MXPA01005616A - Chlamydia - Google Patents

Abstract

The present invention provides a method of nucleic acid, including DNA, immunization of a host, including humans, against disease caused by infection by a strain of Chlamydia, specifically C. pneumoniae, employing a vector containing a nucleotide sequence encoding a 98 kDa outer membrane protein of a strain of Chlamydia pneumoniae and a promoter to effect expression of the 98 kDa outer membrane protein gene in the host. Modifications are possible within the scope of this invention.

Description

ANTIGENS OF CHLAMYDIA AND CORROSIVE DECOXY-PYRUBONUCLEIC ACID FRAGMENTS AND USES OF SAME REFERENCE TO RELATED REQUESTS This application claims the benefit of the Provisional Application of E.U.A. No. 60/1 13,439, filed on December 1, 1998 and Provisional Application of E.U.A. No. 60 / 132,272, filed May 3, 1999.

FIELD OF THE INVENTION The present invention relates to 98 Kda of Chlamydia outer membrane protein antigen and corresponding DNA molecules, which can be used to prevent and treat Chlamydia infection in mammals such as humans.

BACKGROUND OF THE INVENTION The Chlamydiae are prokaryotes. They exhibit morphological and structural similarities with Gram-negative bacteria, including a trilaminar outer membrane containing lipopolysaccharides and several membrane proteins that are structurally and functionally analogous to the proteins found in E coli. They are obligate intracellular parasites with a unique biphasic life cycle consisting of a metabolically inactive but infectious extracellular stage and an intracellular stage of replication but not an infectious one. The replication stage of the life cycle takes place within an inclusion attached to the membrane that carries the bacteria out of the cytoplasm of the infected host cell. C. pneumoniae is a common human pathogen, originally described as the TWAR strain of Chlamydia psittaci, but was later recognized as a new species. C. pneumoniae is antigenically, genetically and morphologically distinct from other Chlamydia species (C. trachomatis, C. pecorum and C. psittaci). It shows 10% or less of DNA sequence homology, either with C. trachomatis or C. psittaci. C. pneumoniae is a common cause of collective acquired pneumonia, only less frequent than Streptococcus pneumoniae and Mycoplasma pneumoniae (Grayston et al. (1995) Journal of Infectious Diseases 168: 1231; Campos et al. (1995), Investigation of Ophthalmology and Visual Science 36 : 1477). It can also cause symptoms and diseases of the upper respiratory system, including bronchitis and sinusitis (Grayston et al. (1995) Journal of Infectious Diseases 168: 1231; Grayston et al. (1990) Journal of Infectious Diseases 161: 618; Marie (1993) Journal of Infectious Diseases 18: 501, Wang et al. (1986) "Chlamydial Infections", Cambridge University Press, Cambridge, page 329. The vast majority of the adult population (more than 60%) has antibodies to C. pneumoniae (Wang et al. (1986) "Chlamydial Infections" Cambridge University Press, Cambridge, page 329), which indicate a past infection that was not recognized or that was asymptomatic.C. pneumoniae infection usually presents as an acute respiratory disease (ie, cough, sore throat, aphonia and fever, abnormal chest sounds during auscultation.) In most patients, the cough persists for 2 to 6 weeks, and recovery is slow, in approximately 10% of these cases, the inf Upper respiratory tract edema is followed by bronchitis or pneumonia. In addition, during a C. pneumoniae epidemic, a subsequent coinfection with pneumococci has been noted in about half of these patients with pneumonia, particularly in the weak and the elderly. As explained above, there is increasing evidence that C. pneumoniae infection is also linked to diseases other than respiratory infections. It is presumed that the body's deposit is the people. Unlike C. psittaci infections, there is no bird or animal known as a deposit. The transmission has not been clearly defined. It can derive from direct contact with secretions, contaminated particles or airborne propagation. There is a long incubation period, which can last for many months. Based on the analysis of the epidemics, C. pneumoniae seems to spread slowly in a population (with an average interval of 30 days between case and case) because the infected people are inefficient transmitters of the organism. Susceptibility to C. pneumoniae is universal. After primary infection during childhood, reinfections occur during adulthood. C. pneumoniae seems to be an endemic disease throughout the world, notable for overlapping intervals of increased incidence (epidemic) that persist for 2 to 3 years. C. trachomatis infection does not confer cross immunity for C. pneumoniae. Infections are easily treated with oral antibiotics, tetracycline or erythromycin (2 g / d for at least 10 to 14 days). Azithromycin, a newly developed drug, is highly effective as a single-dose therapy against Chlamydia infections. In most cases, C. pneumoniae infection is often light and uncomplicated and up to 90% of infections are subacute or unrecognized. Among children in industrialized countries, it has been thought that infections are rare until the age of 5 years, although a recent study (E. Norman and others "Chlamydia pneumoniae in children with acute respiratory tract infections", Acta Paediatrica, 1998, Vol. 87 Iss 1, pp 23-27) have reported that many children in this age group show CRP evidence of infection despite being seronegative, and estimate a frequency of 17-19% at ages 2 to 4. In countries in of development, the seroprevalence of C. pneumoniae antibodies among young children is high, and it is suspected that C. pneumoniae may be an important cause of acute lower respiratory tract disease and mortality for infants and children in tropical regions of the world.

According to seroprevalence studies and studies of local epidemics, initial C. pneumoniae infection usually occurs between the ages of 5 and 20. In the US, for example, it is estimated that there are 30,000 cases of childhood pneumonia caused by C. pneumoniae each year. Infections can be grouped into groups of children or young adults (that is, school-age children or military conscripts). C. pneumoniae causes 10 to 25% of lower respiratory tract infections acquired by the community (according to reports from Sweden, Italy, Finland, and the US). During an epidemic, C. pneumonia infection can be responsible for 50 to 60% of cases of pneumonia. During these periods, more episodes of mixed infections with S. pneumoniae have also been reported. In adulthood, reinfection is common; the clinical presentation tends to be lighter. Based on studies of population with seroprevalence, exposure seems to increase with age, which is particularly evident among men. Some researchers have speculated that a state of persistent and asymptomatic C. pneumoniae infection is common. In adults of middle age or older, C. pneumoniae infection can develop into chronic bronchitis and sinusitis. A study in the U.S. revealed that the incidence of pneumonia caused by C. pneumoniae in people under 60 years of age is 1 case per 1000 people per year; but in the elderly, the incidence of the disease rose three times.

Infection with C. pneumoniae rarely leads to hospitalization, except in patients with an underlying disease. The association of arteriosclerosis and infection with C. pneumoniae is of considerable importance. There are several epidemiological studies showing a correlation of previous infections with C. pneumoniae and heart attacks, diseases of the coronary artery and the carotid artery (Saikku et al. (1988) Lancet; ii: 983; Thom et al. (1992) JAMA 268 : 68; Linnanmaki et al. (1993), Circulation 87: 1030; Saikku et al. (1992) Annals Internal Medicine 116: 273; Melnick et al. (1993) American Journal of Medicine 95: 499). In addition, organisms have been detected in atheromas and sections with fat from the coronary, carotid, peripheral arteries and aorta arteries (Shor et al. (1992) South African, Medical Journal 82: 158, Kuo et al. (1993) Journal of lnfectious Diseases 167: 841; Kuo et al. (1993) Arteriesclerosis and Thrombosis 13: 1500; Campbell et al. (1995) Journal of Infectious Diseases 172: 585; Chiu et al., Circulation, 1997 (in press.) C. viable C. pneumoniae has been recovered of the coronary and carotid artery (Ramírez et al. (1996) Annals of lnternal Medicine 125: 979; Jackson et al., abstract, K121, p272, 36 ° ICAAC, 15-18 September 1996, New Orleans). demonstrated that C. pneumoniae can induce atherosclerosis changes in a rabbit model (Fong et al. (1997) Journal of Clinical Microbiology 35:48). Overall, these results indicate that it is highly possible that C. pneumoniae may cause arteriosclerosis in humans , although the importance of epid remains to be demonstrated epidemiology of arteriosclerosis by Chlamydia. Several recent studies have also indicated an association between C. pneumoniae infection and asthma. The infection has been related to hoarseness, asthmatic bronchitis, asthma of adult onset and acute exacerbations of asthma in adults, and small-scale studies have shown that prolonged antibiotic treatment was effective in greatly reducing the severity of the disease in some patients. individuals (Hahn DL, et al., "Evidence for Chlamydia pneumoniae infection in steroid-dependent asthma" Ann Alergy Asthma Immunol., January 1998; 80 (1): 45-49; Hahn DL et al., "Association of Chlamydia pneumoniae IgA antibodies with recently symptomatic asthma "Epidemiol Infecí., Dec. 1996; 117 (3): 513-517; Bjornsson E, and others," Serology of chlamydia in relation to asthma and bronchial hyperresponsiveness. "Scand J Infecí Dis. 1996; 28 (1): 63-69; Hahn DL. "Tratment of Chlamydia pneumoniae infection in adult asthma: a before-after trial" J Fam Pract. Oct. 1995; 41 (4): 345-351; Allegra L, et al., "Acute exacerbations of asthma in adults: role of Chlamydia pneumoniae infection" Eur Respir J Dec. 1994; 7 (12): 2165-2168; Hahn DL et al., "Association of Chlamydia pneumoniae (TWAR strain) infection with wheezing, asthmatic bronchitis and adult-onset asthma" JAMA Jui. 10, 1991; 266 (2): 225-230). In view of these results, a protective vaccine against C. pneumoniae infection would be of considerable importance. There is not yet an effective vaccine for any human Chlamydia infection. It is believed that an effective vaccine can be developed using physically or chemically inactivated Chlamydiae. However, such a vaccine does not have a high margin of safety. In general, the safest vaccines are made by genetically manipulating the organism with attenuation or with recombinant means. Therefore, the lack of genetic information on Chlamydia, specifically C. pneumoniae, has been a major obstacle to the creation of a safe and effective vaccine against human Chlamydia infection. Studies with C. írachomaiis and C. psittaci indicate that a safe and effective vaccine against Chlamydia is an achievable goal. For example, mice that have recovered from lung infection with C. frachomaiis are protected against infertility induced by subsequent vaginal exposure (Pal et al. (1996) Infection and Immunity 64: 5341). In the same way, sheep immunized with inactivated C. psittaci were protected against abortions and stillbirths subsequently induced by Chlamydia (Jones et al. (1995) Vaccine 13: 715). Protection against Chlamydia infections has been associated with Th1 immune responses, particularly the induction of INFg producing CD4 + T cells (Igietsemes et al. (1993) Immunology 5: 317). Adoptive transfer of lines or clones of CD4 + cells to hairless mice or SCID, conferred protection against exposure or franked chronic diseases (Igietseme et al. (1993J Regional Immunology 5: 317; Magee et al. (1993) Regional Immunology 5: 305), and in vivo suppression of CD4 + T cells exacerbated the disease after exposure (Landers et al. (1991) Infection &Immunity 59: 3774; Magee et al. (1995) Infection &Immunity 63: 516). presence of sufficiently high titers of neutralizing antibody on mucosal surfaces can also exert a protective effect (Cotter et al. (1995) Infection &Immunity 63: 4704) Antigenic variation within C. pneumoniae species is not well documented due to insufficient genetic information, although variation is expected based on C. trachomatis C. Trachomatis serovars are defined based on antigenic variation in the cipal outer membrane protein (MOMP), but the published gene sequences of C. pneumoniae MOMP, do not show variation among several diverse isolates of the organism (Campbell et al. (1990) Infection and Immunity 58:93; McCafferty et al. (1995) Infection and Immunity 63: 2387-9; Knudsen and others (1996) Third Congress of the European Society for Chlamydia Research, Vienna). The gene coding for a 76 kDa antigen has been cloned from a single strain of C. pneumoniae and the published sequence (Pérez Melgosa et al., Infecí Immun 1994, 62: 880). An operon has been described which codes for the outer membrane protein genes rich in 9 kDa and 60 kDa cysteine (Watson et al., Microbiology (1195) 141: 2489). Many antigens recognized by C. pneumoniae immune serum are conserved throughout Chlamydiae, but 98 kDa, 76 kDa and many other proteins may be specific for C. pneumoniae (Pérez Melgosa et al., Infecí Immun., 1994. 62 : 880; Melgosa et al., FEMS Microbial Lett (1993) 112: 199;, Campbell et al., J Clin Microbiol (1190) 28: 1261; Lijima et al., J Clin Microbiol (1994) 32: 583). An evaluation of the number and relative frequency of any serotype of C. pneumoniae, and the defining antigens is not yet possible. Now we know the complete sequence of genomes of the strain of C. pneumoniae CWL-029 (http://chlamydia-www.berkeley.edu:4231/) and as additional sequences become available, we can have a better understanding of variation antigenic Many antigens recognized by serum immune to C. pneumoniae are conserved across all Chlamydiae, but the 98kDa, 76kDa and 54kDa proteins appear to be specific for C. pneumoniae (Campos et al. (1995) Investigation of Ophthalmology and Visual Science 36 : 1477; Marie (1993) Clinical Infectious Diseases 18: 501; Wiedmann-AI Ahmad M, et al., "Reactions of Polyclonal and Neutralizing Anti-p54 Monoclonal Antibodies with an Isolated, Species-specific 54-Kilodalton Protein of Chlamydia Pneumoniae" Clin Diagn Lab Immunol Nov. 1997; 4 (6): 700-704). An immunoblot of isolates with patient sera does show a variation of blotting patterns among isolates, indicating that serotypes of C. pneumoniae may exist (Grayston et al. (1995) Journal of Infectious Diseases 168: 1231; Ramírez et al. (1996) Annals of Internal Medicine 125: 979). However, the results are potentially confusing because of the state of infection of the patients, since the immunoblot profiles of a patient's serum change with time after infection. An evaluation of the number and relative frequency of any of the serotypes and defining antigens is not yet possible. Therefore, there is a need to identify and isolate C. pneumoniae polynucleotide sequences for use in the prevention and treatment of Chlamydia infection.

