WO2006134898A1

WO2006134898A1 - Temperature controller

Info

Publication number: WO2006134898A1
Application number: PCT/JP2006/311806
Authority: WO
Inventors: Chikako Hakii; Mitsugu Usui
Original assignee: Eisai R & D Management Co., Ltd.
Priority date: 2005-06-15
Filing date: 2006-06-13
Publication date: 2006-12-21

Abstract

It is intended to provide a temperature controller by which a reaction between molecules immobilized to a solid phase and molecules in a liquid phase can be efficiently carried out and the detection sensitivity can be remarkably elevated in analyzing a sample such as an antigen, an antibody or a polynucleotide by using the above reaction. A temperature controller having a part containing a reactor in which molecules immobilized to a solid phase are reacted with molecules in a liquid phase, a means of heating a part of the reactor, and a means of cooling a site of the reactor differing from the heating site as mentioned above, wherein a difference in temperature is given in the reaction solution in the reactor by using the heating means and the cooling means.

Description

Specification

Temperature control device

Technical field

The present invention relates to a temperature control device that controls the temperature of a reaction solution in a reaction vessel that reacts molecules immobilized on a solid phase with molecules in a liquid phase, and more specifically, in the reaction vessel. The present invention relates to a temperature control device for forming a temperature difference in a reaction solution.

Background art

[0002] Conventionally, in the analysis of biochemical samples such as nucleic acids and proteins, various reactions such as hybridization reactions and antigen-antibody reactions are generally performed by uniformly controlling the reaction temperature. In addition, a reaction apparatus for uniformly controlling the entire reaction solution such as a thermostatic chamber has been used.

Disclosure of the invention

Problems to be solved by the invention

[0003] The present inventors have proposed a reaction solution in which a biopolymer reaction such as a hybridization reaction or an antigen-antibody reaction is formed with a temperature difference, as opposed to a constant temperature condition conventionally performed. It was found that the reaction can be carried out efficiently by carrying out the reaction in the inside, and the detection sensitivity can be remarkably increased in the detection of the sample using the reaction.

[0004] The present invention is capable of efficiently carrying out a reaction between a molecule immobilized on a solid phase and a molecule in a liquid phase, and an antigen, an antibody, a polynucleotide, and the like using the reaction. It is an object of the present invention to provide a temperature control device capable of significantly increasing the detection sensitivity in the sample praying.

Means for solving the problem

[0005] In order to solve the above problems, a temperature control device of the present invention is for controlling the temperature of a reaction solution in a reaction vessel in which a molecule immobilized on a solid phase reacts with a molecule in a liquid phase. A temperature control device, a storage part of a reaction container for reacting molecules immobilized on a solid phase with molecules in a liquid phase, heating means for heating a part of the reaction container, and the reaction container Cooling means for cooling a portion different from the heating portion, and the heating means and the front It is characterized in that a temperature difference can be formed in the reaction solution in the reaction vessel using the cooling means.

[0006] Either one of the heating means and the cooling means is preferably separated from the solid phase of the reaction vessel and arranged to heat or cool the liquid phase. Further, the heating means is arranged to heat the lower part of the reaction vessel, and the cooling means is arranged to cool the upper part of the reaction vessel, and the temperature difference is increased and lowered in the reaction solution. It is preferable that it can be formed.

[0007] The molecule immobilized on the solid phase is an antibody, the molecule in the liquid phase is an antigen, or the molecule immobilized on the solid phase is an antigen, and the molecule in the liquid phase is It is preferably an antibody. Alternatively, it is preferable that both the molecule immobilized on the solid phase and the molecule in the liquid phase are polynucleotides.

[0008] The reaction vessel is not particularly limited, but a microplate or a microarray is preferable.

The invention's effect

[0009] According to the present invention, a reaction between a molecule immobilized on a solid phase and a molecule in a liquid phase can be efficiently performed, and a nucleic acid, an antigen, an antibody, or the like using the reaction can be performed. The detection sensitivity can be remarkably increased in the analysis of samples.

Brief Description of Drawings

FIG. 1 is a schematic cross-sectional explanatory view showing an example of a temperature control device of the present invention.

FIG. 2 is a schematic sectional view showing an example of a reaction vessel whose temperature is controlled by the temperature control device of the present invention.

FIG. 3 is a graph showing the results of Example 1 and Comparative Example 1.

FIG. 4 is a graph showing the results of Example 2 and Comparative Example 2.

FIG. 5 is a graph showing the results of Example 3 and Comparative Example 3.

