WO2006128026A2

WO2006128026A2 - Cellular receptor for varicella-zoster virus, methods of inhibiting spread of varicella-zoster and methods of increasing stability and infectivity of the virus

Info

Publication number: WO2006128026A2
Application number: PCT/US2006/020514
Authority: WO
Inventors: Qingxue Li; Jeffrey Cohen
Original assignee: The United States Of America As Represented By Thesecretary, Dept. Of Health And Human Services National Institutes Of Health
Priority date: 2005-05-26
Filing date: 2006-05-26
Publication date: 2006-11-30
Also published as: WO2006128026A3

Abstract

A method of identifying an anti-Varicella-zoster (VZV) compound is described. Also described is the receptor for glycoprotein E (gE) comprising insulin degrading enzyme (IDE). Also described is a compound that inhibits cell-to-cell spread of VZV and methods of inhibiting the entry of VZV into a cell. Also described are pharmaceutical compositions for reducing or preventing the cell to cell spread of VZV. Also described is a compound and method for increasing the stability of VZV vaccines and a compound and method for increasing the infectivity of VZV.

Description

PATENT COOPERATION TREATY APPLICATION

Cellular Receptor for Varicella-Zoster Virus, Methods of

Inhibiting Spread of Varicella-Zoster and Methods of Increasing

Stability and Infectivity of the Virus

Statement of Related Applications

[0001] This application claims priority to U.S. Provisional Application Serial No. 60/684,526, filed May 26, 2005, the content of which is herein incorporated by reference in its entirety.

Background of the Invention

1. Field of the Invention

[0002] This invention relates to the identification of a cellular receptor for Varicella-zoster virus, to methods of inhibiting entry of the virus into cells and inhibiting the spread of Varicella-zoster virus and to methods of increasing stability and infectivity of such virus.

2. Description of the Related Art

[0003] Varicella-zoster virus (VZV) is the etiologic agent of varicella (chickenpox) and zoster (shingles). VZV is a member of the α-herpesvirus family and is closely related to the other two human members of the family, herpes simplex virus (HSV) 1 and 2. Acute infection with VZV is followed by cell-associated viremia and the rash of varicella (Arvin, 2001 ). The virus establishes latency in the nervous system and can reactivate to cause zoster. While varicella is likely transmitted by cell-free airborne virions, in cell culture VZV is highly cell-associated, and the virus is propagated by cell-to-cell spread with no infectious virus present in the medium.

[0004] The mechanism of VZV entry into target cells and spread from cell-to-cell is not well understood. Previous studies showed that VZV, like other members of the herpesvirus family, engages cell surface heparan sulfate for initial attachment (Zhu et al., 1995). Mannose 6-phosphate (Man 6-P) inhibits infection with cell-free VZV, which implicates the cation-independent mannose 6-phosphate receptor (MPRci) in facilitating entry of cell-free virus by interacting with viral glycoproteins that contain phosphorylated N-linked complex oligosaccharides (Gabel et al., 1989; Zhu et al., 1995). Chen et al. used stable cell lines deficient in MPRci to show that the protein is required for infection by cell-free VZV (Chen et al., 2004). However, soluble MPRci did not bind to viral glycoproteins in ligand blotting assays (Zhu et al., 1995). Cell lines deficient in MPRci are not impaired for infection by cell-associated virus; thus, MPRci is not a cellular receptor for cell-to-cell spread of the virus, the major means of transmission of VZV in cell culture and in the body.

[0005] Studies of HSV-1 and HSV-2 have identified viral and/or cellular proteins required for entry and cell-to-cell spread. Herpesvirus entry mediator A, nectin-1 and nectin-2, and 3-O-sulfated heparan sulfate have each been established as HSV receptors for entry of cell-free virus (Cocchi et al., 1998; Geraghty et al., 1998; Montgomery et al., 1996; Shukla et al., 1999). HSV glycoprotein D (gD) has been identified as the viral ligand for each of these receptors. HSV gE/gl, though not essential for entry and replication, sorts nascent virions to cell junctions and is required for efficient cell-to-cell spread of HSV (Collins and Johnson, 2003; Dingwell and Johnson, 1998; Polcicova et al., 2005). Although a cellular receptor for gE/gl has been postulated, it has not yet been identified.

