WO2006137517A1 - Vecteur pour transfert de gène dans un jeune individu - Google Patents

Vecteur pour transfert de gène dans un jeune individu Download PDF

Info

Publication number
WO2006137517A1
WO2006137517A1 PCT/JP2006/312596 JP2006312596W WO2006137517A1 WO 2006137517 A1 WO2006137517 A1 WO 2006137517A1 JP 2006312596 W JP2006312596 W JP 2006312596W WO 2006137517 A1 WO2006137517 A1 WO 2006137517A1
Authority
WO
WIPO (PCT)
Prior art keywords
protein
gene
vector
sev
stranded rna
Prior art date
Application number
PCT/JP2006/312596
Other languages
English (en)
Japanese (ja)
Inventor
Sakura Tanaka
Yoshikazu Yonemitsu
Kumi Yoshida
Katsuo Sueishi
Makoto Inoue
Mamoru Hasegawa
Original Assignee
Dnavec Corporation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Dnavec Corporation filed Critical Dnavec Corporation
Publication of WO2006137517A1 publication Critical patent/WO2006137517A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011—Details
    • C12N2760/18011—Paramyxoviridae
    • C12N2760/18811—Sendai virus
    • C12N2760/18841—Use of virus, viral particle or viral elements as a vector
    • C12N2760/18843—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011—Details
    • C12N2760/18011—Paramyxoviridae
    • C12N2760/18811—Sendai virus
    • C12N2760/18871—Demonstrated in vivo effect