Explanation of symbols

[0011] 10: temperature control device of the present invention, 12: storage section, 14: heating means, 16: cooling means, 18: base, 19: side wall of storage section, 20: reaction vessel, 22: microplate, 24 : Well, 26: lid, 28: solid phase, 32: first molecule (molecule immobilized on solid phase), 34: second molecule (in liquid phase) Molecule), 36: liquid phase (reaction solution).

BEST MODE FOR CARRYING OUT THE INVENTION

[0012] Embodiments of the present invention will be described below with reference to the accompanying drawings, but the illustrated examples are illustrative only, and various modifications can be made without departing from the technical idea of the present invention. Needless to say.

FIG. 1 is a schematic cross-sectional explanatory view showing an example of a temperature control device of the present invention. In FIG. 1, reference numeral 10 denotes a temperature control device of the present invention, which controls the reaction temperature in a reaction vessel in which molecules immobilized on a solid phase react with molecules in a liquid phase. The temperature control device 10 includes a storage unit 12 that stores the reaction vessel, a heating unit 14 that heats the reaction vessel, and a cooling unit 16 that cools the reaction vessel. In FIG. 1, reference numeral 18 denotes a base, and the heating means 14 is provided on the upper surface of the base 18. The storage unit 12 and the side wall 19 of the storage unit are provided at the upper part of the heating unit 14, and the cooling unit 16 is provided at the upper part of the storage unit 12.

[0014] The shape of the storage section 12 is not particularly limited as long as the reaction container can be stored. In the present invention, storage includes placement and installation. For example, the reaction vessel may be placed in the storage unit 12 when the apparatus of the present invention is used, or may be installed in the storage unit 12. When installing the reaction vessel in the storage unit 12, it may be detachably provided or fixedly mounted on the storage unit 12.

[0015] In the present invention, the heating means 14 and the cooling means 16 are arranged so as to heat or cool different portions of the reaction vessel, respectively. Although FIG. 1 shows an example in which the cooling means 16 is provided in the upper part and the heating means 14 is provided in the lower part, in the present invention, the arrangement of the heating means 14 and the cooling means 16 is controlled by temperature. The reaction vessel to be formed and the temperature difference in the reaction solution to be formed may be appropriately selected without particular limitation. In order to effectively form a temperature difference in the reaction solution, one of the heating means 14 and the cooling means 16 is separated from the solid phase of the reaction vessel, and the liquid phase (reaction solution) is changed. Preferably, the heating means 14 arranged to heat or cool is arranged to heat the solid phase, and the cooling means 16 is spaced from the solid phase to cool the liquid phase. More preferably, it is arranged. In the present invention, the reaction vessel The solid phase means a site where molecules in the reaction vessel are immobilized.

[0016] Specifically, when the solid phase is located in the upper part or the lower part of the reaction vessel, either the heating means 14 or the cooling means 16 is arranged so as to control the temperature of the upper part of the reaction vessel, and the other Is preferably arranged so that the temperature of the lower part of the reaction vessel is controlled so that a temperature difference can be formed between the upper and lower sides of the reaction solution. In addition, when the solid phase is located on one side of the reaction vessel, such as a side wall, either one of the heating means 14 or the cooling means 16 is arranged so as to control the temperature of the right side of the reaction vessel and the other is reacted. It is preferable to arrange the left part of the container so as to control the temperature so that a temperature difference can be formed between the left and right sides of the reaction solution. In particular, when a microplate having molecules immobilized on the bottom is used as a reaction vessel, the lower portion of the reaction vessel and the upper portion are cooled as shown in FIG. It is preferable to form a temperature difference and set the upper part of the reaction solution at a lower temperature than the lower part.

[0017] In the case where the heating means 14 is provided at a position where the lower part of the reaction vessel accommodated can be heated, for example, the heating means 14 can be provided on the lower surface or the lower side surface of the reaction vessel. It is preferable to be provided in contact with the lower surface of the container. The shape of the heating means 14 is not particularly limited, and may be selected according to the reaction container to be applied. However, when a micro-mouth plate is used as the reaction container, it contacts the microplate on a plane as shown in FIG. A structure is preferred. It is more preferable to use a Peltier element that preferably controls the temperature of the heating means 14.

[0018] When the cooling means 16 is provided at a position where the upper portion of the reaction vessel to be stored can be cooled, for example, the cooling means 16 can be provided on the upper surface or upper side surface of the reaction vessel. It is preferable to be provided. The shape of the cooling means 16 is not particularly limited and may be selected according to the reaction container to be applied. However, when a microplate is used as the reaction container, it contacts the microplate lid on a plane as shown in FIG. It is preferable that the structure be The cooling means 16 is more preferably a Peltier element that preferably controls the temperature.

