WO2006128296A1 - Pal-based chlamydia vaccine - Google Patents

Pal-based chlamydia vaccine Download PDF

Info

Publication number
WO2006128296A1
WO2006128296A1 PCT/CA2006/000894 CA2006000894W WO2006128296A1 WO 2006128296 A1 WO2006128296 A1 WO 2006128296A1 CA 2006000894 W CA2006000894 W CA 2006000894W WO 2006128296 A1 WO2006128296 A1 WO 2006128296A1
Authority
WO
WIPO (PCT)
Prior art keywords
residue
preferred
composition according
polypeptide
adjuvant
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/CA2006/000894
Other languages
French (fr)
Inventor
Ausra Raudonikiene
Scott Gallichan
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Sanofi Pasteur Ltd
Original Assignee
Sanofi Pasteur Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Sanofi Pasteur Ltd filed Critical Sanofi Pasteur Ltd
Publication of WO2006128296A1 publication Critical patent/WO2006128296A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/118Chlamydiaceae, e.g. Chlamydia trachomatis or Chlamydia psittaci
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04Antibacterial agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/51Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/53DNA (RNA) vaccination
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/54Medicinal preparations containing antigens or antibodies characterised by the route of administration
    • A61K2039/541Mucosal route
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/54Medicinal preparations containing antigens or antibodies characterised by the route of administration
    • A61K2039/541Mucosal route
    • A61K2039/543Mucosal route intranasal
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/555Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
    • A61K2039/55511Organic adjuvants
    • A61K2039/55555Liposomes; Vesicles, e.g. nanoparticles; Spheres, e.g. nanospheres; Polymers
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/60Medicinal preparations containing antigens or antibodies characteristics by the carrier linked to the antigen
    • A61K2039/6031Proteins
    • A61K2039/6075Viral proteins