Definitions

  • the present invention relates to a paramyxovirus vector capable of introducing a gene into a young individual.
  • Non-patent Document 2 virus-like particles
  • Patent Document 1 WO00 / 70070
  • Patent Document 2 WO03 / 025570
  • Non-patent literature l Yonemitsu Y et al. Nature Biotechnol. 2000 Sep; 18 (9): 970-3
  • Non-patent literature 2 SN Waddington et al. Gene Therapy 2004 Apr; ll (7): 599-608 Disclosure of the Invention
  • the present invention has been made in view of the above situation, and the problem to be solved by the present invention is to find a highly safe vector that can be administered to young individuals.
  • the inventors of the present invention who have solved the above-mentioned problems have intensively studied.
  • the inventors of the present invention administered SeV, which was obtained by further improving F protein-deficient SeV, to examine the safety of young individual animals.
  • As the improved F protein-deficient SeV one selected the above-mentioned vector with reduced VLP-forming ability.
  • the vector is a vector in which amino acid mutations at a total of 9 sites, 3 sites in the M protein, 3 sites in the HN protein, 1 site in the P protein, and 2 sites in the L protein (sometimes referred to as SeV18 + / MtsHNts P511Lmut- ⁇ ). F or ts mutant type SeV) (Patent Document 2).
  • SeV18 + / MtsHNts P511Lmut-AF has been confirmed to have a significantly reduced ability to release infectious virus particles and non-infectious particles, and is expected to be highly safe (Patent Document 2).
  • Patent Document 2 a new vector lacking F protein and two envelope proteins: M protein and HN protein (hereinafter sometimes referred to as SeV / ⁇ M ⁇ F ⁇ HN or 3 gene deletion type SeV) Built.
  • the present inventors administered SeV18 + / MtsHNts P511Lmut- ⁇ F or wild-type SeV from the nostril to neonatal mice and adult mice, and observed changes in the expression level of the vector. Although the expression of wild-type SeV was high in both the neonatal and adult mice, the disappearance time was almost the same time.
  • CTL cytotoxic T lymphocyte
  • SeV / AMAFAHN, Se V18 + luci / MtsHNtsPLmut ⁇ F, SeV / Luci were administered to neonatal mice, and body weight changes and survival rates were examined.In the SeV / ⁇ administration group, No deaths were observed, and a significantly higher survival rate was reproduced than other beta doses. Furthermore, the comparison between the administration to neonatal mice and the administration to adult mice shows that the high and safety of SeV / ⁇ M ⁇ F ⁇ HN reflects a decrease in induction of cytodynamic force due to innate immunity. It was thought that it was. SeV / ⁇ has been shown to be a vector suitable for administration to young individuals in the neonatal period, etc., which are safer than other improved SeVs.
  • the present invention relates to a SeV vector that can be administered to young individuals, more specifically, As shown below.
  • a fetal, neonatal, infant, infant and Z or pediatric therapeutic vector comprising a complex consisting of (a) and (b) below.
  • a nora myxovirus vector comprising a complex consisting of the following (a) and (b).
  • the mutation of the L gene corresponds to Sendai virus L protein N1197 and Z or K179 5 (single-stranded RNA virus L protein is a mutation in which the amino acid site of the L protein is substituted with another amino acid (3) ).
  • the mutation in the P gene is a mutation in which the amino acid site of the ( ⁇ ) strand RNA virus P protein corresponding to L511 of Sendai virus P protein is substituted with another amino acid (3
  • a (-) strand single-stranded RNA comprising the nucleotide sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2 and (-1) a single-stranded RNA that is hybridized under stringent conditions with the complementary strand of RNA.
  • a gene therapy drug or gene vaccine comprising the vector of (7) above.
  • a vector DNA encoding (single-stranded single-stranded RNA or its complementary strand) containing the nucleotide sequence set forth in SEQ ID NO: 1 or 2 is introduced into a cell expressing F protein, M protein, and HN protein. And expressing the process, and
  • RNA comprising the nucleotide sequence set forth in SEQ ID NO: 1 or 2; and a protein that binds to the (single-stranded single-stranded RNA) and a complex that is capable of F protein, M protein And introducing into a cell expressing HN protein, and
  • RNA Paramyxovirus-derived (single-stranded single-stranded RNA or RNA) derived from paramyxovirus, including RNA encoding foreign genes, modified so as not to express F protein, M protein and HN protein of paramyxovirus Introducing a vector DNA encoding a complementary strand into a cell expressing F protein, M protein and HN protein, and expressing the DNA; and
  • RNA derived single-stranded RNA
  • RNA that encodes a foreign gene, modified so as not to express the F, M, and HN proteins of paramyxovirus
  • a viral vector into which any foreign gene has been inserted characterized by using a paramyxovirus vector containing the following complex (a) and (b) also has a potential complex: fetus, newborn, infant, infant and Z Or a method of suppressing the decrease in the survival rate caused by viral vectors when administered to children.
  • FIG. La is a diagram showing a construction procedure of SeV18 + NotI / PLmut ⁇ M ⁇ F ⁇ HN—Pad cDNA (pSeV18 + NotI / PLmut ⁇ F ⁇ HN-Pacl).
  • Fig. Lb is a diagram showing a continuation of Fig. La.
  • FIG. 2a is a diagram showing a construction procedure of SeV18 + BssHII / PLmut ⁇ M ⁇ F ⁇ HN—Notl cDNA (pSeV18 + BssHII / PLmut ⁇ F ⁇ HN-Notl).
  • FIG. 2b is a diagram showing a continuation of FIG. 2a.
  • FIG. 2c is a diagram showing a continuation of FIG. 2b.
  • FIG. 3a is a diagram showing the construction procedure of SeV18 + NotI / PLmut ⁇ M ⁇ F ⁇ HN—GFP cDNA (pSeV18 + NotI / PLmut ⁇ M ⁇ F ⁇ HN-GFP).
  • FIG. 3b is a diagram showing a continuation of FIG. 3a.
  • FIG. 4a is a diagram showing the construction of Cre / loxP-inducible M, F and HN gene expression plasmids that express a blasticidin S resistance gene as a selection marker.
  • FIG. 4b is a diagram showing a continuation of FIG. 4a.
  • FIG. 5 is a diagram showing a scheme for producing helper cells expressing SeV-M, F and HN proteins.
  • FIG. 6 is a diagram showing the results of examining the expression level of SeV when nasal administration of an addition-type or ts mutant F-deficient SeV vector carrying luciferase to neonatal mice.
  • FIG. 7 shows the results of examining the expression level of SeV when nasal administration of an addition-type or ts mutant F-deficient SeV vector carrying luciferase to adult mice.
  • FIG. 9 is a graph showing the results of CTL assay for mice treated with ts mutant SeV vector.
  • FIG. 10 This is a graph showing the results of measuring the anti-SeV antibody produced by SeV administration.
  • F (+) addition type SeV
  • ts ts mutant type SeV
  • 3 3 gene deletion type SeV.
  • A Comparison of anti-SeV antibody levels in neonatal mice and adult mice. There was no difference in the amount of antibody produced in the addition-type administration, whereas in the case of the ts-type and 3-gene deletion-type administration, the amount of antibody in adult mice was greater than that in neonatal mice.
  • B When administered to neonatal mice, a significant difference in the amount of antibody was observed between the addition type and the ts type.
  • FIG. 13 is a diagram and a photograph for explaining the construction of the M, F, and HN gene-deleted SeV vectors carrying the GFP gene and confirmation of their structures.
  • A Structure of recombinant SeV genome. The FP gene open reading frame was inserted at each position of the deleted gene, along with SeV termination and initiation signals (EIS). RT-PCR primer positions are indicated by arrows.
  • B The viral genome structure was confirmed by RT-PCR.
  • SeV / ⁇ M ⁇ F ⁇ HN-GFP ( ⁇ M ⁇ F ⁇ HN) DNA fragment from the 5 ′ end of the P gene to the 3 ′ end of the L gene (including GFP) is amplified from the vector genome, This fragment was compared to the corresponding fragment, which also amplified the vector genome power of SeV / ⁇ F-GFP ( ⁇ F) and SeV / ⁇ MA F-GFP (AMAF).
  • C Virus protein was detected by stamp lot analysis. LLC- MK cells, SeV 18+ GF
  • FIG. 14 Graphs and photographs showing the analysis results of SeV infection-dependent cytotoxicity.
  • A SeV infection sensitivity It is a graph which shows the result of the quantitative measurement using CV-1 cell. Cells were treated with SeV / ⁇ F-GFP, SeV / ⁇ -GFP, SeV / ⁇ F-GFP, SeV / ⁇ F ⁇ HN-GFP, or Sev / PLmut ⁇ M ⁇ F at the indicated infection efficiency. Infected with ⁇ HN-GFP. Cytotoxicity was measured by measuring the amount of LDH that also released damaged cell forces. Atsey was performed 3 days after transduction using supernatants cultured in serum-free medium.
  • FIG. 15 is a graph showing a comparison of the expression performance of SeV vectors carrying the SEAP gene.
  • Transfect LLC- ⁇ cells with SeV 18+ SEAP / ⁇ F-GFP, SeV 18+ SEAP / ⁇ ⁇ ⁇ F-GFP, or SeV 18+ SEAP / PLmut ⁇ ⁇ ⁇ FA HN-GFP at ⁇ 3. And then this cell every 24 hours
  • FIG. 16 is a graph and a photograph showing the results of gene transfer of in vivo M, F, and HN gene-deleted SeV vectors.
  • (B) A graph showing the results of quantitative analysis of GFP fluorescence. The intensity of the GFP fluorescence calculated by multiplying the GFP fluorescence area using the NIH image was expressed as a relative intensity. SeV / ⁇ F-GFP or SeV / PLmut ⁇ M ⁇ F ⁇ HN-GFP was administered with or without submandibular lymph node (SMLN) removal
  • FIG. 17 is a graph and a photograph showing the results of examining the immune response to a SeV vector introduced by in vivo transduction.
  • A Photograph of immunohistochemical analysis on macrophage migration. A frozen section of auricle was prepared from BALB / cA mice intradermally administered with SeV / ⁇ F or SeV / PLmut ⁇ M ⁇ F ⁇ HN.
  • B A graph showing the results of sera of mice administered with SeV / AF-GFP or SeV / PLmut ⁇ M ⁇ F ⁇ HN-GFP with respect to total anti-SeV antibody and neutralizing antibody against SeV. Neutralizing antibody activity is expressed as percent inhibition of SeV 18+ GFP (wild type) infectivity.
  • FIG. 18 shows graphs and photographs showing the results of immune responses to SeV vectors induced by etha vivo transduction.
  • B Serum in serum Antibodies were characterized by Western blotting. Purified M protein, a mixture of NP and HN viral proteins prepared by SeV / A F-GFP transduced LLC-MK cells, and
  • FIG. 19 is a diagram for explaining an experimental method for examining (in vivo) the SeV vector administration effect described in Example 17.
  • FIG. 20 is a graph showing the expression level of luciferase activity when various SeV vectors were administered to neonatal and adult mice.
  • FIG. 21 is a graph showing changes in mouse body weight when various SeV vectors were administered to neonatal mice.
  • FIG. 22 is a graph showing changes in survival rate over time when various SeV vectors were administered to neonatal mice.
  • FIG. 23 is a diagram showing changes in the amount of cytodynamic in production when various SeV vectors were administered to neonatal mice.
  • FIG. 24 is a view showing changes in the amount of cytodynamic in production when various SeV vectors were administered to adult mice.
  • FIG. 25 shows NK activity when various SeV vectors are administered to neonatal and adult mice.
  • FIG. 26 shows CTL activity when various SeV vectors were administered to neonatal and adult mice.
  • FIG. 27 is a graph showing anti-SeV antibody titers when various SeV vectors were administered to neonatal and adult mice.
  • the present invention relates to a fetal, newborn, infant or infant treatment vector.
  • the virus vector expresses paramyxovirus F, M and HN proteins It is characterized in that it contains (single-stranded single-stranded RNA derived from a nomyxovirus) that has been modified so that it does not.
  • paramyxovirus refers to a virus belonging to the Paramyxoviridae family or a derivative thereof.
  • the Nomyxoviridae is one of a group of viruses that have non-segmented negative-strand RNA in their genome.
  • Paramyx ovirinae Respirovirus genus (also called Paramyxovirus genus), Rubravirus genus) And the genus Mobilivirus) and -Pneumovirinae (including the genus Pneumovirina and Meta-Humovirus).
  • Viruses included in the Paramyxoviridae virus are specifically Sendai virus, New force disease, Newcastle disease virus, Mumps virus, Measles virus, Measles virus ⁇ RS Unoles (Respiratory syncytial virus Rin derpest virus) ⁇ Distenno virus (distemper virus) ⁇ Sanoreno ⁇ Reinfnorenza virus (SV5), human parainfluenza virus type 1, 2, 3 etc.
  • examples are bendai virus (SeV), human parainfluenza virus-1 (HPIV-1), human parainil uenza virus-3 (HPIV-3), phocine distemper virus (PDV), canine distemper virus (C DV), dolphin molbillivirus (DMV), peste—des—petits— ruminants virus (PDPR), measle s virus (MV), rinderpest virus (RPV), Hendra virus (Hendra), Nipah virus (Nipah), human parainfluenza virus -2 (HPIV-2), simian parainfluenza virus 5 (SV5), human par ainfluenza virus-4a (HPIV-4a), human parainfluenza virus-4b (HPIV-4b), mumps vir us (Mumps), and Newcastle disease virus (NDV
