WO2007007054A1 - Phthalamides, succinimides and related compounds and their use as pharmaceuticals - Google Patents

Abstract

The present invention relates to certain phthalamides, succinimides and related compounds and their use as pharmaceuticals. In particular, the present invention relates to these compounds, pharmaceutical compositions comprising these compounds, and use of these compounds, for example, to inhibit DNA methylation in cells, particularly tumour cells.

Description

PHTHALAMIDES, SUCCINIMIDES AND RELATED COMPOUNDS AND THEIR USE

AS PHARMACEUTICALS

The present invention relates to phthalamides, succinimides and related compounds and their use as pharmaceuticals. In particular, the present invention relates to the use of these compounds to inhibit DNA methylation in cells, particularly tumour cells.

DNA can be methylated through covalent methylation of cytosine residues at their carbon-5 position. It has been found that DNA methylation is an important mechanism of gene regulation, particularly gene silencing. Gene regulation by DNA methylation is an "epigenetic" form of gene regulation, as the DNA sequence information itself remains unaltered.

Aberrant DNA methylation patterns are closely associated with epigenetic mutations or epimutations, which can have the same consequences as genetic mutations. For example, many tumours show hypermethylation and concomitant silencing of tumour suppressor genes. Several developmental disorders are also associated with aberrant DNA methylation.

Thus, changes in DNA methylation play an important role in developmental and proliferative diseases, particularly in tumourigenesis.

The DNA methylation reaction is catalyzed by DNA methyl transferases (DNMTs). Establishment and maintenance of DNA methylation patterns require the activity of several DNMTs. In mammalians, DNA methylation is established during early embryogenesis by the de novo DNA methyl transferases (DNMT3A and DNMT3B). In differentiated cells, methylation patterns are maintained by DNMT1 which is therefore also responsible for maintenance of epimutations.

Inhibition of DNA methylation, particularly by inhibition of DNMTs, more particularly DNMT1 , is considered a promising strategy for treatment of proliferative diseases. However, satisfactory methods for inhibition of DNA methylation have previously not been available.

Genetic inhibition of DNMTs, although theoretically possible (US 6,054,439), suffers from the widely known and currently insurmountable difficulties associated with gene therapy. Pharmacological inhibition of DNMTs has been limited to the use of structural analogues of cytosine, such as 5-azacytidine, 5-aza 2'deoxycytidine (decitabine), and 5,6-dihydro- 5-azacytidine (US 4,058,602; DE 198 23 484 A1). These cytosine analogues suffer from low specificity and high toxicity, limiting their use to a very small set of clinical indications.

Therefore, there is a need for other inhibitors of DNA methylation, particularly inhibitors of DNMTs. Preferably, such inhibitors should have a different mode of action than structural analogues of cytidine, and they should be more specific and less toxic than other inhibitors of DNA methylation.

Accordingly, a first aspect of the present invention provides, a compound according to formula I:

or an isomer, salt, solvate, chemically protected form or prodrug thereof, wherein:

R^A is:

/ Λ

*— N I ₃

where X¹ is selected from -CH₂- and -C(=O)-; X⁴ is selected from -CH₂-, -C(=O)-, -Sf=O)₂- and -Cf=O)-CH₂- wherein -C(=O)- of

-Cf=O)-CH₂- is bonded to N and -CH₂ of -Cf=O)-CH₂- is bonded to X³; or X¹ and X⁴ are N and NH respectively and there is a double bond between X¹ and N;

X² and X³ are either independently -CHR^B1-, where R^B1 is selected from H, optionally substituted C_1-7 alkyl, optionally substituted C_5-20 aryl, optionally substituted C_3-20 heterocyclyl, halo, hydroxy and amido; or X² and X³ form part of a fused benzene or pyridine ring, which may be optionally substituted by one or more optionally substituted Ci_-7 alkyl, optionally substituted

C_5-20 aryl, optionally substituted C_3-20 heterocyclyl, halo, hydroxy, amido, nitro and carboxy groups; R^B is selected from:

(0

where R^B1 and R^B2, together with the carbon atoms to which they are bound form an optionally substituted fused benzene or pyridine ring;

Y¹ is selected from NR^N\ O and S;

Y² is selected from NR^N1, O and S;

Y³ is selected from CH and N, where R^N1 is H or methyl; and

(iii)

R^c is selected from the group consisting of: (i) -COR^G1, wherein R^C1 is selected from the group consisting of: -OH, -NH₂,

-NHNH₂, -NHCN, -NHSO₂R^S1, -NR^N2OR⁰¹, -NH-CN₄H, where R^S1 is H or methyl, R⁰¹ is

H or methyl and R^N2 is H or methyl;

(ii) -(CH₂)_n-CO₂H;

(iii) -CH₂OR⁰². where R°² is selected from H and C_1-4 alkyl; (iv) -NHSO₂R^S1. where R^S1 is as defined above;

(v) -SO₂NHR^S1, where R^S1 is as defined above; and (vi)

(vii) -CN; with the proviso when A is:

and C is -CO₂H, then B is not:

It may be preferred that when A is

and C is -CO₂H, then B is not one or more of the following groups:

It may also be preferred that when A is:

and C is -CO₂H, then B is not unsubstituted or substituted indol-3-yl-methyI. A second aspect of the present invention provides a pharmaceutical composition comprising a compound according to formula I:

or an isomer, salt, solvate, chemically protected form or prodrug thereof, and a pharmaceutically acceptable carrier or diluent, wherein:

R^A is:

where X¹ is selected from -CH₂- and -C(=O)-;

X⁴ is selected from -CH₂-, -C(=O)-, -S(O)₂- and -C(=O)-CH₂- wherein -C(O)- of

-C(O)-CH₂- is bonded to N and -CH₂ of -C(O)-CH₂- is bonded to X³; or X¹ and X⁴ are N and NH respectively and there is a double bond between X¹ and N;

X² and X³ are either independently -CHR^B1-, where R^B1 is selected from H, optionally substituted C_1-7 alkyl, optionally substituted C_5-2O aryl, optionally substituted C_3-20 heterocyclyl, halo, hydroxy and amido; or X² and X³ form part of a fused benzene or pyridine ring, which may be optionally substituted by one or more optionally substituted C_1-7 alkyl, optionally substituted C_5-20 aryl, optionally substituted C_3-20 heterocyclyl, halo, hydroxy, amido, nitro and carboxy groups;

R^B is selected from:

CO

where R^B1 and R^B2, together with the carbon atoms to which they are bound form an optionally substituted fused benzene or pyridine ring;

Y¹ is selected from NR^N1, O and S;

Y² is selected from NR^N1, O and S;

Y³ is selected from CH and N, where R^N1 is H or methyl; and

(ϋ)

R^c is selected from the group consisting of:

(i) -COR^C1, wherein R^C1 is selected from the group consisting of: -OH, -NH₂, -NHNH₂, -NHCN, -NHSO₂R^S1, -NR^N2OR⁰¹, -NH-CN₄H, where R^S1 is H or methyl, R⁰¹ is H or methyl and R^N2 is H or methyl;

(ϋ) -(CH₂)_n-CO₂H; (iii) -CH₂OR⁰². where R°² is selected from H and C_1-4 alky!; (iv) -NHSO₂R⁵³¹. where R^S1 is as defined above;

(V) -SO₂NHR^S1, where R^S1 is as defined above; and

(vi)

(vii) -CN; with the proviso when A is:

and C is -CO₂H, then B is not:

it may be preferred that when A is:

and C is -CO₂H, then B is not:

It may be preferred that when A is:

and C is -CO₂H₁ then B is not:

It may also be preferred that when A is:

and C is -CO₂H, then B is not unsubstituted or substituted indol-3-yl-methyl.

A third aspect of the present invention provides a compound as defined in the second aspect for use in a method of treatment of the human or animal body. A fourth aspect of the present invention provides the use of a compound as defined in the second aspect of the invention in the preparation of a medicament for treating a disease ameliorated by the inhibition of one or more DNMTs, more particularly DNMT1 , and/or the inhibition of DNA methyiation.

A fifth aspect of the present invention provides treatment of a disease ameliorated by the inhibition of one or more DNMTs, more particularly DNMT1 , and/or the inhibition of DNA methyiation, comprising administering to a subject in need of treatment a therapeutically-effective amount of a compound as defined in the second aspect, preferably in the form of a pharmaceutical composition.

In the second to fourth aspects, those compounds which are disclaimed from the first aspect may also be disclaimed. This also applies to the compounds which are disclosed as being possibly disclaimed from the first aspect of the invention.

Aberrant DNA methyiation preferably relates to any kind of hypermethylation, be it genome-wide or limited to distinct genomic or chromosomal regions or genes. DNA methyiation can be measured by any of the methods known in the art (e.g. Okamoto, A., et al., JACS, 124, 10262-10263 (2002)), methyiation sensitive arbitrarily primed PCR (Gonzalgo, M.L., et al., Cancer Res., 57, 594-599 (1997)), methylated CpG island amplification (Toyota, M., et al., Cancer Res., 59, 2307-2312 (1999)), restriction landmark genomic scanning (RLGS) (Hayashizaki, Y., ef al., Electrophoresis, 14, 251- 258 (1993)), differential methyiation hybridization (Huang, T. H., ef al., Hum. MoI. Genet, 8, 459-470 (1999)), capillary electrophoresis (Stach, D., et al., Nucleic Acids Res., 31, e2 (2003)), and microarray-based techniques (Adorjan, P., ef al., Nucleic Acids Research, 30(5), e21 (2002)). Thus, it is also possible to identify diseases associated with aberrant DNA methyiation.

Examples of diseases which can be treated with the compounds according to the present invention include developmental disorders and proliferative diseases.

Examples for developmental disorders which can be treated with the compounds according to the present invention include Prader-Willi-Syndrome, Angelman-Syndrome (Happy Puppet Syndrome), and Beckwith-Wiedemann-Syndrome. Examples for proliferative diseases which can be treated with the compounds according to the present invention include coronary restenosis and neoplastic diseases.

Said neoplastic diseases include neuroblastoma, intestine carcinoma such as rectum carcinoma, colon carcinoma, familiary adenomatous polyposis carcinoma and hereditary non-polyposis colorectal cancer, esophageal carcinoma, labial carcinoma, larynx carcinoma, hypopharynx carcinoma, tongue carcinoma, salivary gland carcinoma, gastric carcinoma, adenocarcinoma, medullary thyroidea carcinoma, papillary thyroidea carcinoma, renal carcinoma, kidney parenchym carcinoma, ovarian carcinoma, cervix carcinoma, uterine corpus carcinoma, endometrium carcinoma, chorion carcinoma, pancreatic carcinoma, prostate carcinoma, testis carcinoma, breast carcinoma, urinary carcinoma, melanoma, brain tumours such as glioblastoma, astrocytoma, meningioma, medulloblastoma and peripheral neuroectodermal tumours, Hodgkin lymphoma, non-Hodgkin lymphoma, Burkitt lymphoma, acute lymphatic leukemia (ALL), chronic lymphatic leukemia (CLL), acute myeolid leukemia (AML), chronic myeloid leukemia (CML), adult T-cell leukemia lymphoma, hepatocellular carcinoma, gall bladder carcinoma, bronchial carcinoma, small cell lung carcinoma, non- small cell lung carcinoma, multiple myeloma, basalioma, teratoma, retinoblastoma, choroidea melanoma, seminoma, rhabdomyosarcoma, craniopharyngeoma, osteosarcoma, chondrosarcoma, myosarcoma, liposarcoma, fibrosarcoma, Ewing sarcoma, prostate carcinoma, and plasmocytoma.

Preferred indications are colon carcinoma, familiary adenomatous polyposis carcinoma and hereditary non-polyposis colorectal cancer, prostate carcinoma, melanoma, non- Hodgkin lymphoma, acute lymphatic leukemia (ALL), chronic lymphatic leukemia (CLL), acute myeolid leukemia (AML), chronic myeloid leukemia (CML), or hepatocellular carcinoma.

The compounds according to the first aspect of the invention can also be used in combination with other pharmaceutically active compounds, preferably compounds which are able to enhance the effect of the compounds according to the first aspect of the invention. Examples of such compounds include: (i) antimetabolites, cytarabine, fludarabine, 5-fluoro-2^'-deoxyuridine, gemcitabine, hydroxyurea or methotrexate; (ii) DNA-fragmenting agents, bleomycin, (iii) DNA-crosslinking agents, chlorambucil, cisplatin, fotemustine, cyclophosphamide or nitrogen mustard; (iv) intercalating agents, adriamycin (doxorubicin) or mitoxantrone; (v) protein synthesis inhibitors, L- asparaginase, cycloheximide, puromycin or diphteria toxin; (vi) topoisomerase I poisons, camptothecin or topotecan; (vii) topoisomerase I! poisons, etoposide (VP-16) or teniposide; (viii) microtubυle-directed agents, colcemid, colchicine, paclitaxel (taxol), docetaxel (taxotere), vinblastine or vincristine; (ix) kinase inhibitors, flavopiridol, staurosporin, STI571 (CPG 57148B) or UCN-01 (7-hydroxystaurosporine); (x) miscellaneous investigational agents, trichostatin A, thioplatin, PS-341, phenylbutyrate, ET-I8-OCH₃, or famesyl transferase inhibitors (L-739749, L-744832); polyphenols, quercetin, resveratrol, piceatannol, epigallocatechine gallate, theaflavins, flavanols, procyanidins, betulinic acid and derivatives thereof; (xi) hormones, glucocorticoids or fenretinide; (xii) hormone antagonists, tamoxifen, finasteride or LHRH antagonists, or (xiii) a combination of any of the pharmaceuticals given above.