Definitions

  • the present invention relates to Chlamydia vaccines based on the peptidoglycan-associated lipoprotein (PaL) from Chlamydia trachomatis .
  • PaL peptidoglycan-associated lipoprotein
  • Chlamydiae are prokaryotes . They exhibit morphologic and structural similarities to gram-negative bacteria including a trilaminar outer membrane, which contains lipopoly-saccharide and several membrane proteins that are structurally and functionally analogous to proteins found in E. coli . They are obligate intracellular parasites with a unique biphasic life cycle consisting of a metabolically inactive but infectious extracellular stage and a replicating but non-infectious intracellular stage. The replicative stage of the life-cycle takes place within a membrane-bound inclusion which sequesters the bacteria away from the cytoplasm of the infected host cell .
  • Chlamydia are associated with a number of human diseases.
  • C. pneumoniae is a common cause of community acquired pneumonia.
  • Several epidemiological studies indicate an association between C. pneumoniae infection and atherosclerosis, and C. pneumoniae infection and asthma.
  • C. trachomatis infection of the genital tract is common.
  • an effective vaccine can be developed using physically or chemically inactivated Chlamydiae.
  • such a vaccine does not have a high margin of safety.
  • safer vaccines are made by genetically manipulating the organism by attenuation or by recombinant means .
  • mice which have recovered from a lung infection with C. trachomatis are protected from infertility induced by a subsequent vaginal challenge.
  • sheep immunized with inactivated C. psittaci were protected from subsequent chlamydial-induced abortions and stillbirths (Jones et al . 1995. Vaccine 13:715) .
  • protection from chlamydial infections has been associated with ThI immune responses, particularly CD8+ CTL response (Rottenberg et al. 1999. J. Immunol.
  • DNA immunization has been used to elicit a protective immune response in Balb/c mice against pulmonary infection with mouse pneumonitis (MoPn) , a mouse-adapted strain of C. trachomatis (Zhang et al . 1997. J. Infect. Dis. 76:1035-1040 and Zhang et al. 1999. Immunology. 96:314-321).
  • MoPn mouse pneumonitis
  • the present invention provides vaccines based on the Chlamydia peptidoglycan-associated lipoprotein (PaL) and/or the major outer membrane protein MOMP.
  • the PaL sequences are based on those from: C. pneumoniae (SEQ ID Nos : 1 and 2), C. trachomatis serovar D, one of 15 C. trachomatis serovars isolated from humans (SEQ ID NO : 5 represents the full-length sequence; SEQ ID NO : 6 represents the mature leader-less sequence), and mouse pneumonitis (MoPn, the single biovar of C. trachomatis isolated from mouse; SEQ ID NO: 7) .
  • the MOMP sequences are based on the C. trachomatis serovar D sequence SEQ ID NO : 8.
  • the vaccines comprise DNA that encode the polypeptide of SEQ ID No: 5, 6, 7 or 8 or a B-cell or T-cell epitope thereof. In another form, the vaccines comprise the polypeptide of SEQ ID No : 5, 6, 7 or 8 or a B-cell or T-cell epitope thereof .
  • a vaccine composition comprising a protein and an agent, wherein the protein comprises the amino acid sequence set forth in SEQ ID No: 5, 6, 7 or 8 or a B-cell or T-cell epitope thereof, and wherein the agent facilitates delivery and/or enhance an immune response to the part of the protein having the amino acid sequence set forth in SEQ ID No : 5, 6, 7 or 8 or the B-cell or T-cell epitope thereof .
  • composition outlined above wherein the protein is a fusion protein comprising the amino acid sequence set forth in SEQ ID No: 5, 6, 7 or 8 or a B-cell or T-cell epitope thereof, fused with a heterologous polypeptide.
  • the heterologous polypeptide may be a peptide tail for purifying the protein.
  • compositions outlined above wherein the agent is a liposome.
  • the liposome may be at least one liposome selected from the group consisting of neutral liposomes, anionic liposomes, microspheres, ISCOMS, and virus-like-particles (VLPs) .
  • compositions outlined above wherein the agent is an adjuvant.
  • the adjuvant may be at least one adjuvant selected from the group consisting of an aluminum compound such as aluminum hydroxide, aluminum phosphate, or aluminum hydroxy phosphate, RIBI, polyphosphazene, DC-chol (3 b- (N- (N 1 ,N' -dimethyl aminomethane) - carbamoyl) cholesterol) and QS-21.
  • compositions outlined above which is suitable for parenteral administration, or for mucosal administration.
  • the adjuvant may be at least one adjuvant selected from the group consisting of bacterial toxin, bacterial monophosphoryl lipid A (MPLA) (such as MPLA of
  • E. coli Salmonella minnesota, Salmonella typhimurium, or Shigella flexneri
  • saponin polylactide glycolide (PLGA) microsphere, polyphosphazene, DC-chol (3 b- (N- (N 1 ,N' -dimethyl aminomethane) -carbamoyl) cholesterol), and QS-21.
  • the bacterial toxin may be selected from the group consisting of cholera toxin (CT) , E.
  • coli heat-labile toxin LT
  • Clostridium difficile toxin A Clostridium difficile toxin A
  • pertussis toxin PT
  • combinations, subunits, toxoids, or mutants thereof that retain adjuvant activity and/or have reduced toxicity LT
  • PT pertussis toxin
  • the adjuvant may be at least one bacterial toxin selected from the group consisting of native cholera toxin subunit B (CTB) , Arg- 7-Lys CT mutant, Arg-192-Gly LT mutant, Arg-9-Lys PT mutant, Glu-129-Gly PT mutant, Ser-63-Lys LT mutant, Ala-69-Gly LT mutant, Glu-110-Asp LT mutant, and Glu-112-Asp LT mutant.
  • CTB native cholera toxin subunit B
  • compositions outlined above in unit dosage form.
  • compositions outlined above further comprising an additional Chlamydia polypeptide that enhances an immune response to the part of the protein having the amino acid sequence set forth in SEQ ID No: 5, 6, 7 or 8 or to the B-cell or T-cell epitope thereof.
  • a vaccine composition comprising a protein fused to a heterologous polypeptide having adjuvant activity, wherein the protein comprises the amino acid sequence set forth in SEQ ID No : 5, 6, 7 or 8 or a B-cell or T- cell epitope thereof.
  • the heterologous polypeptide having adjuvant activity may be suitable as an adjuvant for parenteral administration, or as an adjuvant for mucosal administration.
  • the heterologous polypeptide may be subunit B of cholera toxin (CTB) or subunit B of E. coli heat-labile toxin (LTB) .
  • the heterologous polypeptide may also be a strong T- cell epitope and/or a strong B-cell epitope such as a strong T- cell epitope and/or a strong B-cell epitope from hepatitis B virus core antigen.
  • a method for treating or preventing a Chlamydia infection comprising the step of administering to a subject the vaccine composition as outlined above.
  • the method may further comprise the step of administering to the subject an antibiotic (such as a macrolide, a tetracycline, or a derivative thereof, or azithromycin or doxicyclin) , an antacid, sucralfate, a cytokine immunomodulator (such as interleukin-2 (IL-2) , interleukin-12 (IL-12) , or a steroid) or a combination thereof.
  • an antibiotic such as a macrolide, a tetracycline, or a derivative thereof, or azithromycin or doxicyclin
  • an antacid such as a macrolide, a tetracycline, or a derivative thereof, or azithromycin or doxicyclin
  • an antacid such as a macrolide, a tetracycline, or a derivative thereof
  • a vaccination kit comprising the vaccine composition as outlined above and instructions for its use in vaccinating a subject against Chlamydia infection.
  • a vaccine composition comprising a vaccine vector encoding a polypeptide, or comprising the polypeptide, wherein the polypeptide:
  • (i) comprises an amino acid sequence having at least 69% amino acid sequence identity to SEQ ID NO : 6 and
  • the vaccine comprising the polypeptide and further comprising an adjuvant agent which facilitates delivery and/or enhance an immune response to the protein.
  • the polypeptide may be a fusion protein further comprising a heterologous sequence.
  • the heterologous polypeptide may be a peptide tail for purifying the protein.
  • the adjuvant agent in the compositions described above may be a liposome.
  • the liposome may be at least one liposome selected from the group consisting of neutral liposomes, anionic liposomes, microspheres, ISCOMS, and virus-like-particles (VLPs) .
  • composition described above may be formulated as to be suitable for parenteral administration.
  • Suitable adjuvant agents include those selected from the group consisting of an aluminum compound, RIBI, polyphosphazene, DC-chol (3 b- (N- (N 1 ,N' -dimethyl aminomethane) -carbamoyl) cholesterol) and QS- 21, aluminum hydroxide, aluminum phosphate, or aluminum hydroxy phosphate .
  • the composition described above may be formulated as to be suitable for mucosal administration.
  • the adjuvant may be selected from the group consisting of bacterial toxin, bacterial monophosphoryl lipid A (MPLA) , saponin, polylactide glycolide (PLGA) microsphere, polyphosphazene, DC-chol (3 b- (N- (N' ,N' -dimethyl aminomethane) -carbamoyl) cholesterol), and QS- 21.
  • the adjuvant may be a bacterial toxin selected from the group consisting of cholera toxin (CT) , E.
  • the adjuvant may also be a bacterial toxin selected from the group consisting of native cholera toxin subunit B (CTB) , Arg- 7-Lys CT mutant, Arg-192-Gly LT mutant, Arg-9-Lys PT mutant, Glu-129-Gly PT mutant, Ser-63-Lys LT mutant, Ala-69-Gly LT mutant, GIu-110-Asp LT mutant, and GIu-112 -Asp LT mutant.
  • CTB native cholera toxin subunit B
  • Arg- 7-Lys CT mutant Arg-192-Gly LT mutant
  • Arg-9-Lys PT mutant Glu-129-Gly PT mutant
  • Ser-63-Lys LT mutant Ala-69-Gly LT mutant, GIu-110-Asp LT mutant, and GIu-112 -Asp LT mutant.
  • the adjuvant may also be a bacterial monophosphoryl
  • the vaccine compositions described above may further comprise an additional Chlamydia protein that enhances an immune response to the polypeptide of the composition.
  • the vaccine composition described above may comprise fusion proteins with PaL and/or MOMP, wherein the PaL or MOMP sequence is fused to a heterologous polypeptide having adjuvant activity.
  • the heterologous polypeptide having adjuvant activity may be suitable as an adjuvant for parenteral administration, or for mucosal administration.
  • the heterologous polypeptide may be subunit B of cholera toxin (CTB) or subunit B of E. coli heat-labile toxin (LTB) .
  • the heterologous polypeptide in the fusions may also be a strong T-cell epitope and/or a strong B-cell epitope including those from hepatitis B virus core antigen.
  • the vaccine composition comprising a vaccine vector as described above, wherein a nucleic acid encoding the polypeptide is operably linked to a promoter functional in a mammalian cell .
  • the vaccine vector or the composition may further comprise another nucleic acid encoding an additional polypeptide which enhances the immune response to the polypeptide.
  • the promoter includes viral promoters such as cytomegalovirus (CMV) promoter.
  • the vaccine vector above which is unable to replicate in mammalian cells and unable to integrate substantially in a mammalian genome.
  • the vaccine compositions described above may further comprise nucleic acid encoding a polypeptide, or further comprise the polypeptide, wherein the polypeptide has at least 80% amino acid sequence identity to SEQ ID NO. 8 and comprises any combination of B-cell or T-cell epitope in SEQ ID NO . 8.
  • a method for treating or preventing a Chlamydia infection comprising the step of administering to a subject the vaccine composition as described above.
  • the method may further comprise the step of administering to the subject an antibiotic, an antacid, sucralfate, a cytokine immunomodulator or a combination thereof.
  • the antibiotic includes a macrolide, a tetracycline, or a derivative thereof.
  • the antibiotic includes azithromycin or doxicyclin, and wherein the immunomodulator is interleukin-2 (IL-2) , interleukin-12 (IL-12) , or a steroid.
  • IL-2 interleukin-2
  • IL-12 interleukin-12
  • the methods described above may further comprise administering a nucleic acid encoding a polypeptide, or administering the polypeptide, wherein the polypeptide has at least 80% amino acid sequence identity to SEQ ID NO. 8 and comprises any combination of B-cell or T-cell epitope in SEQ ID NO. 8.
  • a method for treating or preventing a Chlamydia infection comprising the step of administering to a subject the vaccine compositions as defined above in a prime-boost strategy.
  • a vaccination kit comprising the vaccine composition as described above and instructions for its use in vaccinating a subject against Chlamydia infection.
  • the kit may further comprise at least one compound selected from the group consisting of an antibiotic, an antacid, sucralfate, a cytokine immunomodulator, and instructions for using the composition and compound in vaccinating a subject against Chlamydia infection.
  • a vaccination kit comprising: (i) a vaccine composition comprising a polypeptide in unit dosage form, wherein the polypeptide is PaL-based or MOMP-based as defined above; and (ii) a vaccine vector comprising a nucleic acid encoding the polypeptide is PaL-based or MOMP-based as defined above, operably linked to a promoter functional in a mammalian cell; for simultaneous, separate or sequential administration.
  • a vaccination kit comprising at least one container of a vaccine composition comprising a polypeptide in unit dosage form, wherein the polypeptide is PaL-based or MOMP-based as defined above; and optionally at least one container of a vaccine vector comprising a nucleic acid encoding the PaL-based or MOMP-based polypeptide as defined above, operably linked to a promoter functional in a mammalian cell, and instructions for using the polypeptide and optional vector in vaccinating a subject
  • the vaccine kit as described above may further comprise nucleic acid encoding a polypeptide, or further comprising the polypeptide, wherein the polypeptide has at least 80% amino acid sequence identity to SEQ ID NO. 8 and comprises any combination of B-cell or T-cell epitope in SEQ ID NO. 8.
  • Figures IA and IB show the nucleotide sequence of PaL (SEQ ID No: 1) and the deduced amino acid sequence of PaL from Chlamydia pneumoniae (SEQ ID No: 2) .
  • Figures 2A, 2B and 2C show the restriction enzyme analysis of the C. pneumoniae PaL gene (SEQ ID N0:l) .
  • FIG 3 shows the construction and elements of plasmid pCABk831 containing the C. pneumoniae PaL gene. Note that "omp P6 precursor" in pCABk831 indicates the PaL sequence.
  • Figure 4 illustrates protection against C. pneumoniae infection by pCABk831 following intranasal DNA immunization.
  • Figure 5 shows a restriction map and insert positions for plasmid pKNE2 (2) PaI-SP SerD that is used to express PaL SerD in bacteria.
  • FIG. 6 shows SDS-PAGE gels in which lysates of E. coli BL21(DE3) cells transformed with pKNE2(2)Pal SerD-SP (which is the same as pKNE2 (2) PaI-SP SerD) were resolved and proteins visualized by staining with coomassie brilliant blue dye (left panel) or by Western blot analysis (right panel) . Protein expression was induced by the addition of 1 mM isopropyl-beta- D-thiogalactopyranoside (IPTG) and is noted by the "+" symbol.
  • IPTG isopropyl-beta- D-thiogalactopyranoside
  • Figure 7 shows how the plasmid pJL6 expression vector containing the gene for MOMP SerD was constructed by inserting the sequence for MOMP SerD into plasmid pET15b(+) .
  • Figure 8 shows the deduced amino acid sequence of MOMP protein (SEQ ID NO: 8) expressed in E. coli BL21 (DE3) cells which were transformed with plasmid pJL6.
  • Figure 9A shows the full-length amino acid sequences of PaL from C. trachomatis SerD (top, SEQ ID N0:5), C. trachomatis MoPn (SEQ ID NO : 7 , identical to C. muridarum, middle), and C. pneumoniae (serovars CWL029 and AR39, SEQ ID NO : 2 , bottom) . Underlined portions of the sequences indicate the N-terminal gram-negative secretion sequence.
  • Figure 9B shows alignments of the PaL amino sequences with their N-terminal gram-negative secretion sequences cleaved off.
  • Figure 10 shows the inclusion forming units (IFU) of C. trachomatis MoPn elementary bodies (EB) per lung in mice challenged intra-nasally with C. trachomatis MoPn following immunization with the indicated substances.
  • IFU inclusion forming units
  • Figure 11 shows the inclusion forming units (IFU) of C. trachomatis MoPn per vaginal wash in mice challenged intra- vaginally with C. trachomatis MoPn following immunization with the indicated substances.
  • IFU inclusion forming units
  • Figure 12 shows the inclusion forming units (IFU) of C. trachomatis SerD per vaginal wash in mice challenged intra- vaginally with C. trachomatis SerD following immunization with the indicated substances.
  • IFU inclusion forming units
  • Open reading frames encoding the peptidoglycan-associated lipoprotein (PaL) from Chlamydia pneumoniae (SEQ ID NOs 1 and 2) and from C. trachomatis (SEQ ID NOs 5, 6 and 7) are able to confer immune protection against Chlamydia infection.
  • Chlamydia MOMP able to confer immune protection against Chlamydia infection.
  • a vaccine combination using both PaL and MOMP is effective.
  • PaL and MOMP can be used together, or separately in the vaccination procedure.
  • the MOMP sequence demonstrated here is from C. trachomatis serovar D.
  • the PaL sequence useful in the vaccines described herein may be with or without the gram negative signal .
  • the invention as described here includes DNA and/or polypeptide sequences based on the PaL and/or MOMP sequences and their variants as described herein.
  • the variant sequences are described in relation to a reference sequence.
  • the reference sequences are Chlamydia reference sequences and include PaL sequences (amino acid SEQ ID NOS. 2, 5, 6, 7) and MOMP sequences (SEQ ID NO . 8) , including any PaL or MOMP sequences from other variants which are known in the art but which it is not necessary to describe specifically here.
  • isolated polynucleotide is defined as a polynucleotide removed from the environment in which it naturally occurs.
  • a naturally-occurring DNA molecule present in the genome of a living bacteria or as part of a gene bank is not isolated, but the same molecule separated from the remaining part of the bacterial genome, as a result of, e.g., a cloning event (amplification), is isolated.
  • an isolated DNA molecule is free from DNA regions [e.g., coding regions) with which it is immediately contiguous at the 5' or 3' end, in the naturally occurring genome.
  • Such isolated polynucleotides may be part of a vector or a composition and still be defined as isolated in that such a vector or composition is not part of the natural environment of such polynucleotide.
  • polypeptides used in this invention are substantially purified.
  • a "substantially purified polypeptide” as used herein is defined as a polypeptide that is separated from the environment in which it naturally occurs and/or that is free of the majority of the polypeptides that are present in the environment in which it was synthesized.
  • a substantially purified polypeptide is free from cytoplasmic polypeptides found in the host cell in which it was synthesized.
  • the polypeptides useful in the invention may be purified from a natural source, i.e., a Chlamydia strain, or produced by recombinant means .
  • the polynucleotide used in the vaccines as described herein is either RNA or DNA (cDNA, genomic DNA, or synthetic DNA) , or modifications, variants, homologs or fragments based on the PaL sequence .
  • a sequence that encodes the PaL or MOMP amino acid sequences is (a) a coding sequence, (b) a ribonucleotide sequence derived from transcription of (a) , or (c) a coding sequence which uses the redundancy or degeneracy of the genetic code to encode the same polypeptides.
  • polypeptide or “protein” is meant any chain of amino acids, regardless of length or post-translational modification ⁇ e.g. , glycosylation or phosphorylation) . Both terms are used interchangeably.
  • Polypeptides used in the vaccine, or polynucleotides encoding the polypeptides may comprise or encode amino acid sequences which are variants or fragments of the reference sequence.
  • a variant amino acid sequence encompasses homologs and serotypic variants, or may contain deletions or insertions.
  • a variant sequence may differ from the reference sequence by one or more conservative amino acid substitutions.
  • the variant should retain inherent characteristics of the PaL antigen or the MOMP antigen; such characteristics include immunogenicity, i.e. the ability to elicit an immune response, and/or immunoprotection, i.e. the ability to elicit an immunoprotective response.
  • such a variant sequence is at least 75%, more preferably 80%, and most preferably 90% identical to the reference sequence.
  • Variant amino acid sequences include sequences that are identical or substantially identical to the reference sequence.
  • amino acid sequence substantially identical is meant a sequence that is at least 90%, 95%, 97%, or 99% identical to an amino acid sequence of reference.
  • the variant sequence differs from the sequence of reference by a majority of conservative amino acid substitutions.
  • the variant sequences or fragments to be used in the vaccines described herein retain the ability to elicit an immunoprotective response to Chlamydia, e.g. a C. pneumoniae or C. trachomatis infection.
  • polypeptides comprising or having a reference SEQ ID NO., its variants and fragments which confer immunoprotection against Chlamydia, are herein referred to as immunoprotective antigens, or more explicitly as Chlamydia PaL- based or MOMP-based immunoprotective antigens.
  • amino acids having uncharged polar side chains such as asparagine, glutamine, serine, threonine, and tyrosine
  • amino acids having basic side chains such as lysine, arginine, and histidine
  • amino acids having acidic side chains such as aspartic acid and glutamic acid
  • amino acids having nonpolar side chains such as glycine, alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan, and cysteine.
  • variant polynucleotide sequences are defined in a similar way to variant amino acid sequences.
  • a variant DNA sequence is one that is at least 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 87%, 90%, 93%, 96%, or 99% identical to the nucleotide sequence encoding the reference PaL or MOMP amino acid sequence.
  • Variation among sequences may be measured using algorithms for optimal alignment of sequences for comparisons of identity.
  • the computerised implementations of these algorithms include GAP, BESTFIT, FASTA and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, WI 53705; and the BLAST algorithm described in Altschul et al . , 1990, J " . MoI. Biol. 215:403-10 using the published default settings.
  • Software for performing BLAST analysis may be available through the National Center for Biotechnology Information.
  • a vaccine against Chlamydia may include partial sequences of PaL or MOMP sequences, or DNA encoding such partial sequences.
  • the antigen fragments preferably are at least 12 amino acids in length. Longer fragments may be at least 15, 20, 25, 30, 35,
  • Useful polypeptide variants and fragments may be designed using computer-assisted analysis of amino acid sequences. This would identify probable surface-exposed, antigenic regions (Hughes et al. 1992. Infect. Immun. 60(9) :3497). Analysis of 6 amino acid sequences contained in the Chlamydia sequences, based on the product of flexibility and hydrophobicity propensities using the program SEQSEE (Wishart et al . 1994. Comput Appl Biosci .
  • Epitopes which induce a protective T cell-dependent immune response are usually present throughout the length of a polypeptide. However, some epitopes may be masked by secondary and tertiary structures. To reveal such masked epitopes large internal deletions may be created to remove much of the original protein structure and expose the masked epitopes. Such internal deletions sometimes have the additional advantage of removing immunodominant regions of high variability among strains .
  • Polynucleotides encoding polypeptide fragments and polypeptides having large internal deletions may be constructed using standard methods including standard PCR, inverse PCR, restriction enzyme treatment of cloned DNA molecules, site directed mutagenesis (reviewed in Lu 2005. Trends Biotech. 23 (4) : 199-207) . Components for these methods and instructions for their use are readily available from various commercial sources . Useful variants and fragments that do not occur naturally can be designed using known methods for identifying regions of an antigen that are likely to tolerate amino acid sequence changes and/or deletions. As an example, homologs from different species are compared; conserved sequences are identified. The more divergent sequences are the most likely to tolerate sequence changes .
  • sequences may be analyzed using, as an example, the BLAST homology searching algorithm of Altschul et al . 1997. Nucleic Acids Res. 25:3389-3402.
  • sequences are modified such that they become more reactive to T- and/or B-cells, based on computer-assisted analysis of probable T- or B-cell epitopes.
  • Yet another alternative is to mutate a particular amino acid residue or sequence within the polypeptide in vitro, then screen the mutant polypeptides for their ability to prevent or treat Chlamydia infection.
  • the antigenic polypeptide or fragment may be modified or treated to enhance its immunogenicity in the target animal, in whom the antigen is intended to confer protection against Chlamydia.