According to the temperature control apparatus of the present invention, the heating unit and the cooling unit are used to heat a part of the reaction container and cool a part different from the heating part of the reaction container. Thus, a predetermined reaction can be performed in a state where a temperature difference is formed in the reaction solution in the reaction vessel. The reaction performed using the apparatus of the present invention is not particularly limited as long as it includes a reaction between a molecule immobilized on a solid phase and a molecule in a liquid phase.

Next, a reaction vessel whose temperature is controlled by the temperature control device of the present invention will be described. FIG. 2 is a schematic cross-sectional view illustrating an example of a reaction vessel whose temperature is controlled by the temperature control device of the present invention. In FIG. 2, reference numeral 20 denotes a reaction vessel, and an example in which a microplate 22 is used as the reaction vessel is shown. The microplate 22 has one or more tools (holes) 24. The well 24 is a reaction solution (liquid phase) in which the first molecule 32 is immobilized on the bottom (solid phase) 28 and the second molecule 34 may or may be contained therein. 36 has been added. A lid body 26 is provided on the microplate 22. The lid 26 of the reaction vessel preferably has an elastic body (not shown) such as rubber on the upper surface, and is in contact with the heating means 14 or the cooling means 16 via the elastic body.

[0021] Although FIG. 2 shows an example in which a microplate is used as a reaction vessel, the reaction vessel 20 reacts molecules immobilized on a solid phase with molecules in a liquid phase. The reaction device is not particularly limited as long as it can be used. As the reaction vessel 20, for example, a microplate such as a polystyrene plate or a microarray is preferably used.

[0022] The first molecule 32 (molecule immobilized on a solid phase) 32 and the second molecule (molecule in a liquid phase) 34 include the first molecule 32 and the second molecule 34. As long as they can react with each other, there is no particular limitation, but those that specifically bind to each other are preferable. For example, one of the first molecule 32 and the second molecule 34 is used as an antigen, and the other is used as an antibody against the antigen, and an antigen-antibody reaction is performed in a reaction solution provided with a temperature difference by the temperature controller of the present invention. It is preferable to do so. In an immunoassay using a solid phase on which an antibody or antigen is immobilized, the detection sensitivity can be significantly improved by performing an antigen-antibody reaction using the temperature control apparatus of the present invention.

[0023] Further, both the molecule 32 immobilized on the solid phase and the molecule 34 in the liquid phase are both hybridized in a reaction solution using a polynucleotide and having a temperature difference by the temperature controller of the present invention. It is preferable to carry out a single reaction. Utilizing the hybridization reaction In the target gene detection method, the detection sensitivity of the gene can be remarkably improved by performing a hybridization reaction using the temperature controller of the present invention. The hybridization reaction is not particularly limited, but is a signal amplification reaction using the PALSAR method (Patent No. 3267576, Patent No. 3310662, International Publication No. 02/31192, JP 2002 — See 355081 publication, WO 03/02 9441 publication etc.)) is particularly suitable for improving the detection sensitivity of genes.

In the present invention, the term “immobilization” refers to immobilizing a molecule directly to a solid phase indirectly via another molecule or the like. The solid phase for immobilizing the molecule is not particularly limited, but the bottom of the reaction vessel such as a microplate as shown in FIG. 2 is preferably provided on the lower side, one side or the upper side of the reaction vessel. More preferred. In addition, when using a microarray as a reaction vessel, a substrate with molecules immobilized on the substrate surface may be placed in the storage unit of the temperature controller so that the immobilized molecules are in contact with the reaction solution. .

[0025] In the present invention, the set temperatures of the heating means and the cooling means are not particularly limited as long as they are appropriately set according to the reaction performed in the reaction solution, but the set temperature of the cooling means is higher than the set temperature of the calorie heat means. It is more preferable to set the temperature lower by 10 ° C or more, and to provide a temperature difference in the reaction solution. It is more preferable to provide a temperature difference, for example, a temperature gradient, above and below the reaction solution. For example, when carrying out an antigen-antibody reaction, it is preferable to set the heating means to 25 ° C to 55 ° C and the cooling means to 0 ° C to 25 ° C. In addition, when performing a hybridization reaction, it is preferable to set the heating means to 40 ° C. to 80 ° C. and the cooling means to 0 ° C. to 20 ° C. The hybridizer using the PALSAR method is preferably used. In the case of carrying out the isomerization reaction, it is more preferable to set the heating means to 55 ° C to 65 ° C.

Example

[0026] The present invention will be described more specifically with reference to the following examples, but it goes without saying that these examples are shown by way of illustration and should not be construed in a limited manner.

