WO2006128027A1 - Functionally active recombinant peptides, methods for producing same and interactions with other peptides - Google Patents

Abstract

A method is disclosed for inhibiting angiogenic activity by interacting anginex with the peptide galectin-1. Also disclosed is a method for constructing an artificial gene encoding the biologically exogenous peptide anginex and producing the protein recombinantly. The recombinant anginex protein is active at inhibiting endothelial cell growth and migration as well as inhibiting angiogenesis.

Description

FUNCTIONALLY ACTIVE RECOMBINANT PEPTIDES, METHODS FOR PRODUCING SAME AND INTERACTIONS WITH OTHER PEPTIDES

RELATED APPLICATIONS This application claims the benefit of U.S.S.N. 60/685,298, filed May 26, 2005, and

U.S.S.N. 60/690,193, filed June 13, 2005, each of which is incorporated by reference in its entirety.

FIELD OF THE INVENTION The invention relates to peptides useful as inhibitors of angio genesis as well as cellular proliferation and migration. The invention also relates to methods for producing the recombinant peptides and methods for using the peptides as angiogenesis inhibitors.

BACKGROUND OF THE INVENTION Angiogenesis

Angiogenesis and vasculogenesis are processes involved in the growth of blood vessels. Angiogenesis is the process by which new blood vessels are formed from existant capillaries, while vasculogenesis involves the growth of vessels deriving from endothelial progenitor cells, such as during embryogenesis. Angiogenesis is a complex, combinatorial process that is regulated by a balance between pro- and anti-angiogenic molecules. Angiogenic stimuli (e.g. hypoxia or inflammatory cytokines) result in the induced expression and release of angiogenic growth factors such as vascular endothelial growth factors (VEGFs) or fibroblast growth factors (FGFs). These growth factors stimulate endothelial cells (EC) in the existing vasculature to proliferate and migrate through the tissue to form new endothelialized channels. Angiogenesis and vasculogenesis, and the factors that regulate these processes, are important in embryonic development, inflammation, and wound healing, and also contribute to pathologic conditions such as tumor growth, diabetic retinopathy, rheumatoid arthritis, cardiovascular and chronic inflammatory diseases (see, e.g., Yancopoulos, et. al. Vasculogenesis, angiogenesis, and growth factors: ephrins enter the fray at the border, (1998) Cell 93:661-4; Folkman, et al., Blood vessel formation: what is its molecular basis? (1996) Cell 87;1153-5; and Hanahan, et. al,. Patterns and emerging mechanisms of the angiogenic switch during tumorigenesis (1996) Cell 86:353-64).

Both angiogenesis and vasculogenesis involve the proliferation of endothelial cells. Endothelial cells line the walls of blood vessels; capillaries are comprised almost entirely of endothelial cells. The angiogenic process involves not only increased endothelial cell proliferation, but also comprises a cascade of additional events, including protease secretion by endothelial cells, degradation of the basement membrane, migration through the surrounding matrix, proliferation, alignment, differentiation into tube-like structures, synthesis of a new basement membrane and attracktion of accessory cells (e.g. pericytes and smooth muscle cells). Vasculogenesis involves recruitment and differentiation of mesenchymal cells into angioblasts, which then differentiate into endothelial cells which then form de novo vessels {see, e.g., Foltaian, et. al. (1996) Cell 87:1153-5).

Inappropriate, or pathological, angiogenesis is involved in the afore mentioned diseases, specifically the growth of atherosclerotic plaque, diabetic retinopathy, degenerative maculopathy, retrolental fibroplasia, idiopathic pulmonary fibrosis, acute adult respiratory distress syndrome, endometriosis, psoriasis and asthma. Furthermore, tumor progression is associated with neovascularization, which provides a mechanism by which nutrients are delivered to the progressively growing tumor tissue.

Both controlled and uncontrolled angiogenesis are thought to proceed in a similar manner. Endothelial cells and pericytes, surrounded by a basement membrane, form capillary blood vessels. Angiogenesis begins with the erosion of the basement membrane by enzymes released by endothelial cells and leukocytes. The endothelial cells, which line the lumen of blood vessels, then protrude through the basement membrane. Angiogenesis stimulants induce the endothelial cells to migrate through the eroded basement membrane. The migrating cells form a "sprout" off the parent blood vessel, where the endothelial cells undergo mitosis and proliferate. The endothelial sprouts merge with each other to form capillary loops, creating a new vasculature. Creation of the new microvascular system can initiate or exacerbate disease conditions.

Persistent, unregulated angiogenesis occurs in a multiplicity of disease states, tumor metastasis and abnormal growth by endothelial cells and supports the pathological damage seen in these conditions. The diverse pathological states created due to unregulated angiogenesis have been grouped together as angiogenesis dependent or angiogenesis associated diseases. Therapies directed at control of the angiogenic processes could lead to the abrogation or mitigation of these diseases.

Angiogenesis is important in two stages of cancer. The first stage where angiogenesis stimulation is important is in the vascularization of the primary tumor. This new vasculature allows tumor cells to enter the blood stream and to circulate throughout the body. Secondly, after the tumor cells have left the primary site, and have settled into the secondary, metastasis site, angiogenesis must occur before the new tumor can grow and expand. Therefore, prevention or control of angiogenesis could lead to the prevention of metastasis of tumors and possibly contain the neoplastic growth at the primary site.

Clearly, the development and progress of many disease conditions can be controlled by controlling the process of angiogenesis. hi that regard, the art has made many attempts to develop materials and therapies which are capable of controlling angiogenesis. However, many materials which appear promising in vitro have proven to be relatively ineffective when applied in vivo. Furthermore, various of such materials have been found to be unstable, toxic, or otherwise difficult to employ. Consequently, there is a need for materials and methods and capable of controlling angiogenesis in a reliable manner. Anginex Previously, the inventors have described the design of the angiostatic agent anginex, an antiparallel beta-sheet forming 33-mer of which the structure is based on the 3-dimensional folding of the a-chemokines platelet factor 4 (PF4) and interleukin-8 (Griffioen AW, et. al., Anginex, a designed peptide that inhibits angiogenesis. Biochem J. 2001 Mar l;354(Pt 2):233- 42.). Anginex has been shown to prevent adhesion and migration of activated endothelial cells (EC), leading to apoptosis induction in these cells. It has also been demonstrated that these effects lead to a significant tumor growth reduction in various mouse models (van der Schaft DW, et. al., The designer anti-angiogenic peptide anginex targets tumor endothelial cells and inhibits tumor growth in animal models, FASEB J. 2002 Dec 16(14):1991-3 Epub 2002 Oct 18; Dings RP, et. al., Anti-tumor activity of the novel angiogenesis inhibitor anginex. Cancer Lett. 2003 May 8,194(l):55-66; Thijssen, et. al., Angiogenesis gene expression profiling in xenograft models to study cellular interactions. Exp Cell Res. 2004 Oct 1, 299(2k):286-93). Galectin-1

Galectin-1 ("gal-1") is one of a family of related proteins, termed the galectin family of β-galactoside-binding proteins (see S. H. Barondes, et. al., "Galectins: A Family of Animal β- Galactoside-Binding Lectins" (1994), In Cell 76, 597-598). The known proteins are galectin-1 through -14. Galectins 1, 2, 4, 6, 7, and 8 are divalent. Galectins 1, 2 and 7 are believed to occur in a monomer reverse reaction dimer equilibrium. However, only galectin-1 has been truly shown to undergo this equilibrium, (M.- J Cho, et. al., Galectin-1, a j8-Galactoside-Binding Lectin in Chinese Hamster Ovary Cells: I Physical and Chemical Characterization (1995), Journal of Biological Chemistry 270, 5198-5206). Galectins 4, 6, and 8 are covalent dimers and can only exist as dimers. hi contrast, galectins 3 and 5 exist as monomelic species. Galectin-3 has been proposed to have an effect of blocking apoptosis of certain cells (R. Y. Yang, et. al., Expression of Galectin-3 Modulates T-cell Growth and Apoptosis (1996), Proceedings of the National Academy of Sciences, United States of America 93, 6737-42), though this has not been demonstrated for human endothelial cells. Galectin-1 forms a homodimer of 14 kDa subunits and each subunit has a single carbohydrate-binding site. This lectin is unusual in that it is synthesized in the cytosol of mammalian cells where it accumulates in a monomelic form. The lectin is actively, but slowly secreted (ti_/2 approx eq.20 h), and the secreted form occurs as a "metastable intermediate" that requires glycoconjugate ligands to properly fold and acquire stability. The functional lectin exists in a monomer-dimer equilibrium with a K^ of .about.7 μM and the equilibrium rate is rather slow (t_\/2 approx eq.lO h).

Several known cytokines have been proposed to have carbohydrate binding activity and galectins, such as galectin-1, may antagonize or promote their activities. Recently, it was shown that galectin-1 can cause death of T-lymphocytes (N. L. Perillo, et. al., Apoptosis of T Cells Mediated By Galectin-1, (1995) Nature 378, 736-9). T cells stimulated by antigen, but not resting T cells, were killed apoptotically by galectin-1. Perillo, et. al., speculated that this apoptosis required the dimeric form of the lectin, but no direct evidence was presented for this idea. Furthermore, they did not define any specific changes in cell surface glycoconjugates accompanying T cell activation that might predispose T cells to die by apoptosis. Indeed, Perillo et al., stated that resting T cells bind galectin-1, but are not killed. Galectin-1 has been used in therapeutic treatments for T cell-based autoimmune diseases in animal models; for example, experimental autoimmune encephalomyelitis (H. Offner, et. al, Recombinant Human Beta-galactoside Binding Lectin Suppresses Clinical and Histological Signs of Experimental Autoimmune Encephalomyelitis (1990) Journal of Neuroimmunology, 28(2) :84,), and experimental autoimmune myasthenia gravis (G. Levi, et. al, Prevention and Therapy with Electrolectin of Experimental Autoimmune Myasthenia Gravis in Rabbits (1983) European Journal of Immunology, 13(6):7).

Galectin-1 can also inhibit the growth of certain types of cells (V. Wells, et. al., Identification of an Autocrine Negative Growth Factor: Mouse Beta-Galactoside-Binding Protein is a Cytostatic Factor and Cell Growth Regulator (1991) Cell 64, 91-7). Endothelial expression has only been described for galectin-1, -2, -3 and -8. A role in angiogenesis has never been proposed before.

The present invention recognizes that (i) the cellular target of anginex is galectin-1, (ii) galectin-1 is overexpressed on tumor endothelium, (iii) galectin-1 is an important regulator of angiogenesis, and (iv) galectin-1 can serve as a target in anti-angio genesis therapy for disease conditions in which angiogenesis plays a role.

SUMMARY OF THE INVENTION

The present invention relates to methods for producing a recombinant peptide. More specifically, the invention relates to the method of producing a C-terminal deamidated analog of the peptide anginex (herein referred to as recombinant Asp33-anginex)..

The invention also relates to the polypeptide galectin-1 as a receptor or target for the synthetic peptide anginex as well as for recombinant Asp33-anginex. The invention further relates to the role of galectin-1 in tumor angiogenesis and a target for angiostatic cancer therapy. The invention also relates to the polypeptide galectin-1 as an inhibitor of endothelial cell proliferation and migration and which binds to or conjugates with synthetic anginex or recombinant Asp33-anginex.

As used herein, the terms "polypeptide" and "peptide" (used interchangeably) refer to a polymer of amino acids. These terms do not connote a specific length of a polymer of amino acids. Thus, for example, the terms oligopeptide, protein, and enzyme are included within the definition of polypeptide or peptide, whether produced using recombinant techniques, chemical or enzymatic synthesis, or naturally occurring. This term also includes polypeptides that have been modified or derivatized, such as by glycosylation, acetylation, phosphorylation, and the like.

"Amino acid" is used herein to refer to a chemical compound with the general formula: NH₂-CRH-COOH, where R, the side chain, is H or an organic group. Where R is an organic group, R can vary and is either polar or nonpolar (i.e., hydrophobic). The amino acids of this invention can be naturally occurring or synthetic (often referred to as nonproteinogenic).