  • modifications or treatments include amino acid substitutions with an amino acid derivative such as 3- methyhistidine, 4-hydroxyproline, 5-hydroxylysine etc., as well as modifications or deletions which are carried out after preparation of the antigen such as the modification of free amino, carboxyl or hydroxyl side groups of the amino acids.
  • a particular variant or fragment of a Chlamydia reference sequence is useful in the prevention or treatment of Chlamydia infection may be determined by: (i) immunizing an animal in a disease model with the test variant or fragment;
  • Conferring protection is meant that there is a reduction in severity of any of the effects of Chlamydia infection, in comparison with a control animal which was not immunized with the test variant or fragment.
  • the 6OkDa cysteine rich membrane protein contains a sequence cross-reactive with the murine alpha-myosin heavy chain epitope M7A-alpha, an epitope conserved in humans (Bachmaier et al . , Science (1999) 283:1335).
  • This cross- reactivity is proposed to contribute to the development of cardiovascular disease, so it may be beneficial to remove this epitope, and any other epitopes cross-reactive with human antigens, from the antigen for use as a vaccine.
  • the immunoprotective antigens as described herein may therefore be modified to delete or substitute residues of the epitope as to improve the efficacy and safety of the vaccine.
  • a similar approach may be appropriate for any protective antigen found to have unwanted homologies or cross-reactivities with human antigens.
  • a vaccine against Chlamydia may also include or encode fusion polypeptides comprising PaL and/or MOMP sequence or their • variants and fragments.
  • a fusion polypeptide is one that contains the polypeptide which confers immunoprotection, fused at the N- or C-terminal end to any other polypeptide such as another immunoprotective antigen, a signal peptide or a peptide tail .
  • the "other polypeptide” is commonly referred to in this context as a heterologous polypeptide; i.e. a sequence which is different from a reference sequence.
  • an antigen may be both a fusion polypeptide and a variant of PaL or MOMP.
  • a simple way to obtain such a fusion polypeptide is by translation of an in-frame fusion of the polynucleotide sequences, i.e., a hybrid gene.
  • the hybrid gene encoding the fusion polypeptide is inserted into an expression vector which is used to transform or transfect a host cell.
  • the polynucleotide sequence encoding the immunoprotective antigen is inserted into an expression vector in which the polynucleotide encoding the peptide tail is already present.
  • Such vectors and instructions for their use are commercially available, e.g.
  • the peptide tail is a maltose binding protein, the glutathione-S-transferase system of Pharmacia, or the His-Tag system available from Novagen.
  • a fusion polypeptide is one where the polypeptide or variant or fragment that confers immunoprotection is fused to a polypeptide having adjuvant activity, such as subunit B of either cholera toxin or E. coli heat-labile toxin.
  • a polypeptide having adjuvant activity such as subunit B of either cholera toxin or E. coli heat-labile toxin.
  • Another advantageous fusion is one where the polypeptide, variant or fragment is fused to a strong T- cell epitope or B-cell epitope.
  • Such an epitope may be one known in the art (e.g. the Hepatitis B virus core antigen, Millich et al . 1987. Nature. 329:547-549), or one which has been identified in the immunoprotective polypeptide based on computer-assisted analysis of probable T- or B-cell epitopes.
  • a fusion polypeptide comprising T- or B-cell epitopes from PaL and/or MOMP where the epitopes are derived from different regions within PaL or MOMP, possibly from PaL or MOMP homologs such that they constitute a fusion of epitopes from different Chlamydia serotypic variants and/or strains and/or species.
  • Such a fusion is effective in the prevention and treatment of Chlamydia infection since it optimizes the T- and B-cell response to the overall polypeptide.
  • the immunoprotective polypeptide is fused to the N-, or preferably, to the C-terminal end of the polypeptide having adjuvant activity or the T- or B-cell epitope.
  • an immunoprotective fragment is inserted internally within the amino acid sequence of the polypeptide having adjuvant activity.
  • the T- or B-cell epitope may also be inserted internally within the amino acid sequence of the immunoprotective polypeptide.
  • Polynucleotides encoding immunoprotective antigens can encode a precursor or a mature form of the corresponding antigen.
  • the signal peptide is either homologous or heterologous.
  • the antigen would include the leader residues in PaL or MOMP.
  • the antigen lacks these residues and a heterologous leader sequence such as the leader sequence of the tissue-type plasminogen factor (tPA) may be used.
  • tPA tissue-type plasminogen factor
  • the antigen lacks the signal peptide.
  • the vaccines as described herein may be a DNA vaccine or a protein vaccine.
  • DNA vaccines there are two major routes, either using a viral or bacterial host as a polynucleotide delivery vehicle (live vaccine vector) or administering the polynucleotide in a free form, e.g. , inserted into a plasmid.
  • DNA vaccines include a vaccine vector such as a poxvirus, containing a DNA encoding a PaL-based or MOMP-based immunoprotective antigen, placed under the control of elements required for expression.
  • the vaccine may also comprise a vaccine vector encoding and capable of expressing a PaL-based or MOMP-basedimmunoprotective antigen in a therapeutically or prophylactically effective amount, together with a diluent or carrier.
  • the vaccines are useful in a method for inducing an immune response against Chlamydia in a mammal, which involves administering to the mammal an immunogenically effective amount of the vaccine vector to elicit a protective or therapeutic immune response to Chlamydia.
  • Mammals include humans as well as animals since the method can be used in veterinary applications for treating or preventing Chlamydia infection of e.g., cats or birds.
  • Methods for preventing and/or treating a Chlamydia infection also include administering a prophylactic or therapeutic amount of the vaccine vector to an infected individual .
  • Chlamydia infections include those caused by C. trachomatis, C. psittaci, C. pneumonia, C. pecorum.
  • the vaccine vector may be used in the preparation of a medicament for preventing and/or treating Chlamydia infection.
  • Preferred vaccine vectors include those unable to replicate or integrate substantially in the target vaccine recipient. Such vectors include those whose sequences are free of regions of substantial identity to the genome of the vaccine recipient, as to minimize the risk of host-vector recombination.
  • One way to do this is to use promoters not derived from the recipient genome to drive expression of the immunoprotective antigen.
  • the promoter is preferably non-mammalian derived though it should be able to function in mammalian cells, e.g. a viral promoter.
  • a vaccine vector may express one or several immunoprotective antigens.
  • the vaccine vector may express additionally a cytokine, such as interleukin-2 (IL-2) or interleukin-12 (IL- 12), that enhances the immune response (adjuvant effect) .
  • IL-2 interleukin-2
  • IL-12 interleukin-12
  • a vaccine composition may comprise several vaccine vectors, each of them capable of expressing an immunoprotective antigen, in particular PaL and MOMP.
  • the composition may also comprise a vaccine vector capable of expressing an additional Chlamydia antigen, optionally together with a cytokine such as IL-2 or IL-12.
  • the additional Chlamydia antigen and cytokine maybe encoded by the same vaccine vector that encodes the immunoprotective antigen, or they may be encoded on separate vector (s) . They may also be present as polypeptides in the same or a different vaccine composition.
  • a vaccine vector encoding an immunoprotective antigen may be used in vaccination methods for treating or preventing infection.
  • the vaccine vector can be administered by any conventional route, particularly to a mucosal ⁇ e.g., ocular, intranasal, oral, gastric, pulmonary, intestinal, rectal, vaginal, or urinary tract) surface or via the parenteral ⁇ e.g., subcutaneous, intradermal, intramuscular, intravenous, or intraperitoneal) route. Preferred routes depend upon the choice of the vaccine vector. Treatment may be effected in a single dose or repeated at intervals.
  • a vaccine vector encoding an immunoprotective antigen includes live vaccine vectors.
  • Live vaccine vectors available in the art include viral vectors such as adenoviruses and poxviruses as well as bacterial vectors, e.g., Shigella, Salmonella, Vibrio cholerae, Lactobacillus, Bacille bilie de Calmette- Guerin (BCG) , and Streptococcus .
  • adenovirus vector An example of an adenovirus vector, as well as a method for constructing an adenovirus vector capable of expressing a DNA molecule of the invention, is described in U.S. Patent No. 4,920,209.
  • Poxvirus vectors include vaccinia and canary pox virus, described in U.S. Patent No. 4,722,848 and U.S. Patent No. 5,364,773, respectively. Also see, e.g., Tartaglia et al . 1992. Virology. 188:217 for a description of a vaccinia virus vector and Taylor et al. 1995. Vaccine. 13:539 for a reference of a canary pox.
  • Poxvirus vectors capable of expressing an immunoprotective antigen may be obtained by homologous recombination as described in Kieny et al . 1984. Nature. 312:163, so that the polynucleotide encoding the antigen is inserted in the viral genome under appropriate conditions for expression in mammalian cells.
  • the dose of vaccine viral vector for therapeutic or prophylactic use, can be of from about IxIO 4 to about IxIO 11 , advantageously from about IxIO 7 to about IxIO 10 , preferably of from about IxIO 7 to about IxIO 9 plaque-forming units per kilogram.
  • viral vectors are administered parenterally; for example, in 3 doses, 4 weeks apart. It is preferable to avoid adding a chemical adjuvant to a composition containing a viral vector and thereby minimizing the immune response to the viral vector itself.
  • Non-toxioogenic Vibrio cholerae mutant strains that are useful as a live oral vaccine are known. Mekalanos et al . 1983.
  • An effective vaccine dose of a Vibrio cholerae strain capable of expressing an immunoprotective antigen contains about IxIO 5 to about IxIO 9 , preferably about IxIO 6 to about IxIO 8 , viable bacteria in a volume appropriate for the selected route of administration.
  • Preferred routes of administration include all mucosal routes; most preferably, these vectors are administered intranasally or orally.
  • Attenuated Salmonella typhimurium strains genetically engineered for recombinant expression of heterologous antigens or not, and their use as oral vaccines are described in Nakayama et al . 1988. Bio/Technology. 6:693 and WO92/11361.
  • Preferred routes of administration include all mucosal routes; most preferably, these vectors are administered intranasally or orally.
  • compositions comprising the vaccine bacterial vector may further contain an adjuvant. Suitable adjuvants are known to those skilled in the art. Preferred adjuvants are selected as provided herein.
  • a vaccine vector includes an expression cassette containing a DNA encoding an immunoprotective antigen placed under the control of the elements required for expression, in particular under the control of an appropriate promoter.
  • the vaccine vector may be an expression vector containing the expression cassette.
  • a procaryotic or eucaryotic cell may be transformed or transfected with an expression cassette and/or vector encoding the immunoprotective antigen.
  • the immunoprotective antigen may be produced by culturing a procaryotic or eucaryotic cell transformed or transfected with the expression cassette and/or vector under conditions that allow expression of the DNA, and recovering the encoded antigen from the cell culture.
  • a recombinant expression system for producing an immunoprotective antigen or for producing quantities of the vaccine vector may use procaryotic or eucaryotic hosts.
  • Eucaryotic hosts include yeast cells (e.g. , Saccharomyces cerevisiae or Pichia pastoris) , mammalian cells (e.g., COSl, NIH3T3, or JEG3 cells), arthropod cells (e.g., Spodoptera frugiperda (SF9) cells), and plant cells.
  • a preferred expression system is a procaryotic host such as E. coli.
  • Bacterial and eucaryotic cells are available from a number of different sources including commercial sources to those skilled in the art, e.g., the American Type Culture Collection (ATCC; Rockville, Maryland) .
  • the choice of the expression system depends on the features desired for the expressed antigen. For example, it may be useful to produce the antigen in a particular lipidated form or any other form.
  • the host In selecting an expression selection, the host should be chosen that is compatible with the vector which is to exist and possibly replicate in it. Considerations are made with respect to the vector copy number, the ability to control the copy number, and expression of other proteins such as antibiotic resistance.
  • an expression control sequence a number of variables are considered. Among the important variables are the relative strength of the sequence (e.g. the ability to drive expression under various conditions) , the ability to control the sequence's function, compatibility between the polynucleotide to be expressed and the control sequence ⁇ e.g. secondary structures are considered to avoid hairpin structures which prevent efficient transcription) .
  • unicellular hosts are selected which are compatible with the selected vector, tolerant of any possible toxic effects of the expressed product, able to secrete the expressed product efficiently if such is desired, to be able to express the product in the desired conformation, to be easily scaled up, and to which ease of purification of the final antigen or vector product.
  • an expression cassette includes a promoter that is functional in the selected host system and can be constitutive or inducible; a ribosome binding site; a start codon (ATG) if necessary; a region encoding a signal peptide, e.g., a lipidation signal peptide; DNA encoding the immunoprotective antigen; a stop codon; and optionally a 3' terminal region (translation and/or transcription terminator) .
  • the signal peptide encoding region is adjacent to the polynucleotide of the invention and placed in proper reading frame.
  • the signal peptide-encoding region is homologous or heterologous to the DNA encoding the mature antigen and is compatible with the secretion apparatus of the host used for expression.
  • the open reading frame constituted by the DNA encoding the antigen, solely or together with the signal peptide, is placed under the control of the promoter so that transcription and translation occur in the host system.
  • Promoters used to drive expression of the immunoprotective antigen is usually a heterologous promoter, which in this context means that the promoter is other than the PaL gene promoter. Promoters and signal peptide encoding regions are widely known and available to those skilled in the art. These include, for example, the promoter of Salmonella typhimurium and its derivatives, that is inducible by arabinose (promoter araB) and is functional in Gram-negative bacteria such as E. coli as described in U.S. Patent No. 5,028,530 and in Cagnon et al. 1991. Protein Engineering. 4(7):843; the promoter of the gene of bacteriophage T7 encoding RNA polymerase, that is functional in a number of E.
  • Promoters suitable for expression in a mammalian cell include those that function constitutively, ubiquitously or tissue- specifically.
  • non-tissue specific promoters include promoters of viral origin.
  • viral promoters include Mouse Mammary Tumor Virus (MMTV) promoter, Human Immunodeficiency Virus Long Terminal Repeat (HIV LTR) promoter, Moloney virus, avian leukosis virus (ALV), Cytomegalovirus
  • CMV immediate early promoter/enhancer
  • RSV Rous Sarcoma Virus
  • AAV adeno-associated virus
  • EBV Epstein Barr Virus
  • Compatibility of viral promoters with certain antigens is a consideration since their combination may affect expression levels. It is possible to use synthetic promoter/enhancers to optimize expression (see US patent publication 2004/0171573) .
  • tissue-specific promoter is the desmin promoter which drives expression in muscle cells (Li et al . 1989. Gene. 78:243; Li & Paulin 1991. J. Biol. Chem. 266:6562 and Li & Paulin 1993. J. Biol. Chem. 268:10403).
  • Other examples include artificial promoters such as a synthetic muscle specific promoter and a chimeric muscle-specific/CMV promoter (Li et al . 1999. Nat. Biotechnol . 17:241-245; Hagstrom et al . 2000. Blood 95:2536-2542) .
  • the expression cassette is typically part of an expression vector, which is selected for its compatibility with the chosen expression system.
  • Expression vectors ⁇ e.g. , plasmids or viral vectors
  • expression vectors can be chosen, for example, from those described in
  • the immunoprotective antigen Upon expression of the DNA, the immunoprotective antigen is produced and may remain in the intracellular compartment, or may be secreted/excreted in the extracellular medium or in the periplasmic space, or may be embedded in the cellular membrane.
  • the antigen may be recovered in a substantially purified form from the cell extract or from the supernatant after centrifugation of the recombinant cell culture.
  • the antigen is purified by antibody-based affinity purification or by other well-known methods that can be readily adapted, such as fusion of the polynucleotide encoding the antigen to a small affinity binding domain.
  • Vaccines containing vectors encoding immunoprotective antigens may optionally include at least one additional polynucleotide encoding another Chlamydia antigen such as urease subunit A, B, or both, or a fragment or derivative thereof.
  • the vaccine may also contain an additional polynucleotide encoding a cytokine, such as interleukin-2 (IL-2) or interleukin-12 (IL-12) so that the immune response is enhanced.
  • IL-2 interleukin-2
  • IL-12 interleukin-12
  • Standard techniques of molecular biology for preparing and purifying polynucleotides are used in the preparation of polynucleotide vaccines.
  • One method utililizes the polynucleotide in a naked form e.g. an expression plasmid, free of any delivery vehicles.
  • a polynucleotide is simply diluted in a physiologically acceptable solution such as sterile saline or sterile buffered saline, with or without a carrier.
  • the carrier preferably is isotonic, hypotonic, or weakly hypertonic, and has a relatively low ionic strength, such as provided by a sucrose solution, e.g., a solution containing 20% sucrose.
  • An alternative method utilizes the polynucleotide or vaccine vector in association with agents that assist in cellular uptake.
  • agents are (i) chemicals that modify cellular permeability, such as bupivacaine (see, e.g., W094/16737) , (ii) liposomes for encapsulation of the polynucleotide, or (iii) cationic lipids or silica, gold, or tungsten microparticles which associate themselves with polynucleotides. Such agents may also act as adjuvants.
  • Liposomes are well-known in the art. See, e.g., Liposomes: A Practical Approach, RPC New Ed, IRL press 1990, for a detailed description of methods for making liposomes. Liposomes are useful for delivering a large range of products, including polynucleotides and polypeptides.
  • Cationic lipids are also known in the art and are commonly used for gene delivery.
  • Such lipids include LipofectinTM also known as DOTMA (N- [1- (2 , 3 -dioleyloxy) propyl] -N,N,N-trimethylammonium chloride), DOTAP (1, 2-bis (oleyloxy) -3-
  • Cationic lipids for gene delivery are preferably used in association with a neutral lipid such as DOPE (dioleyl phosphatidylethanolamine) , as described in WO90/11092 as an example.
  • DOPE dioleyl phosphatidylethanolamine
  • Formulation containing cationic liposomes may optionally contain other transfection-facilitating compounds.
  • transfection-facilitating compounds include spermine derivatives useful for facilitating the transport of DNA through the nuclear membrane (see, for example, WO93/18759) and membrane-permeabilizing compounds such as GALA, Gramicidine S, and cationic bile salts (see, for example, WO93/19768) .
  • Gold or tungsten microparticles are used for gene delivery, as described in WO91/00359, WO93/17706, and Tang et al . 1992. Nature 356:152.
  • the microparticle-coated polynucleotide is injected via intradermal or intraepidermal routes using a needleless injection device ("gene gun"), such as those described in U.S. Patent No. 4,945,050, U.S. Patent No. 5,015,580, and WO94/24263.
  • the amount of DNA to be used in a vaccine recipient depends, e.g. , on the strength of the promoter used in the DNA construct, the immunogenic!ty of the expressed antigen, the condition of the mammal intended for administration (e.g. , the weight, age, and general health of the mammal), the mode of administration, and the type of formulation.
  • a therapeutically or prophylactically effective dose from about 1 ⁇ g to about 1 mg, preferably, from about 10 ⁇ g to about 800 ⁇ g and, more preferably, from about 25 ⁇ g to about 250 ⁇ g, can be administered to human adults.
  • the administration can be achieved in a single dose or repeated at intervals.
  • DNA vaccines may be administered via a mucosal surface, e.g. , an ocular, intranasal, pulmonary, oral, intestinal, rectal, vaginal, and urinary tract surface; or via a parenteral route, e.g., by an intravenous, subcutaneous, intraperitoneal, intradermal, intraepidermal, or intramuscular route.
  • a mucosal surface e.g. , an ocular, intranasal, pulmonary, oral, intestinal, rectal, vaginal, and urinary tract surface
  • a parenteral route e.g., by an intravenous, subcutaneous, intraperitoneal, intradermal, intraepidermal, or intramuscular route.
  • the choice of administration route depends on the formulation that is selected.
  • a DNA vaccine formulated in association with bupivacaine is advantageously administered into muscles.
  • the formulation can be advantageously injected via intravenous, intranasal (aerosolization) , intramuscular, intradermal, and subcutaneous routes .
  • a DNA vaccine in a naked form can advantageously be administered via the intramuscular, intradermal, or subcutaneous routes .
  • a DNA vaccine can also contain an adjuvant. If so, a systemic adjuvant that does not require concomitant administration in order to exhibit an adjuvant effect is preferable such as, e.g., QS21, which is described in U.S. Patent No. 5,057,546.
  • the vaccines as described herein include protein vaccines .
  • a protein vaccine may comprise an immunoprotective antigen as described herein, together with a diluent or carrier.
  • An immunoprotective antigen for use in a vaccine may comprise the trachomatis PaL sequence (SEQ ID No:2), its variants, fragments, fusions, mature and precursor forms as described in connection with DNA vaccines.
  • the vaccine may be in the form of a pharmaceutical composition containing a therapeutically or prophylactically effective amount of the immunoprotective antigen.
  • the vaccine may be used in a method for inducing an immune response against Chlamydia in a mammal , by administering to the mammal an immunogenically effective amount of the immunoprotective antigen to elicit a protective immune response to Chlamydia.
  • Mammals include humans as well as animals since the method can be used in veterinary applications for treating or preventing Chlamydia infection of e.g. , cats or birds.
  • the vaccines can be used to prevent and/or treat a
  • Chlamydia infection in an infected individual Chlamydia infections include those caused by e.g., C. trachomatis . C. psittaci, C. pneumoniae, or C. pecorum. Additionally, the immunoprotective antigens may be used in the preparation of a medicament for preventing and/or treating Chlamydia infection.
  • Protein vaccines may be administered by conventional routes known the vaccine field, in particular to a mucosal (e.g., ocular, intranasal, pulmonary, oral, gastric, intestinal, rectal, vaginal, or urinary tract) surface or via the parenteral (e.g., subcutaneous, intradermal, intramuscular, intravenous, or intraperitoneal) route.
  • a mucosal e.g., ocular, intranasal, pulmonary, oral, gastric, intestinal, rectal, vaginal, or urinary tract
  • parenteral e.g., subcutaneous, intradermal, intramuscular, intravenous, or intraperitoneal
  • the choice of administration route depends upon a number of parameters, such as the adjuvant associated with the antigen. If a mucosal adjuvant is used, the intranasal or oral route is preferred. If a lipid formulation or an aluminum compound is used, the parenteral route is preferred with the sub-cutaneous or intramuscular
  • a protein vaccine may contain one or several immunoprotective antigens and optionally contains at least one additional polypeptide derived from Chlamydia.
  • the vaccine may also contain a cytokine, such as interleukin-2 (IL-2) or interleukin-12 (IL-12) , that enhances the immune response (adjuvant effect) .
  • the vaccine may also include at least one additional Chlamydia antigen such as urease subunit A, B, or both, or a fragment or derivative thereof.
  • the immunoprotective antigen may be formulated into or with liposomes, preferably neutral or anionic liposomes, microspheres, ISCOMS, or virus-like- particles (VLPs) to facilitate delivery and/or enhance the immune response.