  • the virus of the present invention is preferably a virus or a derivative thereof belonging to the Paramyxovirus subfamily (including the genus Respirovirus, Rubravirus, and Mopirivirus
  • Respirovirus viruses to which the present invention can be applied include human parainfluenza virus type 1 (HPIV-1), human parainfluenza virus type 3 (HPIV-3), ushiparainfluenza virus type 3 (BPIV-3), Sendai virus (also called mouse parainfluenza virus type 1), monkey parainfluenza virus type 10 (SPIV-10), and the like are included.
  • the paramyxovirus is most preferably Sendai virus.
  • Paramyxovirus generally contains a complex composed of RNA and protein (ribonucleoprotein; RNP) inside the envelope.
  • the RNA contained in RNP is a single-stranded (negative) single-stranded RNA that is the genome of paramyxovirus. This single-stranded RNA binds NP protein, P protein, and L protein, and RNP Forming.
  • the RNA contained in this RNP becomes a trap for transcription and replication of the viral genome (Lamb, RA, and D. Kolakofsky, 1996, Paramyxoviridae: The viruses and their replication. Pp.1177—1204.
  • Paramyxovirus "NP, P, M, F, HN, and L genes” encode nucleocapsid, phospho, matrix, fusion, hemaggluten-neuramidase, and large protein, respectively. It refers to a gene.
  • Phospho (P) protein is a phosphate protein that is a small subunit of RNA polymerase.
  • Matrix (M) protein functions to maintain the internal force of the virus particle structure.
  • the fusion (F) protein is a membrane fusion protein involved in entry into the host cell, and the hemadalunno-ilaminidase (HN) protein is a protein involved in binding to the host cell. Large proteins are the large subunits of RNA polymerase.
  • Each gene has an individual transcription control unit, and each gene force also transcribes a single mRNA and transcribes a protein.
  • a nonstructural protein (C) that is translated using a different ORF and a protein (V) that is created by RNA editing in the middle of reading the P protein mRNA are translated.
  • C nonstructural protein
  • V protein
  • each gene in each virus belonging to the subfamily Nomyxovirus is expressed as follows in order from 3 '.
  • the NP gene is sometimes referred to as “N gene”.
  • the accession number of the base sequence database of each gene of Sendai virus is M29343, M30202, M30203, M30204, M51331, M55565, M69046, X17218
  • P gene is M30202, M30203, M30204, M55565, M6904 6, X00583, X17007, X17008,
  • M gene is D11446, K02742, M30202, M30 203, M30204, M69046, U31956, X00584, X53056, F gene For D00152, D 11446, D17334, D17335, M30202, M30203, M30204, M69046, X00152, X02131, for HN gene D26475, M12397, M30202, M30203, M30204, M69046, X0058 6, X02808, X56131, for L gene See D00053, M30202, M30203, M30204, M69 040, X005
  • the viral genes encoded by other viruses are as follows: CDV, AF014953; DMV, X75961; HPIV-1, D01070; HPIV-2, M55320; HPIV-3, D10025; Mapuera, X85128; Mumps, D86172; MV, K01711; NDV, AF064091; PDPR, X74443; PDV, X75717; RPV, X68311; SeV, X00087; SV5, M81442; and Tupaia, AF079780, for the P gene, CDV, X51 869; DMV, Z47758 ; HPIV- 1, M74081; HPIV- 3, X04721; HPIV-4a, M55975; HPIV-4b, M55976; Mumps, D86173; MV, M89920; NDV, M20302; PDV, X75960; RPV, X 68311; SeV
  • the paramyxovirus vector of the present invention is derived from (a) a paramyxovirus modified so as not to express the paramyxovirus F protein, M protein and HN protein.
  • the virus particle contains a single-stranded RNA, and (b) a protein that binds to the (-) single-stranded RNA and a powerful complex.
  • the protein that binds to ( ⁇ ) single-stranded RNA is directly and / or indirectly bound to the ( ⁇ ) single-stranded RNA, and the (single) single-stranded RNA and A protein that forms a complex.
  • the complex of the present invention includes a complex composed of ( ⁇ ) single-stranded RNA derived from a nomyxovirus and proteins (NP, P, and L proteins) derived from a paramyxovirus that bind to the RNA.
  • a nomyxovirus and proteins NP, P, and L proteins
  • derived from paramyxovirus means that the composition (including protein and RNA) of nora myxovirus is as it is or partly modified.
  • a protein or RNA prepared by modifying a nomyxovirus protein or RNA is a protein or RNA “derived from paramyxovirus”.
  • the vector of the present invention is, for example, a paramyxovirus () strand single-stranded RNA modified so as to lack the F protein, M protein and HN protein gene, and these proteins (NP, P, and L proteins).
  • a paramyxovirus RNP complexes have the ability to replicate autonomously in cells.
  • the vector introduced into the cell increases the copy number of the gene (RNA contained in the complex) by amplifying RNP in the cell.
  • the vector of the present invention preferably has an ability to replicate RNA contained in a complex (RNP) in a cell.
  • Paramyxoviruses to which the present invention can be applied include Sendai virus, such as measles virus, simian parainfluenza virus (SV5), and the ability to include human parainfluenza virus type 3. Not.
  • the (single) single-stranded RNA (genomic RNA) in the viral vector of the present invention is typically N It is modified to express P protein, P protein, and L protein, and not express F protein, M protein and / or HN protein.
  • Paramyxovirus F protein is involved in membrane fusion to the host cell membrane, and HN protein is involved in membrane adhesion.
  • the M protein is a protein that maintains the virus particle structure from the inside. Since the viral vector of the present invention does not express genomic RNA forces F, M and HN proteins, it does not have particle-forming ability and spreadability.
  • the viral vector of the present invention may be infectious.
  • F protein, M protein and / or HN protein are co-expressed when reconstructing the viral vector of the present invention, the reconstructed viral vector has infectivity to the host.
  • Sendai virus the native virus has a genome size of about 15,000 bases, the negative strand follows the 3 'short leader region, NP (nucleocapsid), P (phospho), Six genes encoding M (matrix), F (fusion), HN (hemagno-retune-neuramidase), and L (large) proteins are lined up, with a short 5 'trailer region at the other end. Have.
  • NP nucleocapsid
  • P phospho
  • M matrix
  • F fusion
  • HN hemagno-retune-neuramidase
  • L large proteins
  • the NP, P, and L genes encoded in the vector genome may be the virus-derived gene sequences as they are, but the proteins encoded by these genes bind to the genomic RNA and cause RNP replication in the cell. Mutation may be introduced as long as it has the activity to be performed. Examples of such genomic RNA include the sequence shown in SEQ ID NO: 1 or 2. Furthermore, a polypeptide in which one or more amino acids of the polypeptide encoded by the () strand RNA containing the base sequence of the genomic RNA (SEQ ID NO: 1, 2) of the example of the present invention is deleted, substituted, inserted or added.
  • RNA Single-stranded single-stranded RNA that encodes a peptide, including the nucleotide sequence of SEQ ID NO: 1 or 2) (no) hybridized with a complementary strand of single-stranded RNA under stringent conditions (single-stranded single-stranded RNA)
  • RNA can also be the genomic RNA of the vector of the present invention as long as the NP, P, and L proteins encoded by the genes in the RNA bind to the genomic RNA and have RNP replication activity.
  • Such mutations should be performed by techniques well known by those skilled in the art. Can do. For example, site-specific mutations can be introduced by PCR or cassette mutation methods, or random mutations can be introduced by chemical reagents or random nucleotides.
  • hybridization conditions For example, in a hybridization solution containing 25% formamide, 50% formamide under more severe conditions, 4 X SS C, 50 mM Hepes pH 7.0, 10 X Denhardt's solution, 20 g / ml denatured salmon sperm DNA, 42 After pre-hybridization at ° C, perform hybridization at 42 ° C.
  • a polypeptide encoded by a polynucleotide isolated using such a hybridization technique usually has a high homology in amino acid sequence with the polypeptide encoded by the ( ⁇ )-strand RNA.
  • High homology means at least 40% or more, preferably 60% or more, more preferably 80% or more, more preferably 90% or more, more preferably at least 95% or more, more preferably at least 97% or more (for example, , 98-99%) sequence homology.
  • the identity of the amino acid sequence can be determined by, for example, the algorithm BLAST (Proc. Natl. Acad. Sci. USA 87: 2264-2268, 1990, Proc. Natl. A cad. Sci. USA 90: 5873-5877, 1993 by Karlin and Altschul. ) Can be determined. When the amino acid sequence is analyzed by BLASTX (Altschul et al. J. Mol. Biol.
  • score 50
  • wordleng th 3
  • the present invention also relates to a recombinant virus having a mutation that reduces cytotoxicity in the P gene or L gene of the ( ⁇ ) strand RNA virus.
  • mutations include substitution of SeV P protein with 511st Leu (L511) to other amino acids, or substitution of homologous sites of other (-) RNA RNA P proteins.
  • the amino acid mutation may be a substitution with another desired amino acid, but is preferably a substitution with an amino acid having a different side chain chemistry.
  • an amino acid may be a basic amino acid (e.g., lysine, arginine, Stidine), acidic amino acids (eg aspartic acid, glutamic acid), uncharged polar amino acids (eg glycine, asparagine, gnoletamine, serine, threonine, tyrosine, cysteine), nonpolar amino acids (eg alanine, norin, leucine, isoleucine, proline, Powerful amino acids that can be grouped into groups such as phealanine, methionine, tryptophan), ⁇ -branched amino acids (eg threonine, parin, isoleucine) and aromatic amino acids (eg tyrosine, ferrolanine, tryptophan, histidine)
  • substitution with an amino acid other than the amino acid of the group to which the amino acid belongs may be mentioned.
  • substitution to a larger amino acid and the like are exemplified, but it is not limited thereto. Specific examples include substitution of 511 to! 3 ⁇ 46 (511 F) and the like.
  • substitution of the 1197th Asn (Nl 197) and / or the 1795th Lys (K1795) with other amino acids, or substitution of homologous sites of other (-) strand RNA virus L proteins Can be mentioned.
  • L protein genes having both of these two mutations of L protein are particularly preferred.
  • the amino acid mutation may be a substitution with another desired amino acid, but is preferably a substitution with an amino acid having a different side chain chemistry as described above.
  • N1197 can be replaced with Ser (N1197S)
  • K1795 can be replaced with Glu (K1795E), and the like.
  • Having both P gene and L gene mutations can significantly enhance the effects of persistent infectivity, suppression of secondary particle release, or suppression of cytotoxicity. These effects can be dramatically increased by combining the above mutations with a recombinant ( ⁇ ) strand RNA virus modified so as not to express the F protein, HN protein and M protein.
  • ⁇ recombinant
  • ⁇ recombinant strand RNA virus modified so as not to express the F protein, HN protein and M protein.
  • a virus having mutations in both the P and L genes is particularly preferred.
  • viruses of the present invention are used for the purpose of attenuating the cytotoxicity in gene transfer, and the expression level of the transgene in gene transfer. It is useful to suppress the decrease in virus and to suppress the release of virus particles and virus-like particles (VLP) from cells into which viruses have been introduced during gene transfer.
  • VLP virus-like particles
  • the amino acid of the homologous site of the other (single-stranded) RNA virus M protein corresponding to SeV P protein L511, L protein N1197 and K1795 can be searched for homology search of amino acid sequences such as BLAST. It can be identified by aligning it with the amino acid of SeVM protein using an alignment generation program such as CLUSTAL W.
  • this genomic RNA (positive or negative strand) can be transcribed in the presence of NP, P, and L proteins.
  • the RNP of the present invention can be produced.
  • RNP can be formed, for example, in LLC-MK2 cells.
  • the NP, P, and L proteins can be supplied by introducing an expression vector encoding each gene into the cells (see Examples). Each gene is also integrated into the host cell chromosome.
  • the NP, P, and L genes that are expressed to form the RNP need not be completely identical to the NP, P, and L genes encoded in the vector genome.
  • amino acid sequences of the proteins encoded by these genes must be mutated as long as they have the activity of binding to genomic RNA and replicating RNPs in the cells, even if they are not. It may be introduced or may be substituted with a homologous gene of another virus. -Once RNP is formed, NP, P, and L genes are expressed from this RNP, and RNP replicates autonomously in the cell, producing a viral vector.