The compounds of the first aspect of the invention can be used to inhibit DNA methylation in cells either in vivo or in vitro. Particularly, said compounds inhibit one or more DNMTs, more particularly DNMT1 , even more particularly human DNMT1.

The compounds of the first aspect of the invention may also be used to induce cellular differentiation in vivo and/or in vitro. Cellular differentiation relates to any differentiation of a cell from a less differentiated (specialized) state to a more differentiated

(specialized) state. Cell types which can be treated include, but are not limited to, embryonic and adult stem cells, totipotent, omnipotent, pluripotent, multipotent, oligopotent, or monopotent stem cells, progenitor cells, committed progenitor cells, as well as stem cells derived from bone marrow, peripheral blood, umbilical cord blood, adipose tissue, heart muscle, intestine, small intestine, or brain. Particular examples include multipotent adult progenitor cells (MAPCs), mesenchymal stem cells, hematopoetic stem cells, intestinal stem cells, hepatic stem cells (oval cells), neuronal stem cells, epidermal stem cells, myoblasts, cardiomyoblasts, osteoblasts, chondroblasts, and basal cells of epithelia, e.g. the respiratory epithelium.

The GenBank accession numbers of selected DNMTs of human, mouse, Drosphila melanogaster, Haemophilus haemolyticus and Haemophilus aegyptius are given below: human DNMT1 protein (GenBank Ace. No. NP_001370) human DNMT2 protein (GenBank Ace. No. AAC39764) human DNMT3A protein (GenBank Ace. No. AAD33084) human DNMT3B protein (GenBank Ace. No. AAD53063) mouse DNMT1 protein (GenBank Ace. No. NP_034196) D. melanogaster dDNMT2 protein (GenBank Ace. No. AAF03835) H. haemolyticus M.Hhal methyltransferase protein (GenBank Ace. No. XYHIH1) H. aegyptius M.Hhal methyltransferase protein (GenBank Ace. No. AAA24970)

Different DNMTs in different species are highly conserved, i.e. structurally similar, particularly with respect to their C-terminal catalytic domains. Therefore, the compounds of the first aspect of the invention are capable of binding and inhibiting different DNMTs in different species.

One advantage of the compounds according to the present invention is that they are abie to substantially demethylate and reactivate euchromatic genes (e.g. tumour suppressor genes), but not centromeric satellite sequences. This is an advantage for treatment of cells or patients, as demethylation of satellite sequences has been shown to promote tumourigenesis by destabilizing chromosome organization. This will have a positive effect on maintenance of genome stability in cells or patients treated with the compounds according to the present invention.

Definitions

The term "α-amino acid side chain" as used herein, pertains to the group, R, in the following formula for an α-amino acid:

Examples of α-amino acids include both natural amino acids and non-natural amino acids. The natural amino acids include: those with nonpolar (hydrophobic) R groups: alanine, AIa, A; isoleucine, He, I; leucine, Leu, L; methionine, Met, M; phenylalanine, Phe, F; tryptophan, Trp, W; and valine, VaI, V; those with polar but uncharged R groups: asparagine, Asn, N; cysteine, Cys, C; glutamine, GIn, Q; glycine, GIy, G; serine, Ser, S; threonine, Thr, T; and tyrosine, Tyr, Y; those with (potentially) positively charged R groups: arginine, Arg, R; histidine, His, H; and lysine, Lys, K; and those with (potentially) negatively charged R groups: aspartic acid, Asp, D; glutamic acid, GIu, E.

Therefore, natural α-amino acid side chains include: -CH₃ (A), -C(CH₃)C₂H₅ (I),

-CH₂CH(CHa)₂ (L). -C₂H₄SCH₃ (M), -CH₂C₆H₅ (F), -CH₂C₈NH₅ (W); -CH(CHg)₂ (V), -CH₂C(=O)NH₂ (N), -CH₂SH (C), -C₂H₄C(=O)NH₂ (Q), -H (G), -CH₂OH (S), -CH(OH)CH₃ (T), -CH₂C₆H₄OH (Y), -C₃H₆NHC(=NH)NH₂ (R), -CH₂C₃N₂H₃ (H), -C₄H₈NH₂ (K), -CH₂CO₂H (D), -C₂H₄CO₂H (E).

Examples of modified natural amino acids include, but are not limited to, hydroxyproline, γ-carboxyg!utamate, and O-phosphoserine.

Examples of non-natural α-amino acids include: β-(napth-2-yl)alanine, β-(2-cyanophenyl) alanine, β-(ethinyl)alanine, β-(furan-2-yl)a!anine, β-(thien-2- yl)alanine, β-(4-pyridinyl)alanine,

Non-natural amino acid side chains can be defined as being optionally substituted Ci_-7 alkyl groups, wherein the substituents are preferably selected from the group consisting of: hydroxy, ether, thio, thioether, C_5-20 aryl, carboxy, amido and imino.

Alkyl: The term "alkyl" as used herein, pertains to a monovalent moiety obtained by removing a hydrogen atom from a carbon atom of a hydrocarbon compound having from 1 to 20 carbon atoms (unless otherwise specified), which may be aliphatic or alicyclic, and which may be saturated or unsaturated (e.g. partially unsaturated, fully unsaturated). Thus, the term "alkyl" includes the sub-classes alkenyl, alkynyl, cycloalkyl, cycloalkyenyl, cylcoalkynyl, etc., discussed below.

In the context of alkyl groups, the prefixes (e.g. C_1-4, Ci_-7, Ci_-20, C_2-7, C_3-7, etc.) denote the number of carbon atoms, or range of number of carbon atoms. For example, the term "Ci_-4 alkyl", as used herein, pertains to an alkyl group having from 1 to 4 carbon atoms. Examples of groups of alkyl groups include C_1-4 alkyl ("lower alkyl"), C_1-7 alkyl, C-i-_to alkyl and Ci_-20 alkyl. Note that the first prefix may vary according to other limitations; for example, for unsaturated alkyl groups, the first prefix must be at least 2; for cyclic alkyl groups, the first prefix must be at least 3; etc.

Examples of (unsubstituted) saturated alkyl groups include, but are not limited to, methyl (C₁), ethyl (C₂), propyl (C₃), butyl (C₄), pentyl (C₅), hexyl (C₆), heptyl (C₇), octyl (C₈), nonyl (Cg), decyl (Ci₀), undecyl (C₁₁), dodecyl (Ci₂), tridecyl (Ci₃), tetradecyl (C_M), pentadecyl (Ci₅), and eicodecyl (C₂₀).

Examples of (unsubstituted) saturated linear alkyl groups include, but are not limited to, methyl (C₁), ethyl (C₂), n-propyl (C₃), n-butyl (C₄), n-pentyl (amyl) (C₅), n-hexyl (C₆), and n-heptyl (C₇).

Examples of (unsubstituted) saturated branched alkyl groups include iso-propyl (C₃), iso-butyl (C₄), sec-butyl (C₄), tert-butyl (C₄), iso-pentyl (C₅), and neo-pentyl (C₅).

Alkenyl: The term "alkenyl", as used herein, pertains to an alkyl group having one or more carbon-carbon double bonds. Examples of groups of alkenyl groups include C₂.₄ alkenyl, C_2-7 alkenyl, C_2-20 alkenyl.

Examples of (unsubstituted) unsaturated alkenyl groups include, but are not limited to, ethenyl (vinyl, -CH=CH₂), 1-propenyl (-CH=CH-CH₃), 2-propenyl (allyl, -CH-CH=CH₂), isopropenyl (1-methylvinyl, -C(CH₃)=CH₂), butenyl (C₄), pentenyl (C₅), and hexenyl (C₆). Alkynyl: The term "alkynyl", as used herein, pertains to an alkyl group having one or more carbon-carbon triple bonds. Examples of groups of alkynyl groups include C_2-4 alkynyl, C_2-7 alkynyl, C_2-2o alkynyl.

Examples of (unsubstituted) unsaturated alkynyl groups include, but are not limited to, ethynyl (ethinyl, -C≡CH) and 2-propynyl (propargyl, -CH₂-C≡CH).

Cyclόalkyl: The term "cycloalkyl", as used herein, pertains to an alkyl group which is also a cyclyl group; that is, a monovalent moiety obtained by removing a hydrogen atom from an alicyclic ring atom of a carbocyclic ring of a carbocyclic compound, which carbocyclic ring may be saturated or unsaturated (e.g. partially unsaturated, fully unsaturated), which moiety has from 3 to 20 carbon atoms (unless otherwise specified), including from 3 to 20 ring atoms. Thus, the term "cycloalkyl" includes the sub-classes cycloalkenyl and cycloalkynyl. Preferably, each ring has from 3 to 7 ring atoms. Examples of groups of cycloalkyl groups include C_3-2O cycloalkyl, C_3-15 cycloalkyl, C_3-10 cycloalkyl, C_3-7 cycloalkyl.

Examples of cycloalkyl groups include, but are not limited to, those derived from: saturated monocyclic hydrocarbon compounds: cyclopropane (C₃), cyclobutane (C₄), cyclopentane (C₅), cyclohexane (C₆), cycloheptane (C₇), methylcyclopropane (C₄), dimethylcyclopropane (C₅), methylcyclobutane (C₅), dimethylcyclobutane (C₆), methylcyclopentane (C₆), dimethylcyclopentane (C₇), methylcyclohexane (C₇), dimethylcyclohexane (C₈), menthane (C₁₀); unsaturated monocyclic hydrocarbon compounds: cyclopropene (C₃), cyclobutene (C₄), cyclopentene (C₅), cyclohexene (C₆), methylcyclopropene (C₄), dimethylcyclopropene (C₅), methylcyclobutene (C₅), dimethylcyclobutene (C₆), methylcyclopentene (C₆), dimethylcyclopentene (C₇), methylcyclohexene (C₇), dimethylcyclohexene (C₈); saturated polycyclic hydrocarbon compounds: thujane (C₁₀), carane (C₁₀), pinane (C₁₀), bornane (C₁₀), norcarane (C₇), norpinane (C₇), norbomane (C₇), adamantane (Ci₀), decalin (decahydronaphthalene) (C₁₀); unsaturated polycyclic hydrocarbon compounds: camphene (C₁₀), limonene (Ci₀), pinene (C₁₀); polycyclic hydrocarbon compounds having an aromatic ring: indene (C₉), indane (e.g., 2,3-dihydro-1 H-indene) (C₉), tetraline (1,2,3,4-tetrahydronaphthalene) (C₁₀), acenaphthene (Ci₂), fluorene (C₁₃), phenalene (Ci₃), acephenanthrene (Ci₅), aceanthrene (C₁₆), cholanthrene (C₂₀).

Heterocyclyl: The term "heterocyclyl", as used herein, pertains to a monovalent moiety obtained by removing a hydrogen atom from a ring atom of a heterocyclic compound, which moiety has from 3 to 20 ring atoms (unless otherwise specified), of which from 1 to 10 are ring heteroatoms. Preferably, each ring has from 3 to 7 ring atoms, of which from 1 to 4 are ring heteroatoms.

In this context, the prefixes (e.g. C_3-20, C_3-7, C_5-6, etc.) denote the number of ring atoms, or range of number of ring atoms, whether carbon atoms or heteroatoms. For example, the term "C₅.₆heterocyclyr, as used herein, pertains to a heterocyclyl group having 5 or 6 ring atoms. Examples of groups of heterocyclyl groups include C_3-20 heterocyclyl, C_5-20 heterocyclyl, C_3-15 heterocyclyl, C_5-I5 heterocyclyl, C_3-12 heterocyclyl, C_5-I2 heterocyclyl, C_3-I0 heterocyclyl, C_5-10 heterocyclyl, C_3-7 heterocyclyl, C_5-7 heterocyclyl, and C_5-6 heterocyclyl.

Examples of monocyclic heterocyclyl groups include, but are not limited to, those derived from:

N₁: aziridine (C₃), azetidine (C₄), pyrrolidine (tetrahydropyrrole) (C₅), pyrroline (e.g.,

3-pyrroline, 2,5-dihydropyrrole) (C₅), 2H-pyrrole or 3H-pyrrole (isopyrrole, isoazole) (C₅), piperidine (C₆), dihydropyridine (C₆), tetrahydropyridine (C₆), azepine (C₇);

O₁: oxirane (C₃), oxetane (C₄), oxolane (tetrahydrofuran) (C₅), oxole (dihydrofuran) (C₅), oxane (tetrahydropyran) (C₆), dihydropyran (C₆), pyran (C₆), oxepin (C₇);

S₁: thiirane (C₃), thietane (C₄), thiolane (tetrahydrothiophene) (C₅), thiane

(tetrahydrothiopyran) (C₆), thiepane (C₇);

O₂: dioxolane (C₅), dioxane (C₆), and dioxepane (C₇);

O₃: trioxane (C₆); N₂: imidazolidine (C₅), pyrazolidine (diazolidine) (C₅), imidazoline (C₅), pyrazoline

(dihydropyrazole) (C₅), piperazine (C₆);

N₁O₁: tetrahydrooxazole (C₅), dihydrooxazole (C₅), tetrahydroisoxazole (C₅), dihydroisoxazole (C₅), morpholine (C₆), tetrahydrooxazine (C₆), dihydrooxazine (C₆), oxazine (C₆); N₁S₁: thiazoline (C₅), thiazolidine (C₅), thiomorpholine (C₆); N₂O₁: oxadiazine (C₆);

O₁S₁: oxathiole (C₅) and oxathiane (thioxane) (C₆); and,

N₁O₁Si: oxathiazine (C₆).