  • liposomes preferably neutral or anionic liposomes, microspheres, ISCOMS, or virus-like- particles (VLPs) to facilitate delivery and/or enhance the immune response.
  • VLPs virus-like- particles
  • Adjuvants other than liposomes and the like are also used and are known in the art.
  • Adjuvants may protect the antigen from rapid dispersal by sequestering it in a local deposit, or they may contain substances that stimulate the host to secrete factors that are chemotactic for macrophages and other components of the immune system.
  • An appropriate selection can conventionally be made by those skilled in the art, for example, from those described herein.
  • Treatment is achieved in a single dose or repeated as necessary at intervals, as can be determined readily. For example, a priming dose is followed by three booster doses at weekly or monthly intervals.
  • An appropriate dose depends on various parameters including the recipient ⁇ e.g. , adult or infant) , the particular antigen, the route and frequency of administration, the presence / absence or type of adjuvant, and the desired effect ⁇ e.g. , protection and/or treatment) , as can be determined by one skilled in the art.
  • an immunoprotective antigen is administered as a vaccine by a mucosal route in an amount from about 10 ⁇ g to about 500 mg, preferably from about 1 mg to about 200 mg. For the parenteral route, the dose usually does not exceed about 1 mg, preferably about 100 ⁇ g .
  • polynucleotides and polypeptides may be used sequentially as part of a multistep immunization process.
  • a mammal may be initially primed with a vaccine vector of the invention such as a pox virus, e.g., via the parenteral route, and then boosted twice with the immunoprotective antigen encoded by the vaccine vector, e.g., via the mucosal route.
  • liposomes associated with the antigen may also be used for priming, with boosting being carried out mucosally using an antigen in soluble form in combination with a mucosal adjuvant (e.g. , LT) .
  • a mucosal adjuvant e.g. , LT
  • Adjuvants useful in any of the vaccine formulations described above include the following.
  • Adjuvants for parenteral administration include aluminum compounds, such as aluminum hydroxide, aluminum phosphate, and aluminum hydroxy phosphate.
  • the antigen is precipitated with, or adsorbed onto, the aluminum compound according to standard protocols.
  • Other adjuvants such as RIBI (ImmunoChem, Hamilton, MT) , are used in parenteral administration.
  • Adjuvants for mucosal administration include bacterial toxins, e.g., the cholera toxin (CT), the B. coli heat-labile toxin (LT) , the Clostridium difficile toxin A and the pertussis toxin (PT), or combinations, subunits, toxoids, or mutants thereof such as a purified preparation of native cholera toxin subunit B (CTB) . Fragments, homologs, derivatives, and fusions to any of these toxins are also suitable, provided that they retain adjuvant activity. Preferably, a mutant having reduced toxicity is used. Suitable mutants are described, e.g., in
  • WO 95/17211 (Arg-7-Lys CT mutant)
  • WO 96/06627 (Arg-192-Gly LT mutant)
  • WO 95/34323 (Arg-9-Lys and Glu-129-Gly PT mutant)
  • Additional LT mutants that are used in the methods and compositions of the invention include, e.g., Ser-63-Lys, Ala- 69GIy, Glu-110-Asp, and Glu-112-Asp mutants.
  • Other adjuvants such as a bacterial monophosphoryl lipid A (MPLA) of, e.g., E.
  • MPLA bacterial monophosphoryl lipid A
  • coli Salmonella minnesota, Salmonella typhimurium, or Shigella flexneri; saponins, or polylactide glycolide (PLGA) microspheres
  • Adjuvants useful for both mucosal and parenteral administrations include polyphosphazene (WO95/02415) , DC-chol (U.S. Patent No. 5,283,185 and WO96/14831) ; and QS-21 (WO 88/09336) .
  • composition of the invention containing a polynucleotide vaccine vector or immunoprotective antigen may be manufactured in a conventional manner.
  • it may be formulated with a pharmaceutically acceptable diluent or carrier, e.g. , water or a saline solution such as phosphate buffer saline.
  • a diluent or carrier is selected on the basis of the mode and route of administration, and standard pharmaceutical practice. Suitable pharmaceutical carriers or diluents, as well as pharmaceutical necessities for their use in pharmaceutical formulations, are described in Remington' s Pharmaceutical Sciences, a standard reference text in this field and in the USP/NF.
  • Therapeutic or prophylactic efficacy may be evaluated using standard methods in the art, e.g., by measuring induction of a mucosal immune response or induction of protective and/or therapeutic immunity, using, e.g., the C. pneumoniae mouse model .
  • the C. pneumoniae or C. trachomatis strain of the model may be replaced with another Chlamydia strain.
  • the efficacy of antigens from C. pneumoniae is preferably evaluated in a mouse model using C. pneumoniae strain.
  • Cross protection may be determined by evaluating the ability of the antigen to protect an animal against a Chlamydia species different from the species from which the antigen is derived.
  • Protection is determined by comparing the degree of Chlamydia infection to that of a control group. Protection is shown when infection is reduced by comparison to the control group; i.e. there is a reduction in severity of any of the effects of Chlamydia infection, in comparison with a control animal which was not immunized with the test antigen.
  • a Chlamydia vaccine and mucosal adjuvant may be administered in combination with an antibiotic, an antacid, sucralfate, or a combination thereof.
  • antibiotics including, e.g., macrolides, tetracyclines, and derivatives thereof (specific examples of antibiotics that can be used include azithromycin or doxicyclin or immunomodulators such as cytokines or steroids) .
  • compounds containing more than one of the above-listed components coupled together may be used.
  • Compositions for carrying out these methods may include an immunoprotective antigen (s) , an adjuvant, and one or more of the above-listed compounds, in a pharmaceutically acceptable carrier or diluent.
  • Amounts of the above-listed compounds used in the methods and compositions are readily determined by one skilled in the art. Treatment/immunization schedules are also known and readily designed by one skilled in the art.
  • the non- vaccine components can be administered on days 1-14, and the vaccine antigen plus adjuvant can be administered on days 7, 14, 21, and 28.
  • the vaccine vectors and immunoprotective antigens may be formulated in effective amounts with a suitable pharmaceutically acceptable carrier in dosage unit form.
  • a unit dosage form contains the vectors and/or antigens in amounts suitable for their administration depending on the desired route and vaccination schedule.
  • compositions contain supplementary active ingredients (e.g., an antibiotic, an antacid, or sucralfate)
  • supplementary active ingredients e.g., an antibiotic, an antacid, or sucralfate
  • the vaccines described herein may be present in the form of a vaccination kit comprising one or more containers of vaccine vectors and/or immunoprotective antigens in dosage unit form suitable for a particular route of administration (e.g. intravascular, intramuscular, subcutaneous or intraperitoneal injection), together with instructions for following the vaccination method as described herein.
  • the kit could contain a number of sterile ampules, the ampules containing dosages representing a vaccination regimen of an initial immunization plus booster injections.
  • This example illustrates the preparation of plasmid vector pCABk831 containing the C. pneumoniae PaL gene.
  • the omp P6 precursor gene (SEQ ID No:l) was amplified from Chlamydia, pneumoniae genomic DNA by polymerase chain reaction
  • the 5' primer contains a Notl restriction site, a ribosome binding site, an initiation codon and a sequence at the 5' end of the omp P6 precursor coding sequence .
  • the 3 ' primer includes the sequence encoding the C-terminal sequence of the omp P6 precursor gene and a BamHI restriction site. The stop codon was excluded and an additional nucleotide was inserted to obtain an in-frame fusion with the Histidine tag.
  • the PCR fragment was purified using
  • This example illustrates the preparation of the eukaryotic expression vector pCA/Myc-His.
  • Plasmid pcDNA3.1 (-) Myc-His C (Invitrogen) was restricted with Spel and BamHI to remove the CMV promoter and the remaining vector fragment was isolated.
  • the CMV promoter and intron A from plasmid VR-1012 (Vical) was isolated on a Spel / BamHI fragment .
  • the fragments were ligated together to produce plasmid pCA/Myc-His.
  • the Notl/BamHI restricted PCR fragment containing the omp P6 precursor gene (SEQ ID No:l) was ligated into the Notl and BamHI restricted plasmid pCA/Myc-His to produce plasmid pCABk831 ( Figure 3) .
  • the resulting plasmid, pCABk831 was transferred by electroporation into E. coli XL-I blue (Stratagene) which was grown in LB broth containing 50 ⁇ g/ml carbenicillin.
  • the plasmid was isolated by the Endo Free Plasmid Giga KitTM (Qiagen) large scale DNA purification system. DNA concentration was determined by absorbance at 260 nm and the plasmid was verified after gel electrophoresis and ethidium bromide staining by comparison to molecular weight standards. The 5' and 3' ends of the gene were verified by sequencing using a LiCor model 4000 L DNA sequencer and IRD-800 labelled primers .
  • This example illustrates the immunization of mice to achieve protection against an intranasal challenge of C. pneumoniae.
  • mice are susceptible to intranasal infection with different isolates of C. pneumoniae. Strain AR-39 (Grayston et al (1990) Journal of Infectious
  • mice Groups of 7 to 9 week old male Balb/c mice (8 to 10 per group) were immunized intramuscularly (i.m.) plus intranasally (i.n.) with plasmid DNA containing the C. pneumoniae omp P6 precursor gene as described in Examples 1 and 2. Saline or the plasmid vector lacking an inserted Chlamydial gene was given to groups of control animals.
  • Lungs were taken from mice at day 9 post-challenge and immediately homogenised in SPG buffer (7.5% sucrose, 5mM glutamate, 12.5mM phosphate pH7.5) .
  • the homogenate was stored frozen at -70 0 C until assay. Dilutions of the homogenate were assayed for the presence of infectious Chlamydia by inoculation onto monolayers of susceptible cells.
  • the inoculum was centrifuged onto the cells at 3000rpm for 1 hour, then the cells were incubated for three days at 35°C in the presence of l ⁇ g/ml cycloheximide .
  • Figure 4 and Table 1 show that mice immunized i.n. and i.m. with pCABk831 had Chlamydial lung titers less than 39,500 in 5 of 6 cases at day 9 (mean 24,933) whereas the range of values for control mice sham immunized with saline was 13,500 to 178,700 IFU/lung (mean 69,782) at day 9.
  • DNA immunisation per se was not responsible for the observed protective effect since another plasmid DNA construct, pCABkllO ⁇ , failed to protect, with lung titers in immunised mice similar to those obtained for saline-immunized control mice (mean 62,516).
  • pCABkllO6 is identical to pCABk831 except that the nucleotide sequence encoding the putative omp P6 precursor is replaced with a C. pneumoniae nucleotide sequence encoding an unrelated hypothetical protein. Table 1
  • This example illustrates a protocol for producing recombinant PaL protein from E. coli for use in a vaccine.
  • the PaL gene (SEQ ID No : 5 ; C. trachomatis SerD) was amplified from C. trachomatis SerD genomic DNA by polymerase chain reaction (PCR) and cloned into plasmid pET15b(+) containing a His-tag coding sequence. Plasmid DNA was extracted using a QIAprepTM Spin Miniprep Kit (Qiagen) and was amplified with a forward primer (5' GGGAATCCATATGGATTGGGAATGTCACGGT 3'; SEQ ID No: 9) and a reverse primer
  • PaL SerD was induced by the addition of 1 mM isopropyl-beta-D-thiogalactopyranoside (IPTG) to growing cultures of BL21.
  • IPTG isopropyl-beta-D-thiogalactopyranoside
  • the level of PaL SerD expression was examined by resolving bacterial cell lysates on SDS-PAGE gels and visualizing proteins by staining with Coomassie brilliant blue dye or by Western blot analysis. As shown in Figure 6, recombinant PaL SerD protein was expressed at high levels.
  • This example illustrates a protocol for purifying high levels of properly-folded recombinant C. trachomatis SerD major outer membrane protein (MOMP) protein from B. coli for use in a vaccine .
  • MOMP major outer membrane protein
  • the gene encoding C. trachomatis SerD MOMP was amplified by PCR from total DNA harvested from McCoy mouse fibroblast cells infected with C. trachomatis SerD.
  • MOMP PCR product was cloned into plasmid pTrck-CtD to create pTrck-CtD-dS-MOMP and the native N-terminal signal sequence was deleted and three optimized codons present at the start of MOMP in were reverted to the non-optimized sequence by "mutations" encoded in the forward construction primer.
  • Truncated MOMP gene was amplified from pTrcK-CtD-dS-MOMP and the resulting PCR product was restricted with Sail to yield the insert DNA.
  • Plasmid pET-15b was restricted with Ncol , the recessed ends were extended, and then restricted with Xhol .
  • MOMP insert DNA was cloned into the blunted JVcoI site and the Xhol site (Xhol and Sail generate complementary overhangs) of the vector, thereby controlling orientation of the insert in the resulting expression plasmid pJL6 ( Figure 7) .
  • pellets from pJL6-transformed E. coli BL21(DE3) cells expressing MOMP with the deduced amino acid sequence listed in Figure 8 were sonicated and inclusion bodies from the homogenate were sedimented by centrifugation following detergent extraction.
  • the inclusion body preparation was solubilized with urea, and this mixture was loaded onto a Q-type anion exchange column. The column was washed with urea, and retained protein was eluted in a NaCl gradient that also included urea, maintaining the protein in a denatured and soluble state. Eluted fractions containing purified MOMP were pooled and concentrated by diafiltration.
  • the concentrate was mixed with an equal volume of buffer containing the detergent Zwittergent 3-14, and this mixture was applied to a column packed with Superdex 200 size exclusion gel.
  • the material was passed through the column and fractions were collected.
  • a broad peak corresponding to a molecular weight range of 40-500 kDa (based on previous calibration runs) was retained, and in some cases concentrated by diafiltration.
  • the material remained soluble at concentrations exceeding 1 mg/mL.
  • Semi- native SDS-PAGE gels and Western blots showed a series of distinct higher molecular weight bands; this finding, along with the molecular weight range established by size-exlcusion chromatogrphy, suggested that the protein was folded such that it demonstrated the ability to form multimers.
  • Pal protein is expressed by at least three distinct groups of Chlamydiae: C. trachomatis (serovar D) , C. trachomatis MoPn (also known as C. muridarum) , and C. pneumoniae (serovars CWL029 and AR39) .
  • Figure 9A shows the full-length amino acid sequences of PaL from each of these three Chlamydiae.
  • Each of the PaL sequences in Figure 9A have at their N-termini characteristic gram-negative signal sequences that target the nascent protein to the exterior of the cell .
  • the signal sequences can be identified because they conform to a recognized consensus sequence (Juncker et al . , Protein Science (2003) 12 :1652) .
  • Such signal sequences are cleaved from the immature protein prior to its export from the cell. Since mature PaL expressed on the exterior of Chlamydiae lacks the N-terminal signal sequence, the cleaved form of the protein is the more immunologically-relevant form than the full-length form.
  • the relative variability of PaL among different Chlamydiae is reduced by removal of the signal sequence. This may enhance the probability that a vaccine targeted to PaL from a particular species or serovar will cross-react with PaL from a different serovar or species.
  • SerD and PaL MoPn are the most closely-related of the three molecules, with a sequence identity of 96 percent.
  • PaL from C. pneumoniae is more divergent and shares only 69 percent sequence identity with PaL SerD, although approximately one third of the different amino acids are conservative replacements .
  • This example illustrates a protocol for immunization of mice with PaL SerD DNA and protein to achieve protection against an intranasal (i.n.) challenge with C. trachomatis MoPn.
  • Groups of 7- to 9-week old male Balb/c mice (8 to 10 per group) received priming immunizations intramuscularly (i.m.) with plasmid DNA containing an insert coding for PaL SerD.
  • Alternate left and right quadriceps were injected with 100 ⁇ g of DNA in 50 ⁇ l of the adjuvant 3 b- (N- (N 1 ,N 1 -dimethyl aminomethane) -carbamoyl) cholesterol (DC Choi) on three occasions at experimental weeks 0, 3 and 6.
  • i.n. immunization anaesthetized mice were aspirated 50 ⁇ l of DC-Choi containing 5 ⁇ g of recombinant PaL SerD protein.
  • immunized mice were inoculated i.n. with 5 x 10 5 IFU of C. trachomatis MoPn EB in lOO ⁇ l of SPG buffer to test their ability to limit the growth of a sublethal MoPn EB challenge.
  • lungs were taken from mice at day 9 post-challenge and immediately homogenised in SPG buffer (7.5% sucrose, 5 mM glutamate, 12.5 ttiM phosphate, pH 7.5) .
  • SPG buffer 7.5% sucrose, 5 mM glutamate, 12.5 ttiM phosphate, pH 7.5
  • the homogenate was stored frozen at -70 0 C until assay. Dilutions of the homogenate were assayed for the presence of infectious Chlamydia by inoculation onto monolayers of susceptible HeLa cells.
  • the inoculum was centrifuged onto the cells at 3000 rpm for 1 hour, then the cells were incubated for three days at 35 0 C in the presence of 1 ⁇ g/ml cycloheximide . After incubation the monolayers were fixed with formalin and methanol then immunoperoxidase stained for the presence of
  • This example illustrates a protocol for immunization of mice with PaL SerD protein to achieve protection against an intravaginal (IVAG) challenge with C. trachomatis MoPn.
  • mice were administered 2.5 mg of depo provera in a volume of 200 ⁇ l subcutaneously (s.c.) to induce a diestrous-like state.
  • mice were challenged IVAG with 10 4 inclusion forming units (IFU) of C. trachomatis MoPn.
  • IFU inclusion forming units
  • mice were immunized s.c. or i.m with 5 ⁇ g of recombinant PaL SerD protein with Montanide/CpG adjuvant in a total volume of 200 ⁇ l (s.c.) or 100 ⁇ l (i.m.) .
  • Vaginal washes were collected every 3 days until experimental day 148. IVAG Chlamydial shedding was assessed by subjecting the vaginal washes to the assay system described in Example 7.
  • Figure 11 shows the inclusion forming units (IFU) of C. trachomatis MoPn per vaginal wash in mice challenged intra- vaginally with C. trachomatis MoPn following immunization with the indicated substances.
  • IFU inclusion forming units
  • This example illustrates a protocol for immunization of mice with MOMP SerD protein alone or in combination with PaL SerD protein to achieve protection against an intravaginal (IVAG) challenge with C. trachomatis SerD.
  • IVAG intravaginal
  • mice were administered 2.5 mg of depo provera in a volume of 200 ⁇ l subcutaneously (s.c.) to induce a diestrous-like state.
  • mice were immunized s.c. or i.m with 10 ⁇ g of MOMP SerD or 5 ⁇ g of MOMP SerD + 5 ⁇ g PaL SerD formulated in Montanide/CpG adjuvant in a total volume of 200 ⁇ l (s.c.) or 100 ⁇ l (i.m.) .
  • Protein immunizations were repeated on days 26 and 46 as described and on day 48 the mice were again administered with 2.5 mg of depo provera in a volume of 200 ⁇ l subcutaneously (s.c.) to induce a diestrous-like state.
  • vaginal washes were collected and IVAG Chlamydial shedding was assessed by subjecting the vaginal washes to the assay system described in Example 7.
  • Figure 12 shows the inclusion forming units (IFU) of C. trachomatis SerD per vaginal wash in mice challenged intra- vaginally with C. trachomatis SerD following immunization with the indicated substances.
  • IFU inclusion forming units
  • This example illustrates a protocol for analyzing the serum IgG responses of mice immunized with PaL or MOMP proteins as well as a method of predicting T cell epitopes within the amino acid sequences of PaL protein from C. trachomatis SerD, MoPn, and C. pneumoniae.
  • Example 8 mice immunized in the manner described in Example 8 (Pal protein alone) and Example 9 (MOMP protein alone) were bled and serum separated from the collected blood was analyzed by- sandwich enzyme-linked immunosorbant assay (ELISA) to determine the titres of PaL- and MOMP-specific immunoglobulin G (IgG) antibodies (Ab) generated in response to immunization with recombinant PaL or MOMP or with whole EB.
  • ELISA enzyme-linked immunosorbant assay
  • Mouse sera were diluted in 4 fold serial dilutions in an assay buffer of 0.1% BSA in PBS + 0.1% Tween 20, and 150 ⁇ L volume was added to wells. After a 1-hour incubation at room temperature, plates were washed five times with washing buffer.
  • a volume of 100 ⁇ L of the appropriate horseradish peroxidase- conjugated secondary antibody was added as follows: for total IgG, F(ab')2 goat anti-mouse IgG (H+L specific) -HRP, from
  • the titre is taken as the reciprocal of the last dilution at which the optical density (OD) is approximately double. This OD must be greater than that of negative controls comprised of pre-immune or placebo group sera at the starting dilutions.
  • the test was validated with a positive control serum of predetermined titre.
  • results in Table 4 indicate that immunizing with protein elicited much higher specific IgG production than did immunization with live or UV-inactivated Chlamydiae.
  • T H 2 type-2 helper T cells
  • MHC major histocompatibility complex
  • CTL cytotoxic T cell
  • MHC major histocompatibility complex
  • the 1 st residue is VaI, Leu, lie or Phe (VaI is preferred);
  • the 6 th residue is Lys, Arg, or His (Lys is preferred) ;
  • the 9 th residue is Lys, Arg or His (Lys is preferred); n can be any amino acid.
  • the 1 st residue is lie, Leu, VaI or Phe (lie is preferred) ;
  • the 2nd residue is Lys, Arg, or His (Lys is preferred) ;
  • the 3rd residue is Glycine
  • the 4 th residue is GIu or Asp (GIu is preferred) ;
  • the 5 th residue is GIu or Asp
  • the 7 th residue is Leu, lie, VaI, or Phe (Leu is preferred) ;
  • the 8 th residue is Thr, Ala or Ser (Thr is preferred) ;
  • the 9 th residue is VaI, lie, Leu or Phe.
  • the 1 st residue is Phe, Leu, lie or VaI (Phe is preferred)
  • the 2 nd residue is VaI, lie, Leu, or Phe (VaI is preferred)
  • the 3 rd residue is Pro
  • the 7 th residue is Asp or GIu;
  • the 8 th residue is GIu or Asp (GIu is preferred) ;
  • the 9 th residue is GIu or Asp; n is any amino acid,
  • the 1 st residue is Leu, lie, VaI, or Phe (Leu is preferred);
  • the 3 rd residue is Lys, Arg or His (Lys is preferred);
  • the 5 th residue is GIy or Ala (GIy is preferred) ;
  • the 6 th residue is lie, Leu, VaI or Phe (lie is preferred) ;
  • the 7 th residue is Ser, Ala, Thr or GIy;
  • the MHC-I epitopes are about 8-12 residues.
  • a consensus sequence comprises the sequence
  • the 1 st residue is Lys, Arg or His (Lys is preferred) ;
  • the 3 rd residue is GIu or Asp (GIu is preferred) ;
  • the 4th residue is GIu or Asp
  • the 6 th residue is Leu, lie, VaI or Phe (Leu is preferred) ;
  • the 7 th residue is Ala, Thr or Ser (Ala is preferred) ;
  • the 8 th residue is lie, Leu, VaI or Phe (lie is preferred) ;
  • the 9 th residue is Leu, ILe, VaI or Phe (Leu is preferred) ;
  • the 10 th residue is Thr, Ala or Ser.
  • a consensus sequence comprises the sequence Al A2 A3 A4 Asn A6 A7 A8 A9 where
  • the 1 st residue is Ala, Thr, or Ser
  • the 2 nd residue is Ala, Thr, or Ser
  • the 3 rd residue is Phe, Tyr, He, Leu or VaI (Phe is preferred) ;
  • the 4 th residue is Arg, Lys or His (Arg is preferred) ;
  • the 6 th residue is lie, Leu, VaI or Phe (lie is preferred);
  • the 7 th residue is Thr, Ala, or Ser (Thr is preferred) ;
  • the 8 th residue is Phe, Tyr, He, Leu, VaI (Phe is preferred) ;
  • the 9 th residue is Ala, Thr or Ser (Ala is preferred) .
  • a consensus sequence comprises the sequence
  • the 1 st residue is GIu or Asp (GIu is preferred) ;
  • the 2 nd residue is Arg, Lys or His (Arg is preferred) ;
  • the 3 rd residue is GIy;
  • the 4 th residue is Ala, Ser or Thr (Ala is preferred) ;
  • the 5 th residue is Ala, Ser or Thr (Ala is preferred) ;
  • the 6 th residue is Ala, Ser or Thr (Ala is preferred) ;
  • the 7 th residue is Tyr or Phe (Tyr is preferred) ;
  • the 9 th residue is Leu, lie, VaI or Phe (Leu is preferred) .
  • a consensus sequence comprises the sequence
  • the 1 st residue is Lys, Arg or His (Lys is preferred) ;
  • the 4 th residue is Leu, lie, VaI or Phe (Leu is preferred) ;
  • the 6 th residue is Lys, Arg or His (Lys is preferred) ;
  • the 9 th residue is ILe, Leu, VaI or Phe (lie is preferred) ;
  • n is any amino acid.
  • a consensus sequence comprises the sequence
  • the I s residue is Arg, His or Lys (Arg is preferred) ;
  • the 2 residue is Ala, Ser or Thr (Ala is preferred) ;
  • the 4 residue is Ala, Ser or Thr (Ala is preferred) ;
  • the 5 residue is lie, VaI, Leu or Phe (lie is preferred);
  • the 6 -th residue is Lys, His or Arg (Lys is preferred) ;
  • n is any amino acid.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Chemical & Material Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Epidemiology (AREA)
  • Mycology (AREA)
  • Immunology (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Peptides Or Proteins (AREA)