BRIEF DESCRIPTION OF THE FIGURES FIG. IA illustrated the amino acid sequence and folded structure of anginex;

FIG. IB illustrates the codons used for construction of the artificial gene coding for anginex;

FIG. 1C illustrates the construction of the gene by recursive PCR;

FIG. ID illustrates a map of the Pichia pastoris expression vector pPICAaA-anginex cloning site;

FIG. 2A is a Western blot analysis of recombinant anginex (lane b) and endostatin (lane a);

FIG. 2B is Western blot illustrating the determination of the optimal time post methanol induction; FIG. 2C illustrates the N-terminal sequencing of recombinant anginex;

FIG. 3A graphically illustrates the interaction between recombinant and synthetic anginex as determined with BIAcore technology;

FIG. 3B graphically illustrates the CD spectra of synthetic (dashed line) and recombinant (solid line) anginex; FIG. 4A graphically shows the proliferation of bFGF-stimulated HUVEC cultures measured using a [³H]-thymidine incorporation assay;

FIG. 4B depicts the inhibitory effect on migration in bFGF-stimulated HUVEC cultures determined using the wound healing assay;

FIG. 5A-5D illustrate the in vivo angiogenesis inhibition from recombinant anginex using the chorioallantoic membrane assay (CAM) of recombinant and synthetic anginex; FIG. 6 A is the nucleotide sequence for human galectin-1; FIG. 6B is the amino acid sequence for galectin-1;

FIG. 7 A is an immunohistochemical stain detection of anginex treated HUVEC using mouse monoclonal 2D10 anti-anginex antibody in a time-lapse experiment;

FIG. 7B illustrates via electron microscopy microscopy of an immunogold labeling of anginex demonstrating the accumulation of anginex in HUVEC. ;

FIG. 7C illustrates GaI-I overexpressed in EC of human colon carcinoma and Ewing sarcoma as compared to normal human colon;

FIG. 7D illustrates GaI-I mRNA (qPCR; n=5) and protein (FACS; n=4) expression upregulated in activated HUVEC; FIG. 7E illustrates the results of the knockdown of gal-1 expression with ODN results in a concentration dependent inhibition of EC proliferation (n=4);

FIG. 7F illustrates the results of treatment with 1 μM or 5 μM gal-1 ODN results in a significant inhibition of EC migration (n=4);

FIG. 7G illustrates the results of treatment with a gal-1 antibody results in a significant inhibition of EC migration (n=3 ) ;

FIG. 8 A illustrates fluorescence double staining of anginex and galectin-1 in anginex treated EC;

FIG. 8B illustrates the NMR analysis of the galectin-1 /anginex Interaction; FIG. 8C graphically illustrates the validation of galectin-1 immobilization on a BIAcore sensor chip and of protein preservation with galectin-1 antibody (n=2);

FIG. 8D illustrates the results of surface plasmon resonance analysis of interaction between anginex and galectin-1 (n=3);

FIG. 8E illustrates the analysis of binding kinetics of interaction between anginex and immobilized galectin-1. The upper panel shows a representative dose response sensogram for anginex. The areas used for model fitting are shown in bold while the residual plot in the middle panel shows minimal discrepancies between the experimental data and the fit. In the lower panel the observed association rates (kobs) are plotted as a function of analyte concentration with a slope equal to the association rate constant (ka); FIG. 9 A illustrates the quantification of micro vessel density in the CAMs after treatment with different dilutions of anti-galectin-1 antibody; FIG. 9B illustrates Representative images of CAMs after treatment with PBS (control) and anti-galectin-1 antibody;

FIG. 10A-E illustrate whole mount in situ hybridization on 48h zebrafish embodyros.

FIG. 1 IA-D illustrates the o-Dianisidine staining for hemoglobin on 2.5 dpf embryos;

FIG. 12A graphically illustrates F9 teratocarcinoma tumor growth in gal-l^+/+ (solid squares) and gal-1^''^' (solid triangles) mice;

FIG. 12B shows immunohistochemical evaluation of vasculature and gal-1 expression in tumors from gal-l^+/+ (upper panels) and gal- 1^"7" (lower panels) mice;

FIG. 12C illustrates the quantification of microvessel density (MVD) in tumors from gal- 1^+/+ (black bars) and gal-1^"7" (white bars) mice;

FIG. 12D graphically illustrates the F9 teratocarcinoma tumor growth in gal-1 I +/+ mice during treatment with PBS (solid squares) or anginex (open squares);

FIG. 12E illustrates the quantification of microvessel density (MVD) in gal-l^+/+ mice after treatment with PBS or anginex; FIG. 12F graphically illustrates the F9 teratocarcinoma tumor growth in gal- 1^"7" during treatment with PBS (filled triangles) or anginex (open triangles);

FIG. 13 A illustrates the immunohistochemical evaluation of tumor infiltrating leukocytes in galectin-l^+/+ (upper panels) and galectin-l^"7" (lower panels) mice; the left panels show CD45+ cells; in the right panel, CD8+ cells are shown. FIG. 13B illustrates the quantification of CD45+ and CD8+ cells in tumors from galectin-l^{+ +} (black bars) and galectin-1^{" "} (white bars) mice.

FIG. 13C illustrates the quantification of total number of leukocytes in galectin-l^+/+ (black bars) and

(white bars) mice;

FIG. 14A shows the immunohistochemical evaluation of infiltrate in untreated tumors from galectin-l^+/+ (left panels) and in anginex treated tumors from galectin-l^+/+ (middle panels) and galectin-l^"7" (right panels) mice. The upper panels show CD8+ cells; in the lower panels, CD45+ cells are shown; and

FIG. 14B illustrates the quantification of CD45+ and CD8+ cells in untreated tumors from galectin-1 ^+/+ (black bars) andgalectin-1^'7" (white bars) as well as in anginex treated tumors from galectin-1 ^+/+ (downward diagonal) and galectin-1 ^^" (upward diagonal) mice. DETAILED DESCRIPTION

The present invention recognizes the role of synthetic anginex, recombinant Asp33- anginex, and galectin-1 in angiogenesis. Further, the invention provides a therapeutic material which will advantageously interact with galectin-1 so as to moderate or prevent the manifestations of angiogenesis-dependent disease. Anginex

Anginex, a designed peptide 33-mer also commonly referred to in the art as /3pep-25, is a potent angiogenesis inhibitor and anti-tumor agent in vivo. Anginex functions by inhibiting endothelial cell (EC) proliferation and migration leading to detachment of activated EC and their subsequent apoptosis. To better understand tumor endothelium targeting properties of anginex and enable its use in gene therapy, an artificial gene encoding the biologically exogenous peptide has been constructed and which produced the protein recombinantly in Pichia pastoris. This eukaryotic system has proven to be suitable for low-cost production of high levels of functionally active recombinant protein of known angiogenesis inhibitors, such as angiostatin, endostatin and tumstatin. Aside from facilitating large-scale production of the peptide, the anginex gene will be important for use as a molecular biological tool, for example to identify the anginex receptor using yeast-2-hybrid methodology.

Although a synthetic approach for future clinical applications with anginex has some advantages, large-scale production may be more economical through a recombinant approach. Cloning of the anginex gene and isolation from the culture medium yielded recombinant anginex, which has comparable properties as its synthetic form. This was demonstrated both structurally as measured by circular dichroism (CD), and functionally as measured in vitro by inhibition of EC proliferation and migration, and in vivo by inhibition of angiogenesis in the chorioallantoic membrane (CAM)-assay. These results validate the use of the anginex gene in further developing anginex as a useful clinical agent and understanding its mechanism of action. The approach of the present invention will assist in designing other peptides and their corresponding genes that encode for specific receptor antagonists and the use of these genes in gene-therapy.

Mass spectrometry shows recombinant anginex to be a dimer and circular dichroism shows the recombinant protein folds with B-strand structure like the synthetic peptide.

Moreover, like parent anginex, the recombinant protein is active at inhibiting EC growth and migration, as well as inhibiting angiogenesis in vivo in the chorioallantoic membrane (CAM) of the chick embryo.

It is noted that synthetic anginex has the amino acid sequence illustrated in FIG. IA (SEQ ID NO:1). The recombinant anginex of the present invention contemplates the C-terminal deamidated analog of anginex, which is anginex with a C-terminal Asp-COOH (carboxylic acid) (i.e., the Free Acid form) at position 33 as opposed to anginex having a C-terminal ASp-NH₂ at position 33 (the synthetic form). As used throughout this application, the recombinant anginex peptide is intended to be the free acid anginex having a -COOH group, rather than an -NH₂ group at position 33, and will be referred to as "recombinant Asp33-anginex".

Design and cloning of the artificial gene for recombinant Asp33-anginex

Anginex, a peptide 33-mer having an anti-parallel B-sheet structure as shown in FIG. IA, was selected from a small library of designed B-sheet forming peptides because of its strong anti-angiogenic activity. To produce recombinant anginex, an artificial gene first had to be designed. The 33 amino acid sequence of Anginex (SEQ ID NO:1) as shown in FIG. IA, was translated into a 99 bp genetic code, excluding the possibility of strong secondary structure formation of transcribed mRNA as illustrated Figure IB (SEQ ID NO:2), which was checked using the RNAmFOLD server (dG= 3.5 kcal/mole). Using recursive PCR, the gene was formed out of four oligonucleotides. In the first reaction, a double stranded DNA-fragment encoding the 33 amino acid residues of anginex was formed using two partially overlapping 60 bp oligonucleotides. In a second PCR, the restriction sites EcoRI and Xbal were introduced at the 5' and 3' end, respectively. Due to the profound bactericidal activity from anginex, initial cloning steps were performed in a non-expressing bacterial system. The product of the secondary PCR was then cloned into the bacterial TA-cloning vector pCR2.1 to facilitate gene production as shown in FIG. 1C). As a reference and control, the DNA fragment coding for the well-known angiogenesis inhibitor endostatin, which was also obtained by PCR, was simultaneously cloned into the pCR2.1 vector. For recombinant protein production, both genes were digested and cloned into the Pichia pastoris expression vector pPICZaA. This vector introduces a secretion signal peptide and a His-tag on to the anginex and endostatin genes (FIG. ID). Nucleotide sequencing confirmed the in-frame fusion construct of both genes, with the N-terminally-linked a-factor secretion signal and the C-terminally linked 6xHis-tag. Expression, purification and characterization of recombinant Asp33-anginex

After confirming that the constructs were correct, the DNA was linearized and transformed into competent yeast cells. Aside from being easy to manipulate, the Pichia pastoris expression system has other advantages, such as proper eukaryotic protein processing, protein folding and posttranslational modification. In addition, this expression system is faster and less expensive to use than other eukaryotic expression systems and generally expresses at higher levels. From the initial colonies, clones most responsive to methanol-induction (Mut+ phenotype), were selected. As illustrated in FIG. 2A, small-scale expression experiments showed a maximum level of expression of recombinant already 48 hours after induction. The clone with the highest expression level was then selected for large-scale expression in a 5 L culture. The secreted recombinant protein was isolated from the concentrated supernatant using nickel-chelated beads that bind His-tagged proteins. The yield was relatively low, ranging from 0.4 mg/L to 0.8 mg/L of yeast culture. Currently, optimized fermentor technology is being used to increase efficiency with respect to generating biomass, expression levels and isolation of His- tagged proteins.

Since endostatin has been produced already by others using the same expression system, cloning and expression of endostatin was performed as an overall control for production procedures and some functional assays. The protein was secreted into the culture media and isolated using Ni-chelated beads in the same way as was done for recombinant Asp33-anginex. The expected molecular weight of endostatin (23.6kd) was verified using Western blotting, which was immunostained with an anti-endostatin antibody and shown in FIG. 2B

Detection of recombinant anginex was also carried out by Western blotting and was immunostained using a mouse anti-penta-His antibody (Figure 2B). Recombinant Asp-33 anginex appeared on the Western blot as a broad band of 12-14 IdD. This was essentially double the size of the predicted size of 7.2 1<D. To see if there were functional epitopes available, a Western blot was stained with a specific anti-anginex antibody. The antibody did not stain any bands on the gel. This could be explained by the addition of N-terminal amino acids in recombinant anginex , which are likely to block the epitope of the antibody.