BRIEF DESCRIPTION OF THE INVENTION The present invention provides purified and isolated polynucleotide molecules that encode the 98 KDa outer membrane protein of Chlamydia that can be used in methods to prevent, treat and diagnose Chlamydia infection. In one form of the invention, the polynucleotide molecules are DNAs encoding the CPN100640 polypeptides (SEQ ID Nos: 1 and 2). Another form of the invention provides polypeptides corresponding to the isolated DNA molecules. The amino acid sequences of the corresponding encoded polypeptides are shown as SEQ ID No: 3 and 4, wherein SEQ ID No: 3 is the complete sequence and SEQ ID No: 4 is the post-translationally processed sequence. Those skilled in the art will readily understand that the invention, having provided the polynucleotide sequences encoding the 98 KDa outer membrane protein of Chlamydia, also provides polynucleotides that encode fragments derived from such polypeptides. Furthermore, it is understood that the invention provides mutants and derivatives of such polypeptides and fragments derived therefrom, which originate from the addition, elimination or substitution of non-essential amino acids as described herein. Those skilled in the art will also readily understand that the invention, having provided the polynucleotide sequences encoding the Chlamydia polypeptides, further provides monospecific antibodies that specifically bind such polypeptides. The present invention has wide application and includes expression cassettes, vectors and cells transformed or transfected with the polynucleotides of the invention. Therefore, the present invention further provides (i) a method for producing a polypeptide of the invention in a recombinant host system and related expression cassettes, vectors, and transformed or transfected cells; (ii) a vaccine or a live vaccine vector, such as a poxvirus vector, of Salmonella typhimurium, or Vibrio cholerae, which contains a polynucleotide of the invention; such vaccines and vaccine vectors being useful, for example, for preventing and treating Chlamydia infection, in combination with a diluent or carrier, and related pharmaceutical compositions, and associated therapeutic and / or prophylactic methods; (iii) a therapeutic and / or prophylactic use of an RNA or DNA molecule of the invention, either in a simple form or formulated with a delivery vehicle, a polypeptide or combination of polypeptides, or a monospecific antibody of the invention, and related pharmaceutical compositions; (iv) a method for diagnosing the presence of Chlamydia in a biological sample, which may include the use of a DNA or RNA molecule, a monospecific antibody, or a polypeptide of the invention; and (v) a method for purifying a polypeptide of the invention by affinity chromotography based on antibodies.

BRIEF DESCRIPTION OF THE DRAWINGS The present invention will be better understood with the following description with reference to the drawings, in which: Figure 1 shows the nucleotide sequence of CPN100640 (SEQ ID NO: 1 - complete sequence and SEQ ID NO: 2 - coding sequence) and the deduced amino acid sequence of the CPN100640 protein from Chlamydia pneumoniae (SEQ ID NO: 3 - complete and 4 - processed). The sequence is encoded in the negative chain. Figure 2 shows the restriction enzyme analysis of the 98 kDa external membrane protein gene of C. pneumoniae. Figure 3 shows the construction and elements of plasmid pCAI640. Figure 4 illustrates the protection against infection of C. pneumoniae by pCAI640 followed by immunization with DNA.

DETAILED DESCRIPTION OF THE INVENTION In the genome of C. pneumoniae, open reading frames (ORF) have been identified that encode the 98 KDa outer membrane protein of Chlamydia. The gene encoding this protein has been inserted into an expression plasmid and has been shown to confer immune protection against Chlamydia infection. Therefore, this outer membrane protein and related polypeptides can be used to prevent and treat Chlamydia infection. According to a first aspect of the invention, isolated polynucleotides encoding the precursor and the mature forms of the Chlamydia polypeptides are provided, whose amino acid sequences are SEQ ID Nos: 3 and 4, respectively. The term "isolated polynucleotide" is defined as a polynucleotide removed from the environment in which it occurs naturally. For example, a natural DNA molecule, present in the genome of a living bacterium or as part of a gene bank, is not isolated; but the same molecule separated from the remaining part of the bacterial genome, as a result of a cloning event (enlargement) for example, is isolated. Generally, an isolated DNA molecule is free of regions of DNA (e.g., coding regions) with which it is immediately contiguous at the 5 'or 3' ends in the natural genome. Such isolated polynucleotides may be part of a vector or a composition and still be defined as isolates, since such a vector or composition is not part of the natural environment of such a polynucleotide. The polynucleotide of the invention can be RNA or DNA (cDNA, genomic DNA, or synthetic DNA), or modifications, variants, homologs or fragments thereof. The DNA can be double-stranded or single-stranded, and, if it is from a single strand, it can be the coding strand or the non-coding strand (antisense). Any of the sequences encoding the polypeptides of the invention, as shown in SEQ ID Nos: 1 and 2, is (a) a coding sequence, (b) a ribonucleotide sequence derived from the transcription of (a), or (c) a coding sequence that uses the redundancy or degeneracy of the genetic code to encode the same polypeptides. "Polypeptide" or "protein" refers to any chain of amino acids regardless of their length or post-translational modification (e.g., glycosylation or phosphorylation). Both terms are used interchangeably in this application. Consistent with the first aspect of the invention, amino acid sequences are provided which are homologous to any of SEQ ID Nos: 3 or 4. As used herein, a "homologous amino acid sequence" is any polypeptide that is encoded, total or partially, by a nucleic acid sequence that hybridizes at 25-35 ° C below the critical melting temperature (Tm), with any portion of the nucleic acid sequences of SEQ ID Nos: 1 and 2. A homologous sequence of amino acids is one that differs from an amino acid sequence shown in any of SEQ ID Nos: 3 or 4 by one or more conservative amino acid substitutions. Such a sequence also encompasses serotypic variants (defined below) as well as sequences containing deletions or insertions that retain inherent characteristics of the polypeptide, such as immunogenicity. Preferably, such a sequence is at least 75%, preferably 80%, and preferably 90% identical to SEQ ID NOS: 3 or 4. Homologous amino acid sequences include sequences that are identical or substantially identical to SEQ ID NOS: 3 or 4. "Substantially identical amino acid sequence" refers to a sequence that is at least 90%, preferably 95%, preferably 97%, and preferably 99% identical to a reference amino acid sequence, and which preferably differs from the reference sequence by a majority of conservative amino acid substitutions. Conservative amino acid substitutions are substitutions between amino acids of the same class. These classes include, for example, amino acids having uncharged polar side chains, such as asparagine, glutamine, serine, threonine, and tyrosine; amino acids having basic side chains, such as lysine, arginine and histidine; amino acids having acid side chains, such as aspartic acid and glutamic acid; and amino acids having non-polar side chains, such as glycine, alanine, valine, leucine, isolucin, proline, phenylalanine, methionine, tryptophan and cysteine.

Homology is measured using sequence analysis software, such as the software package "Sequence Analysis Software Package" from Computer Genetics Group, Center for Biotechnology, University of Wisconsin, University Avenue 1710, Madison, Wl 53705. The amino acid sequences they line up to maximize identity. To have a correct alignment, spaces can be introduced artificially in the sequence. Once the optimal alignment is established, the degree of homology is established by registering all the positions in which the amino acids of both sequences are identical, with respect to the total number of positions. The homologous polynucleotide sequences are defined similarly. Preferably, a homologous sequence is at least 45%, preferably 60% and preferably 85% identical to any of the coding sequences SEQ ID Nos: 1 or 2. Consistent with the first aspect of the invention, polypeptides having a sequence homologous to any of SEQ ID Nos: 3 or 4 include the allelic variants that occur naturally, as well as also mutants or any other variant that does not occur naturally, that retain the inherent characteristics of the polypeptide of SEQ ID Nos: 3 or 4. As is known in the art, an allelic variant is an alternate form of a polypeptide that is characterized by having a substitution, deletion or addition of one or more amino acids, which does not alter the biological function of the polypeptide. "Biological function" refers to the function of the polypeptide in the cells in which it occurs naturally, although the function is not necessary for the growth or survival of the cells. For example, the biological function of a porin is to allow entry into the cells of compounds present in the extracellular medium. The biological function is different from the antigenic property. A polypeptide can have more than one biological function. Allelic variants are very common in nature. For example, a bacterial species such as C. pneumoniae, is usually represented by a variety of strains that differ from each other by minor allelic variations. Certainly, a polypeptide that fulfills the same biological function in different strains, can have an amino acid sequence (and a polynucleotide sequence) that is not identical in each of the strains. Despite this variation, an immune response generally directed against many allelic variants has been demonstrated. In studies of the Chlamydia MOMP antigen, antibody binding occurs between crossed strains, plus neutralization of infectivity, despite the variation of MOMP amino acid sequences from strain to strain, indicating that, when used as an immunogen, it is tolerant of amino acid variations. Polynucleotides encoding homologous polypeptides or allelic variants are recovered by polymerase chain reaction (PCR) amplification of extracted genomic bacterial DNA by conventional methods. This includes the use of synthetic primer oligonucleotides that coincide towards the initial part and towards the final part of the 5 'and 3' ends of the coding domain. Appropriate initiators are designed according to the nucleotide sequence information provided in SEQ ID Nos: 1 to 10. The procedure is as follows: an initiator is selected consisting of 10 to 40, preferably 15 to 25 nucleotides. It is convenient to select primers containing C and G nucleotides in a sufficient proportion to ensure efficient hybridization; that is, an amount of C and G nucleotides of at least 40%, preferably 50% of the total nucleotide content. A standard PCR reaction typically contains 0.5 to 5 Units of Taq DNA polymerase per 100 μL, 20 to 200 μM of deoxynucleotide each, of preference at equivalent concentrations, 0.5 to 2.5 MM of magnesium on the total deoxynucleotide concentration, 105 to 106 of target molecules, and approximately 20 pmol of each primer. Nearly 25 to 50 PCR cycles are performed with a binding temperature of 15 ° C to 5 ° C below the actual Tm of the primers. A stricter binding temperature improves discrimination against mismatched primers and reduces the incorporation of incorrect nucleotides at the 3 'end of the primers. A denaturation temperature of 95 ° C to 97 ° C is normal, although higher temperatures are suitable for desmaduración of objectives rich in G + C. The number of cycles performed depends on the initial concentration of target molecules, although typically it is not recommended more than 40 cycles, since non-specific base products tend to accumulate.