Abstract

Vaccines against Chlamydia are formulated based on the peptidoglycan-associated lipoprotein (PaL) . The vaccines contain PaL sequences from various Chlamydia strains, the sequences sharing immunologically significant epitopes.

Description

PAL-BASED CHLAMYDIA VACCINE
REFERENCE TO RELATED APPLICATIONS
This patent application claims the benefit of U.S. Provisional Application Mo. 60/685,767, filed June 1, 2005, the content of which is herein incorporated by reference.
FIELD OF INVENTION
The present invention relates to Chlamydia vaccines based on the peptidoglycan-associated lipoprotein (PaL) from Chlamydia trachomatis .
BACKGROUND OF THE INVENTION
Chlamydiae are prokaryotes . They exhibit morphologic and structural similarities to gram-negative bacteria including a trilaminar outer membrane, which contains lipopoly-saccharide and several membrane proteins that are structurally and functionally analogous to proteins found in E. coli . They are obligate intracellular parasites with a unique biphasic life cycle consisting of a metabolically inactive but infectious extracellular stage and a replicating but non-infectious intracellular stage. The replicative stage of the life-cycle takes place within a membrane-bound inclusion which sequesters the bacteria away from the cytoplasm of the infected host cell .
Chlamydia are associated with a number of human diseases. C. pneumoniae is a common cause of community acquired pneumonia. Several epidemiological studies indicate an association between C. pneumoniae infection and atherosclerosis, and C. pneumoniae infection and asthma. C. trachomatis infection of the genital tract is common. There is not yet an effective vaccine for any human chlamydial infection. It is conceivable that an effective vaccine can be developed using physically or chemically inactivated Chlamydiae. However, such a vaccine does not have a high margin of safety. In general, safer vaccines are made by genetically manipulating the organism by attenuation or by recombinant means .
There have been a number of studies with C. trachomatis and C. psϊttaci. In PaL et al . 1996. Infection and Immunity. 64:5341, mice which have recovered from a lung infection with C. trachomatis are protected from infertility induced by a subsequent vaginal challenge. Similarly, sheep immunized with inactivated C. psittaci were protected from subsequent chlamydial-induced abortions and stillbirths (Jones et al . 1995. Vaccine 13:715) . In a mouse model, protection from chlamydial infections has been associated with ThI immune responses, particularly CD8+ CTL response (Rottenberg et al. 1999. J. Immunol. 162:2829-2836 and Penttila et al. 1999. Immunology. 97:490-496. The presence of sufficiently high titres of neutralising antibody at mucosal surfaces can also exert a protective effect (Cotter et al. 1995. Infection and Immunity 63:4704) .
DNA immunization has been used to elicit a protective immune response in Balb/c mice against pulmonary infection with mouse pneumonitis (MoPn) , a mouse-adapted strain of C. trachomatis (Zhang et al . 1997. J. Infect. Dis. 76:1035-1040 and Zhang et al. 1999. Immunology. 96:314-321).
The genome sequence of C. pneumoniae has been described by Griffais in WO99/27105 (strain CMl; ATCC #1360-VR) , published on June 3, 1999 and by Stephens in US patent 6,822,071 on
November 23, 2004. The genome sequence of C. trachomatis has been described by Griffais in WO99/28475, published on June 10, 1999.
SUMMARY OF THE INVENTION
The present invention provides vaccines based on the Chlamydia peptidoglycan-associated lipoprotein (PaL) and/or the major outer membrane protein MOMP. The PaL sequences are based on those from: C. pneumoniae (SEQ ID Nos : 1 and 2), C. trachomatis serovar D, one of 15 C. trachomatis serovars isolated from humans (SEQ ID NO : 5 represents the full-length sequence; SEQ ID NO : 6 represents the mature leader-less sequence), and mouse pneumonitis (MoPn, the single biovar of C. trachomatis isolated from mouse; SEQ ID NO: 7) . The MOMP sequences are based on the C. trachomatis serovar D sequence SEQ ID NO : 8.
In one form, the vaccines comprise DNA that encode the polypeptide of SEQ ID No: 5, 6, 7 or 8 or a B-cell or T-cell epitope thereof. In another form, the vaccines comprise the polypeptide of SEQ ID No : 5, 6, 7 or 8 or a B-cell or T-cell epitope thereof .
In one aspect, there is described a vaccine composition comprising a protein and an agent, wherein the protein comprises the amino acid sequence set forth in SEQ ID No: 5, 6, 7 or 8 or a B-cell or T-cell epitope thereof, and wherein the agent facilitates delivery and/or enhance an immune response to the part of the protein having the amino acid sequence set forth in SEQ ID No : 5, 6, 7 or 8 or the B-cell or T-cell epitope thereof .
In another aspect, there is described the composition outlined above, wherein the protein is a fusion protein comprising the amino acid sequence set forth in SEQ ID No: 5, 6, 7 or 8 or a B-cell or T-cell epitope thereof, fused with a heterologous polypeptide. The heterologous polypeptide may be a peptide tail for purifying the protein.
In another aspect, there is described the compositions outlined above, wherein the agent is a liposome. The liposome may be at least one liposome selected from the group consisting of neutral liposomes, anionic liposomes, microspheres, ISCOMS, and virus-like-particles (VLPs) .
In another aspect, there is described the compositions outlined above, wherein the agent is an adjuvant. The adjuvant may be at least one adjuvant selected from the group consisting of an aluminum compound such as aluminum hydroxide, aluminum phosphate, or aluminum hydroxy phosphate, RIBI, polyphosphazene, DC-chol (3 b- (N- (N1 ,N' -dimethyl aminomethane) - carbamoyl) cholesterol) and QS-21.
In another aspect, there is described the compositions outlined above, which is suitable for parenteral administration, or for mucosal administration. In compositions suitable for mucosal administration, the adjuvant may be at least one adjuvant selected from the group consisting of bacterial toxin, bacterial monophosphoryl lipid A (MPLA) (such as MPLA of
E. coli , Salmonella minnesota, Salmonella typhimurium, or Shigella flexneri) , saponin, polylactide glycolide (PLGA) microsphere, polyphosphazene, DC-chol (3 b- (N- (N1 ,N' -dimethyl aminomethane) -carbamoyl) cholesterol), and QS-21. The bacterial toxin may be selected from the group consisting of cholera toxin (CT) , E. coli heat-labile toxin (LT) , Clostridium difficile toxin A, pertussis toxin (PT) , and combinations, subunits, toxoids, or mutants thereof that retain adjuvant activity and/or have reduced toxicity. Specifically, the adjuvant may be at least one bacterial toxin selected from the group consisting of native cholera toxin subunit B (CTB) , Arg- 7-Lys CT mutant, Arg-192-Gly LT mutant, Arg-9-Lys PT mutant, Glu-129-Gly PT mutant, Ser-63-Lys LT mutant, Ala-69-Gly LT mutant, Glu-110-Asp LT mutant, and Glu-112-Asp LT mutant.
In another aspect, there is described the compositions outlined above, in unit dosage form.
In another aspect, there is described the compositions outlined above, further comprising an additional Chlamydia polypeptide that enhances an immune response to the part of the protein having the amino acid sequence set forth in SEQ ID No: 5, 6, 7 or 8 or to the B-cell or T-cell epitope thereof.
In another aspect, there is described a vaccine composition comprising a protein fused to a heterologous polypeptide having adjuvant activity, wherein the protein comprises the amino acid sequence set forth in SEQ ID No : 5, 6, 7 or 8 or a B-cell or T- cell epitope thereof. The heterologous polypeptide having adjuvant activity may be suitable as an adjuvant for parenteral administration, or as an adjuvant for mucosal administration. Specifically, the heterologous polypeptide may be subunit B of cholera toxin (CTB) or subunit B of E. coli heat-labile toxin (LTB) . The heterologous polypeptide may also be a strong T- cell epitope and/or a strong B-cell epitope such as a strong T- cell epitope and/or a strong B-cell epitope from hepatitis B virus core antigen.
In another aspect, there is described a method for treating or preventing a Chlamydia infection, the method comprising the step of administering to a subject the vaccine composition as outlined above. The method may further comprise the step of administering to the subject an antibiotic (such as a macrolide, a tetracycline, or a derivative thereof, or azithromycin or doxicyclin) , an antacid, sucralfate, a cytokine immunomodulator (such as interleukin-2 (IL-2) , interleukin-12 (IL-12) , or a steroid) or a combination thereof.
In another aspect, there is described a vaccination kit comprising the vaccine composition as outlined above and instructions for its use in vaccinating a subject against Chlamydia infection.
In another aspect, there is described a vaccine composition comprising a vaccine vector encoding a polypeptide, or comprising the polypeptide, wherein the polypeptide:
(i) comprises an amino acid sequence having at least 69% amino acid sequence identity to SEQ ID NO : 6 and
(ii) comprises at least one of any combination of the sequences :
(a) Al n.2 n3 n4 n5 A6 n.7 Pro A9 where the 1st residue is VaI, Leu, lie or Phe (VaI is preferred) ; the 6th residue is Lys, Arg, or His (Lys is preferred) ; the 8th residue is Proline; the 9th residue is Lys, Arg or His (Lys is preferred) ; n can be any amino acid; (b) Al A2 GIy A4 A5 Asn A7 A8 A9 where the 1st residue is lie, Leu, VaI or Phe (lie is preferred) ; the 2nd residue is Lys, Arg, or His (Lys is preferred) ; the 3rd residue is Glycine; the 4th residue is GIu or Asp (GIu is preferred) ; the 5th residue is GIu or Asp; the 6th residue is Asn; the 7th residue is Leu, lie, VaI, or Phe (Leu is preferred) ; the 8th residue is Thr, Ala or Ser (Thr is preferred) ; the 9th residue is VaI, lie, Leu or Phe;
(c) Al A2 Pro n Tyr A6 A7 A8 A9 where the 1st residue is Phe, Leu, lie or VaI (Phe is preferred) ; the 2nd residue is VaI, lie, Leu, or Phe (VaI is preferred) ; the 3rd residue is Pro; the 5th residue is Tyr; the 6th residue is Ser or Thr; the 7th residue is Asp or GIu; the 8th residue is GIu or Asp (GIu is preferred) ; the 9th residue is GIu or Asp; n is any amino acid;
(d) Trp GIn GIn Asn Arg Arg Thr GIu Phe;
(e) Al n A3 GIn A5 A6 A7 A8 where the 1st residue is Leu, lie, VaI, or Phe (Leu is preferred) ; the 3rd residue is Lys, Arg or His (Lys is preferred) ; the 4th residue is Gin; the 5th residue is GIy or Ala (GIy is preferred) ; the 6th residue is lie, Leu, VaI or Phe (lie is preferred) ; the 7th residue is Ser, Ala, Thr or GIy; the 8th residue is Ser, Ala, Thr or GIy;
(f) Al GIy A3 A4 Asn A6 A7 A8 A9 AlO where the lBt residue is Lys, Arg or His (Lys is preferred) ; the 2nd residue is GIy; the 3rd residue is GIu or Asp (GIu is preferred) ; the 4th residue is GIu or Asp; the 5th residue is Asn; the 6th residue is Leu, lie, VaI or Phe (Leu is preferred) ; the 7th residue is Ala, Thr or Ser (Ala is preferred) ; the 8th residue is lie, Leu, VaI or Phe (lie is preferred) ; the 9th residue is Leu, ILe, VaI or Phe (Leu is preferred) ; the 10th residue is Thr, Ala or Ser; (g) Al A2 A3 A4 Asn A6 A7 A8 A9 where the 1st residue is Ala, Thr, or Ser; the 2nd residue is Ala, Thr, or Ser; the 3rd residue is Phe, Tyr, lie, Leu or VaI (Phe is preferred) ; the 4th residue is Arg, Lys or His (Arg is preferred) ; the 5th residue is Asn; the 6th residue is lie, Leu, VaI or Phe (lie is preferred) ; the 7th residue is Thr, Ala, or Ser (Thr is preferred) ; the 8th residue is Phe, Tyr, lie, Leu, VaI (Phe is preferred) ; the 9th residue is Ala, Thr or Ser (Ala is preferred) ;
(h) Leu Ala Trp Gin GIn Asn Arg Arg Thr;
(i) Al A2 GIy A4 A5 A6 A7 Asn A9 where the 1st residue is GIu or Asp (GIu is preferred) ; the 2nd residue is Arg, Lys or His (Arg is preferred) ; the 3rd residue is GIy,- the 4th residue is Ala, Ser or Thr (Ala is preferred) ; the 5th residue is Ala, Ser or Thr (Ala is preferred) ; the 6th residue is Ala, Ser or Thr (Ala is preferred) ; the 7th residue is Tyr or Phe (Tyr is preferred) ; the 8th residue is Asn; the 9th residue is Leu, lie, VaI or Phe (Leu is preferred) ;
(j) Al n2 n3 A4 n5 A6 GIn GIy A9 where the 1st residue is Lys, Arg or His (Lys is preferred) ; the 4th residue is Leu, lie, VaI or Phe (Leu is preferred) ; the 6th residue is Lys, Arg or His (Lys is preferred) ; the 7th residue is GIn; the 8th residue is Gly; the 9th residue is ILe, Leu, VaI or Phe (lie is preferred) ; n is any amino acid;
(k) Al A2 n3 A4 A5 A6 n7 n.8 where the 1st residue is Arg, His or Lys (Arg is preferred) ; the 2nd residue is Ala, Ser or Thr (Ala is preferred) ; the 4th residue is Ala, Ser or Thr (Ala is preferred) ; the 5th residue is lie, VaI, Leu or Phe (lie is preferred) ; the 6th residue is Lys, His or Arg (Lys is preferred) ; n is any amino acid. In another aspect, there is described the vaccine above, comprising the polypeptide and further comprising an adjuvant agent which facilitates delivery and/or enhance an immune response to the protein. The polypeptide may be a fusion protein further comprising a heterologous sequence. The heterologous polypeptide may be a peptide tail for purifying the protein.
The adjuvant agent in the compositions described above may be a liposome. The liposome may be at least one liposome selected from the group consisting of neutral liposomes, anionic liposomes, microspheres, ISCOMS, and virus-like-particles (VLPs) .
The composition described above may be formulated as to be suitable for parenteral administration. Suitable adjuvant agents include those selected from the group consisting of an aluminum compound, RIBI, polyphosphazene, DC-chol (3 b- (N- (N1 ,N' -dimethyl aminomethane) -carbamoyl) cholesterol) and QS- 21, aluminum hydroxide, aluminum phosphate, or aluminum hydroxy phosphate .
The composition described above may be formulated as to be suitable for mucosal administration. The adjuvant may be selected from the group consisting of bacterial toxin, bacterial monophosphoryl lipid A (MPLA) , saponin, polylactide glycolide (PLGA) microsphere, polyphosphazene, DC-chol (3 b- (N- (N' ,N' -dimethyl aminomethane) -carbamoyl) cholesterol), and QS- 21. The adjuvant may be a bacterial toxin selected from the group consisting of cholera toxin (CT) , E. coli heat-labile toxin (LT) , Clostridium difficile toxin A, pertussis toxin (PT), and combinations, subunits, toxoids, or mutants thereof that retain adjuvant activity and/or have reduced toxicity. The adjuvant may also be a bacterial toxin selected from the group consisting of native cholera toxin subunit B (CTB) , Arg- 7-Lys CT mutant, Arg-192-Gly LT mutant, Arg-9-Lys PT mutant, Glu-129-Gly PT mutant, Ser-63-Lys LT mutant, Ala-69-Gly LT mutant, GIu-110-Asp LT mutant, and GIu-112 -Asp LT mutant. The adjuvant may also be a bacterial monophosphoryl lipid A (MPLA) of E. coli, Salmonella minnesota, Salmonella typhimurium, or Shigella flexneri.
In another aspect, there is described the vaccine compositions above in unit dosage form.
In another aspect, the vaccine compositions described above may further comprise an additional Chlamydia protein that enhances an immune response to the polypeptide of the composition. The vaccine composition described above may comprise fusion proteins with PaL and/or MOMP, wherein the PaL or MOMP sequence is fused to a heterologous polypeptide having adjuvant activity. The heterologous polypeptide having adjuvant activity may be suitable as an adjuvant for parenteral administration, or for mucosal administration. The heterologous polypeptide may be subunit B of cholera toxin (CTB) or subunit B of E. coli heat-labile toxin (LTB) .
The heterologous polypeptide in the fusions may also be a strong T-cell epitope and/or a strong B-cell epitope including those from hepatitis B virus core antigen.
In another aspect, there is described the vaccine composition above comprising a vaccine vector as described above, wherein a nucleic acid encoding the polypeptide is operably linked to a promoter functional in a mammalian cell . The vaccine vector or the composition may further comprise another nucleic acid encoding an additional polypeptide which enhances the immune response to the polypeptide. The promoter includes viral promoters such as cytomegalovirus (CMV) promoter.
In another aspect, there is described the vaccine vector above which is unable to replicate in mammalian cells and unable to integrate substantially in a mammalian genome.
The vaccine compositions described above may further comprise nucleic acid encoding a polypeptide, or further comprise the polypeptide, wherein the polypeptide has at least 80% amino acid sequence identity to SEQ ID NO. 8 and comprises any combination of B-cell or T-cell epitope in SEQ ID NO . 8.
In another aspect, there is described a method for treating or preventing a Chlamydia infection, the method comprising the step of administering to a subject the vaccine composition as described above. The method may further comprise the step of administering to the subject an antibiotic, an antacid, sucralfate, a cytokine immunomodulator or a combination thereof. The antibiotic includes a macrolide, a tetracycline, or a derivative thereof. The antibiotic includes azithromycin or doxicyclin, and wherein the immunomodulator is interleukin-2 (IL-2) , interleukin-12 (IL-12) , or a steroid.
The methods described above may further comprise administering a nucleic acid encoding a polypeptide, or administering the polypeptide, wherein the polypeptide has at least 80% amino acid sequence identity to SEQ ID NO. 8 and comprises any combination of B-cell or T-cell epitope in SEQ ID NO. 8.
In another aspect, there is described a method for treating or preventing a Chlamydia infection, the method comprising the step of administering to a subject the vaccine compositions as defined above in a prime-boost strategy.
In another aspect, there is described a vaccination kit comprising the vaccine composition as described above and instructions for its use in vaccinating a subject against Chlamydia infection. The kit may further comprise at least one compound selected from the group consisting of an antibiotic, an antacid, sucralfate, a cytokine immunomodulator, and instructions for using the composition and compound in vaccinating a subject against Chlamydia infection.
In another aspect, there is described a vaccination kit comprising: (i) a vaccine composition comprising a polypeptide in unit dosage form, wherein the polypeptide is PaL-based or MOMP-based as defined above; and (ii) a vaccine vector comprising a nucleic acid encoding the polypeptide is PaL-based or MOMP-based as defined above, operably linked to a promoter functional in a mammalian cell; for simultaneous, separate or sequential administration.
In another aspect, there is described a vaccination kit comprising at least one container of a vaccine composition comprising a polypeptide in unit dosage form, wherein the polypeptide is PaL-based or MOMP-based as defined above; and optionally at least one container of a vaccine vector comprising a nucleic acid encoding the PaL-based or MOMP-based polypeptide as defined above, operably linked to a promoter functional in a mammalian cell, and instructions for using the polypeptide and optional vector in vaccinating a subject
The vaccine kit as described above may further comprise nucleic acid encoding a polypeptide, or further comprising the polypeptide, wherein the polypeptide has at least 80% amino acid sequence identity to SEQ ID NO. 8 and comprises any combination of B-cell or T-cell epitope in SEQ ID NO. 8.
BRIEF DESCRIPTION OF THE DRAWINGS
The present invention will be further understood from the following description with reference to the drawings, in which:
Figures IA and IB show the nucleotide sequence of PaL (SEQ ID No: 1) and the deduced amino acid sequence of PaL from Chlamydia pneumoniae (SEQ ID No: 2) .
Figures 2A, 2B and 2C show the restriction enzyme analysis of the C. pneumoniae PaL gene (SEQ ID N0:l) .
Figure 3 shows the construction and elements of plasmid pCABk831 containing the C. pneumoniae PaL gene. Note that "omp P6 precursor" in pCABk831 indicates the PaL sequence. Figure 4 illustrates protection against C. pneumoniae infection by pCABk831 following intranasal DNA immunization.
Figure 5 shows a restriction map and insert positions for plasmid pKNE2 (2) PaI-SP SerD that is used to express PaL SerD in bacteria.
Figure 6 shows SDS-PAGE gels in which lysates of E. coli BL21(DE3) cells transformed with pKNE2(2)Pal SerD-SP (which is the same as pKNE2 (2) PaI-SP SerD) were resolved and proteins visualized by staining with coomassie brilliant blue dye (left panel) or by Western blot analysis (right panel) . Protein expression was induced by the addition of 1 mM isopropyl-beta- D-thiogalactopyranoside (IPTG) and is noted by the "+" symbol.
Figure 7 shows how the plasmid pJL6 expression vector containing the gene for MOMP SerD was constructed by inserting the sequence for MOMP SerD into plasmid pET15b(+) .
Figure 8 shows the deduced amino acid sequence of MOMP protein (SEQ ID NO: 8) expressed in E. coli BL21 (DE3) cells which were transformed with plasmid pJL6.
Figure 9A shows the full-length amino acid sequences of PaL from C. trachomatis SerD (top, SEQ ID N0:5), C. trachomatis MoPn (SEQ ID NO : 7 , identical to C. muridarum, middle), and C. pneumoniae (serovars CWL029 and AR39, SEQ ID NO : 2 , bottom) . Underlined portions of the sequences indicate the N-terminal gram-negative secretion sequence.
Figure 9B shows alignments of the PaL amino sequences with their N-terminal gram-negative secretion sequences cleaved off.
Figure 10 shows the inclusion forming units (IFU) of C. trachomatis MoPn elementary bodies (EB) per lung in mice challenged intra-nasally with C. trachomatis MoPn following immunization with the indicated substances. 1. Naive (untreated); 2. DNA (empty vector); 3. DC Choi (adjuvant only) ; 4. PaL DNA (naked expression vector containing PaL opening reading frame); 5. PaL Antigen + DC Choi; 6. (PaL DNA as prime vaccine) + (PaL Antigen + DC Choi as boost); 7. EB. Note that 1-3 are negative controls; 7 is positive control.
Figure 11 shows the inclusion forming units (IFU) of C. trachomatis MoPn per vaginal wash in mice challenged intra- vaginally with C. trachomatis MoPn following immunization with the indicated substances.
Figure 12 shows the inclusion forming units (IFU) of C. trachomatis SerD per vaginal wash in mice challenged intra- vaginally with C. trachomatis SerD following immunization with the indicated substances.
DETAILED DESCRIPTION OF EMBODIMENTS
Open reading frames (ORF) encoding the peptidoglycan-associated lipoprotein (PaL) from Chlamydia pneumoniae (SEQ ID NOs 1 and 2) and from C. trachomatis (SEQ ID NOs 5, 6 and 7) are able to confer immune protection against Chlamydia infection.
From the discovery that PaL confers immunoprotection in an in vivo model, it can be deduced that T- and B-cell epitopes from the PaL sequence will also confer immunoprotection.
It is further found that Chlamydia MOMP able to confer immune protection against Chlamydia infection. A vaccine combination using both PaL and MOMP is effective. PaL and MOMP can be used together, or separately in the vaccination procedure. The MOMP sequence demonstrated here is from C. trachomatis serovar D.
Note that the PaL sequence useful in the vaccines described herein may be with or without the gram negative signal . Thus the invention as described here includes DNA and/or polypeptide sequences based on the PaL and/or MOMP sequences and their variants as described herein. The variant sequences are described in relation to a reference sequence. The reference sequences are Chlamydia reference sequences and include PaL sequences (amino acid SEQ ID NOS. 2, 5, 6, 7) and MOMP sequences (SEQ ID NO . 8) , including any PaL or MOMP sequences from other variants which are known in the art but which it is not necessary to describe specifically here.
The polynucleotides used in this invention are in isolated form. The term "isolated polynucleotide" is defined as a polynucleotide removed from the environment in which it naturally occurs. For example, a naturally-occurring DNA molecule present in the genome of a living bacteria or as part of a gene bank is not isolated, but the same molecule separated from the remaining part of the bacterial genome, as a result of, e.g., a cloning event (amplification), is isolated. Typically, an isolated DNA molecule is free from DNA regions [e.g., coding regions) with which it is immediately contiguous at the 5' or 3' end, in the naturally occurring genome. Such isolated polynucleotides may be part of a vector or a composition and still be defined as isolated in that such a vector or composition is not part of the natural environment of such polynucleotide.
The polypeptides used in this invention are substantially purified. A "substantially purified polypeptide" as used herein is defined as a polypeptide that is separated from the environment in which it naturally occurs and/or that is free of the majority of the polypeptides that are present in the environment in which it was synthesized. For example, a substantially purified polypeptide is free from cytoplasmic polypeptides found in the host cell in which it was synthesized. Those skilled in the art would readily understand that the polypeptides useful in the invention may be purified from a natural source, i.e., a Chlamydia strain, or produced by recombinant means .
The polynucleotide used in the vaccines as described herein is either RNA or DNA (cDNA, genomic DNA, or synthetic DNA) , or modifications, variants, homologs or fragments based on the PaL sequence . A sequence that encodes the PaL or MOMP amino acid sequences is (a) a coding sequence, (b) a ribonucleotide sequence derived from transcription of (a) , or (c) a coding sequence which uses the redundancy or degeneracy of the genetic code to encode the same polypeptides. By "polypeptide" or "protein" is meant any chain of amino acids, regardless of length or post-translational modification {e.g. , glycosylation or phosphorylation) . Both terms are used interchangeably.
Polypeptides used in the vaccine, or polynucleotides encoding the polypeptides, may comprise or encode amino acid sequences which are variants or fragments of the reference sequence. A variant amino acid sequence encompasses homologs and serotypic variants, or may contain deletions or insertions. A variant sequence may differ from the reference sequence by one or more conservative amino acid substitutions. The variant should retain inherent characteristics of the PaL antigen or the MOMP antigen; such characteristics include immunogenicity, i.e. the ability to elicit an immune response, and/or immunoprotection, i.e. the ability to elicit an immunoprotective response. Preferably, such a variant sequence is at least 75%, more preferably 80%, and most preferably 90% identical to the reference sequence.
Variant amino acid sequences include sequences that are identical or substantially identical to the reference sequence. By "amino acid sequence substantially identical" is meant a sequence that is at least 90%, 95%, 97%, or 99% identical to an amino acid sequence of reference. Preferably the variant sequence differs from the sequence of reference by a majority of conservative amino acid substitutions. The variant sequences or fragments to be used in the vaccines described herein retain the ability to elicit an immunoprotective response to Chlamydia, e.g. a C. pneumoniae or C. trachomatis infection. Collectively, the polypeptides comprising or having a reference SEQ ID NO., its variants and fragments which confer immunoprotection against Chlamydia, are herein referred to as immunoprotective antigens, or more explicitly as Chlamydia PaL- based or MOMP-based immunoprotective antigens.
Conservative amino acid substitutions are substitutions among amino acids of the same class. These classes include, for example, amino acids having uncharged polar side chains, such as asparagine, glutamine, serine, threonine, and tyrosine; amino acids having basic side chains, such as lysine, arginine, and histidine; amino acids having acidic side chains, such as aspartic acid and glutamic acid; and amino acids having nonpolar side chains, such as glycine, alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan, and cysteine.
Variant polynucleotide sequences are defined in a similar way to variant amino acid sequences. Preferably, a variant DNA sequence is one that is at least 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 87%, 90%, 93%, 96%, or 99% identical to the nucleotide sequence encoding the reference PaL or MOMP amino acid sequence.
Variation among sequences may be measured using algorithms for optimal alignment of sequences for comparisons of identity. The computerised implementations of these algorithms include GAP, BESTFIT, FASTA and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, WI 53705; and the BLAST algorithm described in Altschul et al . , 1990, J". MoI. Biol. 215:403-10 using the published default settings. Software for performing BLAST analysis may be available through the National Center for Biotechnology Information. Once the optimal alignment has been set up, the degree of identity is established by recording all of the positions in which the amino acids of both sequences are identical, relative to the total number of positions.
It is an accepted practice in immunology to use fragments and variants of protein immunogens, or the polynucleotides encoding them, as vaccines, as all that is required to induce an immune response to a protein is a small (e.g. , 8 to 10 amino acid) region of the protein sufficient to form an immunogenic epitope. Various short synthetic peptides corresponding to surface-exposed antigens of pathogens other than Chlamydia have been shown to be effective vaccine antigens against their respective pathogens, e.g. an 11 residue peptide of murine mammary tumor virus (Casey & Davidson. Nucl . Acid Res. 1977. 4:1539), a 16-residue peptide of Semliki Forest virus (Snijders et al., 1991. J. Gen. Virol. 72:557-565), and two overlapping peptides of 15 residues each from canine parvovirus (Langeveld et al., Vaccine. 1994. 12 (15) : 1473-1480) .
A vaccine against Chlamydia may include partial sequences of PaL or MOMP sequences, or DNA encoding such partial sequences. The antigen fragments preferably are at least 12 amino acids in length. Longer fragments may be at least 15, 20, 25, 30, 35,
40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 amino acids in length. Useful polypeptide variants and fragments may be designed using computer-assisted analysis of amino acid sequences. This would identify probable surface-exposed, antigenic regions (Hughes et al. 1992. Infect. Immun. 60(9) :3497). Analysis of 6 amino acid sequences contained in the Chlamydia sequences, based on the product of flexibility and hydrophobicity propensities using the program SEQSEE (Wishart et al . 1994. Comput Appl Biosci . 10 (2) : 121-32) , can reveal potential B- and T-cell epitopes which may be used as a basis for selecting useful immunogenic fragments and variants. This analysis uses a reasonable combination of external surface features that is likely to be recognized by antibodies. Probable T-cell epitopes for HLA- A0201 MHC subclass may be revealed by an algorithms that emulate an approach developed at the NIH (Parker et al . 1995. Immunol Res. 14 (1) : 34-57) .
Epitopes which induce a protective T cell-dependent immune response are usually present throughout the length of a polypeptide. However, some epitopes may be masked by secondary and tertiary structures. To reveal such masked epitopes large internal deletions may be created to remove much of the original protein structure and expose the masked epitopes. Such internal deletions sometimes have the additional advantage of removing immunodominant regions of high variability among strains .
Polynucleotides encoding polypeptide fragments and polypeptides having large internal deletions may be constructed using standard methods including standard PCR, inverse PCR, restriction enzyme treatment of cloned DNA molecules, site directed mutagenesis (reviewed in Lu 2005. Trends Biotech. 23 (4) : 199-207) . Components for these methods and instructions for their use are readily available from various commercial sources . Useful variants and fragments that do not occur naturally can be designed using known methods for identifying regions of an antigen that are likely to tolerate amino acid sequence changes and/or deletions. As an example, homologs from different species are compared; conserved sequences are identified. The more divergent sequences are the most likely to tolerate sequence changes . Homology among sequences may be analyzed using, as an example, the BLAST homology searching algorithm of Altschul et al . 1997. Nucleic Acids Res. 25:3389-3402. Alternatively, sequences are modified such that they become more reactive to T- and/or B-cells, based on computer-assisted analysis of probable T- or B-cell epitopes. Yet another alternative is to mutate a particular amino acid residue or sequence within the polypeptide in vitro, then screen the mutant polypeptides for their ability to prevent or treat Chlamydia infection.