Examples of substituted (non-aromatic) monocyclic heterocyclyl groups include those derived from saccharides, in cyclic form, for example, furanoses (C₅), such as arabinofuranose, lyxofuranose, ribofuranose, and xylofuranse, and pyranoses (C₆), such as allopyranose, altropyranose, glucopyranose, mannopyranose, gulopyranose, idopyranose, galactopyranose, and talopyranose.

C_5-2O aryl: The term "C_5-20 aryl" as used herein, pertains to a monovalent moiety obtained by removing a hydrogen atom from an aromatic ring atom of a C_5-20 aromatic compound, said compound having one ring, or two or more rings (e.g., fused), and having from 5 to 20 ring atoms, and wherein at least one of said ring(s) is an aromatic ring. Preferably, each ring has from 5 to 7 ring atoms.

The ring atoms may be all carbon atoms, as in "carboaryl groups" in which case the group may conveniently be referred to as a "C_5-20 carboaryl" group.

Examples of C_5-20 aryl groups which do not have ring heteroatoms (i.e. C_5-20 carboaryl groups) include, but are not limited to, those derived from benzene (i.e. phenyl) (C₆), naphthalene (C₁₀), anthracene (C₁₄), phenanthrene (C₁₄), and pyrene (C₁₆).

Alternatively, the ring atoms may include one or more heteroatoms, including but not limited to oxygen, nitrogen, and sulfur, as in "heteroaryl groups". In this case, the group may conveniently be referred to as a "C_5-20 heteroaryl" group, wherein "C_5-20" . denotes ring atoms, whether carbon atoms or heteroatoms. Preferably, each ring has from 5 to 7 ring atoms, of which from 0 to 4 are ring heteroatoms.

Examples of C_5-20 heteroaryl groups include, but are not limited to, C₅ heteroaryl groups derived from furan (oxole), thiophene (thiole), pyrrole (azole), imidazole (1,3-diazole), pyrazole (1 ,2-diazole), triazole, oxazole, isoxazole, thiazole, isothiazole, oxadiazole, tetrazole and oxatriazole; and C₆ heteroaryl groups derived from isoxazine, pyridine (azine), pyridazine (1 ,2-diazine), pyrimidine (1,3-diazine; e.g., cytosine, thymine, uracil), pyrazine (1 ,4-diazine) and triazine. The heteroaryl group may be bonded via a carbon or hetero ring atom.

Examples of C_5-20 heteroaryl groups which comprise fused rings, include, but are not limited to, C₉ heteroaryl groups derived from benzofuran, isobenzofuran, benzothiophene, indole, isoindole; C₁₀ heteroaryl groups derived from quinoline, isoquinoline, benzodiazine, pyridopyridine; C₁₄ heteroaryl groups derived from acridine and xanthene.

The above alkyl, heterocyclyl, and aryl groups, whether alone or part of another substituent, may themselves optionally be substituted with one or more groups selected from themselves and the additional substituents listed below.

Halo: -F, -Cl, -Br, and -I.

Hydroxy: -OH.

Ether: -OR, wherein R is an ether substituent, for example, a C_1-7 alkyl group (also referred to as a C_1-7 alkoxy group), a C_3-2O heterocyclyl group (also referred to as a C₃.₂o heterocyclyloxy group), or a C_5-20 aryl group (also referred to as a C_5-20 aryloxy group), preferably a C_1-7 alkyl group.

Nitro: -NO₂.

Cyano (nitrile, carbonitrile): -CN.

Acyl (keto): -C(=O)R, wherein R is an acyl substituent, for example, H, a C_1-7 alkyl group (also referred to as C_1-7 alkylacyl or C_1-7 alkanoyl), a C_3-20 heterocyclyl group (also referred to as C₃.₂₀heterocyclylacyl), or a C_5-20 aryl group (also referred to as C_5-20 arylacyl), preferably a C_1-7 alkyl group. Examples of acyl groups include, but are not limited to, -C(O)CH₃ (acetyl), -C(=O)CH₂CH₃ (propionyl), -C(=O)C(CH₃)₃ (butyryl), and -C(=O)Ph (benzoyl, phenone).

Carboxy (carboxylic acid): -COOH. Ester (carboxylate, carboxylic acid ester, oxycarbonyl): -C(=O)OR, wherein R is an ester substituent, for example, a C_1-7 alkyl group, a C_3-20 heterocyclyl group, or a C₅.₂₀ aryl group, preferably a C_1-7 alkyl group. Examples of ester groups include, but are not limited to, -C(=O)OCH₃, -C(=O)OCH₂CH_3> -C(=O)OC(CH₃)₃, and -C(=O)OPh.

Amido (carbamoyl, carbamyl, aminocarbonyl, carboxamide): -C(=O)NR¹R², wherein R¹ and R² are independently amino substituents, as defined for amino groups. Examples of amido groups include, but are not limited to, -C(=O)NH₂, -C(=O)NHCH₃, -C(=O)N(CH₃)₂, -C(=O)NHCH₂CH₃, and -C(=O)N(CH₂CH₃)₂, as well as amido groups in which R¹ and R², together with the nitrogen atom to which they are attached, form a heterocyclic structure as in, for example, piperidinocarbonyl, morpholinocarbonyl, thiomorpholinocarbonyl, and piperazinylcarbonyl.

Amino: -NR¹R², wherein R¹ and R² are independently amino substituents, for example, hydrogen, a C_1-7 alkyl group (also referred to as C_1-7alkylamino or di-C_1-7alkylamino), a C_3-20 heterocyclyl group, or a C_5-20 aryl group, preferably H or a C_1-7 alkyl group, or, in the case of a "cyclic" amino group, R¹ and R², taken together with the nitrogen atom to which they are attached, form a heterocyclic ring having from 4 to 8 ring atoms. Examples of amino groups include, but are not limited to, -NH₂, -NHCH₃, -NHCH(CH₃)₂, -N(CH₃)₂, -N(CH₂CH₃)₂, and -NHPh. Examples of cyclic amino groups include, but are not limited to, aziridinyl, azetidinyl, pyrrolidinyl, piperidino, piperazinyl, perhydrodiazepinyl, morpholino, and thiomorpholino. The cylic amino groups may be substituted on their ring by any of the substituents defined here, for example carboxy, carboxylate and amido.

Acylamido (acylamino): -NR¹C(=O)R², wherein R¹ is an amide substituent, for example, hydrogen, a C_1-7 alkyl group, a C_3-20 heterocyclyl group, or a C_5-20 aryl group, preferably H or a C_1-7 alkyl group, most preferably H, and R² is an acyl substituent, for example, a C_1-7 alkyl group, a C_3-20 heterocyclyl group, or a C_5-20 aryl group, preferably a C_1-7 alkyl group. Examples of acylamide groups include, but are not limited to, -NHC(=O)CH₃ , -NHC(=O)CH₂CH₃, and -NHC(=O)Ph. R¹ and R² may together form a cyclic structure, as in, for example, succinimidyl, maleimidyl, and phthalimidyl:

succinimidyl maleimidyl phthalimidyl

Ureido: -N(R¹)CONR²R³ wherein R² and R³ are independently amino substituents, as defined for amino groups, and R1 is a ureido substituent, for example, hydrogen, a C_1-7alkyl group, a C_3-2oheterocyclyl group, or a C_5-20aryI group, preferably hydrogen or a C_1-7alkyl group. Examples of ureido groups include, but are not limited to, -NHCONH₂, - NHCONHMe, -NHCONHEt, -NHCONMe₂, -NHCONEt₂, -NMeCONH₂, -NMeCONHMe, -NMeCONHEt, -NMeCONMe₂, -NMeCONEt₂ and -NHC(=O)NHPh.

Acyloxy (reverse ester): -OC(=O)R, wherein R is an acyloxy substituent, for example, a C_1-7 alkyl group, a C_3-2O heterocyclyl group, or a C_5-20 aryl group, preferably a C_1-7 alky! group. Examples of acyloxy groups include, but are not limited to, -OC(=O)CH₃ (acetoxy), -OC(=O)CH₂CH₃, -OC(=O)C(CH₃)₃, -OC(=O)Ph, -OC(=O)C₆H₄F, and - OC(O)CH₂Ph-

Thiol : -SH.

Thioether (sulfide): -SR, wherein R is a thioether substituent, for example, a C_1-7 alkyl group (also referred to as a C_1-7 alkylthio group), a C_3-2O heterocyclyl group, or a C_5-20 ary! group, preferably a C_1-7 alkyl group. Examples of C_1-7 alkylthio groups include, but are not limited to, -SCH₃ and -SCH₂CH₃.

Sulfoxide (sulfinyl): -S(=O)R, wherein R is a sulfoxide substituent, for example, a C_1-7 alkyl group, a C_3-20 heterocyclyl group, or a C_5-20 aryl group, preferably a C_1-7 alkyl group. Examples of sulfoxide groups include, but are not limited to, -S(=O)CH₃ and -S(=O)CH₂CH₃.

Sulfonyl (sulfone): -S(=O)₂R, wherein R is a sulfone substituent, for example, a C_1-7 alkyl group, a C_3-20 heterocyclyl group, or a C_5-20 aryl group, preferably a C_1-7 alkyl group. Examples of sulfone groups include, but are not limited to, -S(=O)₂CH₃ (methanesulfonyl, mesyl), -S(=O)₂CF₃, -S(=O)₂CH₂CH₃, and 4-methylphenylsulfonyl o (tosyl).

Thioamido (thiocarbamyl): -C(=S)NR¹R², wherein R¹ and R² are independently amino substituents, as defined for amino groups. Examples of amido groups include, but are not limited to, -C(=S)NH₂, -C(=S)NHCH₃, -C(=S)N(CH₃)₂, and -C(=S)NHCH₂CH₃.

Sulfonamino: -NR¹S(=O)₂R, wherein R¹ is an amino substituent, as defined for amino groups, and R is a sulfonamino substituent, for example, a C_1-7alkyl group, a C₃. ₂₀heterocyclyl group, or a C₅.₂₀aryl group, preferably a C_1-7atky! group. Examples of sulfonamino groups include, but are not limited to, -NHS(=O)₂CH₃, -NHS(=O)₂Ph and -N(CH₃)SC=O)₂C₆H₅.

As mentioned above, the groups that form the above listed substituent groups, e.g. C_1-7 alky!, C_3-20 heterocyclyl and C_5-20 aryl, may themselves be substituted. Thus, the above definitions cover substituent groups which are substituted.

Further Preferences

The following preferences can apply to each aspect of the present invention, where applicable.

Ft*

X¹ and X⁴ are preferably either both -CH₂- or -C(=O)-, and more preferably both are -

C(=O)-.

X² and X³ preferably form part of a fused benzene ring, which may be optionally substituted. The fused benzene ring is preferably substituted by one or two groups as defined above. More preferable substituent groups include, but are not limited to, halo

(e.g. chloro, bromo), nitro and carboxy.

R⁸

R^B is preferably benzhydrylsufanylmethyl (-CH₂SCHPh₂).

R^c R^c is preferably selected from the group consisting of: (i) -COR^C\ wherein R^C1 is selected from the group consisting of: -OH₁ -NHNH₂, -NHCN,

(vi) ; and

(vii) -CN,

Includes Other Forms

Included in the above are the well known ionic, salt, solvate, and protected forms of these substituents. For example, a reference to carboxylic acid (-COOH) also includes the anionic (carboxylate) form (-COO^"), a salt or solvate thereof, as well as conventional protected forms. Similarly, a reference to an amino group includes the protonated form (-N⁺HR¹R²), a salt or solvate of the amino group, for example, a hydrochloride salt, as well as conventional protected forms of an amino group. Similarly, a reference to a hydroxyl group also includes the anionic form (-0^"), a salt or solvate thereof, as well as conventional protected forms of a hydroxyl group.

Isomers, Salts, Solvates, Protected Forms, and Prodrugs

Certain compounds may exist in one or more particular geometric, optical, enantiomeric, diasteriomeric, epimeric, stereoisomeric, tautomeric, conformational, or anomeric forms, including but not limited to, cis- and fra/?s-forms; E- and Z-forms; c~, t~, and r-forms; endo- and exσ-forms; R-, S-, and meso-forms; D- and L-forms; d- and /-forms; (+) and (- ) forms; keto-, enol-, and enolate-forms; syn- and anti-forms; synclinal- and anticlinal- forms; α- and β-forms; axial and equatorial forms; boat-, chair-, twist-, envelope-, and halfchair-forms; and combinations thereof, hereinafter collectively referred to as "isomers" (or "isomeric forms").

If the compound is in crystalline form, it may exist in a number of different polymorphic forms.