To determine the purity of the isolated protein and to help explain the molecular weight of recombinant Asp33 -anginex, mass spectrometry (MS) was used. MS analysis revealed the presence of two main peaks, the first representing a 7.5 IcD species (86% of total protein) and the second a 15.0 kD species (Figure2A). N-terminal protein sequencing demonstrated that the 7.5 kD fragment was indeed anginex flanked by the signal sequence as expected (FIG. 2C). In this regard, the 15 kD MS peak probably represents dimerized anginex, a feature that has been previously reported to occur with synthetic anginex. N-terminal amino acid sequencing also revealed that the processing of the a-factor signaling sequence was incomplete (see FIG. 2C). Instead of three, there were seven extra amino acids at the N-terminus of anginex. The first four amino acids originated from the STEl 3 signal cleavage site. The processing of the a-signal sequence involves two steps. The first step of signal cleavage occurs at the Arg-Glu site belonging to a-factor C-tenninus by Kex2 endopeptidase. This is followed by cleavage of two GIu- Ala repeats by the STE 13 protein. The efficiency and completeness of this process can be affected by the surrounding amino acid sequence. This is not an uncommon observation, since similar observations have been reported for other proteins as well. The incomplete cleavage of the STEl 3 protease suggests that the 3 -dimensional structure of anginex influences the cleavage efficiency of the protease or that the amount of protein produced exceeds the catalytic power of the protease for effective cleavage of the fusion protein. Given the low yield of recombinant Asp33-anginex in the Pichia pastoris expression system, the latter is not likely.

Subsequent BIAcore analysis confirmed that recombinant Asp33-anginex does associate with synthetic anginex (FIG. 3A). This suggests that the B-sheet folding of recombinant Asp33- anginex is preserved. This is supported by structural analysis using CD, which demonstrates the presence of a prominent band st ill nm, characteristic of B-sheet structure. Figure 3B compares CD traces for synthetic and recombinant Asp33 -anginex. Both spectral traces indicate the predominance of B-sheet conformation in these peptides. Linear combinations of secondary structure basis spectra (a-helix, B-sheet and random coil) fitted to the CD spectra showed the B- sheet content of 86% and 72% in the synthetic and recombinant Asp33-anginex peptide, respectively. The remaining portion of the CD curve arises from unstructured regions in the peptides. Larger content of random coil in recombinant Asp33 -anginex is expected due to amino acid extensions at both peptide termini, primarily to the six histidine residues at the C-terminus. Note, that because small peptides are relatively flexible, the secondary structure contributions are used here merely to confirm that recombinant Asp33-anginex adopts B-sheet conformation. Recombinant anginex inhibits endothelial cell proliferation and migration in vitro

To demonstrate that recombinant Asp33-anginex is biologically active, the endothelial cell (EC) proliferation assay using ³H-thymidine incorporation was performed and compared to the antiproliferative activity from synthetic anginex. It was found that recombinant anginex inhibited EC proliferation, albeit to a lesser degree than from positive controls synthetic anginex and PF4. Although the actual activity of recombinant Asp33-anginex was lower (ED_5O 8-10 PM) than that from synthetic anginex (ED₅₀ 1-3 pM) (Figure 4A), recombinant Asp33 -anginex still demonstrated significant activity at a concentration of 2.5 pM (p<0.037). Moreover, recombinant Asp33-anginex also markedly inhibited the migration of EC in the in vitro wound- healing assay as shown in FIG. 4B. As a control, synthetic anginex and recombinant endostatin, known inhibitors of EC migration, were used (FIG. 4B). Recombinant endostatin functions very well at early time points. Interestingly, in contrast to the inhibition of proliferation, recombinant anginex was essentially as effective as synthetic anginex after 2 hours (p<0.006 versus p<0.013). After 24 hours, however, the wound was still clearly visible in the cell layer treated with recombinant Asp33-anginex, whereas the culture treated with synthetic anginex was almost completely grown to confluency.

Differences in activities between synthetic and recombinant Asp33-anginex maybe explained by the recombinant peptide having an additional seven amino acids at the N-terminus and the tags at its C-terminus. From previous studies, it is known that the amino acids important for the activity of anginex are situated at the N-terminal and second B-strands. Therefore, it was expected that the tags at the C-terminus would have less of an influence than the additional residues at the N-terminus. Moreover, it was known that addition of a single methionine to the N-terminus of anginex can affect its function by inhibiting EC proliferation without leading to apoptosis (unpublished data). Observed functional differences can also be explained by differential glycosylation. Although the synthetic anginex, glycosylation is absent, it is possible that expression in the eukaryotic system has introduced some glycosylation, thereby modifying function. However, based on the amino acid sequence, glycosylation is not expected. In addition, MS analysis did not indicate the presence of sugar groups. Therefore, either the amino acid sequence difference, or some small change in the folded structure of the protein may be responsible for the slight loss of activity as compared to synthetic anginex. Nevertheless, differences in recombinant Asp33-anginex have led to a somewhat greater effect on the signaling pathways affecting migration, as compared to pathways involved in EC proliferation.

Recombinant Asp33-anginex inhibits angiogenesis in vivo To study inhibition of angiogenesis in vivo, the chick embryo chorioallantoic membrane

(CAM)-assay was used. This assay, which measures developmental angiogenesis, is routinely used as the first step in in vivo testing of angiostatic compounds. In CAMs treated with recombinant Asp33-anginex between day 10 and 13 of development (65 plof 25 pM, daily), a profound inhibition of micro-vessel formation was observed, whereas larger pre-existing vessels were apparently unaffected. Figure 5 shows the development of CAM vasculature at day 14 post-fertilization and following treatment with recombinant Asp33-anginex, synthetic anginex, or vehicle alone. Post-treatment vessel counts with recombinant Asp33-anginex were 88 + 15 vs. 150 + 12 for treatment with vehicle alone (41% inhibition, p<0.014). The angiostatic effect using recombinant Asp33 -anginex was essentially the same as that from synthetic anginex (36% inhibition, p<0.060) as illustrated in FIG. 5.

Galectin-1

The present inventors previously described the strong angiostatic activity of a synthetic beta-sheet forming peptide anginex. Since anginex specifically targets activated endothelial cells (EC) the inventors set out to elucidate the underlying mechanism of this peptide. The encoding nucleotide sequence and amino acid sequence of galectin-1 are known in the art. The coding sequence for human galectin-1 is set forth in FIG. 6 A —the ATG start codon is bolded (SEQ ID NO:3). FIG. 6B shows the amino acid sequence for galectin-1 (SEQ ID NO:4)

The present inventors previously described the strong angiostatic activity of a synthetic beta-sheet forming peptide anginex. Since synthetic anginex and recombinant Asp33-anginex specifically target activated endothelial cells (EC) the inventors set out to elucidate the underlying mechanism of this peptide. As shown in FIG. 7A, immunohistochemistry revealed vesicular uptake of anginex by EC within 2 hours. Electron microscopy showed in FIG. 7B that anginex located at the membrane of intracellular vesicles, suggesting receptor-mediated uptake. To identify this receptor, yeast two-hybrid (Y2H) analysis was performed. To that end, the described artificial anginex gene was cloned in frame with the GAL-4 DNA binding domain of the Y2H bait vector pGBDT7, which was confirmed by Western blotting (not shown). Multiple screens against cDNA libraries of activated EC identified galectin-1 (gal-1) as the receptor for anginex which was independently confirmed using three approaches: (i) Double staining of anginex treated EC showed co-localization of anginex and gal-1, (ii) Analysis of NMR spectra revealed chemical shift changes of certain resonances from gal-1 upon addition of anginex, indicative of a specific molecular interaction, (iii) Plasmon resonance spectroscopy (BIAcore analysis) was used to further define the kinetics and stoichiometry of the interaction. Analysis of the binding kinetics revealed a 1 :1 Langmuir association with a rate constant (k_a) of ~6.5xl O³ Ms^"1, while the dissociation kinetics followed a biphasic pattern with dissociation rate constants of 4.2xlO^"2 s^"1 and 5.9xlO^'4 s^"1, respectively. These data suggest that dimerized anginex binds to gal-1 and that subsequently the two anginex molecules dissociate as monomers with a K_& of 6.4 μM for dissociation of first anginex molecule and a K_d of 90 nM for the second molecule (FIGS. 8 A and 8B). This result is supported by mass spectrometry which displayed a major peak with a mass of 22.8 kD (gal-1 monomer (14.7 kD) + anginex dimer (8 kD) (not shown). The data above show that gal-1 and anginex interact, suggestive of gal-1 serving as receptor for anginex.

Galectin-1 is overexpressed in tumor EC and plays a crucial role in EC proliferation and migration To determine the role of gal-1 in tumor EC biology, we first analyzed gal-1 expression in human tumor blood vessels by immunohistochemistry. While gal-1 is only weakly expressed in EC of normal tissue (colon is shown: Figure 7C, left panels), a strong expression was found in EC of human colon carcinoma (Figure 7C, middle panels) and breast carcinoma (not shown), especially in EC that stained positive for the proliferation marker Ki67. Similar results were observed for a sarcoma type of tumor (Ewing sarcoma) in which the gal-1 staining was almost exclusively observed in vessels (Figure 7C, right panels). These data demonstrate that the amount of gal-1 protein is upregulated in angiogenically active EC. Indeed, growth factor activation of freshly isolated human umbilical vein EC resulted in a significant increase in gal-1 mRNA expression and a concomitant > 10-fold induction of gal-1 protein expression (Figure 7D). Furthermore, treatment of activated EC with a gal-1 specific antisense ligodeoxynucleotide (ODN) resulted in inhibition of EC proliferation, while a random ODN had no effect (Figure 7E). Next to EC proliferation, EC migration was also inhibited by treatment with either the gal-1 specific ODN (Figure 7F) or the rabbit polyclonal anti-gal-1 antibody (Figure 7G). These data strongly suggest a role for gal-1 in EC biology.

Galectin-1 is required for coordinated angiogenesis in vivo. The role of gal-1 in angiogenesis in vivo was first studied in the chick chorioallantoic membrane (CAM) (Fig. 8). Challenging angiogenesis in the CAM with a rabbit polyclonal anti- gal-1 antibody induced a significant inhibition of micro vessel density. Interestingly, treatment caused tortuous and irregular growth of the vessels, suggesting a defect in vascular guidance. For further insight in the role of gal-1 during angiogenesis in vivo, we used the Tg(flil:egfp/^] zebrafish model. In this model, EC are marked by expression of green fluorescent protein (GFP) (17). Recently, 3 prototype galectins were described in zebrafish (Lgalsl- L1/L2/L3) of which Lgalsl-L2 was found to preferentially bind N-acetyllactosamine, similar to human gal-1 (18). Whole mount RNA in situ hybridization at 48 hours post-fertilization revealed specific expression of Lgalsl-L2 in the eyes around the lens and in the ventricular zone in the head (Figure 10A). Lgalsl-L3 expression was broader and largely overlapped with that of Lgalsl-L2 (Figure 10B). Furthermore, cross sections at the level of the midbrain showed co- localization of both Lgalsl-L2/-L3 and the EC specific marker VE-cadherin in the retinal vessels (Figures 1 OC-E) and in the blood vessels in the brain (not shown).

To determine the function oϊLgalsl-L2 and -L3 on vascular development, morpholino- modified antisense oligonucleotides (MOs) were designed to specifically target either the translation start site (ATG-MO) or the splice donor site (splice-MO). The injection of each splice-MO was verified to ascertain that each successfully interfered with the splicing of the respective transcripts (not shown). Injection of either Lgalsl-L2 or -L3 ATG-MO induced hemorrhages in the head and in/behind the eyes of the embryos at 2.5 days post fertilization, as detected with a sensitive o-Dianisidine blood staining. Co-injection of both Lgalsl-L2 and -L3 MOs resulted in even more severe hemorrhages (Figures 1 IA-D). Similar results were observed with the splice-MOs (not shown). Confocal scanning laser microscopy in the ventricular zone of Tgφihegfp/¹ zebrafish revealed vascular defects, at the location of the hemorrhages, after co- injection of Lgalsl-L2 and -L3 ATG MO. Compared to untreated zebrafish (Figure 1 IF), abnormal sprouting and misguidance of vessels clearly appeared in the mid-cerebral area of the Lgalsl-L2 and -L3 ATG MO treated animals (Figures 1 IE-H). Vascular network formation of the middle cerebral-, dorsal longitudinal-, mesencephalic- and anterior cerebral veins was also distorted by both MOs, and most severely in the double knockdown (Figure 1 IG). The same defects were observed upon co-injection of both splice MOs, indicating specificity of the knockdown defects (Figure 1 IH), while single injection of each splice MO revealed weaker defects (not shown). Similar to those in the ventricular zone, retinal vessels showed abnormal sprouting and growth in the regions where hemorrhages occurred (not shown). Together with observations from the CAM, results in zebrafish indicate that gal-1 is important in vivo for coordinated vessel outgrowth and vascular network formation.