The antigenic polypeptide or fragment may be modified or treated to enhance its immunogenicity in the target animal, in whom the antigen is intended to confer protection against Chlamydia. Such modifications or treatments include amino acid substitutions with an amino acid derivative such as 3- methyhistidine, 4-hydroxyproline, 5-hydroxylysine etc., as well as modifications or deletions which are carried out after preparation of the antigen such as the modification of free amino, carboxyl or hydroxyl side groups of the amino acids.
Once the variants have been constructed, they are tested to confirm their ability to prevent or treat Chlamydia infection. Whether a particular variant or fragment of a Chlamydia reference sequence is useful in the prevention or treatment of Chlamydia infection may be determined by: (i) immunizing an animal in a disease model with the test variant or fragment;
(ii) inoculating the immunized animal with Chlamydia; and
(iii) selecting those variants or fragments which confer protection against Chlamydia.
By "conferring protection" is meant that there is a reduction in severity of any of the effects of Chlamydia infection, in comparison with a control animal which was not immunized with the test variant or fragment.
It may be beneficial to modify the sequence of the immunoprotective antigen to remove unwanted epitopes. For example, the 6OkDa cysteine rich membrane protein contains a sequence cross-reactive with the murine alpha-myosin heavy chain epitope M7A-alpha, an epitope conserved in humans (Bachmaier et al . , Science (1999) 283:1335). This cross- reactivity is proposed to contribute to the development of cardiovascular disease, so it may be beneficial to remove this epitope, and any other epitopes cross-reactive with human antigens, from the antigen for use as a vaccine. The immunoprotective antigens as described herein may therefore be modified to delete or substitute residues of the epitope as to improve the efficacy and safety of the vaccine. A similar approach may be appropriate for any protective antigen found to have unwanted homologies or cross-reactivities with human antigens.
A vaccine against Chlamydia may also include or encode fusion polypeptides comprising PaL and/or MOMP sequence or their variants and fragments. A fusion polypeptide is one that contains the polypeptide which confers immunoprotection, fused at the N- or C-terminal end to any other polypeptide such as another immunoprotective antigen, a signal peptide or a peptide tail . The "other polypeptide" is commonly referred to in this context as a heterologous polypeptide; i.e. a sequence which is different from a reference sequence. Thus in some instances, an antigen may be both a fusion polypeptide and a variant of PaL or MOMP.
A simple way to obtain such a fusion polypeptide is by translation of an in-frame fusion of the polynucleotide sequences, i.e., a hybrid gene. The hybrid gene encoding the fusion polypeptide is inserted into an expression vector which is used to transform or transfect a host cell. Alternatively, the polynucleotide sequence encoding the immunoprotective antigen is inserted into an expression vector in which the polynucleotide encoding the peptide tail is already present. Such vectors and instructions for their use are commercially available, e.g. the pMal-c2 or pMal-p2 system from New England Biolabs, in which the peptide tail is a maltose binding protein, the glutathione-S-transferase system of Pharmacia, or the His-Tag system available from Novagen. These and other expression systems provide convenient means for further purification of the immunoprotective antigens.
An advantageous example of a fusion polypeptide is one where the polypeptide or variant or fragment that confers immunoprotection is fused to a polypeptide having adjuvant activity, such as subunit B of either cholera toxin or E. coli heat-labile toxin. Another advantageous fusion is one where the polypeptide, variant or fragment is fused to a strong T- cell epitope or B-cell epitope. Such an epitope may be one known in the art (e.g. the Hepatitis B virus core antigen, Millich et al . 1987. Nature. 329:547-549), or one which has been identified in the immunoprotective polypeptide based on computer-assisted analysis of probable T- or B-cell epitopes. Consistent with this aspect of the invention is a fusion polypeptide comprising T- or B-cell epitopes from PaL and/or MOMP where the epitopes are derived from different regions within PaL or MOMP, possibly from PaL or MOMP homologs such that they constitute a fusion of epitopes from different Chlamydia serotypic variants and/or strains and/or species. Such a fusion is effective in the prevention and treatment of Chlamydia infection since it optimizes the T- and B-cell response to the overall polypeptide.
To effect fusion, the immunoprotective polypeptide is fused to the N-, or preferably, to the C-terminal end of the polypeptide having adjuvant activity or the T- or B-cell epitope. Alternatively, an immunoprotective fragment is inserted internally within the amino acid sequence of the polypeptide having adjuvant activity. The T- or B-cell epitope may also be inserted internally within the amino acid sequence of the immunoprotective polypeptide.
Polynucleotides encoding immunoprotective antigens can encode a precursor or a mature form of the corresponding antigen. In the precursor form, the signal peptide is either homologous or heterologous. In the former, the antigen would include the leader residues in PaL or MOMP. In the latter case, the antigen lacks these residues and a heterologous leader sequence such as the leader sequence of the tissue-type plasminogen factor (tPA) may be used. In the mature form, the antigen lacks the signal peptide.
The vaccines as described herein may be a DNA vaccine or a protein vaccine. For DNA vaccines, there are two major routes, either using a viral or bacterial host as a polynucleotide delivery vehicle (live vaccine vector) or administering the polynucleotide in a free form, e.g. , inserted into a plasmid. DNA vaccines include a vaccine vector such as a poxvirus, containing a DNA encoding a PaL-based or MOMP-based immunoprotective antigen, placed under the control of elements required for expression. The vaccine may also comprise a vaccine vector encoding and capable of expressing a PaL-based or MOMP-basedimmunoprotective antigen in a therapeutically or prophylactically effective amount, together with a diluent or carrier. The vaccines are useful in a method for inducing an immune response against Chlamydia in a mammal, which involves administering to the mammal an immunogenically effective amount of the vaccine vector to elicit a protective or therapeutic immune response to Chlamydia. Mammals include humans as well as animals since the method can be used in veterinary applications for treating or preventing Chlamydia infection of e.g., cats or birds. Methods for preventing and/or treating a Chlamydia infection also include administering a prophylactic or therapeutic amount of the vaccine vector to an infected individual . Chlamydia infections include those caused by C. trachomatis, C. psittaci, C. pneumonia, C. pecorum. Additionally, the vaccine vector may be used in the preparation of a medicament for preventing and/or treating Chlamydia infection.
Preferred vaccine vectors include those unable to replicate or integrate substantially in the target vaccine recipient. Such vectors include those whose sequences are free of regions of substantial identity to the genome of the vaccine recipient, as to minimize the risk of host-vector recombination. One way to do this is to use promoters not derived from the recipient genome to drive expression of the immunoprotective antigen. For example, if the recipient is a mammal, the promoter is preferably non-mammalian derived though it should be able to function in mammalian cells, e.g. a viral promoter. A vaccine vector may express one or several immunoprotective antigens. The vaccine vector may express additionally a cytokine, such as interleukin-2 (IL-2) or interleukin-12 (IL- 12), that enhances the immune response (adjuvant effect) . It is understood that each of the components to be expressed is placed under the control of elements required for expression in the vaccine recipient .
A vaccine composition may comprise several vaccine vectors, each of them capable of expressing an immunoprotective antigen, in particular PaL and MOMP. The composition may also comprise a vaccine vector capable of expressing an additional Chlamydia antigen, optionally together with a cytokine such as IL-2 or IL-12. The additional Chlamydia antigen and cytokine maybe encoded by the same vaccine vector that encodes the immunoprotective antigen, or they may be encoded on separate vector (s) . They may also be present as polypeptides in the same or a different vaccine composition.
A vaccine vector encoding an immunoprotective antigen may be used in vaccination methods for treating or preventing infection. The vaccine vector can be administered by any conventional route, particularly to a mucosal {e.g., ocular, intranasal, oral, gastric, pulmonary, intestinal, rectal, vaginal, or urinary tract) surface or via the parenteral {e.g., subcutaneous, intradermal, intramuscular, intravenous, or intraperitoneal) route. Preferred routes depend upon the choice of the vaccine vector. Treatment may be effected in a single dose or repeated at intervals. The appropriate dosage depends on various parameters understood by skilled artisans such as the vaccine vector itself, the route of administration or the condition of the mammal to be vaccinated (weight, age and the like) . A vaccine vector encoding an immunoprotective antigen includes live vaccine vectors. Live vaccine vectors available in the art include viral vectors such as adenoviruses and poxviruses as well as bacterial vectors, e.g., Shigella, Salmonella, Vibrio cholerae, Lactobacillus, Bacille bilie de Calmette- Guerin (BCG) , and Streptococcus .
An example of an adenovirus vector, as well as a method for constructing an adenovirus vector capable of expressing a DNA molecule of the invention, is described in U.S. Patent No. 4,920,209. Poxvirus vectors include vaccinia and canary pox virus, described in U.S. Patent No. 4,722,848 and U.S. Patent No. 5,364,773, respectively. Also see, e.g., Tartaglia et al . 1992. Virology. 188:217 for a description of a vaccinia virus vector and Taylor et al. 1995. Vaccine. 13:539 for a reference of a canary pox. Poxvirus vectors capable of expressing an immunoprotective antigen may be obtained by homologous recombination as described in Kieny et al . 1984. Nature. 312:163, so that the polynucleotide encoding the antigen is inserted in the viral genome under appropriate conditions for expression in mammalian cells. Generally, the dose of vaccine viral vector, for therapeutic or prophylactic use, can be of from about IxIO4 to about IxIO11, advantageously from about IxIO7 to about IxIO10, preferably of from about IxIO7 to about IxIO9 plaque-forming units per kilogram. Preferably, viral vectors are administered parenterally; for example, in 3 doses, 4 weeks apart. It is preferable to avoid adding a chemical adjuvant to a composition containing a viral vector and thereby minimizing the immune response to the viral vector itself.
Non-toxioogenic Vibrio cholerae mutant strains that are useful as a live oral vaccine are known. Mekalanos et al . 1983.
Nature. 306:551 and U.S. Patent No. 4,882,278 describe strains which have a substantial amount of the coding sequence of each of the two ctxA alleles deleted so that no functional cholerae toxin is produced. WO92/11354 describes a strain in which the irgA locus is inactivated by mutation; this mutation can be combined in a single strain with ctxA mutations. WO94/01533 describes a deletion mutant lacking functional ctxA and attRSl DNA sequences. These mutant strains are genetically engineered to express heterologous antigens, as described in WO94/19482. An effective vaccine dose of a Vibrio cholerae strain capable of expressing an immunoprotective antigen contains about IxIO5 to about IxIO9, preferably about IxIO6 to about IxIO8, viable bacteria in a volume appropriate for the selected route of administration. Preferred routes of administration include all mucosal routes; most preferably, these vectors are administered intranasally or orally.
Attenuated Salmonella typhimurium strains, genetically engineered for recombinant expression of heterologous antigens or not, and their use as oral vaccines are described in Nakayama et al . 1988. Bio/Technology. 6:693 and WO92/11361. Preferred routes of administration include all mucosal routes; most preferably, these vectors are administered intranasally or orally.
Other bacterial strains used as vaccine vectors are described for Shigella flexneri in High et al . 1992. EMBO. 11:1991 and Sizemore et al . 1995. Science. 270:299; for Streptococcus gordonii in Medaglini et al. 1995. Proc . Natl. Acad. Sci . USA. 92:6868; and for Bacille Calmette Guerin in Flynn 1994. Cell. MoI. Biol. 40 (suppl. I) :31, WO88/06626, WO90/00594, WO91/13157, WO92/01796, and WO92/21376.
In bacterial vectors, the polynucleotide encoding the immunoprotective antigen is inserted into the bacterial genome or remains in a free state as part of a plasmid. Compositions comprising the vaccine bacterial vector may further contain an adjuvant. Suitable adjuvants are known to those skilled in the art. Preferred adjuvants are selected as provided herein.
A vaccine vector includes an expression cassette containing a DNA encoding an immunoprotective antigen placed under the control of the elements required for expression, in particular under the control of an appropriate promoter. The vaccine vector may be an expression vector containing the expression cassette.
A procaryotic or eucaryotic cell may be transformed or transfected with an expression cassette and/or vector encoding the immunoprotective antigen. The immunoprotective antigen may be produced by culturing a procaryotic or eucaryotic cell transformed or transfected with the expression cassette and/or vector under conditions that allow expression of the DNA, and recovering the encoded antigen from the cell culture.
A recombinant expression system for producing an immunoprotective antigen or for producing quantities of the vaccine vector may use procaryotic or eucaryotic hosts. Eucaryotic hosts include yeast cells (e.g. , Saccharomyces cerevisiae or Pichia pastoris) , mammalian cells (e.g., COSl, NIH3T3, or JEG3 cells), arthropod cells (e.g., Spodoptera frugiperda (SF9) cells), and plant cells. A preferred expression system is a procaryotic host such as E. coli. Bacterial and eucaryotic cells are available from a number of different sources including commercial sources to those skilled in the art, e.g., the American Type Culture Collection (ATCC; Rockville, Maryland) .
The choice of the expression system depends on the features desired for the expressed antigen. For example, it may be useful to produce the antigen in a particular lipidated form or any other form.
In selecting an expression selection, the host should be chosen that is compatible with the vector which is to exist and possibly replicate in it. Considerations are made with respect to the vector copy number, the ability to control the copy number, and expression of other proteins such as antibiotic resistance. In selecting an expression control sequence, a number of variables are considered. Among the important variables are the relative strength of the sequence (e.g. the ability to drive expression under various conditions) , the ability to control the sequence's function, compatibility between the polynucleotide to be expressed and the control sequence {e.g. secondary structures are considered to avoid hairpin structures which prevent efficient transcription) . In selecting the host, unicellular hosts are selected which are compatible with the selected vector, tolerant of any possible toxic effects of the expressed product, able to secrete the expressed product efficiently if such is desired, to be able to express the product in the desired conformation, to be easily scaled up, and to which ease of purification of the final antigen or vector product.
The choice of expression cassette depends on the host system selected as well as the features desired for the expressed antigen. Typically, an expression cassette includes a promoter that is functional in the selected host system and can be constitutive or inducible; a ribosome binding site; a start codon (ATG) if necessary; a region encoding a signal peptide, e.g., a lipidation signal peptide; DNA encoding the immunoprotective antigen; a stop codon; and optionally a 3' terminal region (translation and/or transcription terminator) . The signal peptide encoding region is adjacent to the polynucleotide of the invention and placed in proper reading frame. The signal peptide-encoding region is homologous or heterologous to the DNA encoding the mature antigen and is compatible with the secretion apparatus of the host used for expression. The open reading frame constituted by the DNA encoding the antigen, solely or together with the signal peptide, is placed under the control of the promoter so that transcription and translation occur in the host system.
Promoters used to drive expression of the immunoprotective antigen is usually a heterologous promoter, which in this context means that the promoter is other than the PaL gene promoter. Promoters and signal peptide encoding regions are widely known and available to those skilled in the art. These include, for example, the promoter of Salmonella typhimurium and its derivatives, that is inducible by arabinose (promoter araB) and is functional in Gram-negative bacteria such as E. coli as described in U.S. Patent No. 5,028,530 and in Cagnon et al. 1991. Protein Engineering. 4(7):843; the promoter of the gene of bacteriophage T7 encoding RNA polymerase, that is functional in a number of E. coli strains expressing T7 polymerase described in U.S. Patent No. 4,952,496; OspA lipidation signal peptide ; and RIpB lipidation signal peptide (Takase et al . 1987. J. Bact . 169:5692).
Promoters suitable for expression in a mammalian cell include those that function constitutively, ubiquitously or tissue- specifically. Examples of non-tissue specific promoters include promoters of viral origin. Examples of viral promoters include Mouse Mammary Tumor Virus (MMTV) promoter, Human Immunodeficiency Virus Long Terminal Repeat (HIV LTR) promoter, Moloney virus, avian leukosis virus (ALV), Cytomegalovirus
(CMV) immediate early promoter/enhancer, Rous Sarcoma Virus (RSV), adeno-associated virus (AAV) promoters; adenoviral promoters, and Epstein Barr Virus (EBV) promoters. Compatibility of viral promoters with certain antigens is a consideration since their combination may affect expression levels. It is possible to use synthetic promoter/enhancers to optimize expression (see US patent publication 2004/0171573) .
An example of a tissue-specific promoter is the desmin promoter which drives expression in muscle cells (Li et al . 1989. Gene. 78:243; Li & Paulin 1991. J. Biol. Chem. 266:6562 and Li & Paulin 1993. J. Biol. Chem. 268:10403). Other examples include artificial promoters such as a synthetic muscle specific promoter and a chimeric muscle-specific/CMV promoter (Li et al . 1999. Nat. Biotechnol . 17:241-245; Hagstrom et al . 2000. Blood 95:2536-2542) .
Useful vectors are described in numerous publications, specifically WO94/21797 and Hartikka et al. 1996. Human Gene Therapy 7:1205.
The expression cassette is typically part of an expression vector, which is selected for its compatibility with the chosen expression system. Expression vectors {e.g. , plasmids or viral vectors) can be chosen, for example, from those described in
Pouwels et al . Cloning Vectors: A Laboratory Manual 1985, Supp. 1987. Suitable expression vectors can be purchased from various commercial sources .
Methods for transforming/transfecting host cells with expression vectors are well-known in the art and depend on the host system selected as described in Ausubel et al . , Current Protocols in Molecular Biology, John Wiley & Sons Inc., 1994.
Upon expression of the DNA, the immunoprotective antigen is produced and may remain in the intracellular compartment, or may be secreted/excreted in the extracellular medium or in the periplasmic space, or may be embedded in the cellular membrane. The antigen may be recovered in a substantially purified form from the cell extract or from the supernatant after centrifugation of the recombinant cell culture. Typically, the antigen is purified by antibody-based affinity purification or by other well-known methods that can be readily adapted, such as fusion of the polynucleotide encoding the antigen to a small affinity binding domain.
Vaccines containing vectors encoding immunoprotective antigens may optionally include at least one additional polynucleotide encoding another Chlamydia antigen such as urease subunit A, B, or both, or a fragment or derivative thereof. The vaccine may also contain an additional polynucleotide encoding a cytokine, such as interleukin-2 (IL-2) or interleukin-12 (IL-12) so that the immune response is enhanced. These additional polynucleotides are placed under appropriate control for expression and may be part of the vaccine vector encoding the immunoprotective antigen, or may be part of separate vectors, or the additional Chlamydia antigen and/or cytokine may be used in protein form.
Standard techniques of molecular biology for preparing and purifying polynucleotides are used in the preparation of polynucleotide vaccines.
One method utililizes the polynucleotide in a naked form e.g. an expression plasmid, free of any delivery vehicles. Such a polynucleotide is simply diluted in a physiologically acceptable solution such as sterile saline or sterile buffered saline, with or without a carrier. When present, the carrier preferably is isotonic, hypotonic, or weakly hypertonic, and has a relatively low ionic strength, such as provided by a sucrose solution, e.g., a solution containing 20% sucrose. An alternative method utilizes the polynucleotide or vaccine vector in association with agents that assist in cellular uptake. Examples of such agents are (i) chemicals that modify cellular permeability, such as bupivacaine (see, e.g., W094/16737) , (ii) liposomes for encapsulation of the polynucleotide, or (iii) cationic lipids or silica, gold, or tungsten microparticles which associate themselves with polynucleotides. Such agents may also act as adjuvants.
Anionic and neutral liposomes are well-known in the art. See, e.g., Liposomes: A Practical Approach, RPC New Ed, IRL press 1990, for a detailed description of methods for making liposomes. Liposomes are useful for delivering a large range of products, including polynucleotides and polypeptides.
Cationic lipids are also known in the art and are commonly used for gene delivery. Such lipids include Lipofectin™ also known as DOTMA (N- [1- (2 , 3 -dioleyloxy) propyl] -N,N,N-trimethylammonium chloride), DOTAP (1, 2-bis (oleyloxy) -3-
(trimethylammonio) propane) , DDAB (dimethyldioctadecyl-ammonium bromide) , DOGS (dioctadecylamidologlycyl spermine) and cholesterol derivatives such as DC-Choi (3 beta- (N- (N1 ,N1 - dimethyl aminomethane) -carbamoyl) cholesterol) . A description of these cationic lipids can be found in EP 187,702, WO90/11092, U.S. Patent No. 5,283,185, WO91/15501, WO95/26356, and U.S. Patent No. 5,527,928. Cationic lipids for gene delivery are preferably used in association with a neutral lipid such as DOPE (dioleyl phosphatidylethanolamine) , as described in WO90/11092 as an example.
Formulation containing cationic liposomes may optionally contain other transfection-facilitating compounds. A number of them are described in WO93/18759, WO93/19768, WO94/25608, and WO95/02397. They include spermine derivatives useful for facilitating the transport of DNA through the nuclear membrane (see, for example, WO93/18759) and membrane-permeabilizing compounds such as GALA, Gramicidine S, and cationic bile salts (see, for example, WO93/19768) .
Gold or tungsten microparticles are used for gene delivery, as described in WO91/00359, WO93/17706, and Tang et al . 1992. Nature 356:152. The microparticle-coated polynucleotide is injected via intradermal or intraepidermal routes using a needleless injection device ("gene gun"), such as those described in U.S. Patent No. 4,945,050, U.S. Patent No. 5,015,580, and WO94/24263.
The amount of DNA to be used in a vaccine recipient depends, e.g. , on the strength of the promoter used in the DNA construct, the immunogenic!ty of the expressed antigen, the condition of the mammal intended for administration (e.g. , the weight, age, and general health of the mammal), the mode of administration, and the type of formulation. In general, a therapeutically or prophylactically effective dose from about 1 μg to about 1 mg, preferably, from about 10 μg to about 800 μg and, more preferably, from about 25 μg to about 250 μg, can be administered to human adults. The administration can be achieved in a single dose or repeated at intervals.
The route of administration is any conventional route used in the vaccine field. As general guidance, DNA vaccines may be administered via a mucosal surface, e.g. , an ocular, intranasal, pulmonary, oral, intestinal, rectal, vaginal, and urinary tract surface; or via a parenteral route, e.g., by an intravenous, subcutaneous, intraperitoneal, intradermal, intraepidermal, or intramuscular route. The choice of administration route depends on the formulation that is selected. A DNA vaccine formulated in association with bupivacaine is advantageously administered into muscles. When a neutral or anionic liposome or a cationic lipid, such as DOTMA or DC-Choi, is used, the formulation can be advantageously injected via intravenous, intranasal (aerosolization) , intramuscular, intradermal, and subcutaneous routes . A DNA vaccine in a naked form can advantageously be administered via the intramuscular, intradermal, or subcutaneous routes .
Although not absolutely required, a DNA vaccine can also contain an adjuvant. If so, a systemic adjuvant that does not require concomitant administration in order to exhibit an adjuvant effect is preferable such as, e.g., QS21, which is described in U.S. Patent No. 5,057,546.
The vaccines as described herein include protein vaccines . A protein vaccine may comprise an immunoprotective antigen as described herein, together with a diluent or carrier. An immunoprotective antigen for use in a vaccine may comprise the trachomatis PaL sequence (SEQ ID No:2), its variants, fragments, fusions, mature and precursor forms as described in connection with DNA vaccines. The vaccine may be in the form of a pharmaceutical composition containing a therapeutically or prophylactically effective amount of the immunoprotective antigen. Thus the vaccine may be used in a method for inducing an immune response against Chlamydia in a mammal , by administering to the mammal an immunogenically effective amount of the immunoprotective antigen to elicit a protective immune response to Chlamydia. Mammals include humans as well as animals since the method can be used in veterinary applications for treating or preventing Chlamydia infection of e.g. , cats or birds. The vaccines can be used to prevent and/or treat a
Chlamydia infection in an infected individual. Chlamydia infections include those caused by e.g., C. trachomatis . C. psittaci, C. pneumoniae, or C. pecorum. Additionally, the immunoprotective antigens may be used in the preparation of a medicament for preventing and/or treating Chlamydia infection.
Protein vaccines may be administered by conventional routes known the vaccine field, in particular to a mucosal (e.g., ocular, intranasal, pulmonary, oral, gastric, intestinal, rectal, vaginal, or urinary tract) surface or via the parenteral (e.g., subcutaneous, intradermal, intramuscular, intravenous, or intraperitoneal) route. The choice of administration route depends upon a number of parameters, such as the adjuvant associated with the antigen. If a mucosal adjuvant is used, the intranasal or oral route is preferred. If a lipid formulation or an aluminum compound is used, the parenteral route is preferred with the sub-cutaneous or intramuscular route being most preferred. The choice also depends upon the nature of the vaccine agent. For example, the immunoprotective antigen fused to CTB or LTB is best administered to a mucosal surface.
A protein vaccine may contain one or several immunoprotective antigens and optionally contains at least one additional polypeptide derived from Chlamydia. The vaccine may also contain a cytokine, such as interleukin-2 (IL-2) or interleukin-12 (IL-12) , that enhances the immune response (adjuvant effect) . The vaccine may also include at least one additional Chlamydia antigen such as urease subunit A, B, or both, or a fragment or derivative thereof.
For use in a protein vaccine, the immunoprotective antigen may be formulated into or with liposomes, preferably neutral or anionic liposomes, microspheres, ISCOMS, or virus-like- particles (VLPs) to facilitate delivery and/or enhance the immune response. These compounds are readily available to one skilled in the art; for example, see Liposomes: A Practical Approach, RCP New Ed, IRL press (1990) .
Adjuvants other than liposomes and the like are also used and are known in the art. Adjuvants may protect the antigen from rapid dispersal by sequestering it in a local deposit, or they may contain substances that stimulate the host to secrete factors that are chemotactic for macrophages and other components of the immune system. An appropriate selection can conventionally be made by those skilled in the art, for example, from those described herein.
Treatment is achieved in a single dose or repeated as necessary at intervals, as can be determined readily. For example, a priming dose is followed by three booster doses at weekly or monthly intervals. An appropriate dose depends on various parameters including the recipient {e.g. , adult or infant) , the particular antigen, the route and frequency of administration, the presence / absence or type of adjuvant, and the desired effect {e.g. , protection and/or treatment) , as can be determined by one skilled in the art. In general, an immunoprotective antigen is administered as a vaccine by a mucosal route in an amount from about 10 μg to about 500 mg, preferably from about 1 mg to about 200 mg. For the parenteral route, the dose usually does not exceed about 1 mg, preferably about 100 μg .
When used as vaccine agents, polynucleotides and polypeptides may be used sequentially as part of a multistep immunization process. For example, a mammal may be initially primed with a vaccine vector of the invention such as a pox virus, e.g., via the parenteral route, and then boosted twice with the immunoprotective antigen encoded by the vaccine vector, e.g., via the mucosal route. In another example, liposomes associated with the antigen may also be used for priming, with boosting being carried out mucosally using an antigen in soluble form in combination with a mucosal adjuvant (e.g. , LT) .
Adjuvants useful in any of the vaccine formulations described above include the following.
Adjuvants for parenteral administration include aluminum compounds, such as aluminum hydroxide, aluminum phosphate, and aluminum hydroxy phosphate. The antigen is precipitated with, or adsorbed onto, the aluminum compound according to standard protocols. Other adjuvants, such as RIBI (ImmunoChem, Hamilton, MT) , are used in parenteral administration.
Adjuvants for mucosal administration include bacterial toxins, e.g., the cholera toxin (CT), the B. coli heat-labile toxin (LT) , the Clostridium difficile toxin A and the pertussis toxin (PT), or combinations, subunits, toxoids, or mutants thereof such as a purified preparation of native cholera toxin subunit B (CTB) . Fragments, homologs, derivatives, and fusions to any of these toxins are also suitable, provided that they retain adjuvant activity. Preferably, a mutant having reduced toxicity is used. Suitable mutants are described, e.g., in