  • an envelope protein is expressed in a cell when the vector is reconstituted in the cell, the envelope protein can be incorporated into the virus vector to produce a virus vector that retains the infectivity of the envelope protein. it can. Once such a vector has infected a cell, it can propagate RNP in the cell, but it does not have the envelope gene itself, so it re-produces a virus with the same envelope protein. It is not possible. Such vectors are extremely useful particularly in fields requiring high safety such as gene therapy.
  • the viral vector of the present invention is usually (a) a single-stranded single strand derived from a noraxovirus modified so as not to express paramyxovirus F protein, M protein and HN protein.
  • Vector DNA encoding RNA or its complementary strand is introduced into cells (helper cells) that express paramyxovirus-derived proteins and envelope proteins that bind to the (-) single-stranded RNA.
  • helper cells that express paramyxovirus-derived proteins and envelope proteins that bind to the (-) single-stranded RNA.
  • culturing the cell and recovering virus particles from the culture supernatant When expressing vector DNA, RNP is formed by co-expression of NP, L, and P proteins, and a virus with an envelope protein is constructed.
  • the paramyxovirus vector of the present invention includes a pseudo-type virus vector containing an envelope protein derived from a virus other than the virus from which the genome is derived, such as the VSV-G protein.
  • the vector DNA to be expressed in helper cells encodes (single-stranded single-stranded RNA (negative strand) or its complementary strand (positive strand) contained in the vector of the present invention.
  • (single-stranded single-stranded RNA or DNA encoding its complementary strand is ligated downstream of the T7 promoter and transcribed into RNA by T7 RNA polymerase.
  • Vector DNA may be cloned into a plasmid so that it can be amplified in E. coli.
  • the strand to be transcribed in the cell may be a positive strand or a negative strand of the virus, but it is preferable to increase the efficiency of the reconstruction by allowing the positive strand to be transcribed.
  • vector DNA is designed so that the positive strand is transcribed (SEQ ID NOs: 3 and 4).
  • the vector DNA of SEQ ID NO: 3 encodes the (single-stranded single-stranded RNA of SEQ ID NO: 1
  • the vector DNA of SEQ ID NO: 4 encodes the (single-stranded single-stranded RNA of SEQ ID NO: 2.
  • helper cells a cell expressing an envelope protein is used.
  • helper cells are enveloped in viral vectors. It is not limited to cells that express the gene protein (F, M, HN), but may be a cell that expresses an envelope protein that is different from the protein encoded by the envelope gene that is deficient in the viral vector.
  • an envelope protein for example, VSV-G protein
  • a paramyxovirus envelope protein can be used as the envelope protein.
  • a plasmid that expresses a thread and recombinant Sendai virus vector genome deficient in an envelope gene is transferred to a host cell together with a vector that expresses a deficient envelope protein, and expression vectors for NP, P / C, and L proteins.
  • the virus vector can be reconstructed by using Yong. For example, it can also be produced using a host cell in which the F gene is integrated into the chromosome.
  • These protein groups supplied from sources other than the viral genome introduce mutations if the amino acid sequence is the same as or more than that of the natural type even if the amino acid sequence is the same as that of the natural type.
  • a homologous gene of another virus may be substituted.
  • the vector of the present invention can be amplified by reintroducing the RNP or virus into the helper cells and culturing.
  • This process consists of (a) a ( ⁇ ) single-stranded RNA derived from a nomyxovirus, modified so as not to express paramyxovirus F, M and HN proteins, and the ( ⁇ ) A step of introducing a protein capable of binding to single-stranded RNA and a complex complex into a cell that expresses an envelope protein; and (b) culturing the cell, Recovering.
  • RNP In order to introduce RNP into cells, for example, it can be introduced in the form of a complex with lipofectamine, polycationic ribosome, and the like.
  • various transfer reagents can be used.
  • DOTMA Boehringer
  • Superfect QIAG EN # 301305
  • DOTAP ⁇ DOPE DOSPER (Boehringer # 1811169) and the like can be mentioned.
  • black-and-white quince can also be prepared (Calos, MP, 1983, Proc. Natl. Acad. Sci. USA 80: 3015).
  • the viral vector can be further amplified by co-culturing the cell with a cell expressing an envelope protein.
  • a method of overlaying cells expressing an envelope protein on cells producing virus is preferable.
  • an envelope protein in addition to a viral envelope protein, for example, a polypeptide derived from an adhesion factor, a ligand, a receptor or the like that can adhere to a specific cell is included in the extracellular region.
  • a chimeric protein having a viral envelope-derived polypeptide in the intracellular region can be used. This also makes it possible to create vectors that target specific tissues.
  • the viral vector of the present invention may be, for example, a modified viral gene contained in the vector in order to reduce immunogenicity or to increase RNA transcription efficiency or replication efficiency. .
  • the viral vector of the present invention may contain (RNA) an RNA encoding a foreign gene in (single-stranded single-stranded RNA).
  • a desired gene desired to be expressed in the target cell can be used.
  • a gene for treating a disease of interest is inserted into the virus vector gene.
  • the total number of bases of the genome is 6 times between the transcription initiation (S) sequence and transcription termination (E) sequence.
  • Foreign genes are the viral genes (NP, (P and L genes) can be inserted before or after (see Examples).
  • an EIS sequence transcription start sequence intervening sequence transcription termination sequence
  • the expression level of the inserted foreign gene can be adjusted by the type of transcription initiation sequence added upstream of the foreign gene. It can also be controlled by the position of gene insertion and the base sequence before and after the gene.
  • a foreign gene into the upstream region of the negative-strand genome, such as upstream of the NP gene (on the 3 ′ side of the negative strand) or between the NP gene and the P gene.
  • the closer the insertion position is to the 5 ′ end of the negative-strand RNA (the closer to the L gene in the gene arrangement on the wild-type virus genome), the lower the expression level of the inserted gene.
  • a cloning site can be designed at the insertion site.
  • the cloning site can be, for example, a restriction enzyme recognition sequence.
  • a foreign gene fragment can be inserted into the restriction enzyme site in the vector DNA encoding the genome.
  • the cloning site may be a so-called multicloning site having a plurality of restriction enzyme recognition sequences.
  • the vector of the present invention may thus hold other foreign genes.
  • Thread-replaceable Sendai virus vectors having foreign genes are described in, for example, Kato, A. et al, 1 997, EMBO J. 16: 578-587 and Yu, D. et al., 1997, Genes Cells 2: According to the description of 457-466, it can be constructed as follows.
  • a DNA sample containing a cDNA base sequence of a desired foreign gene is prepared. It is preferable that the DNA sample be confirmed as a single plasmid by electrophoresis at a concentration of 25 ng / 1 or higher.
  • a foreign gene is inserted into the DNA encoding the viral genome using the Notl site. If the target cDNA base sequence contains a Notl recognition site, use a site-specific mutagenesis method, etc. to modify the base sequence so that the encoded amino acid sequence is not changed, and remove the Notl site in advance. It is preferable to keep it.
  • the desired gene fragment from this sample is amplified and recovered by PCR.
  • Both ends of the amplified fragment are Notl sites, and a Notl restriction is added to add a copy of Sendai virus transcription termination sequence (E), intervening sequence (I), and transcription initiation sequence (S) (EIS sequence) at one end.
  • E Sendai virus transcription termination sequence
  • I intervening sequence
  • S transcription initiation sequence
  • EIS sequence transcription initiation sequence
  • the forward-side synthetic DNA sequence has an arbitrary two or more nucleotides on the 5 'side to ensure cleavage by Notl (preferably 4 bases that do not include sequences derived from GCG and GCC Notl recognition sites) And more preferably ACTT), a Notl recognition site gcggccgc is added to the 3 ′ side, and any 9 bases as a spacer sequence or a multiple of 6 to 9 is added to the 3 ′ side.
  • a sequence corresponding to about 25 bases of ORF including the start codon ATG force of the desired cDNA is added to the 3 ′ side. It is preferable to select about 25 bases as the desired cDNA force so that the last base is G or C and use it as the 3 ′ end of the forward-side synthetic oligo DNA.
  • any two or more nucleotides are selected from the 5 'side.
  • the length of these oligo DNAs is designed so that the total number of bases in the Sendai virus genome is a multiple of six (the so-called “rule of six j; Kolakofski, D.
  • a complementary strand sequence of Sendai virus S sequence preferably 5′-CTTTCACCCT-3, (SEQ ID NO: 16), I Sequence, preferably 5'-AAG-3 ', complementary sequence of E sequence, preferably 5'_TTT TTCTTACTACGG-3' (SEQ ID NO: 17), and the desired cDNA sequence at the 3 'end
  • PCR for example, a usual method using ExTaq polymerase (Takara Shuzo) can be used. This is preferably performed using Vent polymerase (NEB), and the amplified fragment of interest is digested with Notl and then inserted into the Notl site of the plasmid vector pBluescript. Confirm the base sequence of the resulting PCR product with a sequencer and select a plasmid with the correct sequence. This plasmid force also excises the insert with Notl and clones it into the Notl site of the plasmid containing the genomic cDNA that lacks the envelope gene. It is also possible to obtain recombinant Sendai virus cDNA by directly inserting into the Notl site without using the plasmid vector pBluescript.
  • NEB Vent polymerase
  • the viral vector DNA of the present invention is transcribed in a test tube or a cell,
  • the RNP L, P, and NP proteins can be used to reconstitute the RNP and generate a viral vector containing this RNP.
  • Reconstitution of virus from viral vector DNA can be performed according to known methods using cells expressing envelope proteins (W097 / 16539; W097 / 16538; Durbin, AP et al., 1997, Virology 235: 323-332; Whelan, SP et al., 1995, Proc. Natl. Acad. Sci. USA 92: 8388-8392; Schnell. MJ. Et al "1994, EMBO J. 13: 4195-4203 Radecke, F.
  • infectious virus particles are not formed as they are, but these deleted genes and other genes are not present in the host cell. Infectious virus particles can be formed by separately introducing and expressing a gene encoding the envelope protein of each virus.
  • Methods for introducing viral vector DNA into cells include the following methods: (0 a method for producing a DNA precipitate that can be taken up by the target cells, suitable for uptake by G0 target cells, and There are methods such as making a complex containing DNA with low toxicity and positive charge characteristics, and (iii) instantaneously opening a hole enough to allow DNA molecules to pass through the target cell membrane.
  • transfection reagents can be used. Examples include DOTMA (Boehringer), Superfect (QIAGEN # 301305), DOTAP, DOPE, DOSPER (Boehringer # 1811 169). Examples of (i) include the transfection method using calcium phosphate, and DNA that has entered cells by this method may also contain a sufficient amount of DNA in the 1S nucleus that is taken up by phagocytic vesicles.
  • Known Graham, FL and Van Der Eb, J "1973, Virology 52: 456; Wigler, M. and Silverstein, S" 1977, Cell 11: 223) 0 Chen and Okayama explore transfer technology optimization 1) Incubate cells with co-precipitate incubation conditions 2-4% CO, 35 ° C, 15-24 hours, 2) DNA is more circular than linear
  • the method (ii) is easy to operate and allows examination of a large number of specimens using a large amount of cells. Therefore, in the present invention, a transfection reagent is suitable. Yes.
  • a transfection reagent is suitable.
  • Superfect Transfection Ragent QIAGEN, Cat No. 301305
  • DOSER Liposomal Transfection Reagent Boehringer Mannheim, Cat No. 18 11169
  • reconstitution from cDNA can be performed as follows.
  • Minimal essential medium containing 10% urine fetal serum (FCS) and antibiotics (100 units / ml penicillin G and 100 ⁇ g / ml streptomycin) on a plastic plate of about 24 to 6 holes or on a 100mm Petri dish (MEM) was used to culture the monkey kidney-derived cell line LLC-MK2 until 70-80% confluent, and for example, UV irradiation treatment in the presence of 1 ⁇ g / ml psoralen was inactivated by treatment for 20 minutes.