[0006] VZV encodes at least 7 glycoproteins, gB, gC, gE, gH, gl, gK, gl_, all of which have well conserved homologs in HSV (Cohen and Straus, 2001 ). In contrast to HSV, VZV does not have a homolog for gD. While HSV gD is one of five glycoproteins in the unique short region of its genome, the corresponding portion of VZV encodes only two VZV glycoproteins, gE and its chaperon gl. Since HSV gD is the receptor binding protein for HSV, and VZV gl is not required for infection by VZV (Cohen and Nguyen, 1997), VZV gE might be important for binding to a cellular receptor. HSV gE, and HSV gD alone, do not mediate membrane fusion. The minimum requirement for HSV fusion to cells is the co-expression of four glycoproteins (gD, gB, gH and gl_) and a cell surface entry receptor specific for gD (Browne et al., 2001 ; Pertel et al., 2001 ). Syncytia formation in VZV, a hallmark of cell-to-cell spread, is due to fusion of cell membranes mediated by gH and gl_, or gB and gE (Cole and Grose, 2003). While expression of gH or gB alone induce a modest amount of fusion; expression of gE alone is not sufficient for fusion, unless it is co-expressed with gB (Maresova et al., 2001). Attempts to generate a VZV gE deletion mutant were unsuccessful (Mo et al., 2002), and a gE minus virus could only be constructed using cells expressing gE (Cohen et al, unpublished data). Taken together, these findings indicate that VZV gE is an essential glycoprotein for VZV. Antibodies to gE neutralize virus in vitro and immunization with a vector expressing gE protects animals from challenge with virus (Lowry et al., 1992; Wu and Forghani, 1997). Therefore VZV gE may be involved in viral entry and cell-to-cell spread, and is a likely candidate for binding to a cellular receptor. Thus, a need exists to identify the receptor for gE, thereby permitting the identification of compounds that inhibit the binding of gE to such receptor. The identification of such inhibitors would lead to methods of inhibiting infection and reducing cell-to-cell spread of VZV infections.

Brief Description of the Drawings

[0007] Figure 1 shows that insulin degrading enzyme (IDE) interacts with the extracellular domain of VZV gE, but not gB or gH.

(A) The extracellular domain of gE fused to the Fc portion of human IgG (gE-Fc) bound to Protein-ASepharose was incubated with a cell lysate from melanoma cells, and proteins that bound to gE-Fc were resolved on SDS-PAGE and stained with Coomassie Blue. A 120 kD cellular protein is present in the cell lysate that interacts with gE-Fc.

(B) gE protein from VZV ROka-infected cells (lane 1 ) or VZV Molly, a low passage clinical isolate (lane 2) was immunoprecipitated with monoclonal anti-gE antibody and IDE was detected in immune complexes. Purified extracellular domain of gE (gEt) immobilized onto protein A Sepharose beads with anti-gE antibody (lane 5 and 6) pulls down IDE from cell lysates.

(C) Plasmids encoding the extracellular domain of VZV gE (lane 1 ), gl (lane 2), full length HSV gE (lane 4) or control vectors (lane 3 and 5) were transfected into CV-1 cells, and immunoprecipitation with the respective antibodies pull down IDE with VZV gE and, to a lesser extent, gl. Lysates from VZV-infected cells immunoprecipitated with anti-gE, but not anti-gB or anti-gH, antibody pull down IDE (lanes 7-9).

(D) ELISA plates were coated with HA-IDE and incubated with equal amounts of His-tagged gEt, gBt, or git and binding was assayed using anti-His antibody. HA-IDE binds to gEt significantly greater than to git or gBt. Error bars show standard deviations and t test was used to determine p values.

[0008] Figure 2 shows that the extracellular domain of gE interacts with IDE on the surface of cells.

(A) Biotinylated cell surface proteins that were precipitated with streptavidin-coated agarose beads pull down IDE from the surface of HeLa (lane 1) or melanoma (lane 2) cells as detected by immunoblotting with antibody to IDE. In the absence of biotinylation, IDE is not detected on the surface of HeLa (lane 3) or melanoma (lane 4) cells.

(B) Monolayers of CV-1/EBNA-1 cells were biotinylated for 30 min at room temperature in PBS to label cell surface proteins. After extensive washing the cells were lysed and incubated with soluble gEt that had been immobilized on beads using anti-gE antibody. After washing, the beads were boiled in SDS protein gel solution and a 120 kDa protein was detected after blotting with Streptavidin-HRP to detect cell-surface IDE, or with anti-IDE to detect total IDE.

[0009] Figure 3 shows blocking IDE with specific antibodies reduces VZV infectivity and cell-to-cell spread.

(A) Monoclonal anti-IDE antibody (50ug/ml) or anti-gH antibody, but not control anti-CD3 antibody, inhibits the number of foci that stain with X-gal in cells infected with ROka-IacZ. The experiments were repeated three times with similar results.

(B) Polyclonal anti-IDE serum reduces the number of VZV-lacZ foci compared with pre-immune serum or buffer controls. The experiments were performed three times with similar results.

(C) Plaque sizes are reduced in cells infected with cell-free VZV-lacZ treated with polyclonal anti-IDE serum (bottom panels) compared with cells treated with pre-immune serum (top panels). Magnification 4OX

[0010] Figure 4 shows Knock-down of expression of IDE blocks VZV infectivity and prevents VZV cell-cell spread.

