30% at day +491 (Figure 4).
[0144] Vector-containing cells were found predominantly in the myeloid fraction. The level of gene marking in the granulocytes of P1 increased from 15% (day +65) to 55% (day +241) and fluctuated thereafter between 60% (day +269) and 54% (day +542) (Figure 3). Similar results were observed for P2. While 15% of the granulocytes were marked at day +84, 48% of the granulocytes contained vector-derived sequences at day +245 and fluctuated thereafter between 36% (day +343) and 42% (day +491) (Figure 4). In both patients the level of gene marking in CD3+ cells remained low (range, 2%-7% (P1) and 0.4%-5% (P2)). in contrast, gene marking levels in isolated CD19+ cells of P1 (purity >98%) were 18% (day +472) and 17% (day +542) (Figure 3), while in B-cells of P2 (purity >94%) these values fluctuated between 11% (day +343) and 10% (day +491) (Figure 4).
[0145] Gene marking in bone marrow hematopoietic progenitor cells was estimated from the number of vector-positive colony-forming cells (CFC). Gene-marked CFCs were detected at a frequency of 68.8% (day +122) and 58.8% (day +381) for patient P1 (Figure 5), while these values were 33.3% (day +119) and 42.8% (day +245) for patient P2 (Figure 6). Vector-derived sequences were detected both in colony-forming units- granulocyte-macrophage (CFU-GM; range, 63.2%-76.9% (P1) and 25.0%- 6.6% (P2)) and burst-forming units-erythrocyte (BFU-E; range, 50.0%-75% (P1) and 20%-40.0% (P2)) colonies, indicating effective gene marking in common myeloid progenitors with long-term engraftment capacities or in hematopoietic stem cells (HSCs).
EXAMPLE 24 Expansion of Hematopoietic Cells in a Patient by Reinfusing Cells
Transfected with a Retroviral Vector
[0146] Cells are isolated from a cell sample taken from a patient in need of blood cells. A retroviral vector is prepared. A cell culture is prepared in the presence of permissive cytokines. The cells are allowed to proliferate. When ex vivo expansion is required, cells are kept in culture in the presence of the same or a different set of cytokines or growth factors, e.g. to induce proliferation only at the stem cell stage, or only at a lineage differentiated stage, e.g. myelopoiesis or thrombopoiesis. The cells are prepared for reinfusion to the patient by washing in PBS to remove cell culture components, followed by sorting of cells according to phenotype. The cells are reinfused to the patient. The patient's cell count is taken weekly. By this method, the patient's blood cell count improves. EXAMPLE 25 Expansion of Hematopoietic Cells in vitro by Upregulating
EVI-I or PRDM 16 Expression
[0147] The human EVI-1 nucleic acid sequence, operably linked to a tetracycline- inducible promoter, is inserted into a plasmid vector sequence using known molecular techniques, and is then transfected to a hematopoietic cell culture. The cell culture is allowed to proliferate as described in Example 24 for a 2 week period in the presence of the inducer agent. The cells are then counted and characterized using cell-type specific markers.
EXAMPLE 26 Administration of EVI-I Expanded Hematopoietic Cells to
Patient in Need of Treatment
[0148] Cells are reinfused intravenously, directly into the bone marrow or delivered to specific target tissues by direct application or injection in appropriate media, e.g. PBS.
EXAMPLE 27 Administration of EVI-I to Hematopoietic Cells in vivo using Nucleic Acid Vector
[0149] A patient in need of expansion of hematopoietic cells is treated with an injection of purified nucleic acid vector containing a nucleic acid sequence encoding EVI-1, operably linked to an inducible promoter. Once in a suitable hematopoietic cell, the nucleic acid integrates into the chromosomal DNA of the patient and/or is transcribed after the inducing agent is provided to the patient orally for 1 year. The hematopoietic cells are capable of in vivo expansion by this method, and the patient health improves.
EXAMPLE 28 Administration of an Agent that Upregulates EVI-related Genes in a Cell Culture
[0150] Cells are isolated from a patient in need of treatment. An agent that upregulates endogenous EVI-1 expression is added to a cell culture, such as an upstream regulator of EVI-1 expression. Cell count is measured daily. After several days, the agent is removed from the culture, the expanded cells are washed and reinfused into the patient. EXAMPLE 29