Note that, except as discussed below for tautomeric forms, specifically excluded from the term "isomers", as used herein, are structural (or constitutional) isomers (i.e. isomers which differ in the connections between atoms rather than merely by the position of atoms in space). For example, a reference to a methoxy group, -OCH₃, is not to be construed as a reference to its structural isomer, a hydroxymethyl group, -CH₂OH. Similarly, a reference to ortho-chlorophenyl is not to be construed as a reference to its structural isomer, meta-chlorophenyl. However, a reference to a class of structures may well include structurally isomeric forms falling within that class (e.g., Ci.₇alkyl includes /7-propyl and /so-propyl; butyl includes /7-, iso-, sec-, and ferf-butyl; methoxyphenyl includes ortho-, meta-, and para-methoxyphenyl).

The above exclusion does not pertain to tautomeric forms, for example, keto-, enol-, and enolate-forms, as in, for example, the following tautomeric pairs: keto/enol, imine/enamine, amide/imino alcohol, amidine/amidine, nitroso/oxime, thioketone/enethiol, Λ/-nitroso/hyroxyazo, and nitro/aci-nitro.

Note that specifically included in the term "isomer" are compounds with one or more isotopic substitutions. For example, H may be in any isotopic form, including ¹H, ²H (D), and ³H (T); C may be in any isotopic form, including ¹²C, ¹³C, and ¹⁴C; O may be in any isotopic form, including ¹⁶O and ¹⁸O; and the like.

Unless otherwise specified, a reference to a particular compound includes all such isomeric forms, including (wholly or partially) racemic and other mixtures thereof. Methods for the preparation (e.g. asymmetric synthesis) and separation (e.g. fractional crystallisation and chromatographic means) of such isomeric forms are either known in the art or are readily obtained by adapting the methods taught herein, or known methods, in a known manner.

It is preferred that the chiral carbon at the centre of the compounds of the present invention has the same stereochemistry as natural α-amino acids, i.e. that the compounds are of formula Ia:

Unless otherwise specified, a reference to a particular compound also includes ionic, salt, solvate, and protected forms of thereof, for example, as discussed below, as well as its different polymorphic forms.

It may be convenient or desirable to prepare, purify, and/or handle a corresponding salt of the active compound, for example, a pharmaceutically-acceptable salt. Examples of pharmaceutically acceptable salts are discussed in Berge, et a/., "Pharmaceutically Acceptable Salts", J. Pharm. ScL, 66, 1-19 (1977).

For example, if the compound is anionic, or has a functional group which may be anionic (e.g., -COOH may be -COO^"), then a salt may be formed with a suitable cation. Examples of suitable inorganic cations include, but are not limited to, alkali metal ions such as Na⁺ and K⁺, alkaline earth cations such as Ca²⁺ and Mg²⁺, and other cations such as Al³⁺. Examples of suitable organic cations include, but are not limited to, ammonium ion (i.e., NH₄ ⁺) and substituted ammonium ions (e.g., NH₃R⁺, NH₂R₂ ⁺, NHR₃ ⁺, NR₄ ⁺). Examples of some suitable substituted ammonium ions are those derived from: ethylamine, diethylamine, dicyclohexylamine, triethylamine, butylamine, ethylenediamine, ethanolamine, diethanolamine, piperazine, benzylamine, phenylbenzylamine, choline, meglumine, and tromethamine, as well as amino acids, such as lysine and arginine. An example of a common quaternary ammonium ion is N(CHa)₄ ⁺.

If the compound is cationic, or has a functional group which may be cationic (e.g., -NH₂ may be -NH₃ ⁺), then a salt may be formed with a suitable anion. Examples of suitable inorganic anions include, but are not limited to, those derived from the following inorganic acids: hydrochloric, hydrobromic, hydroiodic, sulfuric, sulfurous, nitric, nitrous, phosphoric, and phosphorous. Examples of suitable organic anions include, but are not limited to, those derived from the following organic acids: acetic, propionic, succinic, gycolic, stearic, palmitic, lactic, malic, pamoic, tartaric, citric, gluconic, ascorbic, maleic, hydroxymaleic, phenylacetic, glutamic, aspartic, benzoic, cinnamic, pyruvic, salicyclic, sulfanilic, 2-acetyoxybenzoic, fumaric, toluenesulfonic, methanesulfonic, ethanesulfonic, ethane disulfonic, oxalic, isethionic, valeric, and gluconic. Examples of suitable polymeric anions include, but are not limited to, those derived from the following polymeric acids: tannic acid, carboxymethyl cellulose.

It may be convenient or desirable to prepare, purify, and/or handle a corresponding solvate of the active compound. The term "solvate" is used herein in the conventional sense to refer to a complex of solute (e.g. active compound, salt of active compound) and solvent. If the solvent is water, the solvate may be conveniently referred to as a hydrate, for example, a mono-hydrate, a di-hydrate, a tri-hydrate, etc. It may be convenient or desirable to prepare, purify, and/or handle the active compound in a chemically protected form. The term "chemically protected form," as used herein, pertains to a compound in which one or more reactive functional groups are protected from undesirable chemical reactions, that is, are in the form of a protected or protecting group (also known as a masked or masking group or a blocked or blocking group). By protecting a reactive functional group, reactions involving other unprotected reactive functional groups can be performed, without affecting the protected group; the protecting group may be removed, usually in a subsequent step, without substantially affecting the remainder of the molecule. See, for example, "Protective Groups in Organic Synthesis" (T. Green and P. Wuts; 3rd Edition; John Wiley and Sons, 1999).

For example, a hydroxy group may be protected as an ether (-OR) or an ester (-OC(=O)R), for example, as: a f-butyl ether; a benzyl, benzhydryl (diphenylmethyl), or trityl (trϊphenylmethyl) ether; a trimethylsilyl or f-butyldimethylsilyl ether; or an acetyl ester (-OC(=O)CH₃, -OAc).

For example, an aldehyde or ketone group may be protected as an acetal or ketal, respectively, in which the carbonyl group (>C=O) is converted to a diether (>C(OR)₂), by reaction with, for example, a primary alcohol. The aldehyde or ketone group is readily regenerated by hydrolysis using a large excess of water in the presence of acid.

For example, an amine group may be protected, for example, as an amide or a urethane, for example, as: a methyl amide (-NHCO-CH₃); a benzyloxy amide (-NHCO- OCH₂C₆H₅, -NH-Cbz); as a t-butoxy amide (-NHCO-OC(CH₃)₃, -NH-Boc); a 2-biphenyl- 2-propoxy amide (-NHCO-OC(CHs)₂C₆H₄C₆H₅, -NH-Bpoc), as a 9-fluorenylmethoxy amide (-NH-Fmoc), as a 6-nitroveratryloxy amide (-NH-Nvoc), as a 2- trimethylsilylethyloxy amide (-NH-Teoc), as a 2,2,2-trichloroethyloxy amide (-NH-Troc), as an allyloxy amide (-NH-Alloc), as a 2(-phenylsulphonyl)ethyloxy amide (-NH-Psec); or, in suitable cases, as an Λ/-oxide (>NO ).

For example, a carboxylic acid group may be protected as an ester for example, as: an C_1-7 alkyl ester (e.g. a methyl ester; a f-butyl ester); a C_1-7 haloalkyl ester (e.g. a C_1-7 trihaloalkyl ester); a triC-|.₇ alkylsilyl-C_1-7 alkyl ester; or a C_5-20 aryl-C^ alkyl ester (e.g. a benzyl ester; a nitrobenzyl ester); or as an amide, for example, as a methyl amide. For example, a thiol group may be protected as a thioether (-SR), for example, as: a benzyl thioether; an acetamidomethyl ether (-S-CH₂NHC(=O)CH₃).

It may be convenient or desirable to prepare, purify, and/or handle the active compound in the form of a prodrug. The term "prodrug", as used herein, pertains to a compound which, when metabolised (e.g. in vivo), yields the desired active compound. Typically, the prodrug is inactive, or less active than the active compound, but may provide advantageous handling, administration, or metabolic properties.

For example, some prodrugs are esters of the active compound (e.g. a physiologically acceptable metabolically labile ester). During metabolism, the ester group (-C(=O)OR) is cleaved to yield the active drug. Such esters may be formed by esterification, for example, of any of the carboxylic acid groups (-C(=O)OH) in the parent compound, with, where appropriate, prior protection of any other reactive groups present in the parent compound, followed by deprotection if required. Examples of such metabolically labile esters include those wherein R is Ci_-2o alky! (e.g. -Me, -Et); C_1-7 aminoalkyl (e.g. aminoethyl; 2-(Λ/,Λ/-diethylamino)ethyl; 2-(4-morpholino)ethyl); and acyloxy-Ci_-7 alkyl (e.g. acyloxymethyl; acyloxyethyl; e.g. pivaloyloxymethyl; acetoxymethyl; 1-acetoxyethyl; 1-(1-methoxy-1-methyl)ethyl-carbonxyloxyethyl; 1-(benzoyloxy)ethyl; isopropoxy-carbonyloxymethyl; 1-isopropoxy-carbonyloxyethyl; cyclohexyl- carbonyloxymethyl; 1-cyclohexyl-carbonyloxyethyl; cyclohexyloxy-carbonyloxymethyl; 1- cyclohexylσxy-carbonyloxyethyl; (4-tetrahydropyranyloxy) carbonyloxymethyl; 1-(4- tetrahydropyranyloxy)carbonyloxyethyl;

(4-tetrahydropyranyl)carbonyloxymethyl; and 1 -(4-tetrahydropyranyl)carbonyloxyethyl).

Further suitable prodrug forms include phosphonate and glycolate salts. In particular, hydroxy groups (-OH), can be made into phosphonate prodrugs by reaction with chlorodibenzylphosphite, followed by hydrogenation, to form a phosphonate group -O- P(=O)(OH)₂. Such a group can be cleared by phosphotase enzymes during metabolism to yield the active drug with the hydroxy group.

Also, some prodrugs are activated enzymatically to yield the active compound, or a compound which, upon further chemical reaction, yields the active compound. For example, the prodrug may be a sugar derivative or other glycoside conjugate, or may be an amino acid ester derivative. Acronyms

For convenience, many chemical moieties are represented using well known abbreviations, including but not limited to, methyl (Me), ethyl (Et), π-propyl (nPr), iso- propyl (iPr), n-butyl (nBu), terf-butyl (tBu), n-hexyl (nHex), cyclohexyl (cHex), phenyl (Ph), biphenyl (biPh), benzyl (Bn), naphthyl (naph), methoxy (MeO), ethoxy (EtO), benzoyl (Bz), and acetyl (Ac).

For convenience, many chemical compounds are represented using well known abbreviations, including but not limited to, methanol (MeOH), ethanol (EtOH), iso- propanol (i-PrOH), methyl ethyl ketone (MEK), ether or diethyl ether (Et₂O), acetic acid (AcOH), dichloromethane (methylene chloride, DCM), trifluoroacetic acid (TFA), dimethylformamide (DMF), tetrahydrofuran (THF), and dimethylsulfoxide (DMSO).

General Synthesis

Compounds of formula I:

R^A R^B~-< c ^(l)

R^C can, in general, be synthesised by coupling a compound of formula 1 :

Formula 1

with a compound of formula 2a:

O I , Formula 2a

or a precursor thereof.

When X¹ and X⁴ are both -C(=O)-, or X¹ is -C(=O)- and X⁴ is -C(=O)-CH₂- or -Sf=O)₂-, then the coupling can be with the appropriate anhydride (i.e. a compound of formula 2a), or with a precursor, such as the acid or ester thereof. The coupling reaction is then followed by a ring closure step, often with the use of base, if the compound coupled was not already in a ring, or the original ring was opened in the coupling step.

When one of X¹ and X⁴ are -CH₂-, the coupling may be achieved by coupling a precursor of formula 2a, where an aldehyde is in place of the desired -CH₂- group, followed by reduction. The other end of the coupled molecule can then be ring closed as discussed above.

Compounds where both of X¹ and X⁴ are CH₂ can, in general, be synthesised by coupling a compound of formula 1 with a compound of formula 2b:

Formula 2b

wherein A and B are leaving groups, for example bromo or O-mesylate and X² and X³ are described as above.

Compounds of formula 1 , where R^c is carboxy are α-amino acids are readily available, or can be synthesised by literature methods. Compounds of formula I where R^c is not carboxy can be synthesised from compounds of formula 1 where R^G is the appropriate group, or from compounds of formula I where R^c is carboxy.

Compounds of formula 1 where R^c is COR⁰¹ wherein R^C1 is -NH₂, -NHNH₂, -NHCN, -NHSO₂R^S1, -NR^N2OR⁰¹, -NH-CN₄H, where R^S1, R^N2, R⁰¹ are described as above may be synthesised from compounds of formula 1 where R^c is -CO₂H by standard methods known to those skilled in the art, such as amide coupling using EDC and a tertiary amine base.

Compounds of formula 1 where R° is -CH₂OH can be prepared from compounds of formula 1 where R° is -CO₂R, wherein R is H or methyl, by standard methods such as reduction using lithium aluminium hydride.

Compounds of formula 1 where R^c is CN can be prepared from compounds of formula 1 where R^c is CONH₂ by standard methods such as dehydration in the presence of phosphorous oxychloride.

Compounds of formula 1 where R^c is :-

may be prepared from compounds of formula 1 where R^c is -C(NOH)NH₂ by standard methods such as cyclisation in the presence of 1 ,1'-carbonyldiimidazole. Compounds of formula 1 where R^c is -C(NOH)NH₂ are prepared from compounds of formula 1 where R^c is -CN by standard methods known to those skilled in the art such as condensation with hydroxylamine hydrochloride in the presence of a base for example sodium bicarbonate.