  • Recombinant vaccinia virus expressing T7 polymerase vTF7-3 (Fuerst, TR et al, Proc. Natl. Acad. Sci.
  • Sendai virus cDNA is used to express a plasmid that expresses a viral protein that acts in trans essential for the generation of the full-length Sendai virus genome ( 24-0.5 ⁇ g pGEM- ⁇ , 12-0.25 ⁇ g pGEM- ⁇ , and 24-0.5 ⁇ g pGEM-L, more preferably 1 ⁇ g pGEM- ⁇ , 0.5 ⁇ g pGEM- ⁇ , And 1 ⁇ g pGEM-L) (Kato, A.
  • Transfection cells are optionally treated with 100 ⁇ g / ml rifampicin (Sigma) and cytosine arabinoside (AraC), more preferably 40 ⁇ g / ml cytosine arabinoside (AraC).
  • raC cytosine arabinoside
  • infectious viral vectors can be obtained more efficiently by transfection of LLC-MK2 cells that initially express envelope proteins with NP, L, or P expression plasmids or by transfection with an envelope expression plasmid. it can. It is also possible to amplify defective virus vectors by overlaying LLC-MK2 cells expressing envelope proteins on the transfected cells (see International Publication Nos. WO00 / 70055 and WO00 / 70070). ).
  • the titer of the recovered virus can be determined by, for example, CIU (Cell-Infected Unit) measurement or hemagglutination activity (HA) measurement (WOOO / 70070; Kato, A. et al. , 199, Genes Cells 1: 569—579; Yonemitsu, Y. & Kaneda, Y., Hemaggulutinating virus of Japan— lipid— mediated gene delivery to vascular cells. Ed. By Baker AH. Molecular Biology of Vascular Diseases. Method in Molecular Medicine: Humana Presess: pp. 295-306, 1999).
  • CIU Cell-Infected Unit
  • HA hemagglutination activity
  • the titer can be quantified by directly counting infected cells using the marker as an index (eg, as GFP-CIU).
  • the titer measured in this way can be handled in the same way as CIU (WOOO / 70070).
  • the host cell used for reconstitution is not particularly limited.
  • cultured cells such as monkey kidney-derived CV-I cells, LLC-MK cells, and hamster kidney-derived BHK cells can be used.
  • infectious virus particles having the envelope can also be obtained.
  • Sendai virus In order to obtain Kuta, for example, the virus vector obtained as described above together with a vector expressing an envelope gene can be infected with a developing chicken egg, and the vector can be amplified. Alternatively, a viral vector can be produced using a transgenic chicken egg in which an envelope protein gene is incorporated. A method for producing a viral vector using eggs has already been developed (Nakanishi et al., (1993), “Advanced Technology Protocol for Neuroscience Research III, Molecular Neuronal Physiology”, Koseisha, Osaka, ⁇ . 153-172).
  • fertilized eggs are placed in an incubator and cultured at 37-38 ° C. for 9-12 days to grow embryos.
  • the Sendai virus vector is inoculated into the chorioallantoic cavity together with the vector expressing the envelope protein, and the egg vector is cultured for several days to propagate the virus vector.
  • Linker based sperm-mediated gene transfer process (BioAgri Corporation, CA, USA: Alper J., Science 300, 729-730 (2003)) as a method for generating envelope protein, and retrovirus as a method for using a vector.
  • Vector alter DW et al., Virology 157, 236-24 0 (1987), Briskin MJ et al, Proc Natl Acad Sci US A.
  • the recovered paramyxovirus vector can be purified to be substantially pure.
  • the purification method can be performed by a known purification / separation method or a combination thereof including filtration (filtration), centrifugation, column purification, and the like.
  • “Substantially pure” refers to the ability of the viral vector to occupy a major proportion as a component in the sample in which it is present.
  • a substantially pure viral vector will have a viral vector-derived ratio of 10% of the total protein in the sample (except for proteins added as carriers and stabilizers). % Or more, preferably 20% or more, more preferably 50% or more, preferably 70% or more, more preferably 80% or more, and further preferably 90% or more. This can be confirmed.
  • noramyxovirus for example, a method using cellulose sulfate ester or crosslinked polysaccharide sulfate ester (Japanese Examined Patent Publication No. 62-30752, Japanese Examined Publication No. 62-33879, and Japanese Examined Publication No. 62-30753). And a method of adsorbing to a sulfated-fucose-containing polysaccharide and / or a degradation product thereof (WO 97/32010) and the like.
  • the virus vector of the present invention has high safety. As will be described later in the examples, the virus vector of the present invention lacking F, HN, M proteins and having mutations in L and P genes, one administration of macrophage migration was delayed compared to vector administration lacking only F protein A decrease in the amount of neutralizing antibody was observed, and it was confirmed that the host immune response to the viral vector of the present invention was weak in both cellular immunity and humoral immunity.
  • the ts mutant SeV is a SeV vector designed for the purpose of improving safety, and has the characteristics similar to the virus vector of the present invention in that the particle forming ability is remarkably reduced and non-propagating ( WO03 / 025570). Therefore, it is an unexpected effect that a clear difference was shown between the safety of the ts mutant SeV and the safety of the viral vector of the present invention.
  • the viral vector of the present invention can be prepared as a composition according to the purpose.
  • the vector can be combined with a desired pharmacologically acceptable carrier or vehicle as required.
  • a “pharmaceutically acceptable carrier or vehicle” is a material that can be administered with a vector and does not significantly inhibit gene transfer by the vector.
  • the vector can be appropriately diluted with physiological saline or phosphate buffered saline (PBS) to obtain a composition.
  • Urine fluid may be included when the vector is propagated in eggs.
  • a composition containing a vector is It may contain a carrier or a medium such as ionic water and 5% dextrose aqueous solution.
  • compositions comprising the vectors of the present invention are useful as reagents and as medicaments.
  • a viral vector is prepared using a gene for treating a disease as a foreign gene, this vector can be administered to perform gene therapy.
  • this vector can be administered to perform gene therapy.
  • either a gene expression by direct administration or a gene expression by indirect (ex vivo) administration can be performed in a foreign gene or a patient's body that can be expected to have a therapeutic effect. It is possible to express endogenous genes, etc., for which supply is insufficient.
  • nucleic acids that encode proteins that are not particularly restricted as foreign genes for example, do not code for proteins such as antisense or ribozyme! / ⁇
  • the vector of the present invention when the vector of the present invention was administered to a neonatal mouse in a relatively large amount (2.5 x 10 6 CIU), serious deaths such as mortality and suppression of weight gain observed with other vectors were observed. No side effects were observed (Example). That is, the vector of the present invention is a highly safe vector, since the attenuation of the damage to young individuals is actually confirmed at the individual level.
  • the vector of the present invention makes it possible to provide a highly safe gene therapy and gene vaccine.
  • the vector of the present invention is innovative as a vector that can be administered to young individuals.
  • the vector of the present invention it is possible to suppress the occurrence of unwanted biological reactions and side effects that occur with gene therapy in gene therapy of fetuses, newborns, infants, infants or children using noramyxovirus vectors. It seems possible. For example, it is considered possible to suppress the occurrence of an undesirable immune response, the occurrence of serious side effects such as death, and the reduction of the survival rate.
  • This vector into which a foreign gene related to a disease has been inserted is expected as a drug for gene therapy. For example, providing safe and highly effective medicines for respiratory diseases such as fetal, newborn, infant, infant or infant infection, fetus, newborn, infant, infant, or pediatric tumor, cystic fibrosis It can be done.
  • the virus vector of the present invention may be applied to, for example, tumors, infectious diseases, and other common diseases.
  • a gene having a therapeutic effect can be expressed by using the vector of the present invention in tumor cells or antigen-presenting cells (APC) such as DC cells.
  • APC antigen-presenting cells
  • genes include cancer antigen Muc-1 or Muc-1-like mucin tandem repeat peptide (US Pat. No. 5,744,144), melanoma gplOO antigen and the like.
  • Such gene therapy has been widely applied to breast cancer, colon cancer, spleen cancer, prostate cancer, lung cancer and the like. It is also effective to combine site power-in to increase the adjuvant effect.
  • genes include: i) a combination of IL-2 and single-stranded IL-12 (Proc. Natl. Acad. Sci. US A 96 (15): 8591-8596, 1999), ii) IL -2 and interferon- ⁇ (US Pat.No. 5,798,100), iii) Granulocyte colony-stimulating factor (GM-CSF) used alone, iv) GM-CSF and IL-4 for treatment of brain tumors Combinations (J. Neurosurgery 90 (6), 1115-1124 (1999)) and the like can be mentioned.
  • GM-CSF Granulocyte colony-stimulating factor
  • cholera for example, the B subunit of cholera toxin (CTB) (Arakawa T, et al., Nature Biotechnology (1998) 16 (10): 934-8, Arak awa T, et al., Nature Biotechnology (1998) 16 (3): 292-7).
  • CTB cholera toxin
  • rabies for example, the rabies virus glycoprotein (Lodmell DL et al., 1998, Nature Medicine 4 (8): 949-52), human papillomavirus type 6 capsid in cervical cancer Npaku LI (J. Med. Virol, 60, 200-204 (2000)) and the like.
  • the dose of the vector varies depending on the disease, the patient's weight, age, sex, symptom, purpose of administration, form of administration composition, administration method, transgene, etc., but will be determined appropriately by those skilled in the art. It is possible.
  • the route of administration can be selected as appropriate, for example, transcutaneous, intranasal, transbronchial, intramuscular, intraperitoneal, intravenous, intraarticular, intrathecal, or subcutaneous. It is not limited to. Nasal administration is one preferred route of administration. It can be administered locally or systemically.
  • the amount of vector administered is preferably about 10 5 ClU / ml to about 10 11 CIU / mU, more preferably about 10 7 ClU / ml to about 10 9 CIU / ml, most preferably about 1 ⁇ 10 8 ClU / ml.
  • To about 5 ⁇ 10 8 CIU / ml is preferably administered in a pharmaceutically acceptable carrier.
  • the preferred dose per dose is 2 X 10 5 CIU to 2 X 10 1Q CIU can be 1 or multiple doses within the range of clinically acceptable side effects. The same applies to the number of administrations.
  • the protein dosage is, for example, 10 ng / kg to 100 / zg / kg, preferably 100 ng / kg to g / kg, more preferably 1 ⁇ g / kg. It should be in the range of kg force 5 / zg / kg.
  • an amount converted from the above dose can be administered based on the body weight ratio between the target animal and human or the volume ratio (for example, average value) of the administration target site.
  • the administration target of the composition containing the vector of the present invention includes all mammals such as humans, monkeys, mice, rats, rabbits, hidges, sushi, and nu.
  • the age of the patient receiving the composition containing the vector of the present invention is not particularly limited.
  • the vector of the present invention has a remarkable safety in that it can be administered to young individuals with no established immune system, such as fetuses, newborns, infants, infants and children. However, as a matter of course, it can be administered as a highly safe vector not only for young individuals but also for adults.
  • CD of M / F / HN3 gene deletion type SeV vector (SeV18 + NotI / PLmut ⁇ M ⁇ F ⁇ HN-Pacl) NA (pSeV18 + NotI / PLmut ⁇ M ⁇ F ⁇ HN-Pacl) was constructed by the following procedure.
  • a total of 9 types of 6 mutations (M: G69E, T116A, A183S, HN: A262T, G264R, K461G) and mutations derived from persistent infection (P: L511F, L: N1197S, K1795E)
  • the F gene-deficient SeV vector (SeV18 + NotI / MtsHNtsP Lmut ⁇ F-GFP: WO03 / 025570) carrying the GFP gene is mutated, and Sail and A plasmid (Litmus-MtsHNtsPmut ⁇ F-GFP: WO03 / 025570) containing a fragment containing M, HN and GFP genes digested with Nhel (8294 bp) and subcloned into the Sall / Nhel site of Litmus38 (New England Biolabs, Beverly, MA) ) And started construction.