Expansion of Hematopoietic Cells in vitro by Upregulating SETBPl Expression [0151] The human SETBP1 nucleic acid sequence, operably linked to a steroid hormone inducible promoter, is inserted into an integrating vector sequence using known molecular techniques, and is then transfected to a hematopoietic cell culture. The cell culture is allowed to proliferate as described in Example 6 for one week in the presence of a steroid inducer agent. The cells are then counted and characterized using cell-type specific markers.
EXAMPLE 30 Administration of SETBPl Expanded Hematopoietic Cells to Patient in Need of Treatment
[0152] The desired cells are isolated from the culture described in Example 11, and are washed in PBS. The cells are then reinfused directly into the bone marrow of the patient. By use of this method, the patient hematopoietic cell count improves, and the patient health improves.
EXAMPLE 31 Administration of PRDM 16 to Hematopoietic Cells in vivo using Nucleic Acid Vector
[0153] A patient in need of expansion of hematopoietic cells is treated with an injection of purified nucleic acid vector containing a nucleic acid sequence encoding PRDM 16, operably linked to an inducible promoter. Once in a suitable hematopoietic cell, the nucleic acid integrates into the chromosomal DNA of the patient and/or gets transcribed after the inducing agent is provided to the patient orally for 1 year. The hematopoietic cells are capable of in vivo expansion by this method, and the patient health improves.
EXAMPLE 32
Administration of an Agent that Upregulates PRDMl 6 Genes in a Cell Culture [0154] Cells are isolated from a patient in need of treatment. An agent that upregulates endogenous PRDM 16 expression is added to a cell culture, and the cells are allowed to proliferate for 9 days. Cell count is measured daily. After 9 days, the agent is removed from the culture, the expanded cells are washed and reinfused into the patient. By use of this method, the patient health improves.
[0155] One skilled in the art will appreciate that these methods and devices are and may be adapted to carry out the objects and obtain the ends and advantages mentioned, as well as those inherent therein. The methods, procedures, and devices described herein are presently representative of preferred embodiments and are exemplary and are not intended as limitations on the scope of the invention. Changes therein and other uses will occur to those skilled in the art which are encompassed within the spirit of the invention and are defined by the scope of the disclosure.
[0156] It will be apparent to one skilled in the art that varying substitutions and modifications may be made to the invention disclosed herein without departing from the scope and spirit of the invention.
[0157] Those skilled in the art recognize that the aspects and embodiments of the invention set forth herein may be practiced separate from each other or in conjunction with each other. Therefore, combinations of separate embodiments are within the scope of the invention as disclosed herein.
[0158] All patents and publications mentioned in the specification are indicative of the levels of those skilled in the art to which the invention pertains. All patents and publications are herein incorporated by reference to the same extent as if each individual publication was specifically and individually indicated to be incorporated by reference.
[0159] The invention illustratively described herein suitably may be practiced in the absence of any element or elements, limitation or limitations which is not specifically disclosed herein. Thus, for example, in each instance herein any of the terms "comprising", "consisting essentially of and "consisting of may be replaced with either of the other two terms. The terms and expressions which have been employed are used as terms of description and not of limitation, and there is no intention that in the use of such terms and expressions indicates the exclusion of equivalents of the features shown and described or portions thereof. It is recognized that various modifications are possible within the scope of the invention disclosed. Thus, it should be understood that although the present invention has been specifically disclosed by preferred embodiments and optional features, modification and variation of the concepts herein disclosed may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention as defined by the disclosure.
[0160] In addition, where features or aspects of the invention are described in terms of Markush groups, those skilled in the art will recognize that the invention is also thereby described in terms of any individual member or subgroup of members of the Markush group.