Compounds of formula 1 where R^c is :-

may be prepared from compounds of formula 1 where R^c is CN by standard methods such as cyclisation in the presence of trimethylsilyl azide and dialkyltin oxides preferably n-butyltin oxide. Compounds of formula 1 where R^Gis :-

may be prepared from O-protected hydroxamic acids of formula 3:

Formula 3

in the presence of an acid such as hydrochloric acid. O-protected hydroxamic acids of formula 3 may be prepared from diones of formula 4:

Formula 4

and tert-butyl N-(tert-butoxy carbonyloxy)carbamate:

by standard methods known to those skilled in the art. Diones of formula 4 may be prepared from compounds of formula 1 where R^c is -COCI and 2,2-dimethyl- [1 ,3]dioxane-4,6-dione:

in the presence of a base, for example pyridine.

Compounds of formula 1 where R^c is -SO₂NHR^S1, where R^S1 is defined as above, may be prepared from compounds of formula 1 where R^c is -SO₃H by reaction with an amine in the presence of a chlorinating agent, for example phosphorous oxychloride. Compounds of formula 1 where R^c is -SO₃H may be prepared from alcohols of formula 5: OH

B /

R⁵— \ Formula 5

SO₃H by conversion of the alcohol to a suitable leaving group, for example mesylate, and subsequent displacement with R^AH. Alcohols of formula 5 may be prepared from aldehydes of formula 6:

O

R^B -\ Formula e H by condensation with sodium hydrogensulphate.

The R^B group in compounds of the present invention may be present in the molecules coupled together as described above. Alternatively precursors may be present which are then converted after coupling.

Use

The compounds of the present invention are capable of binding to DNMTs, particularly human DNMT1 , and inhibiting their catalytic activity.

One assay which may conveniently be used in order to assess the inhibition of DNMT1 offered by a particular compound is described in the examples below.

The present invention provides a method of inhibitig DNA methylation in cells either in wVo or in vitro. Particularly, said compounds inhibit one or more DNMTs, more particularly DNMT1 , even more particularly human DNMT1.

For example, a sample of cells may be grown in vitro and an active compound brought into contact with said cells, and the effect of the compound on those cells observed. As examples of "effect", the amount of DNA methylated in a certain time may be determined. Where the active compound is found to exert an influence on the cells, this may be used as a prognostic or diagnostic marker of the efficacy of the compound in methods of treating a patient carrying cells of the same cellular type.

The term "treatment", as used herein in the context of treating a condition, pertains generally to treatment and therapy, whether of a human or an animal (e.g. in veterinary applications), in which some desired therapeutic effect is achieved, for example, the inhibition of the progress of the condition, and includes a reduction in the rate of progress, a halt in the rate of progress, amelioration of the condition, and cure of the condition. Treatment as a prophylactic measure (i.e. prophylaxis) is also included.

Active compounds may also be used as part of an in vitro assay, for example, in order to determine whether a candidate host is likely to benefit from treatment with the compound in question.

Administration The active compound or pharmaceutical composition comprising the active compound may be administered to a subject by any convenient route of administration, whether systemically/ peripherally or at the site of desired action, including but not limited to, oral (e.g. by ingestion); topical (including e.g. transdermal, intranasal, ocular, buccal, and sublingual); pulmonary (e.g. by inhalation or insufflation therapy using, e.g. an aerosol, e.g. through mouth or nose); rectal; vaginal; parenteral, for example, by injection, including subcutaneous, intradermal, intramuscular, intravenous, intraarterial, intracardiac, intrathecal, intraspinal, intracapsular, subcapsular, intraorbital, intraperitoneal, intratracheal, subcuticular, intraarticular, subarachnoid, and intrastemal; by implant of a depot, for example, subcutaneously or intramuscularly.

The subject may be a eukaryote, an animal, a vertebrate animal, a mammal, a rodent (e.g. a guinea pig, a hamster, a rat, a mouse), murine (e.g. a mouse), canine (e.g. a dog), feline (e.g. a cat), equine (e.g. a horse), a primate, simian (e.g. a monkey or ape), a monkey (e.g. marmoset, baboon), an ape (e.g. gorilla, chimpanzee, orangutang, gibbon), or a human.

Formulations

While it is possible for the active compound to be administered alone, it is preferable to present it as a pharmaceutical composition (e.g., formulation) comprising at least one active compound, as defined above, together with one or more pharmaceutically acceptable carriers, adjuvants, excipients, diluents, fillers, buffers, stabilisers, preservatives, lubricants, or other materials well known to those skilled in the art and optionally other therapeutic or prophylactic agents.

Thus, the present invention further provides pharmaceutical compositions, as defined above, and methods of making a pharmaceutical composition comprising admixing at least one active compound, as defined above, together with one or more pharmaceutically acceptable carriers, excipients, buffers, adjuvants, stabilisers, or other materials, as described herein.

The term "pharmaceutically acceptable" as used herein pertains to compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgement, suitable for use in contact with the tissues of a subject (e.g. human) without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio. Each carrier, excipient, etc. must also be "acceptable" in the sense of being compatible with the other ingredients of the formulation.

Suitable carriers, diluents, excipients, etc. can be found in standard pharmaceutical texts. See, for example, "Handbook of Pharmaceutical Additives", 2nd Edition (eds. M. Ash and I. Ash), 2001 (Synapse Information Resources, Inc., Endicott, New York, USA), "Remington's Pharmaceutical Sciences", 20th edition, pub. ϋppincott, Williams & Wilkins, 2000; and "Handbook of Pharmaceutical Excipients", 2nd edition, 1994.

The formulations may conveniently be presented in unit dosage form and may be prepared by any methods well known in the art of pharmacy. Such methods include the step of bringing into association the active compound with the carrier which constitutes one or more accessory ingredients. In general, the formulations are prepared by uniformly and intimately bringing into association the active compound with liquid carriers or finely divided solid carriers or both, and then if necessary shaping the product.

Formulations may be in the form of liquids, solutions, suspensions, emulsions, elixirs, syrups, tablets, losenges, granules, powders, capsules, cachets, pills, ampoules, suppositories, pessaries, ointments, gels, pastes, creams, sprays, mists, foams, lotions, oils, boluses, electuaries, or aerosols.

Formulations suitable for oral administration (e.g., by ingestion) may be presented as discrete units such as capsules, cachets or tablets, each containing a predetermined amount of the active compound; as a powder or granules; as a solution or suspension in an aqueous or non-aqueous liquid; or as an oil-in-water liquid emulsion or a water-in-oil liquid emulsion; as a bolus; as an electuary; or as a paste.

A tablet may be made by conventional means, e.g. compression or molding, optionally with one or more accessory ingredients. Compressed tablets may be prepared by compressing in a suitable machine the active compound in a free-flowing form such as a powder or granules, optionally mixed with one or more binders (e.g. povidone, gelatin, acacia, sorbitol, tragacanth, hydroxypropylmethyl cellulose); fillers or diluents (e.g. lactose, microcrystailine cellulose, calcium hydrogen phosphate); lubricants (e.g. magnesium stearate, talc, silica); disintegrants (e.g. sodium starch glycolate, cross- linked povidone, cross-linked sodium carboxymethyl cellulose); surface-active or dispersing or wetting agents (e.g., sodium lauryl sulfate); and preservatives (e.g., methyl p-hydroxybenzoate, propyl p-hydroxybenzoate, sorbic acid). Molded tablets may be made by molding in a suitable machine a mixture of the powdered compound moistened with an inert liquid diluent. The tablets may optionally be coated or scored and may be formulated so as to provide slow or controlled release of the active compound therein using, for example, hydroxypropylmethyl cellulose in varying proportions to provide the desired release profile. Tablets may optionally be provided with an enteric coating, to provide release in parts of the gut other than the stomach.

Formulations suitable for topical administration (e.g. transdermal, intranasal, ocular, buccal, and sublingual) may be formulated as an ointment, cream, suspension, lotion, powder, solution, past, gel, spray, aerosol, or oil. Alternatively, a formulation may comprise a patch or a dressing such as a bandage or adhesive plaster impregnated with active compounds and optionally one or more excipients or diluents.

Formulations suitable for topical administration in the mouth include losenges comprising the active compound in a flavored basis, usually sucrose and acacia or tragacanth; pastilles comprising the active compound in an inert basis such as gelatin and glycerin, or sucrose and acacia; and mouthwashes comprising the active compound in a suitable liquid carrier.

Formulations suitable for topical administration to the eye also include eye drops wherein the active compound is dissolved or suspended in a suitable carrier, especially an aqueous solvent for the active compound. Formulations suitable for nasal administration, wherein the carrier is a solid, include a coarse powder having a particle size, for example, in the range of about 20 to about 500 microns which is administered in the manner in which snuff is taken, i.e. by rapid inhalation through the nasal passage from a container of the powder held close up to the nose. Suitable formulations wherein the carrier is a liquid for administration as, for example, nasal spray, nasal drops, or by aerosol administration by nebuliser, include aqueous or oily solutions of the active compound.

Formulations suitable for administration by inhalation include those presented as an aerosol spray from a pressurised pack, with the use of a suitable propellant, such as dichlorodifluoromethane, trichlorofluoromethane, dichoro-tetrafluoroethane, carbon dioxide, or other suitable gases.

Formulations suitable for topical administration via the skin include ointments, creams, and emulsions. When formulated in an ointment, the active compound may optionally be employed with either a paraffinic or a water-miscible ointment base. Alternatively, the active compounds may be formulated in a cream with an oil-in-water cream base. If desired, the aqueous phase of the cream base may include, for example, at least about 30% w/w of a polyhydric alcohol, i.e., an alcohol having two or more hydroxyl groups such as propylene glycol, butane-1,3-diol, mannitol, sorbitol, glycerol and polyethylene glycol and mixtures thereof. The topical formulations may desirably include a compound which enhances absorption or penetration of the active compound through the skin or other affected areas. Examples of such dermal penetration enhancers include dimethylsulfoxide and related analogues.

When formulated as a topical emulsion, the oily phase may optionally comprise merely an emulsifier (otherwise known as an emulgent), or it may comprises a mixture of at least one emulsifier with a fat or an oil or with both a fat and an oil. Preferably, a hydrophilic emulsifier is included together with a lipophilic emulsifier which acts as a stabiliser. It is also preferred to include both an oil and a fat. Together, the emulsifier(s) with or without stabiliser(s) make up the so-called emulsifying wax, and the wax together with the oil and/or fat make up the so-called emulsifying ointment base which forms the oily dispersed phase of the cream formulations. Suitable emulgents and emulsion stabilisers include Tween 60, Span 80, cetostearyl alcohol, myristyl alcohol, glyceryl monostearate and sodium lauryl sulphate. The choice of suitable oils or fats for the formulation is based on achieving the desired cosmetic properties, since the solubility of the active compound in most oils likely to be used in pharmaceutical emulsion formulations may be very low. Thus the cream should preferably be a non-greasy, non-staining and washable product with suitable consistency to avoid leakage from tubes or other containers. Straight or branched chain, mono- or dibasic alkyl esters such as di-isoadipate, isocetyl stearate, propylene glycol diester of coconut fatty acids, isopropyl myristate, decyl oleate, isopropyl palmitate, butyl stearate, 2-ethylhexyl palmitate or a blend of branched chain esters known as Crodamo) CAP may be used, the last three being preferred esters. These may be used alone or in combination depending on the properties required. Alternatively, high melting point lipids such as white soft paraffin and/or liquid paraffin or other mineral oils can be used.

Formulations suitable for rectal administration may be presented as a suppository with a suitable base comprising, for example, cocoa butter or a salicylate.

Formulations suitable for vaginal administration may be presented as pessaries, tampons, creams, gels, pastes, foams or spray formulations containing in addition to the active compound, such carriers as are known in the art to be appropriate.

Formulations suitable for parenteral administration (e.g., by injection, including cutaneous, subcutaneous, intramuscular, intravenous and intradermal), include aqueous and non-aqueous isotonic, pyrogen-free, sterile injection solutions which may contain anti-oxidants, buffers, preservatives, stabilisers, bacteriostats, and solutes which render the formulation isotonic with the blood of the intended recipient; and aqueous and non-aqueous sterile suspensions which may include suspending agents and thickening agents, and liposomes or other microparticulate systems which are designed to target the compound to blood components or one or more organs. Examples of suitable isotonic vehicles for use in such formulations include Sodium Chloride Injection, RingerDs Solution, or Lactated RingerDs Injection. Typically, the concentration of the active compound in the solution is from about 1 ng/ml to about 10 μg/ml, for example from about 10 ng/ml to about 1 μg/ml. The formulations may be presented in unit-dose or multi-dose sealed containers, for example, ampoules and vials, and may be stored in a freeze-dried (lyophilised) condition requiring only the addition of the sterile liquid carrier, for example water for injections, immediately prior to use. Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules, and tablets. Formulations may be in the form of liposomes or other microparticulate systems which are designed to target the active compound to blood components or one or more organs.