  • a plasmid (pSeV / ⁇ SallNhelfrg) that has a mutation at Nike (N1197S, K1795E) in the L gene and a multicloning site (5'—GTCGACACCAGGTATTTAAATTAATTAATCGCGAGCTA GC-3 ': SEQ ID NO: 7) between Sail and Nhel -MCS: Fragment recovered by digesting WO03 / 02557 0) with Sail and Nhel (8294bp) and Litmus-Pmut ⁇ ⁇ ⁇ F ⁇ HN-Pacl (P gene containing L511F mutation) digested with Sail and Nhel The fragment (5008bp) recovered in this way was ligated, M / F / HN3 gene deletion type SeV vector having Notl site in front of NP gene and Pad site at M / F / HN gene deletion site CDN A (pSeV18 + NotI / PLmut ⁇ F ⁇ HN-Pad)
  • a gene of interest such as a therapeutic gene
  • a GOI gene fragment with Sendai virus termination signal-intervening sequence-initiating signal added downstream of the gene is restricted by Notl.
  • an enzyme recognition sequence is used for insertion (WO00 / 70070, WO03 / 025570, etc.).
  • the expression level of the loaded gene varies depending on the insertion position into the vector, and the expression level decreases as the expression level increases toward the 5 'side, while the expression level increases on the 3' side of the (-) strand RNA genome. ⁇ Polar effect '' is known! /, (Tokusumi T.
  • M / F / HN3 gene deletion type SeV vector (SeV18 + BssHII / PLmut ⁇ M ⁇ F ⁇ HN with BssHII site in front of NP gene and Notl site at M / F / HN gene deletion site -Notl)
  • cDNA (pSeV18 + BssHII / PLmut ⁇ F ⁇ HN-Notl) was constructed by the following procedure. First, a Notl site was introduced into the M / F / HN gene deletion site.
  • Litmus- Pmut AMAF ⁇ ⁇ - Pad as template, primer (pF (dMdFdHN- Notl): 5'- gaaaaacccaggg tgaaagggcggccgcccataggtcatggatgg- 3 '(middle U number 8), and pR (dMdFdHN- Notl): 5'-ccatggcgggg Using 3 ′ (3rd column number 9)), mutagenesis was performed to construct Litmus-Pmut ⁇ M ⁇ F ⁇ HN-Notl (FIG. 2a).
  • the expression level of the on-board gene is higher on the 3 'side of the (-) strand RNA genome, and the expression level decreases as it goes to the 5' side.
  • Sendai virus stop signal-intervening sequence-start signal The GOI gene fragment is often inserted using Notl restriction enzyme recognition sequence, but it is used when the GOI expression level causes cytotoxicity or the vector recovery rate / production amount is poor. It can be used as a vector. It is also possible to load the second gene GOI using the BssHII site.
  • Example 3 Construction of M / F / HN 3 gene deletion type SeV genomic cDNA having GFP gene Green fluorescence protein (GFP) gene, which is a protein emitting green fluorescence, is deleted in M / F / HN gene M / F / HN3 gene deletion-type SeV vector (SeV18 + NotI / P Lmut ⁇ ⁇ ⁇ F ⁇ HN-GFP: SeV / PLmut ⁇ M ⁇ F ⁇ HN—GFP) (pSeV18 + NotI) / PLmut ⁇ M ⁇ F ⁇ HN-GFP) was constructed by the following procedure.
  • GFP Green fluorescence protein
  • an F gene-deficient SeV vector cDNA (pSeV18 + / A F-GFP: WO03 / 02 5570) containing the GFP gene ⁇ Puima ⁇ (pGFP_Sg!
  • the M / F / HN3 gene deletion type SeV vector cDNA (pSeV18 + Notl / PLmut ⁇ ⁇ F ⁇ HN-GFP) having the GFP gene at the M / F / HN gene deletion site was constructed ( Figure 3b).
  • GFP expression is easy to detect and is suitable for examining the basic properties of vector reconstitution and M / F / HN3 gene-deficient SeV vectors.
  • the Cre / loxP expression induction system was used to generate helper cells that express M, F and HN proteins.
  • the system attracts gene products with Cre DNA recombinase.
  • This is a plasmid pCALNdLw (Arai, T. et al., J. Virol. 72: 1115- 1121 (1988)) designed to induce expression, and is a helper cell that expresses F protein (Li, H .-O. Et al., J. Virology 74, 6564-6569 (2000), WO00Z70070), helper cells expressing M and F proteins (Inoue M. et al "J. Gene Med. 6, 1069-1081 (2004), WO03 / 025570) is also used when creating the system.
  • the Cre / loxP-inducible expression plasmid that expresses the M, F, and HN genes was constructed by amplifying the M, F, and HN genes by PCR and inducing the gene product by Cre DNA recombinase. Amplification product at the unique site Swal site (or the same site after converting the site to EcoRI recognition sequence) of the generated plasmid pCALNdlw (Arai, T. et al., J. Virology 72, 1998, pi 115-1121) Built by inserting.
  • PCA LNdLw / F (WO00 / 70070) used for F gene transfer has a neomycin resistance gene
  • pCALNdLw / hygroM (WO03 / 025570) used for M gene transfer has a hygromycin metagene! /
  • Cre / loxP-inducible M, F and HN gene expression plasmids expressing the blasticidin S resistance gene (Invitrogen, Groningen, Netherlands) as a selectable marker were newly constructed (Figs. 4a and 4b). ). To construct these plasmids, the neomycin resistance gene of the pCALNdLw plasmid was first replaced with the blasticidin S resistance gene.
  • pC ALNdLw was digested with Spel and EcoT22I, separated by agarose electrophoresis, and then a band corresponding to a fragment containing the neomycin resistance gene (265 lbp) and a fragment containing the ampicillin resistance gene (3674 bp) were excised, and the QIAquick Gel Extraction Kit It was collected at.
  • the collected fragment (265 lbp) containing the neomycinlf gene was further digested with Xho I, and after electrophoresis, the fragment (1761 bp) not containing the neomycin resistance gene was excised and collected using the QIAquick Gel Extraction Kit.
  • the fragment (3674 bp) containing the ampicillin resistance gene was purified by the QIAquick PCR purification Kit after dephosphorylation.
  • the blasticidin S resistance gene is bTE—5 ′ (5′—TCTCGAGTCGCTCG GTACGATGGCCAAGCCTTTGTCTCAAGAAGAATCCA-3′Z SEQ ID NO: 14) and pTEFl / Bst (Invitrogen, Groningen, Netherlands) as a template.
  • PCR was performed using the primers described above, recovered with the QIAquick PCR Purification Kit, and then digested with Xhol and EcoT22I. These three kinds of fragments were ligated to prepare pCALNdLw / b st.
  • Fig. 5 shows a scheme for producing helper cells expressing SeV-M, F and HN proteins. First, introduce F gene to create F protein expression helper cells, then introduce M gene to create M and F protein expression helper cells, and introduce M and F genes together with HN gene, M, F And helper cells expressing the HN protein.
  • Helper cells expressing F protein were created following the method of Li et al. (Li, H.-O. et al, J. Virology 74, 6564-6569 (2000), WO00 / 70070).
  • Lipofect AMINE PLUS reagent (Invitrogen, Groningen, Netherlands) was used for the transformation as described in the protocol. That is, the following method was taken. LLC-MK2 cells were seeded at 0xl mm cells at 5xl0 5 cells / dish and cultured in D-MEM containing 10% FBS for 24 hours. 1 ⁇ g of pCALNdLw / F was diluted in D-MEM not containing FBS and antibiotics (total amount: 242 ⁇ L).
  • Recombinant adenovirus (AxCANCre) expressing Cre DNA recombinase diluted in MEM containing 5% FBS in a state of almost confluent in a 12-well plate was prepared by the method of Saito et al. (Saito, I. et al., Nucl. Acid. Res. 23, 3816—3821 (1995), Arai, T. et al., J. Virol. 72, 1115—1121 (1998)). After culturing at 32 ° C for 2 days, the culture supernatant was removed, washed once with PBS, and detached with a cell scraper to recover the cells.
  • Helper cells expressing M and F proteins were produced by introducing the M gene according to the method of Example 5 based on LLC / F / # 33. That is, the following method was taken. LLC / F / # 33 cells were seeded at 5xl0 5 cells / dish in an O60 mm petri dish and cultured in D-MEM containing 10% FBS for 24 hours. Dilute 1 ⁇ g of pCALNdLw / hygroM in D-MEM without FBS and antibiotics (total amount: 242 ⁇ L). After stirring, add 8 ⁇ L of LipofectAMINE PLUS reagent, stir again, and let stand at room temperature for 15 minutes .
  • the cells are detached with trypsin, diluted in a 96-well plate at a rate of approximately 5 cells / well or 25 cells / well, and 10 g FBS containing 150 g / mL hygromycin B (Invitrogen, Groningen, Netherlands).
  • the cells were cultured for about 2 weeks in ID-MEM. Expand a clone from a single cell to a 6-well plate Cultured. About the obtained clone, the expression level of F and M protein was analyzed semi-quantitatively by Western-blotting.
  • Recombinant adenovirus (AxCANCre) expressing Cre DNA recombinase diluted in MEM containing 5% FBS in an almost confluent state was plated on a 12-well plate.
  • the method of Saito et al. Saito, I. et al., Nucl. Acid. Res. 23, 3816-3 821 (1995), Arai, T. et al "J. Virol. 72, 1115-1121 (1998)) with MOI 5.
  • Helper cells expressing M, F and HN proteins were produced by introducing the HN gene according to the method of Example 5 based on LLC / F / M / # 72-17. At this time, the M and F genes were simultaneously introduced again. That is, the following method was taken. LLC / F / M / # 72-17 cells were seeded in O60 mm dishes at 5xl0 5 cells / dish and cultured in D-MEM containing 10% FBS for 24 hours. Dilute 1 ⁇ g each of pCALNdLw / bstM, pCALNdLw / bstF and pCALNdLw / bstHN in D-MEM without FBS and antibiotics (total 242 ⁇ L).
  • LipofectAMINE PLUS reagent 8 / z L Added, stirred again and left at room temperature for 15 minutes. After standing, 12 ⁇ L of LipofectAMINE reagent was diluted with D-MEM not containing FBS and antibiotics (250 ⁇ L in total) and left at room temperature for 15 minutes. After standing, 2 mL of F-BS and antibiotic-free D-MEM was added, stirred, and the transfection mixture was added to LLC / F / M / # 72 cells washed once with PBS. After 3 hours in a 37 ° C, 5% CO incubator, transfer
  • Recombinant adenovirus (AxCANCre) expressing Cre DNA recombinase diluted in MEM containing 5% FBS was sown in a 12-well plate and almost confluent.
  • the method of Saito et al. (Saito, I. et al. , Nucl. Acid. Res. 23, 3816-3821 (1995), Arai, T. et al "J. Virol. 72, 1115-1121 (1998)) at MOI 5.
  • the helper cells were evaluated simultaneously using the reconstructed sample of SeV18 + NotI / PLmut ⁇ M ⁇ F ⁇ HN-GFP (Se V / PLmut ⁇ mut ⁇ F ⁇ HN-GFP) of Example 8.
  • the most productive LLC / F / M / HN # 17-5 was obtained, and after ultradilution again, cell cloning and productivity evaluation were performed, and SeV / PLmut AMAF ⁇ HN- TriRE # 7 was selected as a clone because of high GFP productivity.
  • SeV18 + NotI / PLmut ⁇ M ⁇ F ⁇ HN-GFP SeV / PLmut ⁇ M ⁇ F ⁇ HN-GFP
  • GFP gene Li (Li, H.-O. et al., J. Virology 74. 6564-6569 (2000), WOOO / 70070) were modified and carried out.
  • Recombinant vaccinia virus that expresses T7 polymerase treated with psoralen and long-wave ultraviolet light (365 °) for 20 minutes after inoculating LLC-MK2 cells at 5xl0 6 cells / dish in an OlOcm petri dish and culturing for 24 hours.
  • the titer of SeV18 + NotI / PLmut ⁇ M ⁇ F ⁇ HN-GFP (SeV / PLmut ⁇ F ⁇ HN—GFP) prepared using this helper cell (TriRE # 7) was lxlO 8 GFP—CIU / mL or more (the definition of GFP—CIU is described in WO00Z70070), and sufficient titers that can be used for in vitro and in vivo experiments were secured. Further, it can be further concentrated by a general method such as centrifugation.
  • F-deficient SeV vector was administered to mice and the time course of vector expression was observed.
  • a newborn mouse a mouse (0 days after birth) born by spontaneous delivery from an ICR (CD-l) mouse in late pregnancy was used.
  • ICR ICR
  • 8-week-old ICR (CD-1) mouse females were used.
  • a ts mutant (SeV18 + / MtsHNts P511Lmut-AF, WO03 / 255070) equipped with luciferase was used.
  • additional type field (Raw type) SeV was used.
  • CT L atsay was conducted as follows.
  • MOI mult iplicity of infection
  • FIG. 9 shows the CTL activity of 9-week-old neonatal mice after inhalation of ts mutant-type SeV vectors and adult mice 6 weeks after inhalation. It was observed that neonatal mouse tended to have lower CTL activity than adult mice.
  • the anti-SeV antibody at 4 weeks after administration of the SeV vector was measured by the EIA method.
  • As the vector addition type SeV, ts mutant type SeV, and 3 gene deletion type SeV prepared in Example 8 (SeV18 + NotI / PLmut ⁇ F ⁇ HN-GFP) were used. The measurement was performed using a Molyzer HVJ kit (Wamotomoto Pharmaceutical). In both neonatal and adult mice, the anti-SeV antibody was highly positive regardless of the type of SeV vector administered and the number of weeks after SeV administration ( Figure 10).
  • the antibody against SeV is produced against SeV-derived protein, part of which is produced against the membrane protein, so the 3 gene deletion type and the membrane protein after infection (in this case HN protein) It was expected that the ts mutant type SeV, whose localization on the membrane surface was significantly suppressed, was less capable of producing antibodies than the addition type SeV. However, in the results obtained, no significant difference was recognized between the two. In the measurement by this detection method, it is known that anti-NP antibody is often detected, and the difference in anti-HN antibody is considered to be difficult to detect. In neonatal mice, the immaturity of the immune system may have resulted in low antibody production against SeV, but there was no significant difference in antibody production between Neonate and Adult.