Galectin-1 facilitates tumor progression through angiogenesis.

The presented results urged us to study the role of gal-1 by analyzing tumor angiogenesis in the gal-1 null mice. To compare tumor growth in the presence or absence of gal-1, wild type (gal-l^{+ +}) and null (gal-1^{" "}) mutant 129P3/J mice were subcutaneously injected with syngeneic murine F9 teratocarcinoma cells. Three days after injection, a small palpable tumor developed in all mice, suggesting that tumor initiation and initial growth is not dependent on gal- 1. However, subsequent tumor growth was significantly abrogated in the gal-1^{" "} mice compared to the wild- type animals. Fifteen days after injection, the tumor volumes in the gal-l^7" mice were approximately 4-fold smaller compared to those in the gal-l^+/+ mice (Figure 1 IA). As expected, immunohistochemical analysis showed high expression of gal-1 in the EC of tumor vessels in the wild-type animals and no expression in the null mice (Figure 1 IB). Quantification of micro vessel density revealed a significant lower amount of blood vessels in null mice compared to wild-type mice (Figure HC). hi addition, parameters of vessel architecture were decreased as illustrated in Table 1 :

Table 1 : Vascular parameters in F9 tumors of wild type and mutant mice

Mice Vessel End Branch Vessel Density" Points⁵ Points⁰ Length^d gal-l^+/+ 8642 ± 666 147 ± 11 lO ± l.l 11.6 ± 1.0

gal-1^"'^" 2009 ± 269* 48.8 ± 3.4" 2.0 ± 0.6* 2.8 ± 0.3*

On the last day of the experiment, tumors were excised. Tumors without apparent widespread necrosis were embedded in tissue freezing medium (Miles Inc.) and snap frozen in liquid nitrogen. Preparation and procedures were performed as described in Wild, et. al., Quantitative assessment of angiogenesis and tumor vessel architecture by computer-assisted digital image analysis: effects of VEGF-toxin conjugate on tumor microvessel density (2000) Microvasc Res 59, 368-76. ^a After binarization of the images from CD31 -staining, microvessel density was estimated by scoring the total number of white pixels per field. ^b Mean number of vessel end points as determined after skeletonization of the images(6). ^cMean number of vessel branch points/nodes per image. ^d Mean total vessel length per image.

All results are expressed as mean pixel counts per image ±standard error from 20 images.

^# ρ<0.05 vs. wildtype.

Since gal-1 has been shown to mediate apoptosis in activated T cells, which could contribute positively to tumor growth (20), we also quantified the amount of peripheral blood leukocytes, and the presence of CD45⁺ and CD8⁺ cells in the tumors. There was no detectable difference in these parameters between gal-l^+/+ and gal-1^"7" animals (Fig. 13) which strongly suggests that impaired tumor progression in gal-1 null mice largely results from decreased angiogenesis.

Galectin-l is a target protein for angiostatic therapy.

Because gal-1 was initially identified as a receptor for the angiostatic peptide anginex, we also analyzed the effect of anginex treatment in wild type and gal-1 null mice, hi wild-type animals, anginex significantly inhibited tumor growth by approximately 70% (Figure 12D) and vessel density by approximately 55% (Figure 12E), which is comparable with previous observations for anginex in other tumor models. In gal-1^"7" mice, treatment with anginex had no effect on tumor growth (Figure 12F). In addition, anginex treatment did not affect the number of infiltrating CD45⁺ or CD8⁺ cells in the tumors of both the wild type and null mice (Fig. 14). These data demonstrate that gal-1 mediates the angiostatic activity of anginex and that gal-1 can serve as a target for angiostatic therapy. Based upon much of the above experimentation it has been determined that glycosylation is not the cause of interaction since the anginex gene does not contain sites for glycosylation and MS of the recombinant protein does not show glycosylation. Furthermore, interaction was confirmed by NMR and BiaCore analysis with the synthetic peptide. Finally, galectin-1 was picked up by yeast two-hybrid no elongation of glycan chains on cytosolic proteins, and anginex binds to the C-terminal of galectin-1, which is outside the carbohydrate recognition domain. The feasibility of the approach was confirmed by the identification of partial cDNAs encoding fibronectin of which recently has been shown that it is involved in homing of anginex to tumor vessels

The experimentation confirms that the response to TNFα is in line with previous observations and all these indicate that galectin-1 is an early activation marker for endothelial cells similar as described for CD44. Furthermore, the results described above show that the lack of CAM response to galectin-1/3 could be explained by the absence of galectin-1 β in chicken.

The present invention provides a method for the treatment of a patient afflicted with cancer and inflammatory diseases wherein such disease states may be treated by the administration of an effective amount of a compound of the present invention to a patient in need thereof. The present invention further provides a method of treating a patient to promote an inflammatory response by treating the patient with an effective amount of a compound of the present invention.

A therapeutically effective amount of a compound of the present invention refers to an amount which is effective in controlling, reducing, or promoting the inflammatory response. The term "controlling" is intended to refer to all processes wherein there may be a slowing, interrupting, arresting, or stopping of the progression of the disease and does not necessarily indicate a total elimination of all disease symptoms. Where used herein, the term "purified" with respect to synthetic anginex, recombinant Asp33-anginex and galectin-1 refers to galectin-1 (monomelic or dimeric form) and anginex (synthetic or recombinant) in a form substantially free of natural contaminants.

The term "therapeutically effective amount" is further meant to define an amount resulting in the improvement of any parameters or clinical symptoms characteristic of the inflammatory response. The actual dose will be different for the various specific molecules, and will vary with the patient's overall condition, the seriousness of the symptoms, and counterindications. As used herein, the term "subject" or "patient" refers to a warm blooded animal such as a mammal which is afflicted with a particular inflammatory disease state. It is understood that guinea pigs, dogs, cats, rats, mice, horses, cattle, sheep, and humans are examples of animals within the scope of the meaning of the term. A therapeutically effective amount of the compound used in the treatment described herein can be readily determined by the attending diagnostician, as one skilled in the art, by the use of conventional techniques and by observing results obtained under analogous circumstances. In determining the therapeutically effective dose, a number of factors are considered by the attending diagnostician, including, but not limited to: the species of mammal; its size, age, and general health; the specific disease involved; the degree of or involvement or the severity of the disease; the response of the individual patient; the particular compound administered; the mode of administration; the bioavailability characteristic of the preparation administered; the dose regimen selected; the use of concomitant medication; and other relevant circumstances. Preferred amounts and modes of administration are able to be determined by one skilled in the art. One skilled in the art of preparing formulations can readily select the proper form and mode of administration depending upon the particular characteristics of the compound selected the disease state to be treated, the stage of the disease, and other relevant circumstances using formulation technology known in the art, described for example in Remington's Pharmaceutical Sciences, latest edition, Mack Publishing Co.

The polypeptides of this invention can be administered alone in a pharmaceutically acceptable buffer or carrier, as an antigen in association with another protein, such as an immunostimulatory protein or with a protein carrier such as, but not limited to, keyhole limpet hemocyanin (KLH), bovine serum albumin (BSA), ovalbumin, or the like. They may be employed in a monovalent state (i.e., free peptide or a single peptide fragment coupled to a carrier molecule). They may also be employed as conjugates having more than one (same or different) peptides bound to a single carrier molecule. The carrier may be a biological carrier molecule (e.g., a glycosaminoglycan, a proteoglycan, albumin or the like) or a synthetic polymer (e.g., a polyalkyleneglycol or a synthetic chromatography support). Typically, ovalbumin, human serum albumin, other proteins, polyethylene glycol, or the like are employed as the carrier. Such modifications may increase the apparent affinity and/or change the stability of a peptide. The number of peptides associated with or bound to each carrier can vary, but from about 4 to 8 peptides per carrier molecule are typically obtained under standard coupling conditions.

The polypeptides can be conjugated to other polypeptides using standard methods such as activation of the carrier molecule with a heterobifunctional sulfosuccinimidyl 4-(n- maleimidomethyl) cyclohexane-1-carboxylate reagent. Cross-linking of an activated carrier to a peptide can occur by reaction of the maleimide group of the carrier with the sulfhydryl group of a peptide containing a cysteine residue. Conjugates can be separated from free peptide through the use of gel filtration column chromatography or other methods known in the art. For instance, peptide/carrier molecule conjugates may be prepared by treating a mixture of peptides and carrier molecules with a coupling agent, such as a carbodiimide. The coupling agent may activate a carboxyl group on either the peptide or the carrier molecule so that the carboxyl group can react with a nucleophile (e.g., an amino or hydroxyl group) on the other member of the peptide/carrier molecule, resulting in the covalent linkage of the peptide and the carrier molecule.

The present invention also provides a composition that includes one or more active agents (i.e., polypeptides) of the invention and one or more pharmaceutically acceptable carriers. One or more polypeptides with demonstrated biological activity can be administered to a patient in an amount alone or together with other active agents and with a pharmaceutically acceptable buffer. The polypeptides can be combined with a variety of physiological acceptable carriers for delivery to a patient including a variety of diluents or excipients known to those of ordinary skill in the art.

Pharmaceutical compositions can be manufactured utilizing techniques known in the art. Typically the therapeutically effective amount of the compound will be admixed with a pharmaceutically acceptable carrier.

The compounds or compositions of the present invention may be administered by a variety of routes, for example, orally or parenterally (i.e. subcutaneously, intravenously, intramuscularly, intraperitoneally, or intratracheally).

For oral administration, the compounds can be formulated into solid or liquid preparations such as capsules, pills, tablets, lozenges, melts, powders, suspensions, or emulsions. Solid unit dosage forms can be capsules of the ordinary gelatin type containing for example, surfactants, lubricants and inert fillers such as lactose, sucrose, and cornstarch or they can be sustained release preparations.

In another embodiment, the compounds of this invention can be tabletted with conventional tablet bases such as lactose, sucrose, and cornstarch in combination with binders, such as acacia, cornstarch, or gelatin, disintegrating agents such as potato starch or alginic acid, and a lubricant such as stearic acid or magnesium stearate. Liquid preparations are prepared by dissolving the active ingredient in an aqueous or non-aqueous pharmaceutically acceptable solvent which may also contain suspending agents, sweetening agents, flavoring agents, and preservative agents as are known in the art. For parenteral administration the compounds may be dissolved in a physiologically acceptable pharmaceutical carrier and administered as either a solution or a suspension. Illustrative of suitable pharmaceutical carriers are water, saline, dextrose solutions, fructose solutions, ethanol, or oils of animal, vegetative, or synthetic origin. The pharmaceutical carrier may also contain preservatives, and buffers as are known in the art. The compounds of this invention can also be administered topically. This can be accomplished by simply preparing a solution of the compound to be administered, preferably using a solvent known to promote transdermal absorption such as ethanol or dimethyl sulfoxide (DMSO) with or without other excipients. Preferably topical administration will be accomplished using a patch either of the reservoir and porous membrane type or of a solid matrix variety. As noted above, the compositions can also include an appropriate carrier. For topical use, any of the conventional excipients maybe added to formulate the active ingredients into a lotion, ointment, powder, cream, spray, or aerosol. For surgical implantation, the active ingredients may be combined with any of the well-known biodegradable and bioerodible carriers, such as polylactic acid and collagen formulations. Such materials may be in the form of solid implants, sutures, sponges, wound dressings, and the like. Preparation of compositions for local use are detailed in Remington's Pharmaceutical Sciences, latest edition, (Mack Publishing).