Dosage

It will be appreciated that appropriate dosages of the active compounds, and compositions comprising the active compounds, can vary from patient to patient. Determining the optimal dosage will generally involve the balancing of the level of therapeutic benefit against any risk or deleterious side effects of the treatments of the present invention. The selected dosage level will depend on a variety of factors including, but not limited to, the activity of the particular compound, the route of administration, the time of administration, the rate of excretion of the compound, the duration of the treatment, other drugs, compounds, and/or materials used in combination, and the age, sex, weight, condition, general health, and prior medical history of the patient. The amount of compound and route of administration will ultimately be at the discretion of the physician, although generally the dosage will be to achieve local concentrations at the site of action which achieve the desired effect without causing substantial harmful or deleterious side-effects.

Administration in vivo can be effected in one dose, continuously or intermittently (e.g., in divided doses at appropriate intervals) throughout the course of treatment. Methods of determining the most effective means and dosage of administration are well known to those of skill in the art and will vary with the formulation used for therapy, the purpose of the therapy, the target cell being treated, and the subject being treated. Single or multiple administrations can be carried out with the dose level and pattern being selected by the treating physician.

In general, a suitable dose of the active compound is in the range of about 100 μg to about 250 mg per kilogram body weight of the subject per day. Where the active compound is a salt, an ester, prodrug, or the like, the amount administered is calculated on the basis of the parent compound and so the actual weight to be used is increased proportionately. Examples

Materials and Methods:

All solvents used for synthetic work were purchased anhydrous from Aldrich or Fluka. Solvents for column chromatography were obtained as HPLC grade and used directly. The HPLC-solvents were also purchased as HPLC grade and used directly, as was trifluoroacetic acid.

LCMS method For HPLC analysis 1 mg of compound was dissolved in acetonitrile, acetonitrile:water (1 :1), DMSO, DMA or methanol and diluted to 1ml. The sample was then submitted for HPLC/MS analysis.

For preparative HPLC the compound was dissolved in the same solvents as above, but to a concentration of 30mg/ml.

LCMS1:

For analysis of samples by High Performance Liquid Chromatography-Mass Spectrometry the following conditions were used.

The pumps used were Gilson 306, the mixer was a Gilson 811C, the manometric module was a Gilson 806 and the detector was a Gilson UV/VIS 152. The detection wavelength used was 254 nm

A Phenomenex Luna, 5-micron pore size, C18 column of dimensions 50x4.60 mm was used. The injection volume was 10 micro litres.

The flow rate was 1 ml/min and the mobile phases of water and acetonitrile contained 0.1% formic acid. The elution was started at 95% water:5% acetonitrile ramping up to 2% water:98% acetonitrile over 3 minutes. This eluent level was held for 5 minutes before returning to the starting conditions of 95% water:5% acetonitrile over 30 seconds. These conditions were held for 2 minutes to allow equilibration of the column before the next sample was injected.

LCMS2: For analysis of samples by High Performance Liquid Chromatography-Mass Spectrometry the following conditions were used.

The pumps used were Gilson 306, the mixer was a Gilson 811C, the manometric module was a Gilson 806 and the detector was a Gilson UV/VIS 152. The detection wavelength used was 254 nm

A Waters SunFire, 5 micron pore size, C18 column of dimensions 50x4.60 mm was used. The injection volume was 10 micro litres.

The flow rate was 1.5 mL/min and the mobile phases of water and acetonitrile contained 0.1% formic acid. The elution was started at 95% water:5% acetonitrile ramping up to 5% water:95% acetonitrile over 5.5 minutes. This eluent level was held for 2 minutes before returning to the starting conditions of 95% water:5% acetonitrile. These conditions were held for 1 minute to allow equilibration of the column before the next sample was injected.

Example 1a: (S)-2-(1,3-Dihydro-isoindol-2-yl)-3-(1H-indol-2-yl)-propionic acid (2)

(i) (S)-2-(1 ,3-Dιhydrθ'isoindol-2-yl)-3-(1 H-indol~3-yl)-propionic acid methyl ester (1)

To a stirred suspension of L-tryptophan methylester hydrochloride (Aldrich, 364517) (1 g, 4 mmol), was added triethylamine (0.89 ml, 12 mmol), 1,2-bis(bromomethyl)benzene (Aldrich, D4,440-5) (0.94 ml, 4 mmol) and the mixture heated to 50⁰C for 2 hours followed by stirring at room temperature for 16 hours. The resulting suspension was washed with water and extracted with ethyl acetate. The organics were dried over Na₂SO₄ and the solvents removed to afford a tan oil. The crude material was subjected to preparative HPLC. LCMS (LCMS1) m/z 321.3 [M+Hf; RT 4.87 min; purity 95.6%

(H) (S)-2-(1,3-Dihydro-isoindol-2-yl)-3-(1H-indol-2-yl)-propionic acid (2)

(S)-2-(1,3-Dihydro-isoindol-2-yl)-3-(1H-indol-3-yl)-propionic acid methyl ester (2) (0.48 g, 1.5 mmol) was dissolved in 2M potassium hydroxide/methanol (10 ml) and the solution heated to reflux for 3 hours. The reaction was allowed to cool, acidified to pH2 (cone HCI) and extracted with ethylacetate (50 ml). The organics were concentrated in vacuo and purified by preparative HPLC to afford the title compound. LCMS (LCMS1) m/z 307.3 [M+H]⁺; RT 4.47 min; purity 89.9%. Example 1b: (S)-2-(1-oxo-1,3-dihydroisoindol-2yl)-3-indolylpropionic acid (3)

To a slurry of L-tryptophan (0.41 g, 2.0 mmol) in methanol (30 ml) was added methyl-2- formylbenzoate (0.36 g, 2.2 mmol). This was stirred for 5 minutes and then treated with sodium cyanoborohydride (0.14 g, 2.2 mmol). The reaction was heated to reflux for 6 hours, and the left to stand over night. The reaction volume was reduced to approximately 1/3 of the original by evaporation in vacuo, quenched with saturated sodium bicarbonate (100 ml) and washed with diethyl ether (2 x 50 ml). The aqueous layer was carefully acidified by drop-wise addition of sulphuric acid to pH2 and extracted with ethylacetate (3 x 100ml). The combined extracts were dried (MgSO₄) and concentrated in vacuo to afford the title compound as a white solid. LCMS (LCMS1) m/z 321.2 [M+H]⁺, RT 5.38 min; purity 94%.

Example 1c:

A mixture of the relevant substituted phthalic anhydrides (25 mmol), L-tryptophan (25 mmol) and DMF (70 mL) was heated at 100 ⁰C for seven hours. The crude reaction mixture was diluted with ethyl acetate (250ml) and washed with brine (3 x 120ml). The organic layer was dried (MgSO₄), filtered and the solvent removed in vacuo. The crude material was purified by chromatography column (DCM:MeOH:AcOH (95:4:1) elution) to give the pure product. Method: LCMS1. The compounds made are listed below:

Example 1d

A mixture of the relevant substituted phthalic anhydrides (25 mmol), D-tryptophan (25 mmol) and DMF (70 ml_) was heated at 100 ⁰C for seven hours. The crude reaction mixture was diluted with ethyl acetate (250ml) and washed with brine (3 x 120ml). The organic layer was dried (MgSO₄), filtered and the solvent removed in vacuo. The crude material was purified by chromatography column (DCM:MeOH:AcOH (95:4:1) elution) to give the pure product. Method: LCMS1.

The compounds made are listed below:

Example 1e:

Acetic acid (15 ml_) was added to a stirring solution of the relevant substituted maleic anhydride (20 mmol) and (L)-Tryptophan (20 mmol) in DMF (30 mL). The mixture was heated to 120 ⁰C and heated at reflux for 3 hours. The reaction mixture was diluted with ethyl acetate (35 mL) and washed with brine (3 x 35 mL). The organic extracts were then dried (MgSO₄) and evaporated in vacuo. The crude product was purified by column chromatography in ethyl acetate at 1:2 to 1 :1 to 2:1 to give the pure product. Method: LCMS 1.

The compounds made are listed below:

Example 1f: (S)-2-((R)-3-Hydroxy-2,5-dioxo-pyrrolidin-1-yl)-3-(1 H-indol-3-yl)- propionic acid (42)

(S)-2-((S)-3-Acetoxy-2-5,-dioxo-pyrrolidin-1-yl)-3-(1 H-indol-3-y!)-propionic acid (39) (1.48g, 4.3 mmol) was dissolved in ethanol (10 mL) and then treated with a solution of HCI (2M, 10 mL). The mixture was stirred at room temperature for 4 hours. Water (20 mL) was added and the mixture was extracted with ethyl acetate (2 x 50 mL), the extracts were dried (MgSO₄), filtered and evaporated in vacuo to give the pure product (1.3 g, 100 % yield); LC-MS (LCMS2) m/z 303.2 [M+H]⁺ , RT=3.6 min. Example 1g:

(i) (S)-2-((R)-3-Amino-2,5-dioxo-pyrrolidin-1-yl)-3-(1H-indol-3-yl)-propionic acid (43) Palladium (5 % on carbon, 0.05 g, 0.4 mmol) was added to a stirring solution of (S)-2- ((S)-3-Benzyloxycarbonylamino-2,5-dioxo-pyrro!idin-1-yl)-3-(1 H-indol-3-yl)-propionic acid (38) (0.6 g, 1.4 mmol) in ethanol (12 mL) and 2N HCI (3 mL) and the mixture placed under a hydrogen atmosphere. After 3 h the reaction appeared complete by HPLC and the mixture was filtered through celite and concentrated in vacuo, to give the title compound: Purity 91 %, 2.31 min, [M+H]⁺: 302.2, Method: LCMS2.

(H) The relevant acyl chloride ( 0.91 mmol) was added to a solution of (S)-2-((R)-3- Amino-2,5-dioxo-pyrrolidin-1-yl)-3-(1H-indol-3-yl)-propionic acid (43) (0.25g, 0.83 mmol) and TEA (0.24 mL, 1.74 mmol) in DCM (7 mL). DMF (approx. 1 mL) was added until all reagents were dissolved. The mixture was left to stir at room temperature for 18 h, then diluted with DCM, washed with 1M HCI solution, dried, and concentrated in vacuo. The crude mixture was purified by HPLC. Method: LCMS2.

The compounds made are listed below:

Example ih: (S)-3-(1H-lndol-3-yl)-2-(3-morpholin-4-yl-2,5-dioxo-pyrrolidin-1-yl)- propionic acid (47)

(i) (S)-2-(2, 5-Dioxo-2, 5-dihydro-pyrrol-1-yl)-3-(1H-indol-3-yl)-propionic acid (46) A mixture of acetic acid (6ml) and L-tryptophan (1g, 4.9 mmol) was stirred at room temperature. A solution of maleic anhydride (480mg, 4.9 mmol) in AcOH (2ml) was then added. The yellow mixture was stirred for three hours and evaporated in vacuo to give a yellow solid. The intermediate yellow solid was added to triethylamine (1 mL, 7.1 mmol) and toluene (120ml), and refluxed with a Dean-Stark apparatus at 140 ⁰C for three hours. The mixture was left to cool and evaporated in vacuo. The residue was acidified to pH2 with 2 M HCI and the aqueous phase was extracted twice with ethyl acetate. The organic layer was dried (MgSO₄), filtered and evaporated in vacuo to give a light brown solid, which was purified by column chromatography (DCM:MeOH:AcOH, 90:5:5) to give the title compound as a yellow oil (402 mg, 29%): LCMS (LCMS1) m/z 285 [M+H]⁺, R = 5.30mins; ¹HNMR (CDCI₃), ppm: 1.262 (1 H, m), 3.675 (2H, m), 5.156 (1H, m), 6.564 (2H, s), 6.985 (1H, d), 7.178 (2H, m), 7.307 (1H, m), 7.541 (1 H, d), 8.00 (1H, s).

(H) (S)-3-(1H-indol-3-yl)-2-(3-morpholin-4-yl-2,5-dioxo-pyrrolidin-1-yl)-propionic acid (47) Morpholine (31 μl_, 0.28 mmol) was added to (S)-2-(2,5-Dioxo-2,5-dihydro-pyrrol-1-yl)-3- (1H-indol-3-yl)-propionic acid (46) (0.079 g, 0.28 mmol) and acetonitrile (2 mL) and the mixture was left to stir at room temperature for 14 hours. The crude reaction mixture was purified by HPLC, to give the product: LCMS (LCMS1) m/z 372.4 [M+H]⁺, RT 4.90 min, Purity 89 %. Example 2a: (R)-3-Benzhydrylsulfanyl-2-(1 ,3-dioxo-1 ,3-dihydro-isoindol-2- y!)propionic acid (48)

A mixture of benzhydryl-methyl-L-cysteine (0.48 g, 1.7 mmol) and phthalic anhydride (0.252 g, 1.7 mmol) in dimethylformamide (5 ml) was refluxed overnight at 100⁰C. The crude reaction mixture was purified by preparative HPLC to yield the pure product. LCMS (LCMS1) m/z: 416 [M+H]⁺; RT 6.01 min.