Claims

WHAT IS CLAIMED IS:
1. A method of expanding cells, comprising: obtaining at least one cell from a patient; transfecting, infecting or transducing said cell with a retroviral or nonintegrating vector, such that cell entry and/ or integration of the vector promotes proliferation, persistence, or selective advantage of the cell; allowing the transfected cell to proliferate; reinfusing a plurality of proliferated transfected cells into said patient; and allowing said proliferated cells to expand further in the patient.
2. The method of Claim 1, wherein said transfected cell is or has characteristics of a cell selected from the group consisting of a hematopoietic progenitor cell, a hematopoietic stem cell, and a stem cell.
3. The method of Claim 2, wherein said method is used to treat a patient with a hematopoietic or other treatable disease.
4. The method of Claim 1, wherein the vector further comprises a sequence for correction or modification of a defective or deleterious gene.
5. A method of increasing cell proliferation in a mammalian cell, comprising: obtaining a cell; contacting said cell with a nucleic acid sequence encoding a protein selected from the group consisting of EVI-1, PRDM16, SETBP1, and a fragment thereof; allowing said nucleic acid to enter the cell; and allowing said cell to proliferate; wherein said cell containing said nucleic acid proliferates at an increased rate compared to a cell that has not been contacted with said nucleic acid sequence.
6. The method of C1aim 5, wherein said proliferation occurs in a cell culture.
7. The method of Claim 5, wherein said proliferation occurs in vivo.
8. The method of Claim 5, wherein said nucleic acid integrates into the chromosomal DNA.
9. The method of C1aim 5, wherein said nucleic acid is present in the cytoplasm of the cell.
10. The method of Claim 5, wherein said nucleic acid is operably linked to a promoter.
11. The method of Claim 5, wherein said nucleic acid' is constitutively expressed.
12. The method of Claim 5, wherein expression of said nucleic acid is inducible by an exogenously added agent.
13. The method of Claim 5, wherein said nucleic acid is conditionally expressed.
14. The method of Claim 5, wherein said nucleic acid is present in a vector.
15. The method of C1aim 14, wherein said vector is a viral vector.
16. The method of Claim 5, wherein said nucleic acid is expressed for a number of division cycles selected from the group consisting of: about 1, 3, 5, 8, 10, 13, 17, or 20 division cycles, then expression decreases or stops thereafter.
17. The method of C1aim 5, wherein said cell is or has characteristics of a cell selected from the group consisting of a hematopoietic stem cell, hematopoietic progenitor cell, a stem cell, an embryonic stem cell, an adult stem cell, a multipotent stem cell, and a myelopoietic stem cell.
18. The method of Claim 17, wherein said cell is a hematopoietic stem cell.
19. A method of expansion of a gene-corrected cell, comprising: obtaining a cell in need of gene correction; transfecting said cell with a functional copy of a said gene in need of correction; transfecting said cell with a copy of a nucleic acid encoding a polypeptide sequence selected from the group consisting of EVI-1, PRDM 16, SETBP1, and a fragment thereof; and allowing said cell to proliferate in culture; thereby obtaining an expanded culture of gene corrected cells.