[0027] (Example 1)

Using a commercially available serum sialylated glycan antigen KL 6 measurement kit (manufactured by Sanko Junyaku Co., Ltd., trade name: Eitest (registered trademark of Eisai Co., Ltd.) KL-6), except for reaction temperature conditions Kid According to the attached operation method, the measurement was carried out by the sandwich enzyme immunoassay as follows.

[0028] The reaction solution (normal Tris buffer containing Usagi serum) 100 _beta L and dispensed antibody coated force-up (a polystyrene cup anti KL-6 mouse monoclonal antibody immobilized microphone port plate, below 20 ml of each concentration of standard antigen (Tris buffer solution containing 0, 1, 2, 5, 5, 10 or 20 U / mL of KL-6 antigen) in each concentration and mixed well. .

[0029] After sealing the cup with an aluminum seal and placing a rubber elastic body on the upper surface of the aluminum seal, the apparatus similar to that shown in FIG. The first reaction was carried out for 2 hours under the conditions of ° C and the cooling means set at 10 ° C.

[0030] After the first reaction, the inside of the cup is washed with a washing solution (saline containing polyoxyethylene sorbitan monolaurate) and then an enzyme-labeled antibody solution (a solution containing horseradish peroxidase-labeled anti-KL-6 mouse monoclonal antibody). ) Was added and sealed with aluminum, and the second reaction was carried out for 1 hour using the same equipment as in Fig. 1 with the heating means set to 37 ° C and the cooling means set to 10 ° C.

[0031] Coloring agent (freeze-dried product containing 2, 2'-azinobis (3-ethylbenzothiazoline-6-sulfonic acid)) Add 1 mL of purified water to 1 vial and dissolve to dissolve enzyme substrate (Nippon Oxide) 30 μL) was added to prepare a substrate solution.

After washing the inside of the cup after the second reaction with a washing solution, add 100 μL of the substrate solution and seal it with aluminum. After the third reaction at 25 ° C for 30 minutes, stop the reaction solution (sodium azide solution). Absorbance was measured at 405 nm. The results are shown in Figure 3.

[0032] (Comparative Example 1)

37 for the first and second reactions. The measurement was performed in the same manner as in Example 1 except that the measurement was performed in a C incubator (IC-150MA, manufactured by AZONE Corporation). The results are shown in Figure 3.

[0033] Example 1 in which an immunoassay using an antigen-antibody reaction using the temperature controller of the present invention as shown in Fig. 3 was performed was more sensitive than Comparative Example 1 using a conventional incubator. Improved.

[0034] (Example 2)

<Preparation of each solution> Use target oligonucleotides with the same sequence as the Staphylococcus aureus rRNA so that the target oligonucleotide is at each concentration (0, 50, 100, 200, 400, 800 or 1600 fmol / mL). A sample for measurement diluted with Tris buffer was prepared.

Base sequence of target oligonucleotide (SEQ ID NO: 1)

5 '-TTCGGGAAACCGGAGCTAATA CCGGATAATATTTTGAACCGC ATGGT TC AAAAGTGAAAGAC G GTCTTGCTGTCACTTATAGAT GTTGGTAAGGTAA CGGCTTAC -3'

[0035] Using an assist probe containing a sequence complementary to the target oligonucleotide, the first hybridization solution [4XS SC, 0.2% SDS, l% Blocking reagent (Roche And 20% honremamide, Salmon sperm DN (10 μg / mL)] to prepare a first hybridization reaction solution.

Assist probe base sequence (SEQ ID NO: 2)

5 '-CATGTCTCGTGTCTTGCATC CTGCTACAGTGAACACCATC GTTCTCG ACATAGACCAGTC ATCTATAAGTGACAGCAAGAC _3,

[0036] A labeled oligonucleotide having a sequence complementary to the assist probe and labeled at the 5 'end with attalizinum ester (AE) was prepared. Ataridinium ester labeling was performed using 200201 Acridinium Protein Labeling Kit (Cayman). Add the labeled oligonucleotide to the second hybridization solution [4XSS C, 0.2% SDS, l% Blocking reagent (Roche)] so that it contains 200 pmoL / mL, and then add the second hybridization reaction solution. Was prepared.

Base sequence of labeled oligonucleotide (SEQ ID NO: 3)

AE-5 '-GATGCAAGACACGAGACATG GATGGTGTTCACTGTAGCAG GACTG GTCTATGTCGAGAAC _3,

A capillary probe having a sequence complementary to the target oligonucleotide (nucleic acid probe having the following base sequence) was immobilized on a 96-well microphone plate of a strip well type and used for the experiment. The base sequence of the capillary probe (SEQ ID NO: 4)

5 '-CGTCTTTCACTTTTGAACCAT-3,-Amino link

To the microplate on which the capillary probe is immobilized, 50 samples of the first hybridization reaction solution and 50 x L of the first hybridization reaction solution are sequentially added, and an apparatus similar to that shown in FIG. The first reaction was carried out for 2 hours under the conditions of 45 ° C for the heating means and 20 ° C for the cooling means.