Example 2b: 2-(1,3-Dioxo-1,3-dihydro-isoindol-2-yl)-3-(1-methyl-1H-indol-3-yl)- propionic acid (49)

A mixture of 1-methyl-L-tryptophan (0.22 g, 1 mmol), methyl-2- ((succinimidooxy)carbonyl) benzoate (0.23g, 1mmol) and potassium carbonate (0.69 g, 5 mmol) in dimethylformamide was heated to 100⁰C for 3 hours.The reaction was acidified with 2 M hydrochloric acid and extracted with ethyl acetate. The organics were washed with brine, dried (MgSO₄) and the solvent removed to afford the title compound. LCMS (LCMS1) m/z: 349.3 [M+1]; RT 5.76 min; purity 82% Example 3a: JV-Phthaloyl-L-tryptophanyl cyanamide (52)

(i) (S)-2-(1,3-Dioxo-1,3-dihydro-isoindol-2-yl)-3-(1H-indoI-3-yl)-propionic acid (50) A mixture of L-tryptophan (4g, 19.5mmol), methyl 2-((succinimidooxy)carbonyl)benzoate (5.3g, 19mmol) and potassium carbonate (0.69 g, 5 mmol) in dimethyiformamide was heated to 100° C for 3 hours. The reaction was acidified with 2 M hydrochloric acid and extracted with ethyl acetate. The organics were washed with brine, dried (MgSO₄) and evaporated in vacuo to afford the title compound as a yellow solid, which was purified by HPLC. LCMS (LCMS 1) m/z: 335 [M+H]⁺; RT 5.55 min.

(H) (S)-2-(1,3-Dioxo-1,3-dihydro-isoindol-2-yl)-3-(1H-indol-3-yl)-propionic acid 2,5-dioxo- pyrrolidin-1-yl ester (51)

A solution of (S)-2-(1,3-Dioxo-1 ,3-dihydro-isoindol-2-yl)-3-(1H-indol-3-yl)-propionic acid (50) (1.7g, 5mmol), N-hydroxysuccinimide (0.6g, 5.2mmol) and dicyclohexylcarbodiimide (1.1g, 5mmol) was stirred at O⁰C in acetonitrile (35ml) for 5 hours. The resulting urea was filtered off and the solvent evaporated in vacuo to afford the title compound as a white solid. NMR ¹H ppm: 8.01 (br, 1H), 7.76 (m, 2H), 7.66 (m, 2H), 7.28 (S₁ 1H), 7.05 (m, 3H), 5.60 (dd, 1 H), 3.80 (m, 2H)₁ 2.01 (s, 3H); ¹³C ppm: 168.43, 166.80, 165.02, 136.04, 134.24, 131.47, 126.96, 123.67, 123.01 , 122.27,

119.73, 118.41 , 111.18, 109.76, 50.72, 25.58, 24.93; LCMS (LCMS1) m/z 431.7 [M+H]⁺, RT 5.31 min.

(Hi) N-Phthaloyl-L-tryptophanyl cyanamide (52) A solution of (S)-2-(1 ,3-Dioxo-1 ,3-dihydro-isoindol-2-yl)-3-(1/-/-indol-3-yl)-propionic acid 2,5-dioxo-pyrrolidin-1-yl ester (51) (0.886 g, 2 mmol), THF (5 ml) and 10% sodium hydroxide (1 ml) was added dropwise to a solution of cyanamide (0.084 g, 2 mmol) and water (10 ml) at 0⁰C. The mixture was allowed to warm to room temperature and was then stirred over night. The solvent was removed in vacuo and the residue taken up in water and the mixture was washed with ethyl acetate. The remaining aqueous was then acidified with 1 M hydrochloric acid to pH 1 , to precipitate a white solid. The suspension was extracted with diethyl ether and the crude residue was purified by preparative HPLC to afford a yellow oil which solidified on standing. LCMS (LCMS1) m/z 359 [M+Hf; RT 6.23 min; purity 100%.

Example 3b: (S)-2-(1 ,3-Dioxo-1 ,3-dihydro-isoindol-2-yl)-3-(1 H-indo!-3-yl)-N- methoxy-N-methyl-propionamide (53)

A suspension of (S)-2-(1 ,3-dioxo-1 ,3-dihydro-isoindol-2-yl)-3-(1 H-indol-3-yl)-propionic acid (50) (4.5g, 13.5mmol) and Λ/-(3-dimethy!aminopropyl)-Λ/'-ethylcarbodiimide hydrochloride (2.6g, 13.5mmol) in DCM was treated with N.O-dimethyl hydroxylamine hydrochloride (1.3g, 13.5mmol) and triethylamine (3.7ml, 127mmol) and the resulting brown solution was stirred at room temperature for 3 hours. The crude reaction mixture was then washed with brine, dried (MgSO₄) and concentrated in vacuo. The crude mixture was purified by preparative HPLC. LCMS (LCMS 1) m/z 378.4 [M+H]⁺, RT 5.75min

Example 3c: (S)-2-(1 ,3-Dioxo-1 ,3-dihydro-isoindol-2-yl)-3-(1 H-indol-3-yl)-propionic acid hydrazide (54)

A solution of (S)-2-(1,3-dioxo-1 ,3-dihydro-isoindol-2-yl)-3-(1/-/-indol-3-yl)-propionic acid (50) (0.18g, 0.55mmol), Λ/-(3-dimethylaminopropyl)-Λ/-ethylcarbodiimide hydrochloride (0.11g, 0.55mmol), hydrazine (0.017ml, 0.55mmol) and triethylamine (0.21ml, 1.5mmol) were stirred at O⁰C in acetonitrile (35ml) for 5 hours. The crude reaction was washed with brine, dried (MgSO₄) and concentrated in vacuo. The crude mixture was purified by preparative HPLC. LCMS (LCMS1) m/z 349.4 [IvHH]⁺; RT 5.12 min, purity 89.02%.

Example 3d: (S)-2-(1,3-Dioxo-1,3-dihydro-isoindol-2-yl)-3-(1H-indol-3-yl)- propionitrile (56)

(i) (S)-2-(1, 3-Dioxo- 1, 3-dihydro-isoindol-2-yl)-3-(1H-indol-3-yl)-propionamide (55) A mixture of (S)-2-amino-3-(1 /-/-indol-3-yl)-propionamide (7.64 g, 37.59 mmol), phthalic acid 1-(2,5-dioxo-pyrrolidin-1-yl) ester 2-methyl ester (10.42 g, 37.59 mmol), sodium carbonate (19.92 g, 187.95 mmol), water (170 ml) and acetonitrile (280 ml) was stirred for two hours at room temperature. The reaction mixture was diluted with ethyl acetate (300 ml), washed with water (100 ml), brine (3 x 150ml), dried (MgSO₄) and concentrated in vacuo to afford a yellow solid. The solid was further purified by preparative HPLC. LCMS (LCMS1) m/z 334 [M+Hf; RT 5.31 min.

(i) (S)-2-(1,3-Dioxo-1, 3-dihydro-isoindol-2-yl)-3-(1H-indol-3-yl)-propionitrile (56)

A mixture of (S)-2-(1 ,3-dioxo-1 ,3-dihydro-isoindol-2-yl)-3-(1f/-indol-3-yl)-propionamide

(55) (500 mg, 1.5 mmol) and sodium chloride (300 mg, 5.13 mmol) was stirred in dicholoromethane (10 ml) at room temperature for 15 minutes. Phosphorus oxychloride (POCI₃) (0.5 ml) was added and the reaction mixture was refluxed at 40⁰C overnight. The reaction mixture was quenched with ice/NaOH solution (50 ml) and extracted with dichloromethane. The organics were collected, dried (MgSO₄), filtered and evaporated in vacuo to yield a brown solid, which was purified using preparative HPLC. LCMS (LCMS1) m/z 316 [M+H]⁺; RT 6.01 min. Example 3e: (S)-2-(1 ,3-Dioxo-1 ,3-dihydro-isoindol-2-yl)-3-(1 H-indo!-3-yl)-N-(1 H- tetrazol-5-yl)-propionamide (57)

A suspension of (S)-2-(1 ,3-dioxo-1 ,3-dihydro-isoindol-2-yl)-3-(1 H-indo!-3-yl)-propionic acid (50) (4.17g, 12.5 mmol) in cold DMF (25ml) was treated with HOBt (1.68 g, 12.5 mmol) and EDAC (2.39 g, 12.5 mmol). The reaction mixture was treated with TEA (5.2 mL, 37.5 mmol) and stirred at 0 ⁰C for 30 mins and allowed to reach room temperature. An aliquot (1 mL, 0.5 mmol) of the activated ester solution was added to 5- aminotetrazole hydrate (51 mg, 0.5 mmol) and the reaction was stirred at room temperature for 3 hours after which time DCM (5ml) and water (3ml) was added. The crude reaction mixture was then passed through a hydrophopic membrane and the resulting crude purified by LCMS: LCMS (LCMS1) m/z 391.5 [M+H]\ RT= 5.53 min .

Example 3f: 2-[(S)-2-(1W-lndoI-3-yl)-1-(5-oxo-4,5-dihydro-[1,2,4]oxadiazol-3-yl)- ethyl]-isoindole-1,3-dione (59)

(i) (S)-2-(1,3-Dioxo-1,3-dihydro-isoindol-2-yl)-N-hydroxy-3-(1H-indol-3-yl)- propionamidine (58)

To a solution of (S)-2-(1 ,3-dioxo-1,3-dihydro-isoindol-2-yl)-3-(1/-/-indol-3-y!)-propionitrile (56) (500 mg, 1.586 mmol) in methanol (10 ml) was added sodium bicarbonate (139 mg, 1.657 mmol), hydroxylamine hydrochloride (115 mg, 1.657 mmol) and the mixture was heated to reflux (70°C) for 4 hours. The residue was dissolved in ethyl acetate (50 ml), washed (water, 50 ml), dried (MgSCU) and concentrated in vacuo to afford a crude oil. The yellow oil was purified by preparative HPLC to afford the title compound. LCMS (LCMS 1) m/z 349 [M+H]⁺; RT 5.07 min.

rø 2-/('S;-2-ffW-/πdo/-3-y/;-^('5-oxO'4,5-d//7ycf^o-/t,2,4;oxad/azo/-3-y/;-ef/7y/7-/so/nc/o/e- 1,3-dione (59)

A solution of (S)-2-(1 ,3-dioxo-1 ,3-dihydro-isoindol-2-yl)-/V~hydroxy-3-(1H-indol-3-yl)- propionamide (58) (280 mg, 0.8 mmol), 1,1'-carbonyldiimidazole (162 mg, 0.997 mmol), 1 ,8-diazabicyclo[5.4.0]undec-7-ene (131 mg, 0.862 mmol) in 1 ,4-dioxane (10 ml) was heated at reflux for 35 minutes. The reaction mixture was allowed to cool, concentrated in vacuo and purified by preparative HPLC to afford the title compound. LCMS (LCMS1) m/z 373 [M+H]⁺; RT 5.66 min.

Example 3g: 2-[(S)-2-(1H-lndol-3-yl)-1-(1H-tetrazoI-5yl)-ethyl]-isoindole-1,3-dione (60)

A mixture of (S)-2-(1 ,3-dioxo-1,3-dihydro-isoindol-2-yl)-3-(1H-indol-3-yl)-propionitrile (56) (0.27 g, 0.85 mmol), sodium azide (0.16 g, 2.6 mmol), aluminium chloride (0.12 g, 0.89 mmol) and THF (10 mL) was heated at reflux for 24 hours. Water (10 ml) was added to the mixture and the THF was removed in vacuo. The precipitate was removed by filtration and the mixture was resuspended in water (11.25 ml) and concentrated hydrochloric acid (1.25 ml). The mixture was stirred at room temperature for one hour then cooled to 0 ⁰C. The title compound was filtered from the suspension as a fine brown powder and the product was purified by preparative HPLC. ¹H NMR, (CD₃COCD₃) 3.67 (2H, m), 5.55 (1 H, m), 7.07 (2H, m), 7.29 (2H, m), 7.63 (1 H₁ d) and 7.85 (4H, m); ¹³C NMR, (CD₃COCD₃): 32, 46, 102 -141 (12 peaks) and 171. Example 3h: (S)-2-(1,3-Dioxo-1,3-dihydro-isoindol-2-yl)-N-hydroxy-3-(1H-indol-3- yl)-propionamide (62)

(i) (S)-2-(1,3-Dioxo-1,3-dihydro-isoindol-2-yl)-3-(1H-indol-3-yl)-propionic acid (61) (S)-2-(1,3-Dioxo-1.S-dihydro-isoindol^-yO-S-ζiH-indol-S-yO-propionic acid (61) was synthesised from L-tryptophan (4g, 19.5mmol) and methyl 2-

((succinimidooxy)carbonyl)benzoate (5.3g, 19mmol) according to the method described in example 2a to afford the title compound as a yellow solid, which was purified by HPLC. LCMS m/z: 325 [M+1]; RT 5.55 min.

(H) (S)-2-(1 ,3-Dioxo-1 ,3-dihydro-isoindol-2-yl)-N-hydroxy-3-(1 H-indol-3-yl)-propionamide

(62)

To a solution of (S)-2-(1 ,3-dioxo-1 ,3-dihydro-isoindol-2-yl)-3-(1Hindol-3-yl)-propionic acid (61) (1 g, 3 mmol) in acetonitrile (15 ml) was added 1 ,3-dicyclohexyldicarbodiimide (DCC) (619 mg, 3 mmol), 1-hydroxybenzotriazole hydrate (HOBT) (405 mg, 3 mmol) and the mixture stirred at 0⁰C for 2 hours. The reaction mixture was filtered and to the yellow filtrate was added hydroxyiamine hydrochloride (208 mg, 3 mmol), triethylamine (364 mg, 3.6 mmol) and the reaction stirred at room temperature overnight. The solution was acidified to pH1 (1 M HCI) and diluted with ethylacetate (approx. 50ml). The solution was washed with 1 M HCI (2 x 30 ml), brine (30 ml), and the organics collected, dried (MgSO₄), concentrated in vacuo to afford a yellow solid. The residue was purified by preparative HPLC to afford the title compound. LCMS m/z: 350 [M+1]; RT 5.21 min.