20. A method of forming a bodily tissue having gene corrected cells, comprising: obtaining a cell in need of gene correction; transfecting said cell with a functional copy of a said gene in need of correction; transfecting said cell with a copy of a nucleic acid encoding a polypeptide sequence selected from the group consisting of EVI-1, PRDM16, SETBP1, and a fragment thereof; allowing said cell to proliferate in culture; and treating said cell culture to allow formation of a bodily tissue; thereby obtaining an expanded culture of gene corrected cells.
21. A method of identifying a gene, the modulation of which increases the proliferation rate of a cell, comprising: obtaining a sample of cells from a patient having previously received a therapeutic transfection with a nucleic acid sequence; identifying positions of nucleic acid insertion in the cells from the sample; identifying a favorable insertion site based upon disproportional representation of said site in the population of transfected cells; and identifying a gene associated with the insertion site.
22. A nucleic acid integration region that, when insertionally modulated, results in increased hematopoietic cell proliferation, comprising a sequence selected from the group consisting of: the EVI-1 gene, the PRDM16 gene, and the SETBP1 gene.
23. A nucleic acid sequence whose modulation of expression is associated with the increased proliferation of hematopoietic cells, selected from the group consisting of: MGC10731, PADI4, CDA, CDW52, ZBTB8, AK2, FLJ32112, TACSTD2, FLJ13150, MGC24133, NOTCH2, NOHMA, EST1B, PBX1, PLA2G4A, HRPT2, ATP6V1G3, PTPRC, NUCKS, CABC1, LOC339789, PRKCE, AFTPHILIN, NAGK, MARCH7, DHRS9, PRKRA, SESTD1, MGC42174, CMKOR1, TBC1D5, THRB, MAP4, IFRD2, ARHGEF3, FOXP1, ZBTB20, EAF2, MGLL, PLXND1, SLC9A9, SELT, CCNL1, MDS1, BCL6, MIST, STIM2, TEC, OCIAD1, FLJ10808, SEPTIl, PRKG2, MLLT2, PGDS, MANBA, SRY1, SET7, MAML3, DCTD, CARF, IRF2, AHRR, POLS, ROPN1L, FLJ10246, IPO11, C2GNT3, SSBP2, EDIL3, SIAT8D, FLJ20125, GNB2L1, C6orf105, JARID2, C6orf32, HCG9, MGC57858, TBCC, SENP6, BACH2, REPS1, HDAC9, 0SBPL3, HOXA7, CALN1, FKBP6, NCF1, HIP1, GNAI7, ZKSCAN1, MGC50844, LOC346673, CHRM2, ZH3HAV1, REPlN1, SMARCD3, CTSB, ADAM28, LYN, YTHDF3, SMARCA2, C9orf93, NPR2, BTEB1, ALDH1A1, AUH, C9orf3, WDR31, CEP1, GSN, RABGAP1, ZNF79, CUGBP2, C10orf7, PTPLA, PLXD2, ACBD5, PRKG1, MYST4, IFIT1, C10orf129, CUEDC2, FAM45A, GRK5, OR52N1, OR2AG2, ZNF143, C11orf8, LM02, NGL-1, DGKZ, NR1H3, KBTBD4, C1QTNF4, MGC5395, ARRB1, FLJ23441, FGIF, MAML2, LOC196264, HSPC063, ELKS, CACNA2D4, CHD4, EPS8, LRMP, NEUROD4, RNF41, FAM19A2, RASSF3, PAMC1, PLXNC1, DAP13, MGC4170, FLJ40142, JIK, CDK2AP1, GPR133, PCDH9, C13orf25, ABHD4, AP4S1, MIA2, RPS29, PSMC6, RTN1, MED6, C14orf43, C14orf118, RPS6KA5, GNG2, PAK6, B2M, ATP8B4, TRIP4, CSK, MESDC1, RKHD3, AKAP13, DET1, DKFZp547K1113, SV2B, LRRK1, CHSY1, TRAF7, ZNF205, ABCC1, THUMPD1, IL21R, MGC2474, N4BP1, SLIC1, CDH9, GPR56, ATBF1, ZNRF1, CMIP, MGC22001, C17orf31, SAT2, ADORA2B, TRPV2, NF1, LOC117584, MLLT6, STAT5A, STAT3, HOXB3, HLF, MAP3K3, SCN4A, ABCA10, EPB41L3, ZNF521, RNF125, SETB