WO 95/17211 (Arg-7-Lys CT mutant) , WO 96/06627 (Arg-192-Gly LT mutant) , and WO 95/34323 (Arg-9-Lys and Glu-129-Gly PT mutant) . Additional LT mutants that are used in the methods and compositions of the invention include, e.g., Ser-63-Lys, Ala- 69GIy, Glu-110-Asp, and Glu-112-Asp mutants. Other adjuvants, such as a bacterial monophosphoryl lipid A (MPLA) of, e.g., E. coli, Salmonella minnesota, Salmonella typhimurium, or Shigella flexneri; saponins, or polylactide glycolide (PLGA) microspheres, is also be used in mucosal administration. Adjuvants useful for both mucosal and parenteral administrations include polyphosphazene (WO95/02415) , DC-chol (U.S. Patent No. 5,283,185 and WO96/14831) ; and QS-21 (WO 88/09336) .
Any pharmaceutical composition of the invention containing a polynucleotide vaccine vector or immunoprotective antigen may be manufactured in a conventional manner. In particular, it may be formulated with a pharmaceutically acceptable diluent or carrier, e.g. , water or a saline solution such as phosphate buffer saline. In general, a diluent or carrier is selected on the basis of the mode and route of administration, and standard pharmaceutical practice. Suitable pharmaceutical carriers or diluents, as well as pharmaceutical necessities for their use in pharmaceutical formulations, are described in Remington' s Pharmaceutical Sciences, a standard reference text in this field and in the USP/NF.
Therapeutic or prophylactic efficacy may be evaluated using standard methods in the art, e.g., by measuring induction of a mucosal immune response or induction of protective and/or therapeutic immunity, using, e.g., the C. pneumoniae mouse model . Those skilled in the art will recognize that the C. pneumoniae or C. trachomatis strain of the model may be replaced with another Chlamydia strain. For example, the efficacy of antigens from C. pneumoniae is preferably evaluated in a mouse model using C. pneumoniae strain. Cross protection may be determined by evaluating the ability of the antigen to protect an animal against a Chlamydia species different from the species from which the antigen is derived. Protection is determined by comparing the degree of Chlamydia infection to that of a control group. Protection is shown when infection is reduced by comparison to the control group; i.e. there is a reduction in severity of any of the effects of Chlamydia infection, in comparison with a control animal which was not immunized with the test antigen.
A Chlamydia vaccine and mucosal adjuvant may be administered in combination with an antibiotic, an antacid, sucralfate, or a combination thereof. Examples of such compounds that can be administered with the vaccine antigen and the adjuvant are antibiotics, including, e.g., macrolides, tetracyclines, and derivatives thereof (specific examples of antibiotics that can be used include azithromycin or doxicyclin or immunomodulators such as cytokines or steroids) . In addition, compounds containing more than one of the above-listed components coupled together may be used. Compositions for carrying out these methods may include an immunoprotective antigen (s) , an adjuvant, and one or more of the above-listed compounds, in a pharmaceutically acceptable carrier or diluent.
Amounts of the above-listed compounds used in the methods and compositions are readily determined by one skilled in the art. Treatment/immunization schedules are also known and readily designed by one skilled in the art. For example, the non- vaccine components can be administered on days 1-14, and the vaccine antigen plus adjuvant can be administered on days 7, 14, 21, and 28.
The vaccine vectors and immunoprotective antigens may be formulated in effective amounts with a suitable pharmaceutically acceptable carrier in dosage unit form. A unit dosage form contains the vectors and/or antigens in amounts suitable for their administration depending on the desired route and vaccination schedule. Where compositions contain supplementary active ingredients (e.g., an antibiotic, an antacid, or sucralfate) , the dosages are determined by reference to the usual dose and manner of administration of the supplementary active ingredients.
The vaccines described herein may be present in the form of a vaccination kit comprising one or more containers of vaccine vectors and/or immunoprotective antigens in dosage unit form suitable for a particular route of administration (e.g. intravascular, intramuscular, subcutaneous or intraperitoneal injection), together with instructions for following the vaccination method as described herein. The kit could contain a number of sterile ampules, the ampules containing dosages representing a vaccination regimen of an initial immunization plus booster injections.
EXAMPLES
The above disclosure generally describes the present invention. A more complete understanding can be obtained by reference to the following specific examples. These examples are described solely for purposes of illustration and are not intended to limit the scope of the invention. Changes in form and substitution of equivalents are contemplated as circumstances may suggest or render expedient. Although specific terms have been employed herein, such terms are intended in a descriptive sense and not for purposes of limitation.
Example 1 :
This example illustrates the preparation of plasmid vector pCABk831 containing the C. pneumoniae PaL gene.
The omp P6 precursor gene (SEQ ID No:l) was amplified from Chlamydia, pneumoniae genomic DNA by polymerase chain reaction
(PCR) using a 5' primer
(5' ATAAGAATGCGGCCGCCACCATGAATATACATTCCCTATGGAAAC 3'; SEQ ID No : 3 ) and a 3 ' primer
(5' GCGCCGGATCCCGCGTGCATGAATCTTAAACTCTGTACGGC 3'; SEQ ID No: 4). The 5' primer contains a Notl restriction site, a ribosome binding site, an initiation codon and a sequence at the 5' end of the omp P6 precursor coding sequence . The 3 ' primer includes the sequence encoding the C-terminal sequence of the omp P6 precursor gene and a BamHI restriction site. The stop codon was excluded and an additional nucleotide was inserted to obtain an in-frame fusion with the Histidine tag.
After amplification, the PCR fragment was purified using
QIAquick™ PCR purification kit (Qiagen) , digested with Notl and BamHI and cloned into the pCA-Myc-His eukaryotic expression vector described in Example 2 (Figure 3) with transcription under control of the human CMV promoter.
Example 2 :
This example illustrates the preparation of the eukaryotic expression vector pCA/Myc-His.
Plasmid pcDNA3.1 (-) Myc-His C (Invitrogen) was restricted with Spel and BamHI to remove the CMV promoter and the remaining vector fragment was isolated. The CMV promoter and intron A from plasmid VR-1012 (Vical) was isolated on a Spel / BamHI fragment . The fragments were ligated together to produce plasmid pCA/Myc-His. The Notl/BamHI restricted PCR fragment containing the omp P6 precursor gene (SEQ ID No:l) was ligated into the Notl and BamHI restricted plasmid pCA/Myc-His to produce plasmid pCABk831 (Figure 3) .
The resulting plasmid, pCABk831, was transferred by electroporation into E. coli XL-I blue (Stratagene) which was grown in LB broth containing 50 μg/ml carbenicillin. The plasmid was isolated by the Endo Free Plasmid Giga Kit™ (Qiagen) large scale DNA purification system. DNA concentration was determined by absorbance at 260 nm and the plasmid was verified after gel electrophoresis and ethidium bromide staining by comparison to molecular weight standards. The 5' and 3' ends of the gene were verified by sequencing using a LiCor model 4000 L DNA sequencer and IRD-800 labelled primers .
Example 3 :
This example illustrates the immunization of mice to achieve protection against an intranasal challenge of C. pneumoniae.
It has been previously demonstrated (Yang et al. Infect. Immun. May 1993. 61 (5) : 2037-40) that mice are susceptible to intranasal infection with different isolates of C. pneumoniae. Strain AR-39 (Grayston et al (1990) Journal of Infectious
Diseases 161:618-625) was used in Balb/c mice as a challenge infection model to examine the capacity of Chlamydia gene products delivered as naked DNA to elicit a protective response against a sublethal C. pneumoniae lung infection. Protective immunity is defined as an accelerated clearance of pulmonary infection.
Groups of 7 to 9 week old male Balb/c mice (8 to 10 per group) were immunized intramuscularly (i.m.) plus intranasally (i.n.) with plasmid DNA containing the C. pneumoniae omp P6 precursor gene as described in Examples 1 and 2. Saline or the plasmid vector lacking an inserted Chlamydial gene was given to groups of control animals.
For i.m. immunization, alternate left and right quadriceps were injected with lOOμg of DNA in 50μl of PBS on three occasions at 0, 3 and 6 weeks. For i.n. immunization, anaesthetized mice were aspirated 50μl of PBS containing 50 μg DNA on three occasions at 0, 3 and 6 weeks. At week 8, immunized mice were inoculated i.n. with 5 x 105 IFU of C. pneumoniae, strain AR39 in lOOμl of SPG buffer to test their ability to limit the growth of a sublethal C. pneumoniae challenge.
Lungs were taken from mice at day 9 post-challenge and immediately homogenised in SPG buffer (7.5% sucrose, 5mM glutamate, 12.5mM phosphate pH7.5) . The homogenate was stored frozen at -700C until assay. Dilutions of the homogenate were assayed for the presence of infectious Chlamydia by inoculation onto monolayers of susceptible cells. The inoculum was centrifuged onto the cells at 3000rpm for 1 hour, then the cells were incubated for three days at 35°C in the presence of lμg/ml cycloheximide . After incubation the monolayers were fixed with formalin and methanol then immunoperoxidase stained for the presence of Chlamydial inclusions using convalescent sera from rabbits infected with C. pneumoniae and metal- enhanced DAB as a peroxidase substrate.
Figure 4 and Table 1 show that mice immunized i.n. and i.m. with pCABk831 had Chlamydial lung titers less than 39,500 in 5 of 6 cases at day 9 (mean 24,933) whereas the range of values for control mice sham immunized with saline was 13,500 to 178,700 IFU/lung (mean 69,782) at day 9. DNA immunisation per se was not responsible for the observed protective effect since another plasmid DNA construct, pCABkllOδ, failed to protect, with lung titers in immunised mice similar to those obtained for saline-immunized control mice (mean 62,516). The construct pCABkllO6 is identical to pCABk831 except that the nucleotide sequence encoding the putative omp P6 precursor is replaced with a C. pneumoniae nucleotide sequence encoding an unrelated hypothetical protein. Table 1
Figure imgf000047_0001
Example 4 :
This example illustrates a protocol for producing recombinant PaL protein from E. coli for use in a vaccine.
The PaL gene (SEQ ID No : 5 ; C. trachomatis SerD) was amplified from C. trachomatis SerD genomic DNA by polymerase chain reaction (PCR) and cloned into plasmid pET15b(+) containing a His-tag coding sequence. Plasmid DNA was extracted using a QIAprep™ Spin Miniprep Kit (Qiagen) and was amplified with a forward primer (5' GGGAATCCATATGGATTGGGAATGTCACGGT 3'; SEQ ID No: 9) and a reverse primer
(5 'GATCCTCGAGTCATTAGCGAGCATGGATCTTAAA 3'; SEQ ID No: 10) to generate Ndel and Xhol sites, respectively, while removing the native N-terminal signal peptide. The resulting PCR product was digested with Ndel and Xhol and then subcloned into plasmid pET24b(+) to create plasmid pKNE2 (2) PaI-SP SerD (Figure 5) which was used to transform E. coli DH5 cells. Plasmid DNA from positive clones was isolated as described above and was in turn used to transform E. coli BL21(DE3) . Expression of recombinant PaL SerD was induced by the addition of 1 mM isopropyl-beta-D-thiogalactopyranoside (IPTG) to growing cultures of BL21. The level of PaL SerD expression was examined by resolving bacterial cell lysates on SDS-PAGE gels and visualizing proteins by staining with Coomassie brilliant blue dye or by Western blot analysis. As shown in Figure 6, recombinant PaL SerD protein was expressed at high levels.
For efficient recovery of PaL SerD from E. coli, we isolated the protein from inclusion bodies by sonicating cell pellets resuspended in Tris buffered saline (TBS), pH 8.5, containing 0.25% Triton X-100. The sonicated suspensions were then centrifuged and pellets were resuspended in TBS buffer supplemented with 6 M guanidine hydrochloride . Resuspended His-tagged PaL SerD was recovered by immobilized metal ion affinity chromatography (IMAC) on columns packed with NiCl2. After concentration, the final process yield of eluted PaL SerD protein was 65 mL @ 159.4 μg/mL.
Example 5 :
This example illustrates a protocol for purifying high levels of properly-folded recombinant C. trachomatis SerD major outer membrane protein (MOMP) protein from B. coli for use in a vaccine .
The gene encoding C. trachomatis SerD MOMP was amplified by PCR from total DNA harvested from McCoy mouse fibroblast cells infected with C. trachomatis SerD. MOMP PCR product was cloned into plasmid pTrck-CtD to create pTrck-CtD-dS-MOMP and the native N-terminal signal sequence was deleted and three optimized codons present at the start of MOMP in were reverted to the non-optimized sequence by "mutations" encoded in the forward construction primer. Truncated MOMP gene was amplified from pTrcK-CtD-dS-MOMP and the resulting PCR product was restricted with Sail to yield the insert DNA. Plasmid pET-15b was restricted with Ncol , the recessed ends were extended, and then restricted with Xhol . MOMP insert DNA was cloned into the blunted JVcoI site and the Xhol site (Xhol and Sail generate complementary overhangs) of the vector, thereby controlling orientation of the insert in the resulting expression plasmid pJL6 (Figure 7) .
To produce recombinant MOMP protein folded into its native conformation, pellets from pJL6-transformed E. coli BL21(DE3) cells expressing MOMP with the deduced amino acid sequence listed in Figure 8 (SEQ ID No: 8) were sonicated and inclusion bodies from the homogenate were sedimented by centrifugation following detergent extraction. The inclusion body preparation was solubilized with urea, and this mixture was loaded onto a Q-type anion exchange column. The column was washed with urea, and retained protein was eluted in a NaCl gradient that also included urea, maintaining the protein in a denatured and soluble state. Eluted fractions containing purified MOMP were pooled and concentrated by diafiltration. The concentrate was mixed with an equal volume of buffer containing the detergent Zwittergent 3-14, and this mixture was applied to a column packed with Superdex 200 size exclusion gel. The material was passed through the column and fractions were collected. A broad peak corresponding to a molecular weight range of 40-500 kDa (based on previous calibration runs) was retained, and in some cases concentrated by diafiltration. The material remained soluble at concentrations exceeding 1 mg/mL. Semi- native SDS-PAGE gels and Western blots showed a series of distinct higher molecular weight bands; this finding, along with the molecular weight range established by size-exlcusion chromatogrphy, suggested that the protein was folded such that it demonstrated the ability to form multimers. That the protein had assumed conformational aspects of the native protein was also suggested by circular dichroism studies which detected the putative beta-barrel structure found in the native protein, and by semi-native SDS-PAGE gels with native MOMP, in which a similar banding pattern was observed.
Example 6 :
Pal protein is expressed by at least three distinct groups of Chlamydiae: C. trachomatis (serovar D) , C. trachomatis MoPn (also known as C. muridarum) , and C. pneumoniae (serovars CWL029 and AR39) . Figure 9A shows the full-length amino acid sequences of PaL from each of these three Chlamydiae. Each of the PaL sequences in Figure 9A have at their N-termini characteristic gram-negative signal sequences that target the nascent protein to the exterior of the cell . The signal sequences can be identified because they conform to a recognized consensus sequence (Juncker et al . , Protein Science (2003) 12 :1652) .
Such signal sequences are cleaved from the immature protein prior to its export from the cell. Since mature PaL expressed on the exterior of Chlamydiae lacks the N-terminal signal sequence, the cleaved form of the protein is the more immunologically-relevant form than the full-length form.
Furthermore, the relative variability of PaL among different Chlamydiae is reduced by removal of the signal sequence. This may enhance the probability that a vaccine targeted to PaL from a particular species or serovar will cross-react with PaL from a different serovar or species.
The cleaved forms of PaL from C. trachomatis (SerD) , C. trachomatis MoPn, and C. pneumoniae (serovars CWLO29 and AR39) are shown in Figure 9B as alignments performed using the BLAST algorithm available on the web page of the National Center for Biotechnology Information (NCBI) at www.ncbi.nlm.nih.gov. PaL
SerD and PaL MoPn are the most closely-related of the three molecules, with a sequence identity of 96 percent. PaL from C. pneumoniae is more divergent and shares only 69 percent sequence identity with PaL SerD, although approximately one third of the different amino acids are conservative replacements .
Example 7 :
This example illustrates a protocol for immunization of mice with PaL SerD DNA and protein to achieve protection against an intranasal (i.n.) challenge with C. trachomatis MoPn. Groups of 7- to 9-week old male Balb/c mice (8 to 10 per group) received priming immunizations intramuscularly (i.m.) with plasmid DNA containing an insert coding for PaL SerD. Alternate left and right quadriceps were injected with 100 μg of DNA in 50 μl of the adjuvant 3 b- (N- (N1 ,N1 -dimethyl aminomethane) -carbamoyl) cholesterol (DC Choi) on three occasions at experimental weeks 0, 3 and 6. Three weeks afterwards, mice receiving boosting i.n. immunizations at experimental weeks 9, 12 and 15. For i.n. immunization, anaesthetized mice were aspirated 50 μl of DC-Choi containing 5 μg of recombinant PaL SerD protein. At week 18, immunized mice were inoculated i.n. with 5 x 105 IFU of C. trachomatis MoPn EB in lOOμl of SPG buffer to test their ability to limit the growth of a sublethal MoPn EB challenge.
To assess effectiveness of protection, lungs were taken from mice at day 9 post-challenge and immediately homogenised in SPG buffer (7.5% sucrose, 5 mM glutamate, 12.5 ttiM phosphate, pH 7.5) . The homogenate was stored frozen at -70 0C until assay. Dilutions of the homogenate were assayed for the presence of infectious Chlamydia by inoculation onto monolayers of susceptible HeLa cells. The inoculum was centrifuged onto the cells at 3000 rpm for 1 hour, then the cells were incubated for three days at 35 0C in the presence of 1 μg/ml cycloheximide . After incubation the monolayers were fixed with formalin and methanol then immunoperoxidase stained for the presence of
Chlamydial inclusions using the primary antibody CT-MOMP-VD at 1/200 dilution in 0.1% BSA in PBS and horseradish peroxidase- conjugated goat anti-rabbit secondary antibody at 1/3000 dilution in l/70th volume of goat serum and 5% FBS in PBS. Metal-enhanced DAB was used as a peroxidase substrate to visualize and count Chlamydial inclusions within HeLa cells under a microscope. Results of a representative experiment of the kind described above are depicted in Figure 10, which demonstrates the protective effect of immunization with PaL SerD DNA and protein against subsequent i.n. challenge with MoPn.
Example 8 :
This example illustrates a protocol for immunization of mice with PaL SerD protein to achieve protection against an intravaginal (IVAG) challenge with C. trachomatis MoPn.
At experimental day -7, Balb/c mice were administered 2.5 mg of depo provera in a volume of 200 μl subcutaneously (s.c.) to induce a diestrous-like state. At day 0 mice were challenged IVAG with 104 inclusion forming units (IFU) of C. trachomatis MoPn. On days 21, 44, and 65 mice were immunized s.c. or i.m with 5 μg of recombinant PaL SerD protein with Montanide/CpG adjuvant in a total volume of 200 μl (s.c.) or 100 μl (i.m.) .
On day 91, 2.5 mg of depo provera in a volume of 200 μl was administered s.c. to induce a diestrous-like state and then mice were again challenged IVAG with 104 IFU of C. trachomatis MoPn.
Vaginal washes were collected every 3 days until experimental day 148. IVAG Chlamydial shedding was assessed by subjecting the vaginal washes to the assay system described in Example 7.
Figure 11 shows the inclusion forming units (IFU) of C. trachomatis MoPn per vaginal wash in mice challenged intra- vaginally with C. trachomatis MoPn following immunization with the indicated substances. In particular, the data in Figure 11 indicate that immunization with PaL SerD protein has a protective effect against IVAG challenge with MoPn. Example 9 :
This example illustrates a protocol for immunization of mice with MOMP SerD protein alone or in combination with PaL SerD protein to achieve protection against an intravaginal (IVAG) challenge with C. trachomatis SerD.
At experimental day -1, C3H mice were administered 2.5 mg of depo provera in a volume of 200 μl subcutaneously (s.c.) to induce a diestrous-like state. At day 0 mice were immunized s.c. or i.m with 10 μg of MOMP SerD or 5 μg of MOMP SerD + 5 μg PaL SerD formulated in Montanide/CpG adjuvant in a total volume of 200 μl (s.c.) or 100 μl (i.m.) . Protein immunizations were repeated on days 26 and 46 as described and on day 48 the mice were again administered with 2.5 mg of depo provera in a volume of 200 μl subcutaneously (s.c.) to induce a diestrous-like state.
Starting on experimental day 55 and continuing every three days until day 104, vaginal washes were collected and IVAG Chlamydial shedding was assessed by subjecting the vaginal washes to the assay system described in Example 7.
Figure 12 shows the inclusion forming units (IFU) of C. trachomatis SerD per vaginal wash in mice challenged intra- vaginally with C. trachomatis SerD following immunization with the indicated substances. In particular, the data in Figure 12 indicate that immunization with MOMP SerD protein alone or in combination with PaL SerD protein has a protective effect against IVAG challenge with C. trachomatis SerD.
Example 10:
This example illustrates a protocol for analyzing the serum IgG responses of mice immunized with PaL or MOMP proteins as well as a method of predicting T cell epitopes within the amino acid sequences of PaL protein from C. trachomatis SerD, MoPn, and C. pneumoniae.
Mice immunized in the manner described in Example 8 (Pal protein alone) and Example 9 (MOMP protein alone) were bled and serum separated from the collected blood was analyzed by- sandwich enzyme-linked immunosorbant assay (ELISA) to determine the titres of PaL- and MOMP-specific immunoglobulin G (IgG) antibodies (Ab) generated in response to immunization with recombinant PaL or MOMP or with whole EB.
To coat plates for ELISA, 50 μL of chromatography-purified recombinant PaL or MOMP antigen was coated on wells of Nunc- immuno Maxi Sorp flat bottom microtitre plates by incubating antigen at a concentration of 1.0 μg/ml overnight at room temperature in 0.05 M carbonate-bicarbonate buffer, pH 9.6.
Wells were blocked for non-specific binding by adding 250 μL of 1% BSA in PBS and incubating for 1 hour at room temperature, followed by two washes in a washing buffer of PBS + 0.1% Tween 20.
Mouse sera were diluted in 4 fold serial dilutions in an assay buffer of 0.1% BSA in PBS + 0.1% Tween 20, and 150 μL volume was added to wells. After a 1-hour incubation at room temperature, plates were washed five times with washing buffer.
A volume of 100 μL of the appropriate horseradish peroxidase- conjugated secondary antibody was added as follows: for total IgG, F(ab')2 goat anti-mouse IgG (H+L specific) -HRP, from
Jackson Immuno Research Laboratory Inc. at 1/20K dilution; for IgGl, sheep anti-mouse IgGl (Fc specific) -HRP from Serotec at 1/5K dilution; for IgG2a goat anti-mouse IgG2a (Fc specific) - HRP from Caltag Laboratories at 1/20K dilution. Following a 1- hour incubation at room temperature, the plates were washed five times with washing buffer.
A volume of 100 μL H2O2 plus tetramethylbenzidine (TMB) 9/1 was added. Following a 15 min incubation at room temperature, the color reaction was stopped by addition of 50 μL of 1 M H2SO4, and read in a colorimetric microplate reader, using wavelength 450 nm and a reference wavelength of 540 nm. The intensity of the color is directly proportional to the amount of Pal- or MOMP-specific antibody in the well.
The titre is taken as the reciprocal of the last dilution at which the optical density (OD) is approximately double. This OD must be greater than that of negative controls comprised of pre-immune or placebo group sera at the starting dilutions. The test was validated with a positive control serum of predetermined titre.
The results obtained are summarized in Tables 2-4. The data in Tables 2 and 3 indicate that mice mounted a robust balanced humoral IgG response to immunization with PaL or MOMP proteins compared to unimmunized (naive) negative control mice. The results in Table 4 indicate that immunizing with protein elicited much higher specific IgG production than did immunization with live or UV-inactivated Chlamydiae.
Since robust humoral responses to protein antigens depend on help from corresponding type-2 helper T cells (TH2) , the N- terminal truncated amino acid sequence of PaL from C. trachomatis SerD, MoPn, and C. pneumoniae were analyzed to identify peptide sequences that, when released by proteolysis, could bind to the class-II major histocompatibility complex (MHC) and serve as epitopes for by TH2 cells. The data, which are presented in Tables 5-10, indicate the presence of a number of consensus sequences that are conserved between PaL from C. trachomatis SerD, MoPn, and C. pneumoniae.
It has been shown that cytotoxic T cell (CTL) responses are also required for resistance to Chlamydia infections. CTL recognize intracellular peptide antigens in the context of MHC class I. The N-terminal truncated amino acid sequence of PaL from C. trachomatis SerD, MoPn, and C. pneumoniae were analyzed to identify peptide sequences that, when released by proteolysis, could bind to the class- I major histocompatibility complex (MHC) and serve as epitopes for by CTL. The data, which are presented in Tables 5rlO, indicate the presence of a number of consensus sequences that are conserved among PaL from C. trachomatis SerD, MoPn, and C. pneumoniae.
Analysis of the epitope regions throughout the length of the PaL sequences reveal the following.
PaL MHC-II major conserved epitopes:
(a) pneu VHYMKKNPK
SerD VRHLHKSPK
MoPn VRHLRKSPK
Thus a consensus sequence comprises the nonamer
Al n2 n3 n4 n5 A6 n.7 Pro A9 where
the 1st residue is VaI, Leu, lie or Phe (VaI is preferred);
the 6th residue is Lys, Arg, or His (Lys is preferred) ;
the 8th residue is Proline;
the 9th residue is Lys, Arg or His (Lys is preferred); n can be any amino acid.
(b) pneu IKGEENLAITNL-VH
SerD IKGEDNLTILASLVR
MoPn IKGEDNLTLLASLVR
Thus a consensus sequence comprises the nonamer
Al A2 GIy A4 A5 Asn A7 A8 A9 where
the 1st residue is lie, Leu, VaI or Phe (lie is preferred) ;
the 2nd residue is Lys, Arg, or His (Lys is preferred) ;
the 3rd residue is Glycine;
the 4th residue is GIu or Asp (GIu is preferred) ;
the 5th residue is GIu or Asp;
the 6th residue is Asn;
the 7th residue is Leu, lie, VaI, or Phe (Leu is preferred) ;
the 8th residue is Thr, Ala or Ser (Thr is preferred) ;
the 9th residue is VaI, lie, Leu or Phe.
(c) pneu FVPFYSDEE
SerD FVPFYSDEE
pneu FVPLYTEED
Thus a consensus sequence comprises the nonamer
Al A2 Pro n Tyr A6 A7 A8 A9 where
the 1st residue is Phe, Leu, lie or VaI (Phe is preferred) ; the 2nd residue is VaI, lie, Leu, or Phe (VaI is preferred) ; the 3rd residue is Pro;
the 5th residue is Tyr;
the 6th residue is Ser or Thr;
the 7th residue is Asp or GIu;
the 8th residue is GIu or Asp (GIu is preferred) ;
the 9th residue is GIu or Asp; n is any amino acid,
(d) A consensus sequence comprising the nonamer
Trp GIn Gin Asn Arg Arg Thr GIu Phe
(e) pneu LRKQGISA
SerD LIKQGIAA
MoPn LRKQGIAS
Thus a consensus sequence comprises the 8-mer
Al n A3 GIn A5 A6 A7 A8 where
the 1st residue is Leu, lie, VaI, or Phe (Leu is preferred);
the 3rd residue is Lys, Arg or His (Lys is preferred);
the 4th residue is Gin;
the 5th residue is GIy or Ala (GIy is preferred) ;
the 6th residue is lie, Leu, VaI or Phe (lie is preferred) ;
the 7th residue is Ser, Ala, Thr or GIy;
the 8th residue is Ser, Ala, Thr or GIy. PaL MHC-I major conserved epitopes:
The MHC-I epitopes are about 8-12 residues.
(a) pneu KGEENLAILT
SerD KGEDNLTILA
MoPn KGEDNLTILA
A consensus sequence comprises the sequence
Al GIy A3 A4 Asn A6 A7 A8 A9 AlO where
the 1st residue is Lys, Arg or His (Lys is preferred) ;
the 2nd residue is GIy;
the 3rd residue is GIu or Asp (GIu is preferred) ;
the 4th residue is GIu or Asp;
the 5th residue is Asn;
the 6th residue is Leu, lie, VaI or Phe (Leu is preferred) ;
the 7th residue is Ala, Thr or Ser (Ala is preferred) ;
the 8th residue is lie, Leu, VaI or Phe (lie is preferred) ;
the 9th residue is Leu, ILe, VaI or Phe (Leu is preferred) ;
the 10th residue is Thr, Ala or Ser.
(b) pneu AAFRNITFA
SerD TSFRNITFA
MoPn TSFRNITFA
A consensus sequence comprises the sequence Al A2 A3 A4 Asn A6 A7 A8 A9 where
the 1st residue is Ala, Thr, or Ser;
the 2nd residue is Ala, Thr, or Ser;
the 3rd residue is Phe, Tyr, He, Leu or VaI (Phe is preferred) ;
the 4th residue is Arg, Lys or His (Arg is preferred) ;
the 5th residue is Asn;
the 6th residue is lie, Leu, VaI or Phe (lie is preferred);
the 7th residue is Thr, Ala, or Ser (Thr is preferred) ;
the 8th residue is Phe, Tyr, He, Leu, VaI (Phe is preferred) ;
the 9th residue is Ala, Thr or Ser (Ala is preferred) .
(c) A consensus sequence comprising the nonamer
Leu Ala Trp GIn Gin Asn Arg Arg Thr
(d) pneu ERGAASYNL
SerD ERGAAAYNL
MoPn ERGAAAYNL
A consensus sequence comprises the sequence
Al A2 GIy A4 A5 A6 A7 Asn A9 where
the 1st residue is GIu or Asp (GIu is preferred) ;
the 2nd residue is Arg, Lys or His (Arg is preferred) ; the 3rd residue is GIy;
the 4th residue is Ala, Ser or Thr (Ala is preferred) ;
the 5th residue is Ala, Ser or Thr (Ala is preferred) ;
the 6th residue is Ala, Ser or Thr (Ala is preferred) ;
the 7th residue is Tyr or Phe (Tyr is preferred) ;
the 8th residue is Asn;
the 9th residue is Leu, lie, VaI or Phe (Leu is preferred) .
(e) pneu KEHLRKQGI
SerD KQYLIKQGI
MoPn KQYLIKQGI
A consensus sequence comprises the sequence
Al n2 n.3 A4 n5 A6 GIn GIy A9 where
the 1st residue is Lys, Arg or His (Lys is preferred) ;
the 4th residue is Leu, lie, VaI or Phe (Leu is preferred) ;
the 6th residue is Lys, Arg or His (Lys is preferred) ;
the 7th residue is Gin;
the 8th residue is GIy;
the 9th residue is ILe, Leu, VaI or Phe (lie is preferred) ;
n is any amino acid.
(f) pneu RANAIKEH
SerD RANAVKQY MoPn RANAVKQY
A consensus sequence comprises the sequence
Al A2 n3 A4 A5 A6 n7 n8 where
the Is residue is Arg, His or Lys (Arg is preferred) ;
the 2 residue is Ala, Ser or Thr (Ala is preferred) ;
the 4 residue is Ala, Ser or Thr (Ala is preferred) ;
the 5 residue is lie, VaI, Leu or Phe (lie is preferred);
the 6 -th residue is Lys, His or Arg (Lys is preferred) ;
n is any amino acid.
Figure imgf000063_0001
Figure imgf000064_0001
Figure imgf000065_0001
Figure imgf000066_0001
Figure imgf000067_0001
Figure imgf000068_0001
Figure imgf000069_0001
Figure imgf000070_0001
Figure imgf000071_0001
Figure imgf000072_0001
Figure imgf000073_0002
Figure imgf000073_0001
Figure imgf000074_0001
Figure imgf000075_0001
Figure imgf000076_0001
Figure imgf000077_0001
Figure imgf000078_0001
Figure imgf000079_0001
Figure imgf000080_0001
Figure imgf000081_0001
Figure imgf000082_0001
Figure imgf000083_0001
All published documents mentioned in the above specificatidh' are herein incorporated by reference. Various modifications and variations of the described invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific preferred embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Various modifications of the above-described modes for carrying out the invention which are obvious to those skilled in the field of genetics and molecular biology or related fields are intended to be within the scope of the following claims.