An alternative method for recovering polynucleotides encoding homologous polypeptides or allelic variants, is through a hybridization test of a DNA or RNA library. Hybridization procedures are well known in the art and are described in Ausubel et al., (Ausubel et al., Current Protocols in Molecular Biology, John Wiley &Sons Inc., 1994), Silhavy et al., (Silhavy et al., Experiments. with Gene Fusions, Cold Spring Harbor Laboratory Press, 1984), and Davis et al., (Davis et al., A Manual for Genetic Engineering: Advanced Bacterial Genetics, Cold Spring Harbor Laboratory Press, 1980)). Important parameters to optimize the hybridization conditions are reflected in a formula used to obtain the critical temperature of fusion, above which two complementary strands of DNA are separated from each other (Casey &Davidson, Nucí, Acid Res. ) 4: 1539). For polynucleotides of about 600 nucleotides or larger, this formula is as follows: Tm = 81.5 + 0.41 x (% G + C) + 16.6 log (concentration of cationic ions) - 0.63 x (% formamide) -600 / base number. Under conditions of appropriate severity, the hybridization temperature (Th) is from about 20 to 40 ° C, 20 to 25 ° C, or, preferably 30 to 40 ° C below the calculated Tm. Those skilled in the art will understand that the optimum temperature and salt conditions can be easily determined. For the polynucleotides of the invention, the severity conditions, both for prehybridization and hybridization incubations, are achieved (i) in 4 - 16 hours at 42 ° C, in 6x SSC with 50% formamide, or (ii) in 4 - 16 hours at 65 ° C in a 6x SSC aqueous solution (1 M NaCl, 0.1 M sodium citrate (pH 7.0)). Typically, hybridization experiments are carried out at a temperature of 60 to 68 ° C, for example 65 ° C. At such a temperature, severe hybridization conditions can be achieved in 6xSSC, preferably in 2xSSC or 1xSSC, preferably in O.dxSSc, 0.3xSSC or O.lxSSC (in the absence of formamide). 1xSSC contains 0.15 M NaCl and 0.015 M sodium citrate. Useful homologs and their non-naturally occurring fragments are designed using known methods to identify regions of an antigen that are likely to tolerate changes and / or deletions in the amino acid sequence. As an example, homologous polypeptides from different species are compared and the sequences that are conserved are identified. The more divergent the sequences, the more likely they are to tolerate sequence changes. The homology between the sequences can be analyzed using the BLAST homology search algorithm of Altschul et al., Nucleic Acids Res .; 25: 3389-3402 (1997). Alternatively, the sequences are modified in such a way that they become more reactive to T and / or B cells, based on computer-assisted analysis of probable T or B cell epitopes. Another alternative is to mutate a particular amino acid residue or sequence in the polypeptide in vitro, then test the ability of the mutant polypeptides to prevent and treat Chlamydia infection according to the method described below.

A person skilled in the art will readily understand that, by following the test procedure of this invention, it can be determined without further experimentation whether a particular homolog of any of SEQ ID Nos: 3 or 4 can be useful in the prevention and treatment of infection by Chlamydia. The test procedure comprises these steps: (i) immunizing an animal, preferably a mouse, with the homologue or test fragment; (ii) inoculate the animal immunized with Chlamydia; and (iii) select those homologs or fragments that confer protection against Chlamydia. "Confer protection" means that there is a reduction in the severity of any of the effects of the Chlamydia infection, as compared to a control animal that was not immunized with the homologue or test fragment. This section appears as the first part of example 3 in -3, request for 2nd priority. It has previously been shown (Yang, ZP, Chi, EY, Kuo, CC and Grayston, JT 1993. A mouse model of C. pneumoniae strain TWAR pneumonitis 61 (5): 2037-2040) that mice are susceptible to infection intranasal with different isolates of C. pneumoniae. Strain AR-39 Chi, E. Y., Kuo, C. C. and Grayston, J. T. 1987. Unique ultrastructure in the elemental / body of Chlamydia sp. Strain TWAR. J. Bacteriol. 169 (8): 3757-63) was used in Balb / c mice as a model of infection by exposure to examine the ability of the Chlamydia gene products supplied as single DNA, to obtain a protective response against a sublethal infection of lungs by C. pneumoniae. Protective immunity is defined as an accelerated clearance of lung infection. Groups of Balb / c mice from 7 to 9 weeks of age (from 6 to 10 per group) were immunized intramuscularly (i.m.) and intranasally (i.n.) with plasmid DNA containing the coding sequence for a C. pneumoniae polypeptide. Groups of control animals were given saline or the plasmid vector lacking an inserted Chlamydia gene. For im immunization, 100μg of DNA in 50μl of PBS was alternately injected into the left and right quadriceps three times, at weeks 0, 3 and 6. For in immunization, the anesthetized mice aspirated 50μl of PBS containing 50μl. μg of DNA three times in weeks 0, 3 and 6. In week 8, the immunized mice were inoculated in with 5 x 105 IFU of C. pneumoniae, strain AR39 in 100μl of SPG buffer to test its ability to limit the growth of a sublethal exposure to C. pneumoniae. The lungs of the mice were removed on day 9 after exposure and immediately homogenized in SPG buffer (7.5% sucrose, 5mM glutamate, 12.5mM phosphate, pH7.5). The homogenate was stored frozen at -70 ° C until the time of testing. Dilutions of the homogenate were tested for the presence of infectious Chlamydia by inoculation in monolayers of susceptible cells. The inoculum was centrifuged in the cells for one hour at 3000rpm; then, the cells were incubated for three days at 35 ° C in the presence of 1 μg / ml cycloheximide. After incubation, the monolayers were fixed with formalin and methanol, and then labeled with immunoperoxidase to detect the presence of Chlamydia inclusions, using convalescent serum of rabbits infected with C. pneumoniae and DAB increased with metal, as a substrate of peroxidase . Consistent with the first aspect of the invention, polypeptide derivatives are provided which are partial sequences of SEQ ID Nos: 3 or 4, partial sequences of polypeptide sequences homologous to SEQ ID Nos: 3 or 4, polypeptides derived from full-length polypeptides by internal suppression, and fusion proteins. It is an accepted practice in the field of immunology to use fragments and variants of protein immunogens as vaccines, since all that is required to induce an immune response to a protein is a small immunogenic region of the protein ( for example, from 8 to 10 amino acids). It has been found that several short synthetic peptides corresponding to surface-exposed antigens of pathogens other than Chlamydia are effective as vaccine antigens against their respective pathogens, for example, a peptide of 11 murine mammary tumor virus residues (Casey & Davidson, Nucí, Acid Res. (1997) 4: 1539), a peptide from 16 residues of Semliki Forest virus (Snijders et al., 1991 J. Gen.

Virol. 72: 557-565), and two overlapping peptides of 15 residues each, of canine parvovirus (Langeveld et al., Vaccine 12 (15): 1473-1480, 1994). Therefore, it will be readily apparent to one skilled in the art, having read the present disclosure, that the partial sequences of SEQ ID No: 3 or 4, or their homologous amino acid sequences, are inherent to the full length sequences and are taught by the present invention. It is preferred that such polypeptide fragments be at least 12 amino acids in length. Conveniently, of at least 20 amino acids; preferably at least 50 amino acids; preferably 75 amino acids, and most preferably at least 100 amino acids in length. Polynucleotides of 30 to 600 nucleotides encoding partial sequences of sequences homologous to SEQ ID No: 3 or 4 are recovered by means of PCR amplification using the parameters described above and using primers that match the sequences towards the start and towards the end. of the 5 'and 3' ends of the fragment that will be enlarged. The polynucleotide used as a template for such an extension may be the full-length polynucleotide homologous to one of SEQ ID No: 1 to 10, or a polynucleotide contained in a mixture of polynucleotides such as a DNA or RNA library. As an alternative method for recovering the partial sequences, a test hybridization is carried out under the conditions described above using the formula for calculating Tm. When fragments of 30 to 600 nucleotides are expected to recover, the calculated Tm is corrected by subtraction (600? Polynucleotide size in base pairs) and the severity conditions are defined by a hybridization temperature that is 5 to 10 below Tm. . When it is expected to obtain shorter oligonucleotides at 20-30 bases, the formula to calculate the Tm is the following: Tm = 4 x (G + C) + 2 (A + T). For example, a fragment of 18 nucleotides of 50% G + C would have an approximate Tm of 54 ° C. Short peptides which are fragments of SEQ ID No: 3 or 4 or their homologous sequences, are obtained directly by chemical synthesis (E, Gross and H. J. Meinhofer, "4 The Peptides: Analysis, Synthesis, Biology; Modem Techniques of Peptide Synthesis, "John Wiley &Sons (1981), and M. Bodanzki," Principies of Peptide Synthesis ", Springer-Verlag (1984).) Derivatives of useful polypeptides, e.g., polypeptide fragments, are designed using computer-aided analysis of amino acid sequences, this would identify antigenic regions probably exposed on the surface (Hughes et al., 1992. Infecí.Immun.60 (9): 3497) The analysis of 6 amino acid sequences contained in SEQ ID. No: 3 or 4, based on the product of flexibility and hydrophobicity propensities using the SEQSEE program (Wishart DS et al., "SEQSEE: A Comprehensive Program Suite for Protein Sequence Analysis." Compu Appl Biosci, April 1994; 10 (2) : 121 -32), can reveal a number of potential epitopes of B and T cells that can be used as a basis to select useful immunogenic fragments and variants.This analysis uses a reasonable combination of surface characteristics. externally that can probably be recognized by antibodies. Probable T cell epitopes for subclass HLA-A0201 MHC, can be revealed by an algorithm that emulates an approach developed at the NIH (Parker KC and others "Peptide binding to MHC class I molecules: implications for antigenic peptide prediction" Immunol Res 1995; 14 (1): 34-57). Epitopes that induce a protective immune response dependent on T cells are present throughout the length of the polypeptide. However, some epitopes may be masked by secondary and tertiary structures of the polypeptide. To reveal such masked epitopes, large internal deletions are created that remove much of the original protein structure and expose the masked epitopes. Sometimes, such internal deletions affect the additional advantage of removing immunodominant regions of high variability between strains. Using standard methods (Ausubel et al., Current Protocols in Molecular Biology, John Wiley &Sons Inc., 1994), polynucleotides encoding polypeptide fragments and polypeptides having large internal deletions are constructed. Such methods include standard PCR, reverse PCR, restriction enzyme treatment of cloned DNA molecules, or the method of Kunkel et al. (Kunkel et al. Proc. Nati, Acad. Sci. USA (1985) 82: 448). Components for these methods and instructions for their use are available from various commercial sources such as Stratagene. Once the deletion mutants have been constructed, their ability to prevent and treat Chlamydia infection is tested as described above.