Example 4:

L-β-Homotryptophan hydrochloride (0.11 g, 0.39 mmo!) was added to a solution of the relevant substituted phthalic anhydride (0.39 mmo!) and DMF (3 mL). The mixture was left to stir at 100 ⁰C 18 h. The crude mixture was purified by HPLC. Method: LCMS1

The compounds made are listed below:

Example 5:

To a solution of L-Tryptophan tert butylester hydrochloride (0.4g, 1.35 mmol) in anhydrous THF (3 mL) was added TEA (0.19 ml_, 1.35 mmol) followed by a solution of the relevant substituted glutaric anhydride (1.35 mmol) in THF (3 mL) the mixture was stirred for 30 min. The reaction mixture was evaporated in vacuo and the residue was diluted in ethyl acetate. The resulting mixture was treated with HC1 1 M and extracted with ethyl acetate. The organic was washed with brine, dried (MgSO₄) and evaporated in vacuo. The residue was then dissolved in acetic anhydride (3 mL) and sodium acetate (0.14g, 1.755 mmol) was added. The mixture was refluxed for 2 hours. After cooling the mixture was poured into ice water and neutralized by the addition of NaOH. The mixture was extracted with chloroform. The organics were combined and dried (MgSO₄) and evaporated in vacuo. Ethanol (1 mL) was added followed by HCI (1 mL, 2 N) and the mixture was heated at 100⁰C for 10 min in a microwave reactor. The product was purified by preparative HPLC. Method: LCMS2.

The compounds made are listed below:

Example 6

In vitro methylation assay The substrate DNA for the in vitro methylation assay was a 798 bp fragment (-423/+ 375 relative to the initiation codon) from the promoter region of the human p76/nw_agene. The methylation reaction contained 350-400 ng substrate DNA and 4 U of M.Sssl methylase (0.5 μM, New England Biolabs) in a final volume of 50 μl. Inhibitors were added to final concentrations of 10, 100, 200, and 500 μM, respectively. Reactions were performed at 37°C for 2 hours. After completion, the reaction was inactivated at 65⁰C for 15 minutes and the DNA was purified using the QIAquick PCR Purification Kit (Qiagen). 300 ng of purified DNA was digested for 3 hours at 60°C with 30 units of BstUI (New England Biolabs) and analyzed on 2% TBE agarose gels. DNA methylation analysis

Genomic DNA was isolated from cells using the DNeasy kit (Qiagen). Genomic cytosine methylation levels were determined by capillary electrophoresis, as described previously (Stach, D., et al., Nucleic Acids Res., 31, e2 (2003)). The methylation status of satellite sequences was analyzed by methylation-sensitive Southern blots, as described previously (Rhee, I., et al., Nature, 416, 552-556 (2002)). Methylation-specific PCR analysis was performed as described previously (Myohanen, S. K., et al., Cancer Res., 58, 591-593 (1998); Bachman, K. E., et ai, Cancer Res., 59, 798-802 (1999); Suzuki, H., et al., Nat. Genet, 36, 417-422 (2004)). 20 μl reactions contained 2 ocl template, 1x ReddyMix buffer (Abgene), 10 ocM each primer, 1 mM dNTPs (Stratagene), and 1 U of Thermoprime polymerase (Abgene). The primers (M: methylation-specific, U: specific for unmethylated DNA) and the amplification programs were as follows: p16 (M-for TTATTAGAGGGTGGGGCGGATCGC, M-rev GACCCCGAACCGCGACCGTAA-; U-for TTATTAGAGGGTGGGGTGGATTGT, U-rev CAACCCCAAACCACAACCATAA), 95°C 3 min, 35 cycles (95°C 30 s, 60/65⁰C 30 s, 72°C 30 s), 72°C 5 min; TIMP-3 (M-for CGTTGCGTTTTATTTCGTTTCGTC, M-rev TACGCGCCGCCGACG; U-for TTGTTGTGTTTTATTTTGTTTTGTT, U-rev ATTACCATACACACCACCAACA), 95°C 3 min, 35 cycles (95°C 45 s, 52°C s, 72°C 45 s), 72°C 5 min; SFRP1 (M-for GGTAGTAGTTTGCGGTCGCGGAGTC, M-rev GCCCGATACCCATACCGACTCTACG; U- for ATTGGGTAGTAGTTTGTGGTTGTGGAGTT, U-rev

TACACCCAATACCCATACCAACTCTACA), 95°C 3 min, 35 cycles (95⁰C 30 s, 62°C 30 s, 72°C 30 s), 72°C 5 min. For quantitative methylation analysis, genomic DNA was deaminated with sodium bisulfite (Frommer, M, et al., Proc Natl Acad Sci USA, 89, 1827-1831 (1992)) and subsequently amplified by PCR using the following primers and PCR conditions: TIMP3-for TTTGTTTTTTTAGTTTTTGTTTTTT, TIMP3-rev

AATCCCCCAAACTCCAACTAC, 95°C 3 min, 38 cycles (95°C 30 s, 58°C 30 s, 72⁰C 30 s), 72°C 5 min. SAT2-for ATGGAATTTTTATGAAATTGAAAT, SAT2-rev CATTCCATTAAATAATTCCATTC, 35 cycles (95°C 30 s, 51⁰C 30 s, 72°C for 30 s) 72°C 5 min. PCR products were purified using the QIAquick Gel Extraction Kit (Qiagen). For combined bisulfite restriction analysis of chromosome 1 satellite 2, PCR fragments were digested with Hinfl and separated by agarose gel electrophoresis. For bisulfite sequencing of the TIMP-3 promoter region, PCR fragments were subcloned into the pCR 4-Topo plasmid vector (Invitrogen) and subjected to automated sequencing. Results

The following compound were tested using the in vitro methylation assay described above and found to have an IC50 of 450 μM or less: 2 to 37, 40 to 42, 44, 45, 47, 48, 52, 53, 54, 56, 57, 59, 60, 63 to 66.

Of these compounds, 3, 6 to 8, 12, 15, 17 to 19, 23, 25, 26, 29 to 33, 48, 52, 56, 57 and 65 were shown to have an IC50 of 50 μM or less.

Claims

Claims

1. A compound according to formula I:

R'

(0

R^L or an isomer, salt, solvate, chemically protected form or prodrug thereof, wherein: R^A is:

where X¹ is selected from -CH₂- and -C(=O)-;

X⁴ is selected from -CH₂-, -C(=O)-, -S(=O)₂- and -C(=O)-CH₂- wherein -C(=O)- of

-C(=O)-CH₂- is bonded to N and -CH₂ of -C(=O)-CH₂- is bonded to; or X¹ and X⁴ are N and NH respectively and there is a double bond between X¹ and N;

X² and X³ are either independently -CHR^B1-, where R^B1 is selected from H, optionally substituted C_1-7 alkyl, optionally substituted C_5-20 aryl, optionally substituted C_3-20 heterocyclyl, halo, hydroxy and amido; or X² and X³ form part of a fused benzene or pyridine ring, which may be optionally substituted by one or more optionally substituted C_1-7 alkyl, optionally substituted C_5-20 aryl, optionally substituted C_3-2O heterocyclyl, halo, hydroxy, amido, nϊtro and carboxy groups;

R^B is selected from:

(i)

where R^B1 and R^B2, together with the carbon atoms to which they are bound form an optionally substituted fused benzene or pyridine ring;

Y¹ is selected from NR^N1, O and S;

Y² is selected from NR^N1, O and S;

Y³ is selected from CH and N, where R^N1 is H or methyl; and

(iii)

R^c is selected from the group consisting of:

(i) -COR^C1, wherein R^C1 is selected from the group consisting of: -OH, -NH₂, -NHNH₂, -NHCN, -NHSO₂R^S1, -NR^N2OR°\ -NH-CN₄H, where R^S1 is H or methyl, R⁰¹ is H or methyl and R^N2 is H or methyl;

(ii) -(CH₂)_n-CO₂H; (iii) -CH₂OR⁰². where R⁰² is selected from H and C_1-4 alkyl;

(iv) -NHSO₂R^S1. where R^S1 is as defined above;

(V) -SO₂NHR^S1, where R^S1 is as defined above; and

(vi)

(vii) -CN; with the proviso when A is:

and C is -CO₂H, then B is not:

2. A compound according to claim 1 , with the proviso that when A is

and C is -CO₂H, then B is not selected from:

3. A compound according to claim 1 , with the proviso that when A is

and C is -CO₂H, then B is not unsubstituted or substituted indol-3-yl-methyl.

4. A compound according to any one of claims 1 to 3, wherein X¹ and X⁴ are either both -CH₂- or -C(=O)-.

5. A compound according to claim 4, wherein X¹ and X⁴ are both -C(=O)-.

6. A compound according to any one of claims 1 to 5, wherein X² and X³ form part of a fused benzene ring, which may be optionally substituted.

7. A compound according to claim 6, wherein the fused benzene ring is substituted by one or two groups.

8. A compound according to either claim 6 or claim 7, wherein the substituent groups for the fused benzene ring are selected from halo, nitro and carboxy.

9. A compound according to any one of claims 1 to 8, wherein R^c is selected from the group consisting of:

(i) -COR^C\ wherein R^C1 is selected from the group consisting of: -OH, -NHNH₂, -NHCN,

(vi) ; and

(vii) -CN.

10. A pharmaceutical composition comprising a compound according to formula I:

R^A

R^C or an isomer, salt, solvate, chemically protected form or prodrug thereof, and a pharmaceutically acceptable carrier or diluent, wherein: R^A is:

where X¹ is selected from -CH₂- and -C(=O)-;

X⁴ is selected from -CH₂-, -C(=O)-, -S(=O)₂- and -C(=O)-CH₂- wherein -C(=O)- of

-Cf=O)-CH₂- is bonded to N and -CH₂ of -Cf=O)-CH₂- is bonded to X³; or X¹ and X⁴ are N and NH respectively and there is a double bond between X¹ and N;

X² and X³ are either independently -CHR⁶¹-, where R^B1 is selected from H, optionally substituted C_1-? alkyl, optionally substituted C_5-2O aryl, optionally substituted C3.20 heterocyclyl, halo, hydroxy and amido; or X² and X³ form part of a fused benzene or pyridine ring, which may be optionally substituted by one or more optionally substituted C_1-7 alkyl, optionally substituted C_5-20 aryl, optionally substituted C_3-20 heterocyclyl, halo, hydroxy, amido, nitro and carboxy groups;

R^B is selected from:

(0

where R^B1 and R^B2, together with the carbon atoms to which they are bound form an optionally substituted fused benzene or pyridine ring;

Y¹ is selected from NR^N1, O and S;

Y² is selected from NR^N1, O and S;

Y³ is selected from CH and N, where R^N1 is H or methyl; and

(iii)

R^c is selected from the group consisting of: (i) -COR^C1, wherein R^C1 is selected from the group consisting of: -OH, -NH₂,

-NHNH₂, -NHCN, -NHSO₂R^S1, -NR^N2OR⁰¹, -NH-CN₄H, where R^S1 is H or methyl, R⁰¹ is

H or methyl and R^N2 is H or methyl;

(ϋ) -(CH₂)_n-CO₂H;

(iii) -CH₂OR⁰². where R⁰² is selected from H and C_1-4 alkyl; (iv) -NHSO₂R^S1. where R^S1 is as defined above;

(V) -SO₂NHR⁵³¹, where R^S1 is as defined above; and

(vii) -CN; with the proviso when A is:

and C is -CO₂H, then B is not:

11. A pharmaceutical composition according to claim 10, with the proviso when A is:

10

and C is -CO₂H, then B is not selected from

12. A pharmaceutical composition according to claim 10, with the proviso that when A 15 is

then B is not:

13. A pharmaceutical composition according to claim 10, with the proviso that when 5 A is

and C is -CO₂H, then B is not unsubstituted or substituted indol-3-yl-methyl.

14. A pharmaceutical composition according to any one of claims 10 to 13, wherein 10 X¹ and X⁴ are either both -CH₂- or -C(=O)-.

15. A pharmaceutical composition according to claim 14, wherein X¹ and X⁴ are both - C(=O)-.

15 16. A pharmaceutical composition according to any one of claims 10 to 15, wherein X² and X³ form part of a fused benzene ring, which may be optionally substituted.

17. A pharmaceutical composition according to claim 16, wherein the fused benzene ring is substituted by one or two groups.

20

18. A pharmaceutical composition according to either claim 16 or claim 17, wherein the substituent groups for the fused benzene ring are selected from halo, nitro and carboxy.

25 19. A pharmaceutical composition according to any one of claims 10 to 18, wherein R^c is selected from the group consisting of:

(i) -COR^C1, wherein R^C1 is selected from the group consisting of: -OH, -NHNH₂, -NHCN,

(vi) ; and

(vii) -CN.

20. A compound as defined in any one of claims 10 to 19 for use in a method of treatment of the human or animal body.

21. The use of a compound as defined in any one of claims 10 to 19 in the preparation of a medicament for treating a disease ameliorated by the inhibition of one or more DNMTs, more particularly DNMT1 , and/or the inhibition of DNA methylation.