  • Example 10 Effect of SeV vector administration on growth and survival rate
  • the present inventors found that there is a clear individual difference in the size of the body as it grows between newborn mice born with the same maternal power. I noticed. Therefore, we examined the effects of SeV vector administration on body weight changes and survival.
  • Neonatal mice were administered with GFP-loaded ts mutant type, addition type or 3 gene deletion type (SeV18 + NotI / PLmut ⁇ M ⁇ F ⁇ HN-GFP) as described above. Moreover, the mouse
  • Inverse PCR was performed using primer pairs of 3 ′ (SEQ ID NO: 5) and 5′-GCATGTTTCCCAAGGGGAGAGTTAATTAACCAAGC ACTC AC AAGGGAC-3 ′ (SEQ ID NO: 6), and a Pac I site was introduced immediately after the P gene.
  • the PCR product was cut with Pac I and Dpn I and then self-ligated. Thereby, both GFP gene and HN gene were removed from LitmusSallNhelfrg-AMA F-GFP, and LitmusSallNhelfrg- ⁇ M ⁇ F ⁇ HN—Pacl was obtained.
  • pSeV / ⁇ M ⁇ F ⁇ HN-GFP is used as a cocoon-type primer pair for L511F in the P gene 5'-CTCAAACGCATCACGTC TCTTTCCCTCCAAAGAGAAGC-3 '(sense) (SEQ ID NO: 18) and 5'-GCTTCTCT TTGGAGGGAAAGAGACGTGATGCGTTTGAG-3 '(antisense;) (SEQ ID NO: 19), and a primer pair for N1197S in the L gene 5'-GTTCTATCTTCCTG ACTCTATAGACCTGGACACGCTTAC-3' (sense) (SEQ ID NO: 20 ) And 5′-GTA AGCGTGTCCAGGTCTATAGAGTCAGGAAGATAGAAC-3 ′ (antisense;) (SEQ ID NO: 21), and a primer pair for K1795E 5′-CTACCTATTGAGCCCCTTAG TTGACGAAGATAAAG
  • genomic cDNA of pSeV / PLmut ⁇ M ⁇ F ⁇ HN-GFP was prepared, and the structure was confirmed by sequencing.
  • the sequence was the same as SEQ ID NO: 3 except that it encoded GFP.
  • pCALNdLw / HN was transfected into LLC-MK2 / F7 / M # 33 cells at the early passage. After culturing at 37 ° C for 2 weeks, clones were selected and expanded. After infection of the Cre-encoded adenovirus vector, AxCANCre (Kanegae et al., Gene 181: 207-212. (1995)) with an infection efficiency (MOI) of 5, the previously described method (Inoue et al, 2003), we examined the expression of HN protein by Western plot analysis of cellular proteins.
  • a cell lysate containing SeNP / ⁇ M ⁇ F ⁇ HN-GFP RNP and major virions was prepared as follows. Approximately lxlO 7 LLC-MK2 cells seeded in a 10-cm diameter dish were transfected with pSeV / AMAFA HN-GFP and pCAG plasmid carrying NP, P, M, F, HN, or L gene respectively. did. Cells were cultured in MEM containing trypsin (2.5 ⁇ g / ml).
  • the cells are overlaid with LLC-MK2 / F7 / M # 33 / HN7 cells that express M, F, and HN proteins after induction by AxCANCre infection with an infection efficiency of 5.
  • the cells were further cultured for 48 hours. Cells were harvested and freeze-thawed three times in Opti-MEM (ln vitrogen).
  • the cell lysate was transfected into new LLC-MK2 / F7 / M # 33 / HN7 cells after AxCANCre infection. Thereafter, these cells were cultured at 32 ° C for 10 to 20 days in MEM containing trypsin.
  • GFP-expressing cells When GFP-expressing cells were observed to spread to neighboring cells under a fluorescence microscope, it was considered that the viral vector was recovered in the culture supernatant. These supernatants were further amplified by repeating the growth several times.
  • the titer was determined by the ratio of GFP-expressing cells per milliliter (GFP-CIU) (Li et al, 2000) o Passage BSA solution at a final concentration of 1% (w / v) was added to the fourth-generation stock solution And stored at -80 ° C.
  • SeV genomic cDNA (SeV / AMAFA HN-GFP) carrying a green fluorescent protein (GFP) gene at the position of the M, F, and HN genes was constructed (Fig. 13A).
  • Sev cD The GFP gene on NA makes it possible to easily confirm the success or failure of collection of the SeV / ⁇ M ⁇ F ⁇ HN vector.
  • SeV / AMAFAHN—G FP was grown using established reverse cell lines and plasmid-based reverse genetics (Kato et al., Genes Cells 1: 569—579. (1996)) and lxlO 8 ClU in the culture supernatant. A titer of / ml was obtained.
  • RT-PCR reverse transcription PCR
  • RT-PCR amplification consists of random hexamer and primer pair 5'-AGAGAACAAGACT AAGGCTACC-3 '(forward primer specific for P gene) (SEQ ID NO: 24) and 5'- TATTCAACCAAAGATCCTGGAACCC-3' (specific for L gene) (A reverse primer) (SEQ ID NO: 25).
  • a DNA fragment of SeV / ⁇ M ⁇ F ⁇ HN-GFP containing the GFP gene and the 5 ′ end of the P gene up to the 3 ′ end of the L gene was amplified from the vector genome.
  • the vector genome forces of F-GFP and SeV / ⁇ F-GFP were also compared to the corresponding fragments amplified.
  • SeV / ⁇ M ⁇ F ⁇ HN—GFP, SeV / ⁇ F-GFP, and SeV / ⁇ F-GFP In contrast, 2069-bp, 3931-bp, and 5096-bp of DNA were expected to be amplified.
  • SeV / AMAFAHN-GFP deleted the M, F, and HN genes from its genome ( Figure 13B).
  • SeVPLmut / ⁇ M ⁇ F ⁇ HN-GFP deletion of M, F, and HN genes was confirmed by RT-PCR as in the case of SeV / AMAFAHN-GFP, and further amplified from cDNA. Newly introduced mutations in the P and L parts were also confirmed by sequencing the DNA fragment (data not shown). Deletion of M, F, and HN genes can be achieved by infecting SeV / AF-GFP, SeV / ⁇ -GFP, and SeV / ⁇ F-GFP, or SeV / ⁇ F ⁇ HN-GFP, respectively.
  • L LC-MK2 transduced in was also confirmed by Western blot analysis.
  • anti-antibodies, anti-F antibodies, anti-antipox antibodies, or anti-SeV antibodies (mainly detecting sputum proteins) were used.
  • the NP protein detected force M, F, and HN protein were not detected (FIG. 13C).
  • the cells transduced with SeV / AMAF-GFP neither M protein nor F protein was observed.
  • CPE cytopathic effects
  • Confluent CV-1 cells cultured in 96-well plates can be treated with SeV I ⁇ F—GFP, SeV / ⁇ —GFP, SeV / ⁇ F—GFP, SeV / ⁇ M ⁇ F ⁇ HN-GFP, or S ev / PLmutAMAFAHN-GFP transduced at an infection efficiency of 0.1, 0.3, 1, 3, 10, or 30 Incubated at 37 ° C in serum-free MEM. Three days after transduction, the culture supernatant was collected and damaged using a cytotoxicity detection kit (Roche) that measures the activity of released lactate dehydrogenase (LDH) ( Decker et al., J Immunol. Meth od, 115 (1988)).
  • LDH lactate dehydrogenase
  • SeV 18+ SEAP / PLmut ⁇ M ⁇ F ⁇ HN-GFP vector thus prepared was used for SEAP assembly. LLC—MK cells were treated with SeV 18+ SEAP / ⁇ F—GFP ⁇ SeV 18+ SEAP / ⁇ M ⁇ F —GFP (Inoue et al,
  • SeV 18+ SEAP / PLmut AMAFA HN-GFP was transduced at an infection efficiency of 3 and incubated at 37 ° C. in serum-free MEM.
  • the culture supernatant was collected every 24 hours and assayed for SEAP activity using a LEAP 1000 image analyzer (Fuji Film) using a SEAP reporter assembly kit (Toyobo). Average values were calculated from three replicate samples.
  • SeV 18+ SEAP / PLmut ⁇ M ⁇ F ⁇ HN- expression levels in the culture supernatants of the SEAP of GFP is SeV 1 8+ SEAP / ⁇ F- was lower than the level of GFP, SeV 18+ SEAP / ⁇ ⁇ ⁇ F-GFP levels were similar (Fig. 15).
  • the M protein is also involved in the regulation of transgene transcription, not the force involved in virus assembly and budding (Ogino et al., Biochem Biophys Res Commun. 311: 283-293. (2003)).
  • SeV / PLmut ⁇ M ⁇ F ⁇ HN-GFP or SeV / ⁇ F-GFP was subcutaneously administered to the ear of a BALB / cA mouse (5xl0 6 CIU / mouse). Subcutaneous administration was performed as follows. Seven weeks old BALB / cA mice (Charles Ricer) weighing approximately 20-25 g were classified into two groups. In one group, the submandibular lymph node (SMLN) was removed prior to injection.
  • SMLN submandibular lymph node
  • mice were anesthetized and 5 ⁇ l of Sev / ⁇ F-GFP (5xl0 6 GFP-CIU) or Sev / PLmut ⁇ M ⁇ F ⁇ HN-GFP (5xl0 6 GFP-CIU) was injected intradermally into the ear. .
  • the fluorescence by GFP expressed by the subcutaneous administration can be directly observed over time via the skin surface of the auricle without slaughtering the mouse.
  • GFP expression was evaluated by observing the pinna under a fluorescent stereomicroscope. Photographs of the pinna were taken and GFP intensity was quantified using NIH image software.
  • Macrophages were detected using a polyclonal anti-CD-1 lb antibody (Santacruz) and Histofine SAB-PO (R) kit (Nichirei). Immunologically positive cells were visualized with 3,3′-diaminobenzidine tetrahydrochloride (DAB) and counterstained with hematoxylin.
  • DAB 3,3′-diaminobenzidine tetrahydrochloride
  • Example 15 In vivo humoral immune response of M, F, and HN gene-deficient SeV Next, the effect of SeV / PLmut ⁇ M ⁇ F ⁇ HN-GFP on the induction of anti-SeV antibody and neutralizing antibody The effect was examined.
  • BALB / cA mice were administered SeV / PLmut ⁇ M ⁇ F ⁇ HN-GFP or SeV / AF-GFP and their sera were collected weekly for 3 weeks. Mice injected with PBS served as controls.
  • mice administered SeV / PLmut ⁇ M ⁇ F ⁇ HN-GFP were reduced to about half that of mice administered SeV / AF-GFP (FIG. 17B).
  • the total amount of anti-SeV antibody was slightly reduced by using the new SeV vector.
  • Envelope protein power of SeV / PLmut ⁇ M ⁇ F ⁇ HN-GFP particles supplied by packaging cells Potential to contribute to induction of total anti-SeV antibody and some amount of neutralizing antibody There is.
  • Isogenic cells M57G; lxlO 6 cells
  • SeV / PLmut ⁇ M ⁇ F ⁇ H N-GFP or SeV / ⁇ F-GFP were implanted subcutaneously on the back of C57BL / 6 mice.
  • Serum was collected at weekly intervals to measure anti-SeV antibody and SeV neutralizing antibody.
  • the cells were cultured in serum-free MEM at 37 ° C for 3 days.
  • Fluorescent microplate reader (Cytofluor II; Biosearch / Millipore) was used to measure the residual infectivity of SeV GFP (wild type) by measuring the fluorescence of GFP. The results are expressed as percent inhibition when the value of cells infected with untreated SeV 18+ GFP is set as 0% and the value of uninfected cells as 100%.
  • HVJ test kit (Denka Seiken) was used according to the manufacturer's procedure to measure total anti-SeV antibody in serum.
  • FIG. 18A shows that the total amount of anti-SeV antibody is significantly reduced when SeV / PLmut ⁇ M ⁇ F ⁇ HN-GFP is used compared to SeV / ⁇ F-GFP. It is. Furthermore, the neutralizing antibody was not detected in mice transplanted with SeV / PLmut ⁇ M ⁇ F ⁇ HN-GFP transduced cells! . Serum antibodies were characterized by Western blot analysis. Anti-HN and anti-M antibodies were not detected in the serum of mice transplanted with SeV / PLmut AMAF ⁇ HN-GFP transduced cells (FIG. 18B).
  • Anti-antibody antibody titer 28 days
  • SeV18 + luci / MtsHNtsPLmut A F was used as the temperature-sensitive mutation vector, and SeV / A M AFA HN-Luc3 was used as the M, F, and HN gene-deficient vectors.
  • SeV / Luci was used for observation of luciferase activity and body weight.
  • the Wild type instead of SeV / Luci was enforced by the enforcement of the Act on Ensuring Biodiversity through Regulations on the Use of Genetically Modified Organisms (Cartagena Act) on February 19, 2004. SeV was used.
  • mice are not constant in class I expression, only CTL activity was observed using C57B / 6 mice.
  • NK cells function from the early days of virus infection and are involved in virus elimination. In the measurement on the second day after virus administration, neonatal mice showed no increase in NK cell activity at any vector administration. In adult mice, NK cell activity was increased by administration of each vector (Fig. 25).
  • CTL cytotoxic T cells
  • CTL activity was sufficiently increased in both newborn mice and adult mice when either vector was administered (Fig. 26).
  • a highly safe paramyxovirus vector is provided.
  • the vector of the present invention is an improved paramyxovirus vector lacking the envelope gene, but was confirmed to have higher safety than the known improved paramyxovirus vector.
  • the safety of the vector of the present invention has been confirmed in young mice.
  • the vector of the present invention is extremely useful in that it enables gene therapy for newborns and the like.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Virology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L’invention a pour objet la production d’un nouveau vecteur de virus Sendai (SeV) ayant trois gènes supprimés pour les protéines F, M et HN respectivement (un SeV à trois gènes supprimés). Ensuite le SeV à trois gènes supprimés et un SeV amélioré (un SeV à mutant ts), lequel est connu comme vecteur très sûr, sont chacun administrés à des souriceaux nouveaux-nés. Chez les souriceaux qui reçoivent le SeV mutant ts, on observe certaines influences sur le taux de survie. Chez les souriceaux qui reçoivent le nouveau SeV à trois gènes supprimés, par contre, il y a peu d’influence sur le taux de survie et sur l'augmentation du poids corporel. Ces observations démontrent que le SeV à trois gènes supprimés est sûr à un niveau tel qu'il peut être administré à de jeunes individus.
PCT/JP2006/312596 2005-06-24 2006-06-23 Vecteur pour transfert de gène dans un jeune individu WO2006137517A1 (fr)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
JP2005185623 2005-06-24
JP2005-185623 2005-06-24
JP2005-313544 2005-10-27
JP2005313544 2005-10-27