P1, FLJ20071, CDH7, MBP, MBP, NFATC1, GAMT, MOBKL2A, NFIC, CALR, GPSN2, ZNF382, EGLN2, PNKP, LAIR1, ZNF579, SOX12, C20orf30, PLCB1, SNX5, LOC200261, ZNF336, BAK1, SPAG4L, EPB411L1, NC0A3, KIAA1404, STMN3, CBR3, DYRKlA, CSTB, C22orf14, UPB1, MN1, XBP1, C22orf19, RBM9, MYH9, TXN2, PSCD4, UNC84B, FLJ2544, ZCCHC5, MST4, IDS, UTY, SKI, PRDM16, PARK7, CHC1, ZMYM1, TNPP5B, GLIS1, SLC27A3, ASHlL, SLAMF1, PBX1, CGI-49, ELYS, RNF144, FAM49A, FLJ21069, SFRS7, SPTBN1, TMEM17, ARHGAP25, FLJ20558, CAPG, PTPN18, RBMS1, LOC91526, KLF7, FLJ23861, CMKOR1, CRBN, ITPR1, RAFTLIN, TNA, CCDC12, FHIT, VGL-3, PPMlL, EVI-1, MDS1, HDSH3TC1, DHX15, TMEM33, CXCL3, EPGN, LRBA, FLJ25371, CPE, POLS, PTGER4, LHFPL2, C5orf12, CETN3, PHF15, PFDN1, KIAA0555, GNB2L1, HLA-E, SLC17A5, UBE2J1, BACH2, HIVEP2, SNX8, TRIAD3, RAC1, ARL4A, ELMO1, BLVRA, SUNC1, ABCA13, GTF2IRD1, RSBN1L, ADAM22, MLL5, IMMP2L, SEC8L1, FLJ12571, CUL1, ANGPT1, DEPDC6, EPPK1, MLANA, MLLT3, SMUl, TLE4, C9orf3, ABCAl, STOM, RABGAP1, NEK6, NR5A1, MGC20262, FLJ20433, MAP3K8, ARHGAP22, C10orf72, TACR2, NKX2, OBFC1, VTI1A, ABLIM1, FLJ14213, MS4A3, B3GNT6, NADSYN1, CENTD2, MAML2, ATP5L, FLI1, CACNA1C, HEBP1, MLSTD1, IPO8, ARID2, SLC38A1, KRT7, USP15, KIAA1040, WIF1, CGI-119, DUSP6, FLJ11259, CMKLR1, SSH1, TPCN1, FLJ42957, JIK, FLT3, TPT1, FNDC3, ARHGAP5, ARF6, GPHN, C14orf4, STN2, PPP2R5C, CDC42BPB, CEP152, OAZ2, AKAP13, CHSY1, CRAMP1L, MHC2TA, NPIP, SPN, MMP2, DKFZp434I099, SIAT4B, PLCG2, MYO1C, C17orf31, MGC51025, WSB1, TRAF4, SSH2, HCA66, RFFL, DUSP14, TCF2, ZNF652, STXBP4, HLF, MSI2, VMP1, HELZ, TREM5, RAB37, SEC14L1, SEPT9, BIRC5, PSCD1, MGC4368, NDUFV2, C18orf25, ATP8B1, CDH7, FLJ44881, NFATC1, C19orf35, GNG7, MATK, C3, ZNF358, LYL1, F2RL3, ZNF253, ZNF429, KIAA1533, U2AF1L3, GMFG, BC-2, C20orf30, PLCB1, LOC200261, C20orf112, ADA, PREX1, C21orf34, C21orf42, ERG, ABCG1, MN1, HORMAD2, LOC113826, C22orf1, EFHC2, SYLT4, MGC27005, FHL1, GAB3, and CSF2RA.
24. A method of identifying a favorable insertion site of a nucleic acid sequence in a proliferating cell culture, comprising: transfecting a cell sample with a nucleic acid sequence; allowing cell proliferation to occur; determining at least one main insertion site of the nucleic acid using LAM- PCR over time; using said at least one main insertion site to predict the location of at least one main insertion site of another cell sample transfected with a substantially similar nucleic acid sequence over a similar time period; obtaining a sample of cells from a patient having previously received a therapeutic transfection with a nucleic acid sequence; identifying positions of nucleic acid insertion in the cells from the sample; and identifying a favorable insertion site based upon disproportional representation of said site in the population of transfected cells.
25. A method of expansion of a cell, comprising contacting said cell with a polypeptide selected from the group consisting of: an EVI-1 polypeptide, a PRDM 16 polypeptide, a SETBP1 polypeptide, a fragment thereof, or a synthetic peptide derivative thereof.
PCT/US2006/021413 2005-06-01 2006-06-01 Stem and progenitor cell expansion by evi, evi-like genes and setbp1 WO2007008309A2 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US11/948,920 US20090028836A1 (en) 2005-06-01 2007-11-30 Stem and progenitor cell expansion by evi, evi-like genes and setbp1