Additional pharmaceutical methods may be employed to control the duration of action. Controlled release preparations may be achieved through the use of polymers to complex or absorb galectin-1 or its functional derivatives. The controlled delivery may be achieved by selecting appropriate macromolecules (for example, polyesters, polyamino acids, polyvinyl, pyrrolidone, ethylenevinylacetate, methylcellulose, carboxymethylcellulose, or protamine, sulfate) and the appropriate concentration of macromolecules as well as the methods of incorporation, in order to control release.

Another possible method useful in controlling the duration of action by controlled release preparations is incorporation of the galectin-1 molecule or its functional derivatives into particles of a polymeric material such as polyesters, polyamino acids, hydrogels, poly(lactic acid), or ethylene vinylacetate copolymers.

Alternatively, instead of incorporating galectin-1 or its functional derivatives into polymeric particles, it is possible to entrap these materials in microcapsules prepared, for example, by coacervation techniques or by interfacial polymerization (for example, hydroxymethylcellulose or gelatine-microcapsules and poly-(methylmethacylate) microcapsules, respectively), in colloidal drug delivery systems (for example, liposomes, albumin microspheres, microemulsions, nano-particles, and nanocapsules), or in macroemulsions. Such techniques are disclosed in the latest edition of Remington's Pharmaceutical Sciences.

Methods for encapsulating biological materials in liposomes have been described previously and are well known in the art. Essentially, the material is dissolved in an aqueous solution, the appropriate phospholipids and lipids added, along with surfactants if required, and the material dialyzed or sonicated, as necessary. A good review of known methods is by G.

Gregoriadis, Chapter 14. "Liposomes", Drug Carriers in Biology and Medicine, pp. 287-341

(Academic Press, 1979). Microspheres formed of polymers or proteins are well known to those skilled in the art, and can be tailored for passage through the gastrointestinal tract directly into the blood stream. Alternatively, the agents can be incorporated and the microspheres, or composite of microspheres, implanted for slow release over a period of time, ranging from days to months.

When compositions are to be used as an injectable material, they can be formulated into a conventional injectable carrier. Suitable carriers include biocompatible and pharmaceutically acceptable phosphate buffered saline solutions, which are preferably isotonic.

As an atomizable composition, or a lavage, the active ingredients of the present invention may be administered to treat diseases of the lungs. Diseases of the lungs involving inflammation include asbestosis, silicosis, coal miner's pneumoconiosis; those relating to autoimmune conditions that may involve the lungs include rheumatoid arthritis, lupus erythematosus; and granulomatous inflammations of the lungs include Wegener's granulomatosis and eosinophilic granulomatosis.

The term "inflammation" is meant to include reactions of both the specific and nonspecific defense systems. A specific defense system reaction is a specific immune system reaction response to an antigen. Examples of a specific defense system reaction include the antibody response to antigens such as rubella virus, and delayed-type hypersensitivity response mediated by T-cells (as seen, for example, in individuals who test "positive" in the Mantaux test).

A non-specific defense system reaction is an inflammatory response mediated by leukocytes incapable of immunological memory. Such cells include granulocytes, macrophages, endothelial cells, etc. Examples of a non-specific defense system reaction include the immediate swelling at the site of a bee sting, the reddening and cellular infiltrate induced at the site of a burn and the collection of PMN (polymorphonuclear) leukocytes at sites of bacterial infection (e.g., pulmonary infiltrates in bacterial pneumonias, pus formation in abscesses). Although the invention is particularly suitable for cases of acute inflammation, it also has utility for chronic inflammation. Types of inflammation that can be treated with the present invention include diffuse inflammation, traumatic inflammation, immunosuppression, toxic inflammation, specific inflammation, reactive inflammation, parenchymatous inflammation, obliterative inflammation, interstitial inflammation, croupous inflammation, and focal inflammation.

It will be appreciated that the present invention will be easily adapted to the diagnosis, monitoring, and treatment of inflammatory disease processes such as rheumatoid arthritis, acute and chronic inflammation, post-ischemic (reperfusion) leukocyte-mediated tissue damage, acute leukocyte-mediated lung injury (e.g., Adult Respiratory Distress Syndrome), and other tissue-or organ-specific forms of acute inflammation (e.g., glomerulonephritis).

Where used herein, the term "functional derivatives" is intended to include the "fragments," "variants," "analogues," or "chemical derivatives" of the subject polypeptides. For example, a "fragment" of galectin-1 polypeptide is meant to refer to a polypeptide subset. A "variant" of the polypeptides is meant to refer to naturally occurring molecules substantially similar to either the entire molecules or fragments thereof. An "analogue" of galectin-1 is meant to refer to a non-natural molecule substantially similar to either the entire molecules or fragments thereof or a molecule which has the same apoptotic inducing activity as galectin-1. A molecule is said to be "substantially similar" to another molecule if the sequence of amino acids in both molecules is substantially the same, and if both molecules possess a similar biological activity. Thus, provided that two molecules possess a similar activity, they are considered variants as that term is used herein even if one of the molecules contains additional amino acid residues not found in the other, or if the sequence of amino acid residues is not identical.

As used herein, a molecule is said to be a "chemical derivative" of another molecule when it contains additional chemical moieties not normally a part of the molecule. Such moieties may improve the molecule's solubility, absorption, biological half-life, etc. The moieties may alternatively decrease the toxicity of the molecule, eliminate or attenuate any undesirable side effect of the molecule, etc. Examples of moieties capable of mediating such effects are disclosed in the latest edition of Remington's Pharmaceutical Sciences, and will be apparent to those of ordinary skill in the art.

A suitable screening method for determining whether a given compound is an anginex or galectin-1 functional derivative comprises, for example, bioassays as described herein as well as immunoassays, employing RIA or ELISA methodologies, based on the production of specific neutralizing antibodies (monoclonal or polyclonal) to natural galectin-1.

As would be apparent to one of ordinary skill in the art, the therapeutic anti-inflammatory effects of galectin-1 may be obtained by providing to a patient the dimeric form of galectin-1 molecules. Further, the therapeutic pro-inflammatory effects of galectin-1 may be obtained by providing the monomeric form of the molecule, or any therapeutically active peptide fragments thereof.

As is also apparent, the therapeutic advantages of synthetic anginex, recombinant Asp33- anginex and galectin-1 maybe augmented through the use of mutants or variants possessing additional or substituted amino acid residues added to enhance its coupling to a carrier or to enhance the activity of synthetic anginex, recombinant Asp33-anginex or galectin-1. The scope of the present invention is further intended to include mutant forms of synthetic and recombinant anginex and galectin-1 (including anginex and galectin-1 molecules which lack certain amino acid residues), or which contain altered amino acid residues, so long as such mutant galectin-1 molecules exhibit the capacity to affect endothelial cell activity as described herein for monomeric or dimeric forms. The synthetic anginex, recombinant synthetic anginex, recombinant Asp33-anginex and galectin-1 polypeptides of the present invention and functional derivatives can be formulated according to known methods of preparing pharmaceutically useful compositions, whereby these materials or their functional derivatives are combined in a mixture with a pharmaceutically acceptable carrier vehicle. Suitable vehicles and their formulation, including other human proteins, e.g., human serum albumin, are described, for example, in Remington's Pharmaceutical Sciences, (Mack Publishing Co., 1980).

For reconstitution of a lyophilized product in accordance with this invention, one may employ a sterile diluent, which may contain materials generally recognized for approximating physiological conditions and/or as required by governmental regulation. In this respect, the sterile diluent may contain a buffering agent to obtain a physiologically acceptable pH, such as sodium chloride, saline, phosphate-buffered saline, and/or other substances which are physiologically acceptable and/or safe for use. In general, the material for intravenous injection in humans should conform to regulations established by the Food and Drug Administration, which are available to those in the field.

The pharmaceutical composition may also be in the form of an aqueous solution containing many of the same substances as described above for the reconstitution of a lyophilized product.

The compounds can also be administered as a pharmaceutically acceptable acid- or base- addition salt, formed by reaction with inorganic acids such as hydrochloric acid, hydrobromic acid, perchloric acid, nitric acid, thiocyanic acid, sulfuric acid, and phosphoric acid, and organic acids such as formic acid, acetic acid, propionic acid, glycolic acid, lactic acid, pyruvic acid, oxalic acid, malonic acid, suςcinic acid, maleic acid, and fumaric acid, or by reaction with an inorganic base such as sodium hydroxide, ammonium hydroxide, potassium hydroxide, and organic bases such as mono-, di-, trialkyl and aryl amines and substituted ethanolamines.

As mentioned above, the products of the invention may be incorporated into pharmaceutical preparations which may be used for therapeutic purposes. However, the term "pharmaceutical preparation" is intended in a broader sense herein to include preparations containing a protein composition in accordance with this invention, used not only for therapeutic purposes but also for reagent or diagnostic purposes as known in the art, or for tissue culture. The pharmaceutical preparation intended for therapeutic use should contain a "pharmaceutically acceptable" or "therapeutically effective amount" of galectin-1 (dimeric or monomelic form), i.e., that amount necessary for preventative or curative health measures. If the pharmaceutical preparation is to be employed as a reagent or diagnostic, then it should contain reagent or diagnostic amounts of galectin-1.

Other Utilities

The present invention also includes methods of detecting synthetic anginex, recombinant Asp-33 anginex and/or galectin-1 or functional derivatives in a sample or subject. For example, antibodies specific for anginex and/or galectin-1 or for functional derivatives thereof, may be detectably labeled with any appropriate ligand, for example, a radioisotope, an enzyme, a fluorescent label, a paramagnetic label, or a free radical. Methods of making and detecting such detectably labeled antibodies or their functional derivatives are well known to those of ordinary skill in the art.

The detection of foci of such labeled antibodies may be indicative of a site of inflammation (such as via cytokines inflammation). In one embodiment, this examination for inflammation is accomplished by removing samples of tissue or blood and incubating such samples in the presence of detectably labeled antibodies. In a preferred embodiment, this technique is accomplished in a non-invasive manner through the use of magnetic imaging, fluorography, etc. It is possible to use antibodies, or their functional derivatives, to detect or diagnose the presence and location of galectin-1 in a mammalian subject suspected of having an inflammation by utilizing an assay for galectin-1 comprising incubating a biological sample from said subject suspected of containing galectin-1 in the presence of a detectably labeled binding molecule (e.g., antibody) capable of identifying galectin-1 and detecting said binding molecule which is bound in a sample.

Thus, in this aspect of the invention a biological sample may be transferred to nitroccapable of immober solid support which is capable of immobilizing cells, cell particles or soluble protein. The support may then be washed with suitable buffers followed by treatment with the detectably labeled galectin-1 specific antibody. The solid phase support may then be washed with the buffer a second time to remove unbound antibody. The amount of bound label on the antibody may then be detected by conventional means. In carrying out the assay of the present invention, for example, on a sample containing galectin-1, the process may comprise:

(a) contacting a sample suspected of containing galectin-1 with a solid support to effect immobilization of galectin-1; (b) contacting said solid support with a detectably labeled galectin-1 -specific antibody;

(c) incubating said detectably labeled galectin-1 -specific antibody with said support for a time sufficient to allow the galectin-1 -specific antibody to bind to the immobilized galectin-1;

(d) separating the solid phase support from the incubation mixture obtained in step (c); and (e) detecting the bound label and thereby detecting and quantifying galectin-1.

This aspect of the invention relates to a method for detecting galectin-1 or fragment thereof in a sample, comprising:

(a) contacting the sample suspected of containing galectin-1 with a galectin-1 -specific antibody or fragment thereof which binds to galectin-1; and (b) detecting whether a complex is formed.

Of course, the specific concentrations of detectably labeled antibody and galectin-1, the temperature and time of incubation, as well as other assay conditions may be varied, depending on various factors including the concentration of galectin-1 in the sample, the nature of the sample, and the like. Those skilled in the art will be able to determine operative and optimal assay conditions for each determination by employing routine experimentation.

Other such steps as washing, stirring, shaking, filtering and the like may be added to the assays as is customary or necessary for the particular situation.