Publications (1)

Publication Number Publication Date
WO2006137517A1 true WO2006137517A1 (fr) 2006-12-28

Family

ID=37570534

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2006/312596 WO2006137517A1 (fr) 2005-06-24 2006-06-23 Vecteur pour transfert de gène dans un jeune individu

Country Status (1)

Country Link
WO (1) WO2006137517A1 (fr)

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010008054A1 (fr) 2008-07-16 2010-01-21 ディナベック株式会社 Procédé de fabrication d'une cellule reprogrammée utilisant un vecteur viral chromosomiquement non intégré
WO2010050586A1 (fr) 2008-10-31 2010-05-06 ディナベック株式会社 Procédé pour l'amplification de l'expression d'une protéine recombinée
WO2012029770A1 (fr) 2010-08-30 2012-03-08 ディナベック株式会社 Composition pour induire une cellule souche pluripotente, et utilisation de cette composition
WO2015046229A1 (fr) 2013-09-24 2015-04-02 ディナベック株式会社 Procédé améliorant le taux d'induction de cellules souches pluripotentes
WO2019017438A1 (fr) 2017-07-21 2019-01-24 株式会社Ｉｄファーマ Polynucléotide destiné à modifier une séquence cible et son utilisation
WO2022050419A1 (fr) 2020-09-04 2022-03-10 Ｈｅａｒｔｓｅｅｄ株式会社 Agent améliorant la qualité des cellules ips, procédé de production de cellules ips, cellules ips, et composition pour la production de cellules ips
WO2022138964A1 (fr) 2020-12-25 2022-06-30 国立大学法人京都大学 Procédé de production de cellules souches pluripotentes humaines naïves à partir de cellules somatiques

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000070070A1 (fr) * 1999-05-18 2000-11-23 Dnavec Research Inc. Vecteur de virus paramyxoviridae defectueux dans un gene enveloppe
WO2000070055A1 (fr) * 1999-05-18 2000-11-23 Dnavec Research Inc. Ribonucleoproteine derivee d'un paramyxovirus
WO2003025570A1 (fr) * 2001-09-18 2003-03-27 Dnavec Research Inc. Methode permettant d'examiner un vecteur de virus a arn a brin negatif

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000070070A1 (fr) * 1999-05-18 2000-11-23 Dnavec Research Inc. Vecteur de virus paramyxoviridae defectueux dans un gene enveloppe
WO2000070055A1 (fr) * 1999-05-18 2000-11-23 Dnavec Research Inc. Ribonucleoproteine derivee d'un paramyxovirus
WO2003025570A1 (fr) * 2001-09-18 2003-03-27 Dnavec Research Inc. Methode permettant d'examiner un vecteur de virus a arn a brin negatif

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010008054A1 (fr) 2008-07-16 2010-01-21 ディナベック株式会社 Procédé de fabrication d'une cellule reprogrammée utilisant un vecteur viral chromosomiquement non intégré
EP3075850A1 (fr) 2008-07-16 2016-10-05 IP Pharma Co., Ltd. Procédé de production d'une cellule reprogrammée utilisant un vecteur viral chromosomiquement non intégré
WO2010050586A1 (fr) 2008-10-31 2010-05-06 ディナベック株式会社 Procédé pour l'amplification de l'expression d'une protéine recombinée
WO2012029770A1 (fr) 2010-08-30 2012-03-08 ディナベック株式会社 Composition pour induire une cellule souche pluripotente, et utilisation de cette composition
WO2015046229A1 (fr) 2013-09-24 2015-04-02 ディナベック株式会社 Procédé améliorant le taux d'induction de cellules souches pluripotentes
WO2019017438A1 (fr) 2017-07-21 2019-01-24 株式会社Ｉｄファーマ Polynucléotide destiné à modifier une séquence cible et son utilisation
WO2022050419A1 (fr) 2020-09-04 2022-03-10 Ｈｅａｒｔｓｅｅｄ株式会社 Agent améliorant la qualité des cellules ips, procédé de production de cellules ips, cellules ips, et composition pour la production de cellules ips
WO2022138964A1 (fr) 2020-12-25 2022-06-30 国立大学法人京都大学 Procédé de production de cellules souches pluripotentes humaines naïves à partir de cellules somatiques

Similar Documents

Publication Publication Date Title
CA2553976C (fr) Procede de production d'un vecteur de virus a arn a brin negatif a l'aide d'un promoteur hybride contenant un activateur de cytomegalovirus et un promoteur de .beta.-actine aviaire
JP3602058B2 (ja) エンベロープ遺伝子欠損パラミクソ科ウイルスベクター
US7144579B2 (en) Paramyxoviruses comprising modified transcription start sequence
EP1334174B1 (fr) Vecteur de paramyxovirus destine au transfert de genes dans le systeme cardiovasculaire
US6746860B1 (en) Paramyxovirus vectors used for transfer of foreign genes
US7521043B2 (en) Gene therapy for tumors using minus-strand RNA viral vectors encoding immunostimulatory cytokines
WO2008007581A1 (fr) Vecteur de virus paramyxoviridae non répliquant
WO2006137517A1 (fr) Vecteur pour transfert de gène dans un jeune individu
EP2143794A1 (fr) Vecteur viral pour une thérapie génique
JP4791651B2 (ja) 外来遺伝子導入用パラミクソウイルスベクター
EP1642966B1 (fr) Vecteurs viraux de type arn a polarite negative comportant un gene avec des regions hypermutables modifiees
US20060216824A1 (en) Paramyxovirus vector encoding ribozyme and utilization thereof

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 06767245

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: JP