As used herein, a fusion polypeptide is one that contains a polypeptide or a polypeptide derivative of the invention fused at the N or C terminus with any other polypeptide (hereinafter referred to as a peptide tail). A simple way to obtain such a fusion polypeptide is by translating a frame fusion of the polynucleotide sequences; that is, a hybrid gene. The hybrid gene encoding the fusion polypeptide is inserted into an expression vector that is used to transform or transfect a host cell. Alternatively, the polynucleotide sequence encoding the polypeptide or polypeptide derivative is inserted into an expression vector in which the polynucleotide encoding the polypeptide tail is already present. Such vectors and instructions for their use are commercially available, for example, the pMal-c2 or pMal-p2 system from New England Biolabs, wherein the peptide tail is a maltose binding protein; the glutathione-S-transferase system from Pharmacia, or the His-Tag system available from Novagen. These and other expression systems provide convenient means for further purification of the polypeptides and derivatives of the invention. An advantageous example of a fusion polypeptide is one in which the polypeptide, or homolog, or fragment of the invention, is fused to a polypeptide having adjuvant activity, such as subunit B, either of the cholera toxin or the toxin. thermolabile of E. coli. Another advantageous fusion is that in which the polypeptide, homolog or fragment, is fused to a strong epitope of T cells or a B cell epitope. Such an epitope can be one known in the art (eg, the virus core antigen). of Hepatitis B, DR Millich et al., "Antibody production to the nucleocapsid and envelope of the Hepatitis B virus primed by a single synthetic T cell site", Nature 1987, 329: 547-549), or one that has been identified in another polypeptide of the invention based on computer-assisted analysis of probable T or B cell epitopes. Consistent with this aspect of the invention, there is a fusion polypeptide comprising T or B cell epitopes of one of SEQ ID No: 3 or 4 or its homologue or fragment, wherein the epitopes are derived from multiple variants of said polypeptide or homologue or fragment, each variant differing from another in the location and sequence of its epitope within the polypeptide. Such a fusion is effective in the prevention and treatment of Chlamydia infection, since it optimizes the response of T and B cells to the entire polypeptide, homologue or fragment. To effect fusion, the polypeptide of the invention is fused to the N-terminus, or preferably C, of the polypeptide having adjuvant or T-cell epitope or B activity. Alternatively, a polypeptide fragment of the invention is internally inserted into the the amino acid sequence of the polypeptide having adjuvant activity. The T or B cell epitope can also be inserted internally within the amino acid sequence of the polypeptide of the invention. Consistent with the first aspect, the polynucleotides of the invention also encode hybrid precursor polypeptides containing heterologous signal peptides, which are converted into mature polypeptides of the invention. "Heterologous signal peptide" refers to a signal peptide that is not found in the natural precursors of the polypeptides of the invention. A polynucleotide molecule according to the invention, which includes RNA, DNA, or its modifications or combinations, has several applications. For example, a DNA molecule is used, (i) in a process for producing the polypeptide encoded in a recombinant host system, (ii) in the construction of vaccine vectors such as smallpox viruses, which are also used in methods and compositions for preventing and / or treating Chlamydia infection, (iii) as a vaccine agent (also as an RNA molecule), in a simple form or formulated with a delivery vehicle and, (iv) in the construction of attenuated Chlamydia strains that can overexpress a polynucleotide of the invention or express it in a mutant, non-toxic form. Therefore, a second aspect of the invention comprises (i) an expression cassette containing a DNA molecule of the invention placed under the control of elements required for expression, in particular, under the control of an appropriate promoter.; (ii) an expression vector containing an expression cassette of the invention; (iii) a prokaryotic or eukaryotic cell transformed or transfected with an expression cassette and / or vector of the invention, as well as (iv) a method for producing a polypeptide or polypeptide derivative encoded by a polynucleotide of the invention, which involves culturing a prokaryotic or eukaryotic cell transformed or transfected with an expression cassette and / or vector of the invention, under conditions that allow the expression of the DNA molecule of the invention, and recovering the encoded polypeptide or polypeptide derivative from the cell culture. A recombinant expression system is selected from prokaryotic and eukaryotic hosts. Eukaryotic hosts include yeast cells (e.g., Saccharomyces cerevisiae or Pichia pastoris), mammalian cells (e.g., COS1, NIH3T3, or JEG3 cells), arthropod cells (e.g., Spodoptera frugiperda (SF9) cells), and plant cells. A preferred expression system is a prokaryotic host such as E. coli. Bacterial and eukaryotic cells are available from several different sources, including commercial sources, for those skilled in the art, for example, "The American Type Culture Collection" (ATCC, Rockville, Maryland). Commercial sources of cells that are used for the expression of recombinant protein also provide instructions for the use of the cells. The choice of the expression system depends on the characteristics desired for the expressed polypeptide. For example, it may be useful to produce a polypeptide of the invention in a particular lipid form or in any other form. The person skilled in the art will readily understand that all vectors and expression control sequences and hosts would not be expected to express equally well the polynucleotides of this invention.

However, with the guidelines described below, a selection of vectors, expression control sequences and hosts can be made without further experimentation and without departing from the scope of this invention. When selecting a vector, a host should be chosen that is compatible with the vector that is expected to exist and possibly doubled. Considerations are made regarding the number of copies of the vector, the ability to control the number of copies, the expression of other proteins such as resistance to antibiotics. When selecting an expression control sequence, several variables are considered. Among the important variables are the relative strength of the sequence (for example, the ability to drive expression under various conditions), the ability to control the function of the sequence, the compatibility between the polynucleotide to be expressed and the sequence of control (for example, secondary structures are considered to avoid fork structures that prevent efficient transcription). When selecting the host, unicellular hosts are selected that are compatible with the selected vector, tolerant of any possible toxic effect of the expressed product; able to efficiently secrete the expressed product if this is desired; that can express the product in the desired conformation; that can be easily scaled, and that facilitate the purification of the final product. The choice of expression cassette depends on the selected host system as well as the desired characteristics for the expressed polypeptide. Generally, an expression cassette includes a promoter that is functional in the selected host system and that can be constitutive or inducible; a ribosome binding site; a start codon (ATG) if necessary; a region encoding a signal peptide, for example, a lipidation signal peptide; a DNA molecule of the invention; a stop codon; and optionally a 3 'terminal region (a translation and / or transcription terminator). The region encoding the signal peptide is adjacent to the polynucleotide of the invention and is placed in the appropriate reading frame. The region encoding the signal peptide is homologous or heterologous to the DNA molecule encoding the mature polypeptide and is compatible with the host secretion apparatus used for expression. The open reading frame constituted by the DNA molecule of the invention, individually or together with the signal peptide, is placed under the control of the promoter so that transcription and translation occur in the host system. Promoters and regions encoding the signal peptide are widely known and available to those skilled in the art and include, for example, the Salmonella typhimurium promoter (and derivatives) which is inducible by arabinose (araB promoter) and is functional in Gram-negative bacteria such as E. coli (as described in U.S. Patent No. 5,028,530 and in Cagnon et al., (Cagnon et al., Protein Engineering (1991) 4 (7): 843)); the promoter of the bacteriophage T7 gene encoding RNA polymerase, which is functional in several strains of E. coli expressing T7 polymerase (described in the patent of E.U.A No: 4,952,496); OspA lipidation signal peptide; and RIpB lipidation signal peptide (Takase et al., J. Bact. (1987) 169: 5692). The expression cassette is generally part of an expression vector, which is selected by its ability to duplicate itself in the chosen expression system. Expression vectors (eg, plasmids or viral vectors) can be chosen, for example, from those described in Pouweis et al., "Cloning Vectors: A Laboratory Manual" 1985, Supp. 1987). Suitable expression vectors can be purchased from various commercial sources. Methods for transforming / transfecting host cells with expression vectors are well known in the art and depend on the selected host system, as described in Ausubel et al., (Ausubel et al., Current Protocols in Molecular Biology, John Wiley & amp;; Sons Inc., 1994). In expression, a recombinant polypeptide of the invention (or a polypeptide derivative) is produced and remains in the intracellular compartment, secreted / excreted in the extracellular medium or periplasmic space, or embedded in the cell membrane. The polypeptide is recovered in a substantially purified form of the cell extract or the supernatant after centrifugation of the recombinant cell culture. Generally, the recombinant polypeptide is purified by affinity purification based on antibodies or by other well-known methods that can be readily adapted by a person skilled in the art, such as fusion of the polynucleotide encoding the polypeptide or its derivative, to a small domain of affinity binding. Antibodies useful for purifying the polypeptides of the invention by immunoaffinity are obtained as described below. A polynucleotide of the invention may also be useful as a vaccine. There are two main routes, either using a viral or bacterial host as a gene delivery vehicle (live vaccine vector) or administering the gene in a free form, for example, inserted in a plasmid. The therapeutic or prophylactic efficacy of a polynucleotide of the invention is evaluated as described below. Therefore, a third aspect of the invention provides (i) a vaccine vector such as variola virus, which contains a DNA molecule of the invention, placed under the control of the elements required for expression; (ii) a composition of matter comprising a vaccine vector of the invention, together with a diluent or carrier; specifically (iii) a pharmaceutical composition containing a therapeutically or prophylactically effective amount of a vaccine vector of the invention; (iv) a method for inducing an immune response against Chlamydia in a mammal (e.g., a human; alternatively, the method can be used in veterinary applications to prevent or treat Chlamydia infection of animals, e.g., cats or birds), which involves administering to the mammal an immunogenically effective amount of a vaccine vector of the invention to produce an immune, protective or therapeutic response to Chlamydia; and particularly, (v) a method for preventing and / or treating a Chlamydia infection (eg, C. trachomatis, C. psittaci, C. pneumoniae, C. pecorum), which involves administering to an infected individual, an amount , prophylactic or therapeutic, of a vaccine vector of the invention. Additionally, the third aspect of the invention includes the use of a vaccine vector of the invention in the preparation of a medicament for preventing and / or treating Chlamydia infection. As used herein, a vaccine vector expresses one or more polypeptides or derivatives of the invention. The vaccine vector can additionally express a cytosine, such as interleukin 2 (IL-2) or interleukin 12 (IL-12), which increases the immune response (adjuvant effect). It is understood that each of the components to be expressed is placed under the control of the elements required for expression in a mammalian cell. Consistent with the third aspect of the invention, is a composition that includes several vaccine vectors, each capable of expressing a polypeptide or derivative of the invention. A composition could also include a vaccine vector capable of expressing an additional Chlamydia antigen, or a subunit, fragment, homologue, mutant or derivative thereof; optionally together with or a cytokine such as IL-2 or IL-12. Vaccination methods for treating or preventing infection in a mammal include the use of a vaccine vector of the invention, to be administered by any conventional route, particularly to a mucosal surface (eg, ocular, intranasal, oral, gastric, pulmonary, intestinal, rectal, vaginal, or urinary tract) or parenterally (for example, subcutaneous, intradermal, intramuscular, intravenous, or intraperitoneal). Preferred routes depend on the choice of vaccine vector. The treatment can be carried out with a single dose or repeating it in intervals. The appropriate dose depends on several parameters known to the skilled artisan, such as the same vaccine vector, the route of administration or the condition of the mammal to be vaccinated (weight, age and other characteristics). The live vaccine vectors available in the art include viral vectors such as adenovirus and variola virus, as well as bacterial vectors, for example, Shigella, Salmonella, Vibrio cholerae, Lactobacillus, Bacille biblié de Calmette-Guérin (BCG), and Streptococcus An example of an adenovirus vector, as well as a method for constructing an adenovirus vector capable of expressing a DNA molecule of the invention, are described in the patent of E.U.A. No: 4,920,209. Smallpox virus vectors include vaccinia virus and canarypox virus, described in U.S. Patent No. 4,722,848 and U.S. Patent No. 5,364,773, respectively. See also, for example, Tartaglia et al., Virology (1992) 188: 217 for a description of a vaccinia virus vector; and Taylor et al., Vaccine (1995) 13: 539 for a reference to a canary pox. The smallpox virus vectors capable of expressing a polynucleotide of the invention, are obtained by homologous recombination, as described in Kieny et al., Nature (1984) 312: 163, so that the polynucleotide of the invention is inserted into the genome viral under conditions appropriate for expression in mammalian cells. Generally, the dose of the vaccine viral vector, for therapeutic or prophylactic use, may be from about 1x104 to about 1x1011, preferably about 1x107 to about 1x1010, preferably from about 1x107 to about 1x109 plaque forming units per kilogram. Preferably, the viral vectors are administered parenterally; for example, in 3 doses, separated in 4 weeks. It is preferred to avoid the addition of a chemical adjuvant to a composition containing a viral vector of the invention and thereby reduce the immune response to the viral vector itself. Nontoxicogenic mutant strains of Vibrio cholerae are known to be useful as a live oral vaccine. Mekalanos et al., Nature (1983) 306: 551 and the U.S. Patent. No. 4,882,278 describe strains having a substantial amount of the coding sequence of each of the two deleted ctxA alleles, so that no functional Cholerae toxin is produced. WO 92/11354 describes a strain in which the irgA locus is inactivated by mutation; this mutation can be combined in a single strain with ctxA mutations. WO 94/01533 describes a deletion mutant lacking ctxA and attRSL DNA functional sequences. These mutant strains are engineered to express heterologous antigens, as described in WO 94/19482. An effective dose of the vaccine of a strain of Vibrio cholerae, capable of expressing a polypeptide or polypeptide derivative encoded by a DNA molecule of the invention, contains about 1x105 to about 1x109, preferably about 1x106 to about 1x108, bacteria viable in an appropriate volume for the selected administration route. Preferred routes of administration include all mucosal pathways; preferably, these vectors are administered intranasally or orally. Attenuated strains of Salmonella typhimurium, engineered for the recombinant expression of heterologous or non-heterologous antigens, and their use as oral vaccines, are described in Nakayama et al. (Bio / Technology (1998) 6: 693) and WO 92/11361. Preferred routes of administration include all mucosal pathways: preferably, these vectors are administered intranasally or orally. Other bacterial strains used as vaccine vectors in the context of the present invention are described for Shigella flexneri in High et al., EMBO (1992) 11: 1991 and Sizemore et al., Science (1995) 270: 299; for Streptococcus gordonii in Medaglini et al., Proc. Nati Acad. Sci. USA (1995) 92: 6868 and for Bacille Calmette Guerin in Flynn J.L., Cell. Mol. Biol. (1994) 40 (suppl.I): 31, WO 88/6626, WO 90/0594, WO 91/13157, WO 92/1796, and WO 92/21376. In bacterial vectors, the polynucleotide of the invention is inserted into the bacterial genome or remains in a free state as part of a plasmid.