One of the ways in which the galectin-1 -specific antibody can be detectably labeled is by linking the same to an enzyme. This enzyme, in turn when later exposed to its substrate, will react with the substrate in such a manner as to produce a chemical moiety which can be detected, for example, by spectrophotometric, fluorometric or by visual means. Enzymes which can be used to detectably label the galectin-1 -specific antibody include, but are not limited to, malate dehydrogenase, staphylococcal nuclease, delta- V-steroid isomerase, yeast alcohol dehydrogenase, alpha-glycerophosphate dehydrogenase, triose phosphate isomerase, horseradish peroxidase, alkaline phosphatase, asparaginase, glucose oxidase, beta-galactosidase, ribonuclease, urease, catalase, glucose- VI-phosphate dehydrogenase glucoamylase and acetylcholine esterase.

The galectin-1 specific-antibody may also be labeled with a radioactive isotope which can be determined by such means as the use of a gamma counter or a scintillation counter or by audioradiography. Isotopes which are particularly useful for the purpose of the present invention are: ³H, ¹²⁵1, ¹³¹1, ³⁵S, ¹⁴C, and ⁵¹Cr.

It is also possible to label the galectin-1 -specific antibody with a fluorescent compound. When the fluorescently labeled antibody is exposed to light of the proper wave length, its presence can then be detected due to the fluorescence of the dye. Among the most commonly used fluorescent labeling compounds are fluorescein isotbiocyanate rhodamine, phycoerytherin, phycocyanin, allophycocyanin, o-phthaldehyde and fluorescamine.

The galectin-1 -specific antibody can also be detectably labeled using fluorescence emitting metals such as ¹⁵²Eu, or others of the lanthanide series. These metals can be attached to the galectin-1 -specific antibody using such metal chelating groups as diethylenetriamiiiepentaacetic acid (DTPA) or ethylenediaminetetraacetic acid (EDTA).

The galectin-1 -specific antibody also can be detectably labeled by coupling it to a chemiluminescent compound. The presence of the chemiluminescent-tagged galectin-1 -specific antibody is then determined by detecting the presence of luminescence that arises during the course of a chemical reaction. Examples of particularly useful chemiluminescent labeling compounds are luminol, isoluminol, theromatic acridinium ester, imidazole, acridinium salt and oxalate ester.

Likewise, a bioluminescent compound may be used to label the galectin-1 -specific antibody of the present invention. Bioluminescence is a type of chemiluminescence found in biological systems in which a catalytic protein increases the efficiency of the chemiluminescent reaction. The presence of a bioluminescent protein is determined by detecting the presence of luminescence. Important bioluminescent compounds for purposes of labeling are luciferin, luciferase and aequorin.

Detection of the galectin-1 -specific antibody may be accomplished by a scintillation counter, for example, if the detectable label is a radioactive gamma emitter, or by a fluorometer, for example, if the label is a fluorescent material. In the case of an enzyme label, the detection can be accomplished by calorimetric methods which employ a substrate for the enzyme. Detection may also be accomplished by visual comparison of the extent to enzymatic reaction of a substrate in comparison with similarly prepared standards.

In one embodiment of the invention, galectin-1 can be used to screen for agents that activate endothelial cells. This assay is based on the ability of activated, but not non-activated, cells to be agglutinated by galectin-1. In one version, cells would be treated in microtiter wells with the new agent and the visual agglutination of the cells by galectin-1 within minutes would demonstrate activation of the endothelial cells.

In another embodiment, immobilized galectin-1 can be used to physically separate activated endothelial cells from nonactivated cells. Only the activated cells would bind to immobilized lectin. Thus, one could prepare pure populations of either activated or non- activated cells. hi another embodiment potential new pro-inflammatory drugs or compounds can be screened by their ability to block agglutination of activated endothelial cells by dimeric galectin- 1. Such inhibitors could be carbohydrate-based, for example, or could be other organic compounds that mimic such a carbohydrate, for example. Alternatively, one of ordinary skill in the art can screen for drugs or compounds that prevent or inhibit dimerization of galectin. These drugs could be screened by their ability to block galectin-1 induced agglutination of activated endothelial cells.

More particularly, the present invention contemplates a method of screening for compounds which inhibit activation of endothelial cells, comprising the steps of providing a sample of non-activated endothelial cells, treating the sample with a test compound, exposing the treated sample to conditions which normally cause activation of non-activated endothelial cells, and contacting the exposed and treated sample with galectin-1, and wherein when the endothelial cells are observed to be substantially non-agglutinated it is concluded that the test compound inhibits the activated of non-activated endothelial cells. Where used herein, the term test compound is meant to include proteins (including antibodies), glycoproteins, lipoproteins, as well as peptides, lipids, carbohydrates, or other small molecules.

The present invention also contemplates a method of screening for compounds which inhibit the galectin-1 -receptor-mediated binding activity of activated endothelial cells, comprising providing a sample of activated endothelial cells, treating the sample with a test compound, and contacting the treated sample with galectin-1, and wherein when the endothelial cells are observed to be substantially non-agglutinated after being contacted with the galectin-1 it is concluded that the test compound inhibits the galectin-1 -receptor-mediated binding activity of the activated endothelial cells.

The present invention also contemplates a method of screening for compounds which cause activation of endothelial cells, comprising providing a sample of non-activated endothelial cells, treating the sample with a test compound, contacting the treated sample with galectin-1, and wherein when the endothelial cells are observed to be substantially agglutinated after being contacted with the galectin-1 it is concluded that the test compound causes activation of endothelial cells. The present invention further contemplates a method of screening for compounds which stimulate apoptosis of endothelial cells via the galectin-1 receptor, comprising providing a sample of activated endothelial cells, contacting the sample with a quantity of the monomelic form of galectin-1, treating the contacted sample with a test compound able to stimulate apoptosis of endothelial cells, and examining the treated endothelial cells for evidence of apoptosis and concluding that the test compound stimulates apoptosis of endothelial cells via the galectin-1 receptor when the effectiveness of the test compound in inducing apoptosis is reduced or inhibited.

The present invention further contemplates a method of screening for compounds which bind to the galectin-1 receptor on endothelial cells, comprising providing a sample of activated endothelial cells, treating the sample with a test compound, and contacting the treated sample with galectin-1, and wherein when the endothelial cells are observed to be substantially non- agglutinated, concluding that the test compound binds to the galectin-1 receptor. Li particular, the test compound may be a monoclonal antibody.

All of the assay methods listed herein are well within the ability of one of ordinary skill in the art given the teachings provided herein.

EXPERIMENTAL

Anginex Materials Restriction enzymes and T4 DNA ligases were obtained New England Biolabs (Leusden, the Netherlands). Oligonucleotide primers were synthesized by Eurogentec (Liege, Belgium).

Nucleotide sequencing was carried out on an Applied Biosystems DNA sequencer, utilizing the

ABI prism Big dye terminator reaction mix (Nieuwerkerk aan den Ussel, the Netherlands). All tissue culture reagents, the TA-cloning kit and the Pichia pastoris expression system were purchased from Invitrogen (Breda, The Netherlands). BIAcore equipment and reagent kits and chips were obtained from BIAcore life sciences (Breda, the Netherlands).

Design and cloning of the anginex gene

The gene encoding anginex was made using 4 primers in a PCR reaction. The DNA codons used to code for the amino acids were chosen in such a way that the primers did not form stable secondary structures in the PCR reactions. Formation of the artificial 99 bp gene of anginex was a two-step process. Two partial overlapping oligonucleotides were designed to form the gene of anginex: (A) 5'-

GCAAACATAAAACTAAGCGTACAAATGAAACTATTCAAAAGACACCTAAAATGGAA

ATA-3' (SEQ ID NO:5; (B) 5¹ -GTCTAGGCTTAGTTCTCTTCCGT

CGTTTAGTTTTACTATTATTTTCCATTTTAGGTGTCT (SEQ ID NO:6. In a secondary PCR, primers (1) 5' -

TATGAATTCATGGCAAACATAAAACTAAGCGTAC-S' (SEQ ID NO:7) and (2) 5'-

TTATCTAGACGGTCTAGGCTTAGTTCTCTCTTCC (SEQ ID NO: 8) were used to introduce restriction sites for EcoRi and Xbal (shown in bold). The coding sequence for endostatin was obtained using PCR on cDNA of a human colon tumor. The following primers were used: 5'-

TATGAATTCATGCACAGCCACCG-3' (SEQ ID NO:9) and 5'-

TATTCTAGATACTTGGAGGCAGTCATG-S' (SEQ ID NO: 10). Both amplicons were cloned into the pCR2.1 TOPO-TA cloning kit and the sequence was verified by sequencing. Using the flanking restriction enzymes EcoRI and Xbal, the anginex and endostatin coding sequence were cloned into the yeast expression vector pPICZa-A. The new expression constructs were sequence verified with primer 5'AOX: 5'-GACTGGTTCCAATTGACAAGC-S' (SEQ ID NO:11), confirming an in-frame fusion with the Pichia pastoris a-factor secretion signal sequence at the N-terminal side of and the c-myc & 6xHis-tag sequence at the C-terminal side of both genes.

Transformation of Pichia pastoris, determination of the mut phenotype and expression of recombinant anginex (recombinant Asp33-anginex)

Both expression vectors were linearized using the restriction enzyme Sacl in order to facilitate integration at theAOXl locus of the yeast genome. The linearized vector was transformed into the Pichia pastoris strains GS 115 and X33 by using the Pichia Easycomp kit (Invitrogen) according to the manufacturers instructions. For each construct, several zeocine- resistant clones were selected and tested for a Mut⁺ phenotype by patching the colonies, respectively, on MMH (minimal methanol with histidine) and MDH (minimal dextrose with histidine) plates. From the clones that had a Mut⁺ phenotype, ten colonies were selected for a small-scale expression test in order to select the best expressing strain. Using these clones, 25 ml BMGY (1% yeast extract, 2% peptone, 100 mM potassium phosphate, pH 6.0, 1.34% YNB, 4*10^"5 %biotin, l%glycerol) was inoculated. The culture was grown with shaking (300rpm) at 30⁰C until the culture reaches an OD600 nm of 2.0. Cells were harvested and resuspended in BMMY (1 %yeast extract, 2% peptone, 10OmM potassium phosphate, pH 6.0, 1.34% YNB, 4*10^"5 % biotin, 0.5% methanol). For continuous expression, methanol was added every 24 hours to a final concentration of 0.05%. After 3 days, the cells were harvested, and the supernatant was tested for recombinant protein using standard 15% SDS-PAGE.

Large scale expression and His-tag affinity isolation of recombinant Asp33-anginex

Clones that secreted the highest amount of recombinant protein were selected and used to inoculate 50 ml BMGY at 30^°C and shaking (300 rpm) for 24 hours to create biomass. This culture was added to 1 L BMGY and cultured for another 24 hours. Cells were harvested and resuspended in 2 L BMMY in order to induce expression. After 24 hours, the supernatant was collected and concentrated using Centricon-plus 80 biomax 5 concentrators (Millipore

Amsterdam, the Netherlands) to approximately 50 ml. Recombinant Asp33-anginex/his-tag- related fusion proteins were isolated using 1 ml His-select beads (Sigma; Zwijndrecht, the Netherlands) according to the native batch purification method described by the manufacturer. Eluted recombinant proteins were dialysed three times against 5 L water for at least 3 hours at 4⁰C. The dialysates were concentrated using a centricon YM-3 (Millipore) ultrafiltration device. Concentration of recombinant proteins was measured using the micro BCA protein assay reagent kit (Pierce; Etten-Leur, the Netherlands) according to the instruction manual.

Mass spectrometry and amino acid analysis of recombinant Asp33-anginex

A MALDI-TOF Voyager DE-PRO mass spectrometer (Applied Biosystems) was used to analyze the mass of recombinant anginex. In this MALDI technique, recombinant anginex was mixed with a matrix (alpha cyano-4-hydroxycinnamic acid). The crystallized sample was irradiated by a laser beam for desorption and ionization of the peptide. Automated N-terminal Edman degradation consisted of repetitive cycles of Edman chemistry, followed by PTH analysis on a HPLC column according to standard procedures. The first 11 N-terminal amino acids were determined.

Biacore analysis

Real time monitoring of protein interactions was performed at 25 °C using the BIAcore 1000 biosensor according to the manufacturers instructions. Synthetic anginex was mobilized on a CM5 sensor chip using the Amine Coupling Kit with a target resonance level of 4000 RU. For interaction analysis, proteins diluted in HBS-EP (0.01 M HEPES ρH7.4, 0.15M NaCl, 3mM

EDTA, 0.005% surfactant p20) were injected at a flow rate of 10 pl/minute after which the flow cells were regenerated by injection of regeneration buffer (10 mM glycine-HCI pH 2.0) at a flow of 10 pl/minute. Data were analyzed using the BIAevaluation software (version 3.0).