[0039] Thereafter, the reaction solution in the tool was discarded, and after washing three times with a washing solution [50 mM Tris, 0.3 M NaCl, 0.01% Triton X_100, pH 7.6], the second hybridization reaction solution 100 z I got L. Using the same apparatus as in Fig. 1, the second reaction was performed for 30 minutes under the conditions that the heating means was set to 55 ° C and the cooling means was set to 20 ° C.

[0040] After discarding the reaction solution in the well and washing 3 times with the washing solution, Luminescent Reagent A [0.1% H 0, 0.001N

twenty two

HNO] 50 / L and Luminescent Reagent B [1N NaOH] 50 μL were added. Immediately after that, the luminometer

Three

Luminescence intensity (RLU) was measured with one (Berthold, Centra LB-960). The results are shown in Fig. 4. The luminescence intensity is a numerical value that is shown in the background with the measurement result of the target oligonucleotide concentration 0 as the background.

[0041] (Comparative Example 2)

The same as Example 2 except that the first reaction (set temperature 45 ° C) and the second reaction (set temperature 55 ° C) were performed using a thermostat (Anatech Co., Ltd., Cool STAT Mode 5520a). Measurements were taken. The results are shown in Fig. 4.

[0042] By performing a hybridization reaction using the temperature control apparatus of the present invention as shown in FIG. 4, the detection sensitivity in the detection of the target gene using the hybridization reaction is detected. Improved.

[0043] (Example 3)

The measurement was performed in the same manner as in Example 2 except that the second hybridization reaction solution used in the second reaction was prepared as follows. The results are shown in FIG.

The labeled oligonucleotide described in Example 2 (HCP-1, base sequence described in SEQ ID NO: 3) and oligonucleotide probe (hereinafter referred to as HCP-2) are each 200 pmolZmL. As described above, the mixture was added to the second hybridization solution [4XSSC, 0.2% SDS, 1% Blocking reagent (manufactured by Roche)] to prepare a second hybridization reaction solution. HCP-2 has a base sequence capable of forming a self-assembly with the labeled oligonucleotide (HCP-1). The 5 ′ side region, the central region, and the 3 ′ side of HCP-2 and HCP-1 Each region consists of a complementary base sequence.

HCP-2 base sequence (SEQ ID NO: 5)

5 '-CATGTCTCGTGTCTTGCATC CTGCTACAGTGAACACCATC GTTCTCG ACATAGACCAGTC _3'

[0044] (Comparative Example 3)

Same as Example 3 except that the first reaction (set temperature 45 ° C) and the second reaction (set temperature 55 ° C) were performed using a thermostat (Anatech Co., Ltd., Cool STAT Mode 5520a). Measurements were taken. The results are shown in FIG.

[0045] The hybridization reaction including the self-assembly reaction using the PALSAR method is performed by using the temperature control device of the present invention as shown in FIG. 5, thereby utilizing the hybridization reaction. The detection sensitivity was improved in the detection of the target gene.

Claims

The scope of the claims

[1] A container for a reaction vessel for reacting molecules immobilized on a solid phase with molecules in a liquid phase, heating means for heating a part of the reaction vessel, and the heating part of the reaction vessel A cooling means for cooling different parts, and a temperature difference can be formed in the reaction solution in the reaction vessel using the heating means and the cooling means. A temperature control device for performing temperature control.

[2] One of the heating means and the cooling means is separated from the solid phase of the reaction vessel, and is arranged to heat or cool the liquid phase. The temperature control device described.

[3] The heating means is arranged to heat the lower part of the reaction vessel, and the cooling means is arranged to cool the upper part of the reaction vessel, and the temperature difference is increased and decreased in the reaction solution. The temperature control device according to claim 1 or 2, wherein the temperature control device can be formed as follows.

[4] The molecule immobilized on the solid phase is an antibody, the molecule in the liquid phase is an antigen, or the molecule immobilized on the solid phase is an antigen, and the molecule in the liquid phase is The temperature control device according to any one of claims 1 to 3, wherein the temperature control device is an antibody.

5. The temperature control apparatus according to any one of claims 1 to 3, wherein the molecule immobilized on the solid phase and the molecule in the liquid phase are both polynucleotides.

6. The temperature control device according to any one of claims 1 to 5, wherein the reaction vessel is a microplate.