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US68696305P 2005-06-01 2005-06-01
US60/686,963 2005-06-01
US78844606P 2006-03-31 2006-03-31
US60/788,446 2006-03-31

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US11/948,920 Continuation US20090028836A1 (en) 2005-06-01 2007-11-30 Stem and progenitor cell expansion by evi, evi-like genes and setbp1

Publications (2)

Publication Number Publication Date
WO2007008309A2 true WO2007008309A2 (en) 2007-01-18
WO2007008309A3 WO2007008309A3 (en) 2007-07-26

Family

ID=37137578

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2006/021413 WO2007008309A2 (en) 2005-06-01 2006-06-01 Stem and progenitor cell expansion by evi, evi-like genes and setbp1

Country Status (1)

Country Link
WO (1) WO2007008309A2 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013102155A1 (en) * 2011-12-29 2013-07-04 Cell Machines, Inc. Cells for virus and protein production
US11421287B2 (en) * 2016-07-29 2022-08-23 Juno Therapeutics, Inc. Methods for assessing the presence or absence of replication competent virus
US11535903B2 (en) 2018-01-31 2022-12-27 Juno Therapeutics, Inc. Methods and reagents for assessing the presence or absence of replication competent virus

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005083097A1 (en) * 2004-02-25 2005-09-09 Children's Hospital Medical Center A method for creating myeloid cell lines

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005083097A1 (en) * 2004-02-25 2005-09-09 Children's Hospital Medical Center A method for creating myeloid cell lines

Non-Patent Citations (10)

* Cited by examiner, † Cited by third party
Title
BJORGVINSDOTTIR HELGA ET AL: "Retroviral-mediated gene transfer of gp91-phox into bone marrow cells rescues defect in host defense against Aspergillus fumigatus in murine X-linked chronic granulomatous disease" BLOOD, vol. 89, no. 1, 1997, pages 41-48, XP002427458 ISSN: 0006-4971 *
CHI YIQING ET AL: "EVI1 promotes cell proliferation by interacting with BRG1 and blocking the repression of BRG1 on E2F1 activity." JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 278, no. 50, 12 December 2003 (2003-12-12), pages 49806-49811, XP002406183 ISSN: 0021-9258 *
HACEIN-BEY-ABINA S ET AL: "LMO2-Associated Clonal T Cell in Two Patients after Gene Therapy for SCID-X1" SCIENCE, AMERICAN ASSOCIATION FOR THE ADVANCEMENT OF SCIENCE,, US, vol. 302, 17 October 2003 (2003-10-17), pages 415-419, XP002987515 ISSN: 0036-8075 *
LI Z ET AL: "Murine Leukemia Induced by Retroviral Gene Marking" SCIENCE, AMERICAN ASSOCIATION FOR THE ADVANCEMENT OF SCIENCE,, US, vol. 296, 19 April 2002 (2002-04-19), page 497, XP002987516 ISSN: 0036-8075 *
MINAKUCHI MASAYOSHI ET AL: "Identification and characterization of SEB, a novel protein that binds to the acute undifferentiated leukemia-associated protein SET" EUROPEAN JOURNAL OF BIOCHEMISTRY, vol. 268, no. 5, March 2001 (2001-03), pages 1340-1351, XP002427456 ISSN: 0014-2956 *
MOCHIZUKI N ET AL: "A novel gene, MEL1, mapped to 1p36.3 is highly homologous to the MDS1/EVI1 gene and is transcriptionally activated in t(1" BLOOD, W.B.SAUNDERS COMPANY, ORLANDO, FL, US, vol. 96, no. 9, 1 November 2000 (2000-11-01), pages 3209-3214, XP002366033 ISSN: 0006-4971 *
OTT MARION G ET AL: "Correction of X-linked chronic granulomatous disease by gene therapy, augmented by insertional activation of MDS1-EVI1, PRDM16 or SETBP1" NATURE MEDICINE, vol. 12, no. 4, April 2006 (2006-04), pages 401-409, XP002406184 ISSN: 1078-8956 *
OTT MARION G ET AL: "Gene therapy for x-linked chronic granulomatous disease" BLOOD, vol. 104, no. 11, Part 1, November 2004 (2004-11), page 120A, XP002406182 & 46TH ANNUAL MEETING OF THE AMERICAN-SOCIETY-OF-HEMATOLOGY; SAN DIEGO, CA, USA; DECEMBER 04 -07, 2004 ISSN: 0006-4971 *
PODSAKOFF G M ET AL: "Selective survival of peripheral blood lymphocytes in children with HIV-1 following delivery of an anti-HIV gene to bone marrow CD34<+> cells" MOLECULAR THERAPY, ACADEMIC PRESS, SAN DIEGO, CA,, US, vol. 12, no. 1, July 2005 (2005-07), pages 77-86, XP004974951 ISSN: 1525-0016 *
YUASA HIROMI ET AL: "Oncogenic transcription factor Evi1 regulates hematopoietic stem cell proliferation through GATA-2 expression" EMBO (EUROPEAN MOLECULAR BIOLOGY ORGANIZATION) JOURNAL, vol. 24, no. 11, June 2005 (2005-06), pages 1976-1987, XP002427457 ISSN: 0261-4189 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013102155A1 (en) * 2011-12-29 2013-07-04 Cell Machines, Inc. Cells for virus and protein production
US11421287B2 (en) * 2016-07-29 2022-08-23 Juno Therapeutics, Inc. Methods for assessing the presence or absence of replication competent virus
US11535903B2 (en) 2018-01-31 2022-12-27 Juno Therapeutics, Inc. Methods and reagents for assessing the presence or absence of replication competent virus