The composition comprising a bacterial vaccine vector of the present invention may also contain an adjuvant. Various adjuvants are known to those skilled in the art. The preferred adjuvants are selected from the list provided below. Therefore, a fourth aspect of the invention provides (i) a composition of material that includes a polynucleotide of the invention, together with a diluent or carrier; (ii) a pharmaceutical composition that includes a therapeutically or prophylactically effective amount of a polynucleotide of the invention; (Ii) a method for inducing an immune response against Chlamydia in a mammal by administering an immunogenically effective amount of a polynucleotide of the invention to elicit a protective immune response to Chlamydia; and particularly, (v) a method for preventing and / or treating a Chlamydia infection (eg, C. trachomatis, C. psittaci, C. pneumoniae, or C. pecorum) by administering a quantity, prophylactic or therapeutic , of a polynucleotide of the invention to an infected individual. Additionally, the fourth aspect of the invention includes the use of a polynucleotide of the invention in the preparation of a medicament for preventing and / or treating Chlamydia infection. A preferred use includes the use of a DNA molecule placed under conditions for expression in a mammalian cell, especially in a plasmid that can not be duplicated in mammalian cells, and to be substantially integrated into a mammalian genome.

The use of the polynucleotides of the invention includes their administration to a mammal as a vaccine, for therapeutic or prophylactic purposes. Such polynucleotides are used in the form of DNA as part of a plasmid that is unable to duplicate in a mammalian cell and is unable to integrate into a mammalian genome. Generally, such a DNA molecule is placed under the control of an appropriate promoter for expression in a mammalian cell. The promoter works either ubiquitously or tissue-specific. Examples of non-specific tissue promoters include the cytomegalovirus (CMV) early promoter (described in US Patent No. 4,168,062) and the Rous Sarcoma Virus promoter (dectiro in Norton &Coffin, Molec. Cell Biol. (1985) 5: 281). An example of a tissue-specific promoter is the desmin promoter that drives expression in muscle cells (Li et al., Gene (1989) 78: 243, Li &Paulin, J. Biol. Chem. (1991) 266: 6562 and Li &Paulin, J. Biol. Chem. (1993) 268: 10403). The use of the promoters is well known to those skilled in the art. Useful vectors are described in many publications, specifically WO 94/21797 and Hartikka et al., Human Gene Therapy (1996) 7: 1205. The polynucleotides of the invention that are used as a vaccine encode either a precursor or a mature form of the corresponding polypeptide. In the precursor form, the signal peptide is homologous or heterologous. If heterologous, a eukaryotic leader sequence is preferred, such as the tissue type plasminogen factor (tPA) leader sequence.

As used herein, a composition of the invention contains one or more polynucleotides, optionally, with at least one additional polynucleotide encoding another Chlamydia antigen as the urease subunit A, B, or both, or a fragment, derivative, mutant , or its analogue. The composition may also contain an additional polynucleotide that encodes a cytokine, such as interleukin-2 (IL-2) or interleukin-12 (IL-12) to increase the immune response. These additional polynucleotides are placed under appropriate control for expression. Conveniently, DNA molecules of the invention and / or additional DNA molecules that will be included in the same composition are present in the same plasmid. Standard techniques of molecular biology for preparing and purifying polynucleotides are used in the preparation of the therapeutic polynucleotides of the invention. To be used as a vaccine, a polynucleotide of the invention is formulated according to several methods described below. One method uses the polynucleotide in a simple form, free of any delivery vehicle. Such a polynucleotide is simply diluted in a physiologically acceptable solution, such as sterile saline or sterile buffered saline, with or without a carrier. When present, the vehicle is preferably isotonic, hypotonic, or weakly hypertonic, and has a relatively low ionic strength, such as that provided by a sucrose solution, for example, a solution containing 20% sucrose.

An alternative method uses the polynucleotide in association with agents that aid in cellular incorporation. Examples of such agents are (i) chemical agents that modify cell permeability, such as bupivacaine (see, for example, WO 94/16737), (ii) liposomes for encapsulation of the polynucleotide, or (ii) cationic lipids or microparticles of silica, gold, or tungsten that are associated with polynucleotides. Anionic and neutral liposomes are well known in the art (see, for example, "Liposomes: A Practical Approach", RPC New Ed, IRL Press (1990), for a detailed description of methods for making liposomes) and are useful for provide a wide variety of products, including polynucleotides. Cationic lipids are also known in the art and are commonly used for gene delivery. Such lipids include Lipofectin ™ also known as DOTMA (N- [1- (2,3-dioleyloxy) propyl] -NN, N -trimethylammonium chloride), DOTAP (1,2-bis (oleyloxy) -3 - (trimethylammonium) propane), DDAB (dimethyldioctadecylammonium bromide), DOGS (dioctadecylamidologlicil-spermine) and cholesterol derivatives such as DC-Chol (3 beta- (N- (N ', N'-dimethylaminomethane) -carbamoyl) -cholesterol ). A description of these cationic lipids can be found in EP 187,702, WO 90/11092, U.S. Patent No. 5,283,185, WO 91/15501, WO 95/26356, and U.S. Pat. No: 5,527,928. Cationic lipids for gene delivery, preferably used in association with a neutral lipid such as DOPE (dioleyl phosphatidylethanolamine), as described for example in WO 90/11092.