Circular Dichroism (CD)

For CD measurements, freeze-dried synthetic or recombinant Asp33 -anginex was dissolved in 1OmM potassium phosphate buffer, pH 5.2, at a concentration of 0.1 mM. CD spectra were recorded on a Jasco J-710 spectropolarimeter (Jasko, Easton MD) from 190 to 250 nm using a 0.1 mm path- length thermally jacketed quartz cuvette maintained at room temperature. Acquisition was performed using a 0.1 nm step resolution, 100 nm/min scan speed, and a 1.0 πm bandwidth. The response time was 2 s, and the sensitivity was 100 mdeg. Reported spectra are averages of six scans.

Cell proliferation Human umbilical vein ECs (HUVECs) were harvested from normal human umbilical cords and cultured in fibronectin-coated flasks in HUVEC culture medium(RPM11640 with 20% (v/v) human serum, 2mM glutamine, 100 U/ml penicillin and O.lmg/ml streptomycin. Cells were cultured at 37⁰C and 5% CO ₂. For the proliferation assay, HUVECs were seeded at 5000 cells/well in fibronectin-coated flat-bottomed 96-well tissue culture plates and grown for 3 days in culture medium supplemented with 1 ng/ml bFGF, with or without inhibitors. On the third day, 0.3 pCi/well ³H-thymidine was added and incorporation was allowed to occur for 6 hours. After harvesting the cells, thymidine incorporation was quantified by liquid scintillation counting.

Migration assay

HUVEC cultures were grown to confluency in gelatine-coated 24-well tissue culture plates. A cross-shape wound was made by scratching the monolayer with a plastic tip. Wounded monolayers were washed with PBS and incubated with fresh culture medium supplemented with 10-ng/ml bFGF, with or without inhibitors. The wound width was measured microscopically at 4 different places at 0, 2, 4, 6 and 8 hours after wounding the culture.

Chorioallantoic membrane (CAM) assay

Fertilized Lohman-selected white leghorn eggs were incubated for three days at 37°C and 55% relative humidity and rotated once every hour. On day 3, a rectangular window (1 x 2 cm) was made in the egg-shell, and covered with tape to prevent dehydration. The window allowed undisturbed observation of the developing vasculature of the CAM. On day 7, a silicon ring (10 mm diameter) was placed on the CAM to allow local drug administration within the ring. Compounds were dissolved in sterile saline (0.9%NaCl), and applied daily in aliquots of 65 pi from day 10 to day 13. On day 14, CAMs were photographed. Photographs were scanned, and stereological principles were applied as follows. Five concentric rings were projected on the image, and the number of intersections of rings and blood vessels was determined and used as a measure of vessel density.

Statistical analysis Proliferation and migration data are given as mean values + SEM. The Mann- Whitney U test was used to analyze differences between treatment and control groups. For the analysis of vessel density obtained by CAM-assay, the Mann- Whitney U test was used to determine the statistical significance of observed differences. AU values are two-sided, and P values <0.05 were considered statistically significant. Statistical computations were performed in SPSS 10.0.5.

Galectin-1

Galectin-1 Cell Cultures

Primary cultures of human umbilical vein cells were obtained normal human umbilical cords by perfusion with 0.125% trypsin/EDTA. Harvested were either used immediately or cultured in 0.2% gelatin (Merck) coated tissue culture flasks (Costar) in RPMI- 1640 (ϋivitrogen) supplemented with 20% human serum, 1% glutamine (Invitrogen) 50 U/ml penicillin (ICN biomedicals), and 50 ng/ml streptomycin (Serva). COS-I cells subcultured 1 :4 twice a week in RPMI- 1640 supplemented with 10% fetal bovine serum, 1% glutamin. All cultures were kept at and 5% CO₂.

Yeast two-hybrid screening

Yeast two-hybrid screening was performed using the MATCHMAKER GAL4 Two- Hybrid System 3 (Clontech) according to the manufacturers instructions. In short, the artificial anginex gene (1) was PCR amplified and cloned into bait vector pGBKT7 in frame with the GAL4 DNA binding domain (pBD-Ax). The construct was tested for absence of transcriptional activation and toxicity. Subsequently, yeast AH 109 cells were co-transformed with pBD-Ax, Smαl-rinearized prey vector (pGADT7), and a cDNA library which was generated from activated HUVEC mRNA. Following growth on media plates selective for reporter gene activation, prey plasmids from positive yeast colonies were isolated using CHROMA SPIN-1000 columns (Clontech), shuttled into E. CoIi, and sequenced using an automatic DNA-sequencer (AbiPrism377, Applied Biosystems). Confirmation of interaction was performed by targeted transformation of the specific constructs using the small-scale yeast transformation protocol as described in the yeast protocol handbook (Clontech).

Crosslinking with disuccinimidyl suberate

For crosslinking experiments, proteins were mixed in a total volume of 20ul and incubated on ice for 1 hour. Subsequently, 1 ul 50 mM DSS in DMSO or 1 ul DMSO was added and incubated for 30 minutes at room temperature. The reaction was stopped by addition of 1 ul IM Tris, pH 7.5 and incubation at room temperature for 15 minutes.

Surface PIasmon Resonance

Real-time monitoring of molecular interactions was performed at 25° using the BIAcore 1000 biosensor system (BiaCore, Uppsala, Sweden) according to the manufacturer's instructions. In short, anginex, galectin-1, and galectin-1 beta were immobilized to a CM5 sensor chip (BiaCore) via primary amine groups using the Amine Coupling Kit (BiaCore) with a target resonance level of 4000 Ru. For interaction analysis, 20 ul sample, diluted to various concentrations sample, diluted to various concentrations in HBS-EP (0.01 M HEPES pH 7.4, 0.15 M NaCI, 3mM EDTA, 0.005% Surfactant P20), was injected at a flow rate of 10 ul/minute after which the flow cells were regenerated by injection of 20 ul regeneration buffer (10 mM glycine-HCI, pH 2.0) Association-rate (k_a) and dissociation-rate (k_a) constants were determined as global fitting parameters for a 1:1 binding model and obtained by analysis of sensograms using the Biaevaluation software, version 3.0. The equilibrium dissociation constant K_D was defined as k_a/k_a.

NMR

For NMR measurements, 5 mg of recombinant human galectin-1 (2) was dissolved in 600 μl of 1OmM potassium phosphate buffer made with 95%/5% H2O/D2O at pH 5.2. Freeze-dried anginex was dissolved in 10 μ\ of the same buffer and added to the galectin sample at the molar ratio of 1 :2 (anginex: galectin). 2D-homonuclear TOCSY spectra with WATERGATE for water suppression, were acquired on a Varian UNITY Plus-600 NMR spectrometer at 3O⁰C. 2048 complex data points along t2 and 256 increments along tl dimensions over a spectral width of 9000 Hz, were collected. A mixing time of 50 ms was used. Data were processed using a Gaussian window function and the program NMRPipe (4).

FACS analysis FACS analysis of gal- 1 protein expression was performed on ethanol fixed HUVEC.

Cells were washed in 0.1% BSA/0.01% sodium azide/PBS, incubated on ice with polyclonal rabbit anti-galectin antibody, and washed with PBS. Next, the cells were incubated with FITC- labeled polyclonal goat anti-rabbit Ig antibody (Dako) and washed with PBS. Five thousand events were acquired for each sample on a FACSCalibur flow cytometer (Beckton Dickinson). All experiments were performed in triplicate.

MTT assay

The colorimetric MTT assay was used to measure cell growth in vitro. Cells were seeded at a density of 5000 cells/well in 96-well plates and cultured under conditions as described above. Following treatment, the culture medium was replaced with 0.1 ml MTT solution (0.5 mg/ml RPMI-1640) and incubated for 2 hours at 37⁰C. At the end of the incubation, the MTT solution was replaced with acidic (0.1N HCl) isopropanol, and absorbance was determined at 570 run. All experiments were performed in triplicate.

Migration and proliferation assay

Migration and proliferation assays were performed according to the procedures as described in Brandwijk, et. al, Cloning an artificial gene encoding angiostatic anginex: From designed peptide to functional recombinant protein (2005) Biochem Biophys Res Commun 333, 1261-1268. Within each proliferation experiment, treatments were done in triplicate and all proliferation and migration experiments were performed at least three times.

Chorioallantoic membrane (CAM) assay.

CAM assay was performed as described previously, hi brief, on day 3, a window was made in the shell of fertilized Lohman-selected White Leghorn eggs. On day 7, a silicon right (10 mm diameter) was placed on the CAM to allow local drag administration with the ring. From day 10 to day 13, drags were applied daily in aliquots of 65 ul. On day 14, CAMS were photographed, and five concentric rings were projected on the image to determine the number of intersections of rings and blood vessels as a measure of vessel density.

Real-time PCR

Total RNA isolation, subsequent cDNA synthesis, and real-time PCR were performed according to the procedures as described in Thijssen, et. al., Angiogenesis gene expression profiling in xenograft models to study cellular interactions, Exp Cell Res (2004) 299, 286-93, with primers targeted against human gal-1 (Forward: TGC AAC AGC AAGGACGGC (SEQ ID NO: 12; Reverse: CACCTCTGCAACACTTCCA (SEQ ID NO: 13)). Primers were purchased from Eurogentec and experiments were performed in triplicate.

Immunohistochemistry Immunohistochemical staining of anginex uptake was performed on FfUVEC cytospins.

Cells were acetone fixed and air dried. Following incubation in 1% paraformaldehyde cells were incubated in fetal calf serum after which mouse 2D10 monoclonal anti-anginex antibody was applied in 0.05% Triton X100/PBS. Following incubation with Texas Red labeled goat-anti- mouse Ig antibody, the cells were washed with PBS and mounted in Immumount (Shandon Inc.) supplemented with 1 μg/ml 4',6-diamidino-2-phenylindole (DAPI; Molecular Probes). In the negative control, incubation with the first antibody was omitted.

Doublestaining for Ki67 and CD31/34 on paraffin-embedded tissue sections was performed as previously described (41). Tissues from normal colon, colon carcinoma, and Ewing sarcoma were obtained from the stocks of the Department of Pathology, University Hospital Maastricht. For gal-1 staining, paraffin-embedded tissue sections were dewaxed and endogenous peroxidase activity was blocked with 0.3% H₂O₂ in methanol. Next, the slides were microwave pretreated in citric acid. After blocking with 1% BS A/PBS primary antibody was applied in 0.5%BS A/PBS. Next, biotin-labeled secondary antibody was applied and staining was performed with the StreptABComplex/HRP kit (Dako) according the suppliers protocol. The tissue sections were counterstained with haematoxilin (Merck), dehydrated and mounted in Entellan (Merck). The same protocol was used for EC staining with the EC specific antibody 9Fl (42). Staining for CD45+ and CD8+ cells was performed on frozen tissue sections which were fixed in acetone and air dried. Endogenous peroxidase activity was blocked with 0.3% hydrogen peroxidase/PBS and aspecific binding was blocked with 20% FCS/0.1% Tween20/PBS. Next, the primary antibody (MP33 rat anti-mouse CD45 or 53.6.27 rat anti-mouse CD8) was applied, followed by incubation with biotin labeled secondary antibody. Staining was visualized using the Vectastain ABC kit (Vector Laboratories) and subsequently, sections were counterstained with haematoxylin, dehydrated, and mounted with Entellan. Within each section, the number of positive cells was scored at 4 different locations in a blinded fashion by two different observers. Fluorescent staining of CD31 in murine tumors and subsequent scoring of vessel characteristics was performed as described before (6).

Cloning of human and zebrafish galectins

Full length human galectin-1 and N-terniinal deletions in pGADT7 were obtained from yeast-two-hybrid screening. C-terminal deletion constructs were PCR amplified from full length human galectin-1 in pGADT7 using the following primers: galectin-1 forward: AAACATATGATGGCTTGTGGTCTGGTCC (SEQ ID NO: 14); galectin-1 ΔC8 reverse: AAATCTAGATCAGAAGTCACCGTCAGCTGC (SEQ ID NO: 15); galectin-1 ΔC26 reverse: AAATCTAGATCAGAACTTGAATTCGTATCCATC (SEQ ID NO: 16); galectin-1 ΔC48 reverse: AAATCTAGATCACTCTGCAACACTTCCAGGC ((SEQ ID NO: 17).