Claims

WE CLAIM :
1. A vaccine composition comprising a vaccine vector encoding a polypeptide, or comprising the polypeptide, wherein the polypeptide:
(i) comprises an amino acid sequence having at least 69% amino acid sequence identity to SEQ ID NO : 6 and
(ii) comprises at least one of any combination of the sequences :
(a) Al n.2 n3 n.4 n.5 A6 n7 Pro A9 where
the 1st residue is VaI, Leu, lie or Phe (VaI is preferred) ;
the 6th residue is Lys, Arg, or His (Lys is preferred);
the 8th residue is Proline;
the 9th residue is Lys, Arg or His (Lys is preferred) ;
n can be any amino acid;
(b) Al A2 GIy A4 A5 Asn A7 A8 A9 where
the 1st residue is lie, Leu, VaI or Phe (lie is preferred) ;
the 2nd residue is Lys, Arg, or His (Lys is preferred) ;
the 3rd residue is Glycine;
the 4th residue is GIu or Asp (GIu is preferred) ;
the 5th residue is GIu or Asp;
the 6th residue is Asn;
the 7th residue is Leu, lie, VaI, or Phe (Leu is preferred) ; the 8th residue is Thr, Ala or Ser (Thr is preferred) ;
the 9th residue is VaI, lie, Leu or Phe;
(c) Al A2 Pro n Tyr A6 A7 A8 A9 where
the 1st residue is Phe, Leu, lie or VaI (Phe is preferred) ;
the 2nd residue is VaI, lie, Leu, or Phe (VaI is preferred) ; the 3rd residue is Pro;
the 5th residue is Tyr;
the 6th residue is Ser or Thr;
the 7th residue is Asp or GIu;
the 8th residue is GIu or Asp (GIu is preferred) ;
the 9th residue is GIu or Asp; n is any amino acid;
(d) Trp GIn GIn Asn Arg Arg Thr GIu Phe;
(e) Al n A3 Gin A5 A6 A7 A8 where
the 1st residue is Leu, lie, VaI, or Phe (Leu is preferred) ;
the 3rd residue is Lys, Arg or His (Lys is preferred) ;
the 4th residue is GIn;
the 5th residue is GIy or Ala (GIy is preferred) ;
the 6th residue is lie, Leu, VaI or Phe (lie is preferred) ;
the 7th residue is Ser, Ala, Thr or GIy;
the 8th residue is Ser, Ala, Thr or GIy;
(f) Al GIy A3 A4 Asn A6 A7 A8 A9 AlO where the 1st residue is Lys, Arg or His (Lys is preferred) ;
the 2nd residue is GIy;
the 3rd residue is GIu or Asp (GIu is preferred) ;
the 4th residue is GIu or Asp;
the 5th residue is Asn;
the 6th residue is Leu, lie, VaI or Phe (Leu is preferred);
the 7th residue is Ala, Thr or Ser (Ala is preferred) ;
the 8th residue is lie, Leu, VaI or Phe (lie is preferred) ;
the 9th residue is Leu, ILe, VaI or Phe (Leu is preferred) ;
the 10th residue is Thr, Ala or Ser;
(g) Al A2 A3 A4 Asn A6 A7 A8 A9 where
the 1st residue is Ala, Thr, or Ser;
the 2nd residue is Ala, Thr, or Ser;
the 3rd residue is Phe, Tyr, lie, Leu or VaI (Phe is preferred) ;
the 4th residue is Arg, Lys or His (Arg is preferred) ;
the 5th residue is Asn;
the 6th residue is lie, Leu, VaI or Phe (lie is preferred) ;
the 7th residue is Thr, Ala, or Ser (Thr is preferred) ;
the 8th residue is Phe, Tyr, lie, Leu, VaI (Phe is preferred) ;
the 9th residue is Ala, Thr or Ser (Ala is preferred) ; (h) Leu Ala Trp GIn Gin Asn Arg Arg Thr;
(i) Al A2 GIy A4 A5 Aβ A7 Asn A9 where
the 1st residue is GIu or Asp (GIu is preferred) ;
the 2nd residue is Arg, Lys or His (Arg is preferred) ;
the 3rd residue is GIy;
the 4th residue is Ala, Ser or Thr (Ala is preferred) ;
the 5th residue is Ala, Ser or Thr (Ala is preferred) ;
the 6th residue is Ala, Ser or Thr (Ala is preferred) ;
the 7th residue is Tyr or Phe (Tyr is preferred) ;
the 8th residue is Asn;
the 9th residue is Leu, lie, VaI or Phe (Leu is preferred) ;
(j) Al n2 n3 A4 n5 A6 GIn GIy A9 where
the 1st residue is Lys, Arg or His (Lys is preferred) ;
the 4th residue is Leu, lie, VaI or Phe (Leu is preferred) ;
the 6th residue is Lys, Arg or His (Lys is preferred);
the 7th residue is Gin;
the 8th residue is GIy;
the 9th residue is ILe, Leu, VaI or Phe (lie is preferred) ;
n is any amino acid;
(k) Al A2 n3 A4 A5 A6 n7 n8 where
the 1st residue is Arg, His or Lys (Arg is preferred) ; the 2nd residue is Ala, Ser or Thr (Ala is preferred) ;
the 4th residue is Ala, Ser or Thr (Ala is preferred) ;
the 5th residue is lie, VaI, Leu or Phe (lie is preferred);
the 6th residue is Lys, His or Arg (Lys is preferred) ;
n is any amino acid.
2. The vaccine of claim 1 comprising the polypeptide and further comprising an adjuvant agent which facilitates delivery and/or enhance an immune response to the protein.
3. The composition according to claim 1 or 2 wherein the polypeptide is a fusion protein further comprising a heterologous sequence .
4. The composition according to claim 3 wherein the heterologous polypeptide is a peptide tail for purifying the protein.
5. The vaccine composition according to claim 1 wherein the adjuvant agent is a liposome.
6. The composition according to claim 5 wherein the liposome is at least one liposome selected from the group consisting of neutral liposomes, anionic liposomes, microspheres, ISCOMS, and virus-like-particles (VLPs).
7. The composition according to claim 2 which is suitable for parenteral administration.
8. The composition according to claim 7 wherein the adjuvant agent is at least one adjuvant selected from the group consisting of an aluminum compound, RIBI, polyphosphazene, DC- chol (3 b- (N- (N' ,N' -dimethyl aminomethane) -carbamoyl) cholesterol) and QS-21.
9. The composition according to claim 8 wherein the adjuvant is aluminum hydroxide, aluminum phosphate, or aluminum hydroxy phosphate.
10. The composition according to claim 2 which is suitable for mucosal administration.
11. The composition according to claim 10 wherein the adjuvant is at least one adjuvant selected from the group consisting of bacterial toxin, bacterial monophosphoryl lipid A (MPLA) , saponin, polylactide glycolide (PLGA) microsphere, polyphosphazene, DC-chol (3 b- (N- (N1 ,N' -dimethyl aminomethane) - carbamoyl) cholesterol), and QS-21.
12. The composition according to claim 11 wherein the adjuvant is at least one bacterial toxin selected from the group consisting of cholera toxin (CT) , E. coli heat-labile toxin (LT) , Clostridium difficile toxin A, pertussis toxin (PT), and combinations, subunits, toxoids, or mutants thereof that retain adjuvant activity and/or have reduced toxicity.
13. The composition according to claim 12 wherein the adjuvant is at least one bacterial toxin selected from the group consisting of native cholera toxin subunit B (CTB) , Arg- 7-Lys CT mutant, Arg-192-Gly LT mutant, Arg-9-Lys PT mutant, Glu-129-Gly PT mutant, Ser-63-Lys LT mutant, Ala-69-Gly LT mutant, GIu-110 -Asp LT mutant, and GIu- 112 -Asp LT mutant.
14. The composition according to claim 11 wherein the adjuvant is bacterial monophosphoryl lipid A (MPLA) of E. coli, Salmonella minnesota, Salmonella typhimurium, or Shigella flexneri .
15. The composition according to claim 1 in unit dosage form.
16. The vaccine composition according to claim 2 in unit dosage form.
17. The composition according to claim 16, further comprising an adjuvant agent.
18. The composition according to claim 17 wherein the agent is a liposome.
19. The composition according to claim 18 wherein the liposome is at least one liposome selected from the group consisting of neutral liposomes, anionic liposomes, microspheres, ISCOMS, and virus-like-particles (VLPs) .
20. The composition according to claim 16, further comprising an adjuvant.
21. The composition according to claim 20 which is suitable for parenteral administration.
22. The composition according to claim 21 wherein the adjuvant is at least one adjuvant selected from the group consisting of an aluminum compound, RIBI, polyphosphazene, DC- chol (3 b- (N- (N' ,N' -dimethyl aminomethane) -carbamoyl) cholesterol) and QS-21.
23. The composition according to claim 22 wherein the adjuvant is aluminum hydroxide, aluminum phosphate, or aluminum hydroxy phosphate .
24. The composition according to claim 23 which is suitable for mucosal administration.
25. The composition according to claim 24 wherein the adjuvant is at least one adjuvant selected from the group consisting of bacterial toxin, bacterial monophosphoryl lipid A (MPLA) , saponin, polylactide glycolide (PLGA) microsphere, polyphosphazene, DC-chol (3 b- (N- (N1 ,N' -dimethyl aminomethane) - carbamoyl) cholesterol), and QS-21.
26. The composition according to claim 25 wherein the adjuvant is at least one bacterial toxin selected from the group consisting of cholera toxin (CT) , E. coli heat-labile toxin (LT) , Clostridium difficile toxin A, pertussis toxin
(PT) , and combinations, subunits, toxoids, or mutants thereof that retain adjuvant activity and/or have reduced toxicity.
27. The composition according to claim 26 wherein the adjuvant is at least one bacterial toxin selected from the group consisting of native cholera toxin subunit B (CTB) , Arg- 7-Lys CT mutant, Arg-192-Gly LT mutant, Arg-9-Lys PT mutant, Glu-129-Gly PT mutant, Ser-63-Lys LT mutant, Ala-69-Gly LT mutant, Glu-110-Asp LT mutant, and Glu-112-Asp LT mutant.
28. The composition according to claim 25 wherein the adjuvant is bacterial monophosphoryl lipid A (MPLA) of E. coli, Salmonella minnesota, Salmonella typhimurium, or Shigella flexneri .
29. The composition according to claim 16, further comprising an additional Chlamydia protein that enhances an immune response to the polypeptide.
30. The vaccine composition according to claim 1 wherein the polypeptide is a fusion protein further comprising a heterologous polypeptide having adjuvant activity.
31. The vaccine composition according to claim 30 wherein the heterologous polypeptide having adjuvant activity is suitable as an adjuvant for parenteral administration.
32. The vaccine composition according to claim 30 wherein the heterologous polypeptide having adjuvant activity is suitable as an adjuvant for mucosal administration.
33. The vaccine composition according to claim 32 wherein the heterologous polypeptide is subunit B of cholera toxin (CTB) or subunit B of E. coli heat-labile toxin (LTB) .
34. The vaccine composition according to claim 30 wherein the heterologous polypeptide is a strong T-cell epitope and/or a strong B-cell epitope.
35. The vaccine composition according to claim 34 wherein the heterologous polypeptide is a strong T-cell epitope and/or a strong B-cell epitope from hepatitis B virus core antigen.
36. The vaccine composition according to claim 30 further comprising an agent that facilitates delivery and/or enhance the immune response to the part of the protein having the amino acid sequence set forth in SEQ ID NO: 2 or the B-cell or T-cell epitope thereof.
37. The vaccine composition according to claim 36 wherein the agent that facilitates delivery and/or enhance the immune response is a liposome.
38. The vaccine composition according to claim 30 further comprising an adjuvant.
39. The vaccine composition according to claim 30 in unit dosage form.
40. A method for treating or preventing a Chlamydia infection, the method comprising the step of administering to a subject the vaccine composition as defined in claim 1.
41. A method for treating or preventing a Chlamydia infection, the method comprising the step of administering to a subject the vaccine composition as defined in claim 16.
42. A method for treating or preventing a Chlamydia infection, the method comprising the step of administering to a subject the vaccine composition as defined in claim 30.
43. A method for treating or preventing a Chlamydia infection, the method comprising the step of administering to a subject the vaccine composition as defined in claim 10, and further comprising the step of administering to the subject an antibiotic, an antacid, sucralfate, a cytokine immunomodulator or a combination thereof.
44. The method according to claim 43 wherein the antibiotic is a macrolide, a tetracycline, or a derivative thereof .
45. The method according to claim 43 wherein the antibiotic is azithromycin or doxicyclin, and wherein the immunomodulator is interleukin-2 (IL-2) , interleukin-12 (IL- 12) , or a steroid.
46. A vaccination kit comprising the vaccine composition as defined in claim 1 and instructions for its use in vaccinating a subject against Chlamydia infection.
47. A vaccination kit comprising the vaccine composition as defined in claim 16 and instructions for its use in vaccinating a subject against Chlamydia infection.
48. A vaccination kit comprising the vaccine composition as defined in claim 30 and instructions for its use in vaccinating a subject against Chlamydia infection.
49. A vaccination kit comprising the vaccine composition as defined in claim 10, at least one compound selected from the group consisting of an antibiotic, an antacid, sucralfate, a cytokine immunomodulator, and instructions for using the composition and compound in vaccinating a subject against Chlamydia infection.
50. The kit according to claim 49 wherein the antibiotic is a macrolide, a tetracycline, or a derivative thereof.
51. The kit according to claim 49 wherein the antibiotic is azithromycin or doxicyclin, and wherein the immunomodulator is interleukin-2 (IL-2) , interleukin-12 (IL-12) , or a steroid.
52. The vaccine composition according to claim 1 comprising the vaccine vector, wherein a nucleic acid encoding the polypeptide is operably linked to a promoter functional in a mammalian cell.
53. The vaccine composition according to claim 52 wherein the vaccine vector or the composition further comprises another nucleic acid encoding an additional polypeptide which enhances the immune response to the polypeptide.
54. The vaccine composition according to claim 52 wherein the promoter is a viral promoter.
55. The vaccine composition according to claim 54 wherein the promoter is cytomegalovirus (CMV) promoter.
56. The vaccine composition according to claim 52 wherein the nucleic acid encodes fusion polypeptide comprising a heterologous polypeptide.
57. The vaccine composition according to claim 56 wherein the heterologous polypeptide has adjuvant activity.
58. The vaccine composition according to claim 56 wherein the heterologous polypeptide is a strong T-cell epitope and/or a strong B-cell epitope.
59. The vaccine composition according to claim 59 wherein the strong T-cell epitope and/or a strong B-cell epitope is from hepatitis B virus core antigen.
60. The vaccine composition according to claim 52 further comprising an agent that facilitates delivery of the vaccine vector into a mammalian cell.
61. The composition according to claim 60 wherein the agent is a liposome.
62. The vaccine composition according to claim 52 in unit dosage form.
63. The vaccine composition according to claim 52 wherein the vaccine vector is unable to replicate in mammalian cells and unable to integrate substantially in a mammalian genome.
64. A vaccination kit comprising the vaccine composition as defined in claim 52 and instructions for its use in vaccinating a subject against Chlamydia infection.
65. A vaccination kit comprising: (i) a vaccine composition comprising a polypeptide in unit dosage form, wherein the polypeptide is as defined in claim 1; and (ii) a vaccine vector comprising a nucleic acid encoding the polypeptide is as defined in claim 1, operably linked to a promoter functional in a mammalian cell; for simultaneous, separate or sequential administration.
66. A vaccination kit comprising at least one container of a vaccine composition comprising a polypeptide in unit dosage form, wherein the polypeptide is as defined in claim 1; and optionally at least one container of a vaccine vector comprising a nucleic acid encoding the polypeptide as defined in claim 1, operably linked to a promoter functional in a mammalian cell, and instructions for using the polypeptide and optional vector in vaccinating a subject against Chlamydia infection.
67. A method for treating or preventing a Chlamydia infection, the method comprising the step of administering to a subject the vaccine composition as defined in any one of claims 1 to 39 and 52 to 63, in a prime-boost strategy.
68. The vaccine composition of any one of claims 1 to 39 and 52 to 63, further comprising nucleic acid encoding a polypeptide, or further comprising the polypeptide, wherein the polypeptide has at least 80% amino acid sequence identity to SEQ ID NO. 8 and comprises any combination of B-cell or T-cell epitope in SEQ ID NO. 8.
69. The method of any one of claims 40 to 45, further comprising administering a nucleic acid encoding a polypeptide, or administering the polypeptide, wherein the polypeptide has at least 80% amino acid sequence identity to SEQ ID NO. 8 and comprises any combination of B-cell or T-cell epitope in SEQ ID NO. 8.
70. The vaccine kit of any one of claims46to 51 and to 66, further comprising nucleic acid encoding a polypeptide, or further comprising the polypeptide, wherein the polypeptide has at least 80% amino acid sequence identity to SEQ ID NO. 8 and comprises any combination of B-cell or T-cell epitope in SEQ ID NO . 8.
PCT/CA2006/000894 2005-06-01 2006-06-01 Pal-based chlamydia vaccine Ceased WO2006128296A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US68576705P 2005-06-01 2005-06-01
US60/685,767 2005-06-01

Publications (1)

Publication Number Publication Date
WO2006128296A1 true WO2006128296A1 (en) 2006-12-07

Family

ID=37481187

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CA2006/000894 Ceased WO2006128296A1 (en) 2005-06-01 2006-06-01 Pal-based chlamydia vaccine

Country Status (1)

Country Link
WO (1) WO2006128296A1 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7485304B2 (en) * 1993-12-22 2009-02-03 Novartis Vaccines And Diagnostics Srl Non-toxic mucosal adjuvant
WO2017083337A1 (en) * 2015-11-10 2017-05-18 Ohio State Innovation Foundation Methods and compositions related to accelerated humoral affinity
US12263213B2 (en) 2023-03-02 2025-04-01 Sanofi Pasteur Compositions for use in treatment of Chlamydia

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999028475A2 (en) * 1997-11-28 1999-06-10 Genset Chlamydia trachomatis genomic sequence and polypeptides, fragments thereof and uses thereof, in particular for the diagnosis, prevention and treatment of infection
WO2001046224A2 (en) * 1999-12-22 2001-06-28 Aventis Pasteur Limited Chlamydia antigens and corresponding dna fragments and uses thereof
US6822071B1 (en) * 1998-11-12 2004-11-23 The Regents Of The University Of California Polypeptides from Chlamydia pneumoniae and their use in the diagnosis, prevention and treatment of disease
WO2005002619A2 (en) * 2003-06-26 2005-01-13 Chiron Corporation Immunogenic compositions for chlamydia trachomatis

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999028475A2 (en) * 1997-11-28 1999-06-10 Genset Chlamydia trachomatis genomic sequence and polypeptides, fragments thereof and uses thereof, in particular for the diagnosis, prevention and treatment of infection
US6822071B1 (en) * 1998-11-12 2004-11-23 The Regents Of The University Of California Polypeptides from Chlamydia pneumoniae and their use in the diagnosis, prevention and treatment of disease
WO2001046224A2 (en) * 1999-12-22 2001-06-28 Aventis Pasteur Limited Chlamydia antigens and corresponding dna fragments and uses thereof
WO2005002619A2 (en) * 2003-06-26 2005-01-13 Chiron Corporation Immunogenic compositions for chlamydia trachomatis

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
EKO F.O. ET AL.: "A novel recombinant multisubunit vaccine against Chlamydia", J. OF IMMUNOLOGY, vol. 173, no. 5, 1 September 2004 (2004-09-01), pages 3375 - 3382, XP003004839 *
ZHANG D.J. ET AL.: "Characterization of immune responses following intramuscular DNA immunization with the MOMP gene of Chlamydia trachomatis mouse pneumonitis strain", IMMUNOLOGY, vol. 96, no. 2, February 1999 (1999-02-01), pages 314 - 321, XP003004840 *

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7485304B2 (en) * 1993-12-22 2009-02-03 Novartis Vaccines And Diagnostics Srl Non-toxic mucosal adjuvant
WO2017083337A1 (en) * 2015-11-10 2017-05-18 Ohio State Innovation Foundation Methods and compositions related to accelerated humoral affinity
CN108367058A (en) * 2015-11-10 2018-08-03 俄亥俄州创新基金会 With the relevant method and composition of body fluid affinity of quickening
EP3373961A4 (en) * 2015-11-10 2019-07-31 Ohio State Innovation Foundation Methods and compositions related to accelerated humoral affinity
US10835601B2 (en) 2015-11-10 2020-11-17 Ohio State Innovation Foundation Methods and compositions related to accelerated humoral affinity
AU2016354444B2 (en) * 2015-11-10 2021-04-01 Ohio State Innovation Foundation Methods and compositions related to accelerated humoral affinity
US12263213B2 (en) 2023-03-02 2025-04-01 Sanofi Pasteur Compositions for use in treatment of Chlamydia

Similar Documents

Publication Publication Date Title
US7658934B2 (en) Chlamydia antigens and protein vaccine
EP1240331B1 (en) Chlamydia antigens and corresponding dna fragments and uses thereof
US20050002944A1 (en) Chlamydia antigens and corresponding DNA fragments and uses thereof
WO2002018595A9 (en) Moraxella polypeptides and corresponding dna fragments and uses thereof
US7081245B2 (en) Chlamydia antigens and corresponding DNA fragments and uses thereof
WO2001075111A2 (en) Chlamydia antigens and corresponding dna fragments and uses thereof
WO2001046225A2 (en) Chlamydia antigens and corresponding dna fragments and uses thereof
WO2001075113A2 (en) Chlamydia myosin heavy chain homolog as antigen, corresponding dna fragments and uses thereof
US7183402B2 (en) Chlamydia antigens and corresponding DNA fragments and uses thereof
US20080019994A1 (en) Immunization Against Chlamydia Infection
WO2001075114A2 (en) Chlamydia transmembrane protein as antigen, corresponding dna fragments and uses thereof
US20030225017A1 (en) Chlamydia antigens and corresponding DNA fragments and uses thereof
WO2006128296A1 (en) Pal-based chlamydia vaccine
EP1124849B1 (en) Chlamydia 98kd putative outer membrane protein and corresponding dna fragments and uses thereof
US20080166376A1 (en) Immunization Against Chlamydia Infection
MXPA01006663A (en) Chlamydia.
MXPA06005799A (en) Immunization against chlamydia
MXPA01005616A (en) Chlamydia
WO2001036456A2 (en) Chlamydia antigens and corresponding dna fragments and uses thereof
WO2000053764A1 (en) Chlamydia antigens and corresponding dna fragments and uses thereof
WO2001021802A1 (en) Chlamydia antigens and corresponding dna fragments and uses thereof
WO2001036457A2 (en) Chlamydia antigens and corresponding dna fragments and uses thereof

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase

Ref country code: DE

WWW Wipo information: withdrawn in national office

Country of ref document: DE

122 Ep: pct application non-entry in european phase

Ref document number: 06752736

Country of ref document: EP

Kind code of ref document: A1