A formulation containing cationic liposomes can, optionally, contain other compounds that facilitate transfection. Several of them are described in WO 93/18759, WO 93/19768, WO 94/25608, and WO 95/2397. They include spermine derivatives useful for facilitating the transport of DNA through the nuclear membrane (see, for example, WO 93/18759) and membrane permeabilization compounds such as GALA, Gramicidin S, and cationic bile salts (see, for example. , WO 93/19768). Gold or tungsten microparticles are used for gene delivery, as described in WO 91/359, WO 93/17706, and Tang et al., (Nature (1992) 356: 152). The microparticle-covered polynucleotide is injected intradermally or intraepidermally, using a needleless injection device ("gene gun"), as described in the U.S. Patent. No. 4,945,050, the U.S. Patent. No: 5,015,580, and WO 94/24263. The amount of DNA that will be used in a vaccine receptor depends, for example, on the strength of the promoter used in the construction of the DNA, the immunogenicity of the expressed gene product, the condition of the mammal intended for administration (for example, the weight, age, and general health of the mammal), the mode of administration, and the type of formulation. In general, a dose, therapeutically or prophylactically effective from about 1 μg to about 1 mg, preferably from about 10 μg to about 800 μg and, even better, from about 25 μg to about 250 μg, can be administered to adult humans. The administration can be achieved in a single dose or repeated at intervals. The route of administration is any conventional route used in the field of vaccines. As a general guide, a polynucleotide of the invention is administered by means of a mucosal surface, for example, an ocular, intranasal, pulmonary, oral, intestinal, rectal, vaginal and urinary tract surface; or parenterally, for example, by an intravenous, subcutaneous, intraparitoneal, intradermal or intramuscular route. The choice of route of administration depends on the formulation selected. A polynucleotide formulated in association with bupivacaine is conveniently administered in the muscle. When using a neutral or anionic liposome or a cationic lipid, such as DOTMA or DC-Chol, the formulation can be injected, conveniently, intravenously, intranasally (aerosolization), intramuscular, intradermal and subcutaneous. A polynucleotide in simple form can be conveniently administered intramuscularly, intradermally or subcutaneously. Although not absolutely required, such a composition may also contain an adjuvant. If so, a systemic adjuvant that does not require concomitant administration to exhibit an adjuvant effect is preferred, such as for example QS21, which is described in the U.S. Patent. No: 5,057,546. The sequence information provided in the present application makes it possible to design specific nucleotide probes and primers that are used for diagnostic purposes. Therefore, a fifth aspect of the invention provides a nucleotide probe or primer having a sequence found in, or derived from, the degeneracy of the genetic code of a sequence shown in any of SEQ ID No: 1 or 2. The The term "probe", as used in the present application, refers to DNA molecules (preferably single-stranded) or RNA (or its modifications or combinations) that hybridize under severe conditions, as defined above, with nucleic acid molecules having SEQ ID No: 1 or 2 or with sequences homologous to SEQ ID No: 1 or 2, or with their complementary or antisense sequences. Generally, the probes are significantly shorter than the full length sequences. Such probes contain from about 5 to about 100, preferably from about 10 to about 80 nucleotides. In particular, the probes have sequences that are at least 75%, preferably at least 85%, even better 95% homologous to a portion of any of SEQ ID No: 1 or 2 or that are complementary to such sequences . The probes may contain modified bases such as inosine, methyl-5-deoxycytidine, deoxyuridine, dimethylamino-5-deoxyuridine, or diamino-2,6-purine. The sugar or phosphate residues can also be modified or replaced. For example, a deoxyribose residue can be replaced with a polyamide (Nielsen et al., Science (1994) 254: 1497) and the phosphate residues can be replaced with ester groups such as diphosphate, alkyl, arylphosphonate and phosphorothioate esters. In addition, the 2'-hydroxyl group in ribonucleotides can be modified to include such groups as the alkyl. The probes of the invention are used in diagnostic tests, such as capture or detection probes. Such capture probes are conventionally immobilized on a solid support, directly or indirectly, by covalent means or by passive adsorption. A detection probe is labeled with a detection marker selected from: radioactive isotopes, enzymes such as peroxidase, alkaline phosphatase, and enzymes capable of hydrolyzing a chromogenic, fluorogenic, or luminescent substrate; compounds that are chromogenic, fluorogenic, or luminescent, nucleotide base analogs and biotin. The probes of the invention are used in any conventional hybridization technique, such as dot blot (Maniatis et al., "Molecular Cloning: A Laboratory Manual" (1982) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York), Southern blotting (Southern, J. Mol. Biol. (1975) 98: 503), Northern blot (identical to Southern blot with the exception of RNA used as target), or sandwich technique (Dunn et al., Cell (1977) 12:23). The second technique involves the use of a specific capture probe and / or a specific detection probe with nucleotide sequences that differ from each other, at least partially. An initiator is a probe of, usually, about 10 to 40 nucleotides approximately, which is used to initiate the enzymatic polymerization of DNA in an amplification process (eg, PCR), in an elongation process, or in a method of reverse transcription. The primers that are used in diagnostic methods involving PCR are labeled by methods known in the art. As described herein, the invention also includes (i) a reagent comprising a probe of the invention for detecting and / or identifying the presence of Chlamydia in a biological material; (ii) a method for detecting and / or identifying the presence of Chlamydia in a biological material, in which (a) a sample is recovered or derived from the biological material, (b) the DNA or RNA is extracted and denatured from the material , and (c) is exposed to a probe of the invention, e.g., a capture, detection, or both probe, under severe hybridization conditions, to detect hybridization; and (iii) a method for detecting and / or identifying the presence of Chlamydia in a biological material, in which (a) a sample is recovered or derived from the biological material, (b) DNA is extracted therefrom, (c) the extracted DNA is prepared by at least one, and preferably two, initiators of the invention and is amplified by a polymerase chain reaction, and (d) the amplified DNA fragment is produced. It is evident that the description of polynucleotide sequences of SEQ ID No: 1 or 2, their homologous and partial sequences of any of them, makes possible their corresponding amino acid sequences. Therefore, a sixth aspect of the invention features a polypeptide or substantially purified polypeptide derivative having an amino acid sequence encoded by a polynucleotide of the invention. A "substantially purified polypeptide" as used herein, is defined as a polypeptide that is separated from the medium in which it occurs naturally and / or that is free from most polypeptides that are present in the medium in which It was synthesized. For example, a substantially purified polypeptide is free of cytoplasmic polypeptides. Those skilled in the art will readily understand that the polypeptides of the invention can be purified from a natural source, i.e., a Chlamydia strain, or can be produced by recombinant means. Consistent with the sixth aspect of the invention, are the polypeptides, homologs or fragments that are modified or treated to increase their immunogenicity in the target animal, in which the polypeptide, homologue or fragments are expected to confer protection against Chlamydia. Such modifications or treatments include: amino acid substitutions with an amino acid derivative such as 3-methylhistidine, 4-hydroxyproline, 5-hydroxylysine, etc., modifications or deletions that are carried out after the preparation of the polypeptide, homologue or fragment, such as the modification of amino, carboxyl or hydroxyl side groups of amino acids. The identification of homologous polypeptides or polypeptide derivatives encoded by the polynucleotides of the invention having specific antigenicity, is achieved by testing the cross-reactivity with an antiserum raised against the reference polypeptide having an amino acid sequence of any of SEQ ID No: 3 or 4. The procedure is as follows: a monospecific hyperimmune antiserum is developed against a polypeptide of purified reference, a fusion polypeptide (e.g., an expression product of MBP, GST, or His-tag systems), or a synthetic peptide that is predicted to be antigenic. When an antiserum is developed against a fusion polypeptide, two different fusion systems are employed. The specific antigenicity can be determined according to several methods, including Western blot (Towbin et al, Proc. Nati, Acad. Sci. USA (1979) 76: 4350), dot blot, and ELISA, described below. In a Western blot, the product to be tested, either as a purified preparation or a total extract of E. coli, is subjected to an SDS-Page electrophoresis, as described by Laemmli (Nature (1970) 227: 680). . After being transferred to a nitrocellulose membrane, the material is incubated with the monospecific hyperimmune antiserum diluted in the dilution scale from about 1: 5 to about 1: 5000, preferably from about 1: 100 to about 1: 500 . The specific antigenicity is shown once a band corresponding to the product exhibits reactivity in any of the dilutions of the aforementioned scale. In an ELISA test, the product to be tested is preferably used as the coating antigen. A purified preparation is preferred, although a whole cell extract can also be used. Briefly, approximately 100 μl of a preparation of about 10 μg protein / ml is distributed in wells of a 96 well ELISA polycarbonate plate. The plate is incubated for two hours at 37 ° C and overnight at 4 ° C. The plate is washed with phosphate buffered saline (PBS) containing 0.05% Tween 20 (PBS / Tween buffer). The wells are saturated with 250 μl of PBS containing 1% bovine serum albumin (BSA) to prevent nonspecific antibody binding. After one hour of incubation at 37 ° C, the plate is washed with PBS Tween buffer. The antiserum is diluted serially in PBS / Tween buffer containing 0.5% BSA. 100 μl of dilutions are added per well. The plate is incubated for 90 minutes at 37 ° C, washed and evaluated according to standard procedures. For example, a goat anti-rabbit peroxidase conjugate is added to the wells when the specific antibodies were developed in rabbits. Incubation is carried out for 90 minutes at 37 ° C and the plate is washed. The reaction is developed with the appropriate substrate and the reaction is measured by colorimetry (absorbance measured spectrophotometrically). Under the above experimental conditions, a positive reaction becomes evident by D.O. greater than a non-immune control serum. In a dot blot test, a purified product is preferred, although a whole cell extract can also be used. Briefly, a solution of the product at approximately 100 μg / ml is diluted twice in series in 50 mM Tris-HC1 (pH 7.5). 100 μl of each dilution is applied to a 0.45 m nitrocellulose membrane placed in a 96-well dot blot apparatus (Biorad). The shock absorber is removed by applying vacuum to the system. The wells are washed with the addition of 50 mM Tris-HCl (pH 7.5) and the membrane is air dried. The membrane is saturated in blocking buffer (50 mM Tris-HC1 (pH 7.5) 0.15 M NaCl, 10 g / 1 of skimmed milk) and incubated with an antiserum dilution of about 1: 50 to about 1: 5000, preferably about 1: 500. The reaction is revealed according to standard procedures. For example, a goat anti-rabbit peroxidase conjugate is added to the wells when rabbit antibodies are used. Incubation is carried out for 90 minutes at 37 ° C and the blot is washed. The reaction develops with the appropriate substrate and stops. The reaction is measured visually by the appearance of a color spot, for example, by colorimetry. Under the above experimental conditions, a positive reaction becomes apparent once a spot of color is associated with a dilution of at least about 1: 5, preferably at least about 1: 500. The therapeutic or prophylactic efficacy of a polypeptide or derivative of the invention can be evaluated as described below. A seventh aspect of the invention provides (i) a composition of material containing a polypeptide of the invention together with a diluent or carrier; specifically (ii) a pharmaceutical composition containing a therapeutically or prophylactically effective amount of a polypeptide of the invention; (iii) a method for inducing an immune response against Chlamydia in a mammal, by administering to the mammal an immunogenically effective amount of the invention to elicit a protective immune response to Chlamydia; and particularly, (iv) a method for preventing and / or treating a Chlamydia infection (eg, C. trachomatis, C. psittaci, C. pneumoniae or C. pecorum), by administering a quantity, prophylactic or therapeutic, of a polypeptide of the invention, to an infected individual. Additionally, the seventh aspect of the invention includes the use of a polypeptide of the invention for the preparation of a medicament for preventing and / or treating Chlamydia infection. As used herein, the immunogenic compositions of the invention are administered by conventional routes known in the field of vaccines, in particular to a mucosal surface (e.g., ocular, intranasal, pulmonary, oral, gastric, intestinal, rectal, vaginal, or urinary tract) or parenterally (eg, subcutaneous, intradermal, intramuscular, intravenous, or intraperitoneal). The selection of the route of administration depends on several parameters, such as the adjuvant associated with the polypeptide. If a mucosal adjuvant is used, the intranasal or oral route is preferred. If a lipid or an aluminum compound formulation is used, the parenteral route is preferred, with the subcutaneous or intramuscular route being preferred. The selection also depends on the nature of the vaccine agent. For example, a polypeptide of the invention fused to CTB or LTB, is best administered on a mucosal surface.

As used herein, the composition of the invention contains one or more polypeptides or derivatives of the invention. Optionally, the composition contains at least one additional Chlamydia antigen, or a subunit, fragment, homologue, mutant or derivative thereof. For use in a composition of the invention, a polypeptide, or its derivative, is formulated in, or with, liposomes, preferably neutral or anionic liposomes, microspheres, ISCOMS, or virus-like particles (VLPs) to facilitate delivery and / or increase the immune response. These compounds are readily available to those skilled in the art; for example, see Liposomes: A Practical Approach, RCP New Ed, IRL press (1990). Other adjuvants other than liposomes and similar materials are also known and used in the art. Adjuvants can protect the fast-dispersing antigen by sequestering it in a local reservoir, or they may contain substances that stimulate the host to secrete factors that are chemotactic for macrophages and other components of the immune system. An appropriate selection may be conventionally made by those skilled in the art, for example, among those described below (under the eleventh aspect of the invention.) Treatment is achieved in a single dose, or in repeated doses at agreed intervals. is necessary, as can be determined by one skilled in the art For example, a booster dose is followed by three booster doses at weekly or monthly intervals An appropriate dose depends on several parameters including the recipient (eg, adult or infant) ), the particular vaccine antigen, the route and frequency of administration, the presence / absence or type of adjuvant, and the desired effect (e.g., protection and / or treatment), as can be determined by one skilled in the art. In general, a vaccine antigen of the invention is administered via the mucosal route in an amount of about 10 μg to about 500 mg, preferably about imadamente 1mg up to about 200mg. For the parenteral route of administration, the dose generally does not exceed about 1 mg, preferably about 100 μg. When used as vaccine agents, the polynucleotides and polypeptides of the invention can be used in the form of sequences as part of a multistep immunization process. For example, a mammal is initially primed with a vaccine vector of the invention, such as a poxvirus, for example, parenterally, and then boosted twice with the polypeptide encoded by the vaccine vector, e.g. , via the mucosa. In another example, liposomes associated with a polypeptide or derivative of the invention, are also used for priming, carrying out mucosal reinforcement using a polypeptide or soluble derivative of the invention in combination with a mucosal adjuvant (e.g. , LT). A polypeptide derivative of the invention is also used according to the seventh aspect of the invention as a diagnostic reagent for detecting the presence of anti-Chlamydia antibodies, for example, in a blood sample. Such polypeptides have from about 5 to about 80, preferably from about 10 to about 50 amino acids in length. They can be marked or unmarked, depending on the diagnostic method. Diagnostic methods that include such a reagent are described below. In the expression of a DNA molecule of the invention, a polypeptide or polypeptide derivative is produced and purified using known laboratory techniques. As described above, the polypeptide or polypeptide derivative can be produced as a fusion protein containing a fused tail that facilitates purification. The fusion product is used to immunize a small mammal, for example, a mouse or a rabbit, to develop antibodies against the polypeptide or polypeptide derivative (monospecific antibodies). Thus, an eighth aspect of the invention provides a monospecific antibody that binds to a polypeptide or polypeptide derivative of the invention. "Monospecific antibody" refers to an antibody that can react with a naturally occurring, unique Chlamydia polypeptide. An antibody of the invention can be polyclonal or monoclonal. The monospecific antibodies can be recombinant, for example, chimeric (for example, consisting of a variable region of murine origin associated with a human constant region), humanized (a constant skeleton of human immunoglobulin together with a hypervariable region of animal, by example, of murine origin), and / or of a single chain. Both polyclonal and monospecific antibodies may also be in the form of immunoglobulin fragments, for example, F (ab) '2 or Fab fragments. The antibodies of the invention are of any isotype, for example, IgG or IgA, and the polyclonal antibodies are of a single isotype or a mixture of isotypes. Antibodies against the polypeptides, homologs or fragments of the present invention are generated by immunization of a mammal with a composition comprising said polypeptide, homologue or fragment. The antibodies can be polyclonal or monoclonal. Methods for producing polyclonal or monoclonal antibodies are well known in the art. For a review, see "Antibodies, A Laboratory Manual," Cold Spring Harbor Laboratory, Eds. E. Harlow and D. Lane (1988), and D. E. Yelton et al., 1981. Ann. Rev. Biochem. 50: 657-680. For monoclonal antibodies, see Kohl and Milstein (1975) Nature 256: 495-497. Antibodies of the invention, which are developed for a polypeptide or polypeptide derivative of the invention, are produced and identified using standard immunological tests, eg, Western blot, dot blot, or ELISA (see, for example, Coligan et al. others, "Current Protocols in Immunology" (1994) John Wiley & amp;; Sons, Inc., New York, NY). Antibodies are used in diagnostic methods to detect the presence of a Chlamydia antigen in a sample, such as a biological sample. The antibodies are also used in affinity chromatography to purify a polypeptide or polypeptide derivative of the invention. As described below, such antibodies can be used in prophylactic and therapeutic methods of passive immunization. Therefore, a ninth aspect of the invention provides (i) a reagent for detecting the presence of Chlamydia in a biological sample containing an antibody, polypeptide, or polypeptide derivative of the invention; and (ii) a diagnostic method for detecting the presence of Chlamydia in a biological sample, by contacting the biological sample with an antibody, a polypeptide, or a polypeptide derivative of the invention, so that an immune complex is formed, and detecting such a complex to indicate the presence of Chlamydia in the sample or organism from which the sample is derived. Those skilled in the art will readily understand that the immune complex is formed between a component of the sample and the antibody, polypeptide, or polypeptide derivative, whichever is used, and that any unbound material is removed before detecting the complex. It is understood that a polypeptide reagent is useful for detecting the presence of anti-C? / Amy / a antibodies in a sample, for example, a blood sample, while an antibody of the invention is used to test a sample, such as a gastric extract or biopsy, and detect the presence of Chlamydia polypeptides. For diagnostic applications, the reagent (e.g., the antibody, polypeptide, or polypeptide derivative of the invention) is either in a free state or immobilized on a solid support, such as a tube, a globule or any other conventional media used in this field. Immobilization is achieved using direct or indirect means. Direct means include passive adsorption (non-covalent binding) or covalent binding between the support and the reagent. "Indirect media" means that an anti-reactive compound that interacts with a reagent first binds to the solid support. For example, if a polypeptide reagent is used, an antibody that binds to it can serve as an anti-reagent, as long as it binds to an epitope that is not involved in the recognition of antibodies in biological samples. Indirect media can also employ a ligand-receptor system, for example, wherein a molecule, such as a vitamin, is grafted onto the polypeptide reagent and the corresponding receptor is immobilized in the solid phase. This is illustrated by the biotin-streptavidin system. Alternatively, a peptide tail in the reagent is chemically or genetically engineered, and the grafted or fused product is immobilized by passive adsorption or covalent bonding of the peptide tail. Such diagnostic agents can be included in equipment that also has instructions for use. The reagent is marked with a detection means that allows the detection of the reagent when it joins its objective. The detection means may be a fluorescent agent such as fluorescein isocyanate or fluorescein isothiocyanate, or an enzyme, such as horseradish peroxidase or luciferase or alkaline phosphatase, or a radioactive element such as 125 I or 51 Cr.