Also Published As

Publication number Publication date
WO2007008309A3 (en) 2007-07-26

Similar Documents

Publication Publication Date Title
US6586192B1 (en) Compositions and methods for use in affecting hematopoietic stem cell populations in mammals
Schuringa et al. Constitutive activation of STAT5A promotes human hematopoietic stem cell self-renewal and erythroid differentiation
US10653123B2 (en) Methods and compositions for perturbing gene expression in hematopoietic stem cell lineages in vivo
Stier et al. Ex vivo targeting of p21Cip1/Waf1 permits relative expansion of human hematopoietic stem cells
KR20090015976A (en) Isolation and purification of hematopoietic stem cells from post-liposuction lipoaspirates
EP3060670B1 (en) Method
Gori et al. Endothelial cells promote expansion of long-term engrafting marrow hematopoietic stem and progenitor cells in primates
JP2022523052A (en) Compositions and Methods for Targeting Mutant RAS
EP1129175A2 (en) Promotion of self-renewal and improved gene transduction of hematopoietic stem cells by histone deacetylase inhibitors
CN112601812A (en) Gene therapy
JP2022103424A (en) Suicide gene therapeutic agent for brain tumors using pluripotent stem cell
Broxmeyer Cord blood as an alternative source for stem and progenitor cell transplantation
US5837507A (en) Hox-induced enhancement of in vivo and in vitro proliferative capacity and gene therapeutic methods
JP2002502599A (en) Expanded and genetically modified human hematopoietic stem cell population
US20090028836A1 (en) Stem and progenitor cell expansion by evi, evi-like genes and setbp1
WO2007008309A2 (en) Stem and progenitor cell expansion by evi, evi-like genes and setbp1
Suzuki et al. Homeostasis of hematopoietic stem cells regulated by the myeloproliferative disease associated-gene product Lnk/Sh2b3 via Bcl-xL
Andrews et al. Differential engraftment of genetically modified CD34+ and CD34− hematopoietic cell subsets in lethally irradiated baboons
Otsu et al. Reconstitution of lymphoid development and function in ZAP-70–deficient mice following gene transfer into bone marrow cells
Watts et al. Differential effects of HOXB4 and NUP98-HOXA10hd on hematopoietic repopulating cells in a nonhuman primate model
AU4419396A (en) System for the maintenance, growth and differentiation of human and non-human primate pluripotent stem, progenitor and mature bone marrow cells
WO1996017627A9 (en) System for the maintenance, growth and differentiation of human and non-human primate pluripotent stem, progenitor and mature bone marrow cells
EP3893898B1 (en) Method of treating autoimmune and inflammatory diseases using b cells
US20040029271A1 (en) Pax5-deficient pro-B cells, methods of producing them and the use of such cells in human therapy
EP1361268A1 (en) Pax-5-deficient pro-B cells, methods of producing them and the use of such cells in human therapy

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 06771918

Country of ref document: EP

Kind code of ref document: A2