TC180062 containing protogalectin DrGaI-I L2, and TC180062 containing protogalectin DrGaI-I L3, were obtained from the TIGR zebrafish databank. Full length galectins as well as N-terminal deletion constructs were cloned into Pcr2.1 (Invitogen) according to the suppliers protocol following PCR amplification using the following primers: drgall L2 forward: AAACATATGATGGCCGGTGTGCTTATA (SEQ ID NO: 18); drgal-1 L2Δ30 forward: AAACATATGGCTATTAACATTGGTCACAGC (SEQ ID NO: 19); drgal-1 L2 reverse: AAATCTAGATTATTTAATTTCAACCCCTTG ((SEQ ID NO:

20); drgal-1 L3 forward: AAACATATGATGGTGTTCACCATAAAGGA (SEQ ID NO: 21); drgal-1 L3Δ30 forward: AAACATATGATCAACATCGGCCACGAC ((SEQ ID NO: 22); drgal-1 L3 reverse: AAATCTAGATTATTTGGCTTTAACGCTG (SEQ ID NO: 23). Subsequently, all PCR products were directionally cloned into pGADT7 using the appropriate restriction enzymes (NEB), according to standard procedures. All clones were checked by sequence analysis.

Zebrafish experiments For in vivo experiments, the previously described Tgφiliegfpf¹ zebrafish was used (17).

Knock-down of Lgalsl-L2 and -L3 expression was achieved by injection of specific morpholino- modified antisense oligonucleotides (MOs; Genetools) into 1-cell stage embryos (43). The following MOs were used: Lgalsl-L2 ATG-MO, 5¹-GTATAAGCACACCGGCCATTTTGAC-3¹ (SEQ ID NO:24); Lgalsl-LS ATG-MO, S'-AAGATCCCAGGCTAAGGACGTCATT-S' (SEQ ID NO:25); Lgalsl L2 splice-MO, 5'-TTGTAATATACTCACGGCCATTTTG-S' (SEQ ID

NO:26); Lgalsl L3 splice-MO, 5'-ATGTCTGTACTCACGCATCACAGCC-S' (SEQ ID NO:27). Before 24 hours post-fertilization (hpf), l-Phenyl-2-thiourea (PTU, 0.002%) was added to prevent pigment development. For imaging, dechorionated embryos were anesthetized with 0.003% tricaine methanesulfonate and mounted in 2% low melting agarose. Confocal scanning microscopy was performed using a Leica TCS NT.

For whole mount blood staining, dechorionated and PTU treated embryos were incubated in 40% EtOH, 0.01M NaAc ρH5.2, 2.0% H₂O₂, in the presence of 0.8 mg/ml o-dianisidine. Following rehydration in a graded series of EtOH/PBST the embryos were stored in 50% glycerol at 4°C. Whole mount in situ hybridization on zebrafish embryos was carried out as previously described (44). For VE-cadherin riboprobe synthesis we used the previously published plasmid (45). For Lgalsl-L2 antisense probe synthesis RZPD clone MAGp998D0710947Q3 (in pSPORTl) was linearized with BamΗI and transcribed with T7 RNA polymerase. Zebrafish Lgalsl-L3 was cloned from RZPD clone IMAGρ998J1712051Q3 into pBluescript KS giving rise to lgall-L3/ρBs. For lgall-L3 antisense probe synthesis, plasmid lgall~L3/pBs was linearized with Acc65I and transcribed with T7 RNA polymerase. For sectioning, the embryos were embedded in Technovit 8100 (Heraeus Kulzer, Wehrheim Germany). Seven μM thick sections were cut and counterstained with, neutral red dye.

Whole mount blood staining Dechorionated and PTU-treated embryos were incubated in 40% EtOH, 0.01M NaAc pH5.2, 0.7% H202, in the presence of 0.6 mg/ml o-dianisidine for at least 2 hrs at room temperature. Following rehydration in a graded series of EtOH/PBST each for 5 minutes at room temperature, the embryos were stored in glycerol at 4⁰C.

Mouse Tumor model

A total of 14 adult 129P3/J gal-1^"7" mutant mice (19) and 17 matched 129P3/J gal-l^+/+ (wild type) mice were used in this study. On day 1, animals were injected s.c. with 3x10 syngeneic F9 teratocarcinoma cells. On day 7, anginex treatment (10 mg/kg/day) was started in 7 wild type and 9 mutant mice by daily i.p. injections. Tumor volume and mouse weight were measured daily throughout the experiment. Animals were given water and standard chow ad libitum, and they were kept on a 12-hour light/dark cycle. All animal experiments were approved by the local ethical review committee.

Knockdown of galectin-1 expression in vitro Knockdown of gal-1 expression in vitro was obtained using a gal-1 specific antisense oligodeoxynucleotide (hgall ODN: GTCACCGTCAGCTGCCATGT (SEQ ID NO:28)). As control, a random nonspecific antisense oligodeoxynucleotide (control ODN: TCCCTAGTGACTCTTCCC ((SEQ ID NO:29)) was used. ODNs were renewed every other day.

The disclosures of publications within this application are hereby incorporated by reference in their entireties to more fully describe the state of the art to which this invention pertains.

The foregoing is illustrative of particular embodiments and features of the present invention. In view of the teaching presented herein, one of skill in the art could readily prepare and select other materials for use in controlling angiogenesis and disease conditions. The foregoing drawings, disclosure, examples and discussion are not limiting upon the present invention but are illustrative of the principles thereof. It is the following claims, including all equivalents, which define the scope of the invention.

Claims

CLAIMSWhat is claimed is:

1. A method for producing recombinant Asp33-anginex polypeptide, the method comprising the steps of: (a) constructing an artificial gene that encodes biologically exogenous anginex polypeptide;

(b) introducing into a host cell an expression vector capable of directing the expression of a cloned gene;

(c) cloning the artificial gene; and (d) recombinantly producing the anginex protein in the host cell.

2. The method of claim 1, further comprising the step of isolating the anginex polypeptide from the expression vector.

3. The method of claim 1, wherein the host cell is yeast.

4. The method of claim 2, wherein the host cell is Pichia pastoris.

5. A method of inhibiting endothelial cell proliferation and migration which comprises administering an effective amount of the polypeptide of claim 1 or a pharmaceutical composition thereof.

6. A method of inhibiting angiogenesis which comprises administering an effective amount of the polypeptide of claim 1 or a pharmaceutical composition thereof.

7. An isolated recombinant polypeptide cloned from a gene encoding the polypeptide anginex.

8. A recombinant polypeptide having anti-angiogenesis and anti-tumor activity.

9. The recombinant polypeptide of claim 8, wherein the recombinant polypeptide is Asp33- anginex.

10. A gene construct coding for the polypeptide anginex.

11. The gene construct of claim 10, wherein the polypeptide anginex is a recombinant protein.

12. The gene construct of claim 11, wherein the recombinant protein is produced in host cell Pichia pastoris.

13. The gene construct of claim 11, wherein the recombinant protein is an inhibitor of angiogenesis.

14. The gene construct of claim 11, wherein the recombinant protein inhibits endothelial cell growth and migration.

15. The gene construct of claim 10, wherein the construct is an artificial gene.

16. The gene construct of claim 15, wherein the artificial gene is a marker for identification of an anginex receptor.

17. A method of identifying a receptor of the polypeptide anginex, the method comprising the steps of:

(a) preparing an artificial gene that encodes recombinant anginex;

(b) cloning the recombinant anginex in fusion with a galectin-4 DNA binding domain; (c) performing yeast two-hybrid analysis;

(d) expressing a fusion construct; and

(e) screening the fusion construct against cDNA libraries of activated endothelial cells.

18. The method of claim 17, wherein the step expressing the fusion construct is performed using bait vector pGBKT7 frame with the Gal-4 DNA.

19. The method of claim 17, wherein the step of expressing the fusion construct is confirmed by reverse transcriptase-PCR.

20. An isolated Galectin-1 polypeptide expressed in endothelial cells and upregulated in angiogenically active tissues.

21. The polypeptide of claim 20, wherein galectin-1 interacts with a second polypeptide to enhance endothelial cell activation and inhibit angiogenesis.

22. The polypeptide of claim 20, wherein the second polypeptide is an anginex polypeptide.

23. A method for mediating the activity of the anginex polypeptide, the method comprising contacting a cell sample expressing the anginex protein with a galectin-1 polypeptide that binds to said anginex polypeptide in an amount sufficient to mediate the activity of the anginex polypeptide in the cell sample.

24. A method of increasing the angiostatic activity of an anginex polypeptide, the method comprising the step of causing an interaction between the anginex and polypeptide galectin-1 polypeptide.

25. The method of claim 24, wherein the interaction step comprises the step of covalently crosslinking the anginex polypeptide with the galectin-1 polypeptide.

26. The method of claim 24, wherein the crosslinking step is performed using the crosslinking agent disuccinimidyl suberate.

27. A protein fusion construct useful in targeting activated endothelial cells, comprising the polypeptide galectin-1 bound to an anginex polypeptide.

28. A method for inhibiting endothelial cell proliferation in a cell culture, the method comprising contacting cells with an effective amount of a composition comprising: a polypeptide demonstrating endothelial cell proliferation inhibition, said polypeptide consisting of recombinant anginex.

29. A method for promoting inter-cellular adhesion molecule expression in a cell culture, the method comprising contacting cells with an effective amount of a composition comprising a polypeptide promoting inter-cellular adhesion molecule expression, said polypeptide consisting of recombinant Asp33-anginex.

30. A composition comprising N-terminal deletion fragments of galectin-1.

31. The composition of claim 31, wherein the N-terminal deletion fragments of galectin-1 inhibit the binding of the polypeptide anginex and galectin-1 in activated endothelial cells.

32. An isolated deamidated polypeptide comprising SEQ TD NO: 1.

33. The deamidated polypeptide of claim 32, wherein the polypeptide is deamidated at position 33 at the C-terminal of the polypeptide.

34. The deamidated polypeptide of claim 32, wherein the polypeptide includes a carboxylic acid at position 33 of the polypeptide.

35. The deamidated polypeptide of claim 32, further comprising a pharmaceutically acceptable carrier.

36. An isolated polypeptide comprising galectin-1 the polypeptide being a target for diagnosing cancer and tumor angiogenesis.

37. An isolated polypeptide which mediates the angiostatic activity of a polypeptide comprising anginex.

38. The polypeptide of claim 37, wherein the polypeptide is galectin-1.

39. A composition for the regulation of tumor angiogenesis comprising the polypeptide galectin-1.

40. The composition of claim 39, wherein the polypeptide is a target for angiostatic activity.

41. A method for detecting the expression of a polypeptide useful in inhibiting angiogenesis, the method comprising the steps of: (a) contacting activated endothelial cells with a polypeptide comprising galectin-1 ;

(b) determining whether the galectin-1 binds with the polypeptide, whereby the binding of galectin-1 with the polypeptide confirms expression of the polypeptide in the activated endothelial cells.

42. The method of claim 41, wherein the polypeptide which binds with galectin 1 is anginex.

43. The method of claim 41, wherein the binding of the galectin-1 polypeptide with anginex confirms the polypeptide anginex as a receptor of the polypeptide galectin-1.

44. The method of claim 41, wherein the binding of galectin-1 with anginex mediates angiostatic activity of anginex.

45. A method for inhibiting angiogenesis and reducing tumor growth, the method comprising administering an effective amount of a composition comprising:

(a) a polypeptide demonstrating anti-angiogenic activity, the polypeptide consisting of anginex, and (b) a pharmaceutically acceptable carrier.

46. An isolated recombinant polypeptide which binds with the polypeptide galectin-1.

47. The isolated polypeptide of claim 46, wherein the recombinant polypeptide is Asp33- anginex.

48. A method of treating cancer, the method comprising administering to .a patient in need thereof an effective amount of the polypeptide anginex.