Therefore, a tenth aspect of the invention provides a process for purifying, from a biological sample, a polypeptide or a polypeptide derivative of the invention, which includes carrying out affinity chromatography based on antibodies with the biological sample, wherein the antibody is a monospecific antibody of the invention. For use in a purification process of the invention, the antibody is polyclonal or monospecific, and is preferably of the IgG type. Purified IgGs are prepared from an antiserum using standard methods (see, for example, Coligan et al., Current Protocols in Immunology (1994) John Wiley &Sons, Inc., New York, NY). Conventional chromatography supports, as well as standard methods for grafting antibodies, are described for example in "Antibodies: A Laboratory Manual", D. Lane, E. Harlow, Eds. (1988) and are described below. Briefly, a biological sample, such as an extract of C. pneumoniae, preferably in a buffer solution, is applied to a chromatography material, preferably balanced with the buffer used to dilute the biological sample so that the polypeptide or polypeptide derivative of the invention (that is, the antigen), can be adsorbed into the material. The chromatography material, such as a gel or a resin coupled to an antibody of the invention, is in the form of fillers or in a column. The unbound components are washed and the antigen is then eluted with an appropriate elution buffer, such as a glycine buffer or a buffer containing a chaotropic agent, eg, guanidine HCl, or high salt concentration (eg, 3M MgCl2). ). The eluted fractions are recovered and the presence of the antigen is detected, for example, by measuring the absorbance at 280 nm. A eleventh aspect of the invention provides (i) a composition of material comprising a monospecific antibody of the invention, together with a diluent or carrier; (I) a pharmaceutical composition comprising a therapeutically or prophylactically effective amount of a monospecific antibody of the invention, and (iii) a method of treating or preventing a Chlamydia infection (eg, C. trachomatis, C. psittaci, C pneumoniae or C. pecorum), administering a therapeutic or prophylactic amount of a monospecific antibody of the invention to an infected individual. Additionally, the eleventh aspect of the invention includes the use of a monospecific antibody of the invention in the preparation of a medicament for treating or preventing Chlamydia infection. The monospecific antibody can be polyclonal or monoclonal, preferably of the IgA isotype (predominantly). In passive immunization, the antibody is administered to a mucosal surface of the mammal, for example, the gastric mucosa, for example, orally or intragastrically, conveniently, in the presence of a bicarbonate buffer. Alternatively, a systemic administration is carried out, without requiring a bicarbonate buffer. A monospecific antibody of the invention is administered as a single active component or as a mixture with at least one monospecific antibody specific for a different Chlamydia polypeptide. The amount of antibody and the particular regimen used are easily determined by a person skilled in the art. For example, daily administration of approximately 100 to 1,000 mg of antibody per week, or three doses per day of approximately 100 to 1,000 mg of antibody for two or three days, are effective regimens for most purposes. . The therapeutic or prophylactic efficacy is evaluated using standard methods of the art, for example, by measuring the induction of an immune response in the mucosa or the induction of protective and / or therapeutic immunity, using, for example, the mouse model of C. pneumoniae Those skilled in the art will readily recognize that the C. pneumoniae strain of the model can be replaced with another strain of Chlamydia. For example, the effectiveness of DNA particles and polypeptides of C. pneumoniae, is preferably evaluated in a mouse model using a strain of C. pneumoniae. Protection is determined by comparing the degree of Chlamydia infection with that of a control group. The protection becomes evident when the infection is reduced compared to the control group. Such evaluation is made for polynucleotides, vaccine vectors, polypeptides and their derivatives, and antibodies of the invention. The adjuvants useful in any of the vaccine compositions described above are as follows. Adjuvants for parenteral administration include aluminum compounds, such as aluminum hydroxide, aluminum phosphate, and aluminum hydroxyphosphate. The antigen is precipitated or adsorbed on the aluminum compound according to standard protocols. Other adjuvants, such as RIBI (ImmunoChem, Hamilton, MT), are used in parenteral administration. Adjuvants for mucosal administration include bacterial toxins, for example, cholera toxin (CT), heat labile toxin from E. coli (LT), toxin A from Clostridium difficile and pertussis toxin (PT), or combinations thereof , subunits, toxoids, or mutants, such as a purified preparation of subunit B of native cholera toxin (CTB). Fragments, homologs, derivatives, and fusions for any of these toxins are also convenient, as long as they retain the adjuvant activity. Preferably, a mutant having reduced toxicity is used. Suitable mutants are described, for example, in WO 95/17211 (Arg-7Lys mutant of CT), WO 96/06627 (mutant Arg-192-G1y of LT), and WO 95/34323 (mutant of Arg-9-Lys) and Glu-129-G1y of PT). Additional LT mutants that are used in the methods and compositions of the invention include, for example, the mutants Ser-63-Lys, Ala-69-G1y, G1 u-110-Asp, and G1u-112-Asp. Other adjuvants, such as a bacterial monophosphoryl lipid A (MPLA), for example from E. coli, Salmonella minnesota, Salmonella typhimurium, or Shigella flexneri; Saponins, or polylactide glycolide (PLGA) microspheres, are also used in mucosal administration. Adjuvants useful for both mucosal and parenteral administration include polyphosphazene (WO 95/2415), DC-chol (3b- (N- (N ', N'-dimethylaminomethane) -carbomoyl) cholesterol; US Patent No. 5,283,185; WO 96/14831), and QS-21 (WO 88/09336). Any pharmaceutical composition of the invention that contains a polynucleotide, a polypeptide, a polypeptide derivative, or an antibody of the invention is manufactured in the conventional manner. In particular, it is formulated with a pharmaceutically acceptable diluent or carrier, for example, water or a saline solution, such as the saline phosphate buffer solution. In general, a diluent or carrier is selected based on the mode and route of administration, the standard pharmaceutical practice. Suitable pharmaceutical carriers or diluents, and pharmaceutical needs for use in pharmaceutical formulations, are described in "Remington's Pharmaceutical Sciences," a standard reference text in this field and in the USP / NF. The invention also includes methods in which Chlamydia infection is treated by oral administration of a Chlamydia polypeptide of the invention and a mucosal adjuvant, in combination with an antibiotic, an antacid, sucralfate, or a combination thereof. Examples of such compounds that can be administered with the vaccine antigen and the adjuvant are antibiotics, including, for example, macrolides, tetracyclines, and their derivatives (specific examples of antibiotics that can be used, include azithromycin or doxycycline, or immunomodulators such as cytokines or steroids). In addition, compounds containing more than one of the components listed above are used together. The invention also includes compositions for carrying out these methods, that is, compositions containing a Chlamydia antigen (or antigens) of the invention, an adjuvant, and one or more compounds of those listed above, in a pharmaceutically acceptable carrier or diluent. . Recently, the 60-kDa cysteine-rich membrane protein has been shown to contain a cross-reactive sequence with the murine alpha-myosin heavy chain M7A-alpha epitope, a conserved epitope in humans (Bachmaier et al., Science ( 1999) 283: 1335). This cross-reactivity is proposed to contribute to the development of cardiovascular disease, so that it may be beneficial to remove this epitope, and any other epitope cross-reactive with human antigens, of the protein if it is to be used as a vaccine. Accordingly, a further embodiment of the present invention includes modifying the coding sequence, for example, by deleting or replacing the nucleotides encoding the epitope from polynucleotides encoding the protein, so as to improve the efficiency and Protein safety as a vaccine. A similar approach may be suitable for any protective antigen discovered to have unwanted cross-homologies or reactivities with human antigens. The amounts of the compounds listed above used in the methods and compositions of the invention are readily determined by one skilled in the art. The expert also knows and easily designs the treatment / immunization programs. For example, the non-vaccine components can be administered on days 1-14, and the vaccine antigen + adjuvant can be administered on days 7, 14, 21 and 28.e foregoing description details the present invention in a general manner. A more complete understanding can be obtained with reference to the following specific examples. These examples are described exclusively for purposes of illustration and are not intended to limit the scope of the invention. Changes in form and replacement of equivalents are contemplated as recommended or deemed appropriate circumstances. Although specific terms have been employed herein, such terms are considered in a descriptive sense and not for limitation purposes.

EXAMPLE 1 This example illustrates the preparation of the eukaryotic expression vector pCA Myc-His. Plasmid pcDNA3.1 (-) Myc-His C (Invitrogen) was restricted with Spe I and Bam Hl to remove the CMV promoter and the remaining vector fragment was isolated. The CMV promoter and intron A of plasmid VR-1012 (Vical) was isolated in a Spe I / Bam Hl fragment. The fragments were ligated to produce the plasmid pCA / Myc-His.

EXAMPLE 2 This example illustrates the preparation of a plasmid expression vector containing the 98 kDa outer membrane protein gene. The 98 kDa outer membrane protein was amplified from Chlamydia pneumoniae genomic DNA by polymerase chain reaction (PCR) using a 5 'end primer (5' ATAAGAATGCGGCCGCCACCATGGCAGAGGTGACCTTAGATAG_3_') (SEQ ID No: 4) and a 3 'extemal primer (5' CGGCTCGAGTGAAACAAAACTTAGAGCCTAG_3_') (SEQ ID No: 6). The 5 'end primer contains a Not I restriction site, a ribosome binding site, an initiation codon and a sequence at the 5' end of the 98 kDa outer membrane protein coding sequence. The 3 'end primer includes the sequence coding for the C-terminal sequence of the 98 kDa outer membrane protein gene and a restriction site Xho I. The stop codon was excluded and an additional nucleotide was inserted for obtain a merger in frame with the Histidine brand. After amplification, the PCR fragment was purified using QIAquick® purification equipment (Qiagen) and then digested with Not I and Xho I. The Not l / Xho I-restricted PCR fragment containing the membrane protein gene External 98 kDa was ligated into the pCA / Myc-His plasmid restricted by Not I and Xho I to produce the plasmid pCAI640 (FIG. 3). The transcription of the 98 kDa outer membrane protein gene in pCAI640 was under the control of the human cytomegalovirus (CMV) promoter. Plasmid pCAI640 was transferred by electroporation in E. coli XL-1 blue (Stratagene) which was developed in LB broth containing 50 μg / ml carbenicillin. The plasmid was isolated by a large scale Endo Free Plasmid Giga Kit ® DNA purification system (Qiagen). The concentration of DNA was determined by absorbance at 260 nm and the plasmid was verified after gel electrophoresis and staining with ethidium bromide and comparison with molecular weight standards. The 5 'and 3' ends of the gene were verified by sequencing using a LiCor model 4000 L DNA sequencer and primers labeled with IRD-800.

EXAMPLE 3 This example illustrates the immunization of mice to achieve protection against intranasal exposure of C. pneumoniae. It has previously been shown (Yang, ZP, Chi, EY, Kuo, CC and Grayston, JT 1993. A mouse model of C. pneumoniae strain TWAR pneumonitis 61 (5): 2037-2040) that mice are susceptible to infection intranasal with different isolates of C. pneumoniae. The strain AR-39 Chi, E.

Y., Kuo, C.C. and Grayston, J.T. 1987. Unique ultrastructure in the elementan / body of Chlamydia sp. Strain TWAR. J. Bacteriol. 169 (8): 3757-63) was used in Balb / c mice as a model of infection by exposure to examine the ability of the Chlamydia gene products supplied as single DNA, to obtain a protective response against a sublethal infection of lungs by C. pneumoniae. Protective immunity is defined as an accelerated clearance of lung infection. Groups of Balb / c mice from 7 to 9 weeks of age (from 6 to 10 per group) were immunized intramuscularly (i.m.) and intranasally (i.n.) with plasmid DNA containing the coding sequence for a C. pneumoniae polypeptide. Groups of control animals were given saline or the plasmid vector lacking an inserted Chlamydia gene. For i.m. immunization, it was injected alternately into the left and right quadriceps, 100μg of DNA in 50μl of PBS three times, at weeks 0, 3 and 6. For in immunization, the anesthetized mice aspirated 50μl of PBS containing 50μg of DNA three times in weeks 0, 3 and 6. In week 8, the immunized mice were inoculated in with 5 x 105 IFU of C. pneumoniae, strain AR39 in 100μl of SPG buffer to test its ability to limit the growth of a sublethal exposure to C. pneumoniae. The lungs of the mice were removed on day 9 after exposure and immediately homogenized in SPG buffer (7.5% sucrose, 5mM glutamate, 12.5mM phosphate, pH7.5). The homogenate was stored frozen at -70 ° C until the time of testing. Dilutions of the homogenate were tested for the presence of infectious Chlamydia by inoculation in monolayers of susceptible cells. The inoculum was centrifuged in the cells for one hour at 3000rpm; then, the cells were incubated for three days at 35 ° C in the presence of 1 μg / ml cycloheximide. After incubation, the monolayers were fixed with formalin and methanol, and then labeled with immunoperoxidase to detect the presence of Chlamydia inclusions, using convalescent serum of rabbits infected with C. pneumoniae and DAB increased with metal, as a substrate of peroxidase . Table 1 shows that mice immunized i.n. and i.m. with pCAI640 had Chlamydia lung titers below 255,000 in 4 out of 4 cases on day 5 and less than 423,200 in 4 out of 4 cases on day 9, while the scale of values for placebo of control mice immunized with saline was from 227,000-934,200 IFU / lung (mean 685,240) on day 5 and 96,000-494,000 IFU / lung (mean 238,080) on day 9. Immunization of DNA by itself was not responsible for the observed protective effect, since another plasmid DNA construct, pCAI634, did not protect, with lung titers in immunized mice similar to those obtained for control mice immunized with saline. The construction of pCAI634 is identical to pCAI640, except that the nucleotide sequence coding for the 98 kDa outer membrane protein gene is replaced with the nucleotide sequence of C. pneumoniae encoding a different putative membrane protein external 98 kDa. TABLE 1

Claims (32)

NOVELTY OF THE INVENTION CLAIMS

1. - A nucleic acid molecule characterized in that it comprises a nucleic acid sequence encoding a polypeptide selected from any of: (a) SEQ ID Nos: 3 and 4; (b) an immunogenic fragment comprising at least 12 consecutive amino acids of a polypeptide of (a); and (c) a polypeptide of (a) or (b) that has been modified without loss of immunogenicity, wherein said modified polypeptide is at least 75% identical in amino acid sequence to the corresponding polypeptide of (a) or (b) .

2. A nucleic acid molecule characterized in that it comprises a nucleic acid sequence selected from any of: (a) SEQ ID Nos: 1 and 2; (b) a sequence encoding a polypeptide encoded by any of SEQ ID Nos: 1 or 2; (c) a sequence comprising at least 38 consecutive nucleotides of any of the nucleic acid sequences of (a) and (b); and (d) a sequence encoding a polypeptide that is at least 75% identical in its amino acid sequence to the polypeptides encoded by SEQ ID No: 1 or 2.

3. A nucleic acid molecule characterized in that it comprises a sequence of nucleic acid that is antisense to the nucleic acid molecule claimed in claim 1 or 2.

4. - A nucleic acid molecule comprising a nucleic acid sequence encoding a fusion protein, said fusion protein comprising a polypeptide encoded by a nucleic acid molecule as claimed in claim 1, and a second polypeptide.

5. The nucleic acid molecule according to claim 4, further characterized in that the additional polypeptide is a heterologous signal peptide.

6. The nucleic acid molecule according to claim 4, further characterized in that the additional polypeptide has adjuvant activity.

7. The nucleic acid molecule according to any of claims 1 to 6, further characterized in that it is operably linked to one or more expression control sequences.

8. A vaccine comprising at least a first nucleic acid as claimed in any of claims 1, 2, and 4 to 7 and a vaccine vector wherein each first nucleic acid is expressed as a polypeptide, the vaccine optionally it comprises a second nucleic acid encoding an additional polypeptide which increases the immune response to the polypeptide expressed by said first nucleic acid.

9. The vaccine according to claim 8, further characterized in that the second nucleic acid codes for an additional Chlamydia polypeptide.

10. - A pharmaceutical composition characterized in that it comprises a nucleic acid as claimed in any of claims 1 to 7 and a pharmaceutically acceptable carrier.

11. A pharmaceutical composition characterized in that it comprises a vaccine as claimed in claim 8 or 9 and a pharmaceutically acceptable carrier.

12.- A unicellular host transformed with the nucleic acid molecule claimed in claim 7.

13.- A nucleic acid probe of 5 to 100 nucleotides characterized in that it hybridizes under severe conditions to the nucleic acid molecule of SEQ ID No: 1 or 2, or a homologous or complementary or antisense sequence of said nucleic acid molecule.

14. An initiator of 10 to 40 nucleotides characterized in that it hybridizes under severe conditions to the nucleic acid molecule of SEQ ID No: 1 or 2, or a homologous or complementary or antisense sequence of said nucleic acid molecule.

15. A polypeptide encoded by a nucleic acid sequence as claimed in claims 1, 2 and 4 to 7.

16. A polypeptide characterized in that it comprises an amino acid sequence selected from any of: (a) SEQ ID Nos: 3 and 4; (b) an immunogenic fragment comprising at least 12 consecutive amino acids of a polypeptide of (a); and (c) a polypeptide of (a) or (b), which has been modified without loss of immunogenicity, wherein said modified polypeptide is at least 75% identical in its amino acid sequence to the corresponding polypeptide of (a) or ( b)

17. A fusion polypeptide, characterized in that it comprises a polypeptide as claimed in claim 15 or 16, and an additional polypeptide.

18. The fusion polypeptide according to claim 17, further characterized in that the additional polypeptide is a heterologous signal peptide.

19. The fusion polypeptide according to claim 17, further characterized in that the additional polypeptide has adjuvant activity.

20. A method for producing a polypeptide, as claimed in claim 15 or 16, characterized in that it comprises the step of culturing a unicellular host as claimed in claim 12.

21. An antibody against the polypeptide as claimed in claim 12. claims in any of claims 15 to 19.

22. A vaccine, characterized in that it comprises at least a first polypeptide according to any of claims 15 to 19 and a pharmaceutically acceptable carrier, optionally comprising a second polypeptide, which increases the immune response to the first polypeptide.

23. The vaccine according to claim 22, further characterized in that the second polypeptide is an additional Chlamydia polypeptide.

24. A pharmaceutical composition, characterized in that it comprises a polypeptide as claimed in any of claims 15 to 19, and a pharmaceutically acceptable carrier.

25. A pharmaceutical composition, characterized in that it comprises a vaccine according to claim 22 or 23, and a pharmaceutically acceptable carrier, 26.- A pharmaceutical composition, characterized in that it comprises an antibody as claimed in claim 21, and a vehicle pharmaceutically acceptable. 27. The use of: (a) the nucleic acid as claimed in any of claims 1 to 7; (b) the polypeptide as claimed in any of claims 15 to 19; or (c) the antibody as claimed in claim 21, for preparing a medicament for preventing or treating a Chlamydia infection in a mammal. 28. A method for detecting Chlamydia infection, characterized in that it comprises the step of examining a body fluid of a mammal to be tested, with a component selected from any of: (a) the nucleic acid of any of claims 1 to 7; (b) the polypeptide of any of claims 15 to 19; and (c) the antibody of claim 21. 29.- A diagnostic kit, characterized in that it comprises instructions for use and a component selected from any of: (a) the nucleic acid of any of claims 1 to 7; (b) the polypeptide of any of claims 15 to 19; and (c) the antibody of claim 21. 30.- Expression plasmid pCAI640. 31.- The use of a vector and nucleic acid as claimed in any of claims 1 to 7, to prepare a vaccine to prevent Chlamydia infection in a mammal. 32. The use of the polypeptide as claimed in claims 15 to 19, for preparing a vaccine to prevent Chlamydia infection in a mammal. o \ 5é / SUMMARY OF THE INVENTION The present invention provides a method of immunizing a host, including humans, with nucleic acid, including DNA, against disease caused by infection of a Chlamydia strain, epsecifically C. pneumoniae, which employs a vector containing a nucleotide sequence encoding for a 98 kDa outer membrane protein from a strain of Chlamydia pneumoniae and a promoter for expression of the 98 kDa outer membrane protein gene in the host; Modifications are possible within the scope of the invention. MC / cgt * P01 / 885F