(A) MRC-5 cells transfected with two independent specific IDE siRNA pools show reduced levels of IDE protein compared with cells transfected with two independent non-specific control siRNA pools.

(B) MRC-5 cells transfected with IDE siRNA and infected with cell-free ROka-lacZ show reduced numbers of foci that stain with X-gal at 4 days post infection, compared with cells transfected with control siRNA.

(C) MRC-5 cells transfected with IDE-specific siRNA and infected with cell-free ROka-lacZ (panels 3,4) show reduced size of infectious foci at 4 days after infection, compared with cells transfected with control siRNA (panels 1 ,2). Magnification 100X.

(D) MRC-5 cells were transfected with siRNAs and after 2.5 days the cells were infected with cell-associated wild-type (low passage, strain Molly) VZV for 1.5 hrs and then washed twice to remove the inoculum. The cells were fixed 24 hrs after infection, stained with mouse anti-gE antibody followed by FITC-conjugated anti-mouse antibody and the number of immunofluorescent foci were counted. The figure represents the results of two independent experiments. Error bars show standard deviations and t test was used to determine p values.

[0011] Figure 5 shows Bacitracin®, an IDE inhibitor, blocks IDE-gE complex formation, inhibits VZV infectivity, and reduces viral cell-cell spread.

(A) Bacitracin reduces binding of soluble gE to IDE in a pull-down assay.

(B) Bacitracin reduces the number of X-gal positive foci in melanoma cells infected with cell-free ROka-lacZ.

(C) Bacitracin inhibits cell-to-cell spread of cell-associated wild-type VZV. Melanoma cells were infected with cell-associated low passage (Molly strain) VZV in the presence or absence of Bacitracin (1.0 mg/ml) for 24 hrs. Cells were fixed and plaques stained with anti-gE antibody. Cell-to-cell spread was determined by measuring plaque size of virus-infected cells (Collins and Johnson 2003). The surface area of photographed plaques in Bacitracin treated (N=35) and untreated (N=51) cells was analyzed by Image J software. P values were calculated using a t test.

(D) Bacitracin reduces the size of plaques for melanoma cells infected with cell-free ROka-lacZ (lower panels, 2 representative fields), compared to cells infected in the absence of the antibiotic (upper panels, 2 fields). Magnification 100X.

(E) Bacitracin reduces the number and size of foci in melanoma cells infected with cell-free ROka-lacZ, but not HSV-1-LacZ.

[0012] Figure 6 shows that expression of exogenous human IDE increases VZV entry and infectivity, and rescues impaired VZV cell-to-cell spread that results from knock-down of IDE.

(A) Transfection of CHO cells with a plasmid encoding HA-tagged human IDE followed by infection with cell-free ROka-GFP increases the number of GFP-positive foci, compared with cells transfected with control plasmid.

(B) Cells stably expressing human IDE show increased GFP by densitometry after transfection with a reporter plasmid that encodes GFP under a T7 promoter and incubation with cell-associated VZV encoding the T7 polymerase (ROka-T7), when compared with a control cell line that does not express human IDE.

(C) Transfection of CHO cells with HA-IDE results in increased binding of [35S]methionine labeled cell-free VZV compared with cells transfected with control plasmid. Counts per minute (CPM) were obtained by subtracting those from lysates of uninfected cells from virus-infected cells. The binding assay was performed in the presence of heparin to eliminate the contribution of attachment through cell surface heparan sulfate. Error bars show standard deviations and t test was used to determine p values.

(D) Cotransfection of MRC-5 cells with control siRNA and plasmid expressing HA-IDE followed by infection with cell-free ROka-IacZ show increased size of infectious foci (panel 2), compared with cells transfected with control siRNA and control plasmid (panel 1). Cells transfected with IDE-specific siRNAand control plasmid and infected with ROka-IacZ show smaller sized infectious foci (panel 3) than cells transfected with control siRNA and control plasmid (panel 1). Cells transfected with IDE-specific siRNA and plasmid that expresses HA-IDE that is resistant to the siRNA, followed by infection with ROka-IacZ, show increased size of infectious foci (panel 4), compared to cells transfected with IDE-specific siRNA and control plasmid (panel 3).

[0013] Figure 7 shows the level of human IDE in cells correlates with infectivity by VZV.

(Top) Transfection of CHO cells with plasmid expressing HA-IDE or human IDE that is resistant to siRNA (HA-IDE 2-2-B) followed by infection with ROka-GFP increases the number of GFP-positive foci in CHO cells.

(Middle) Transfection of CHO cells with plasmids expressing IDE results in increased levels of total (human plus CHO cells) IDE in CHO cells.

(Bottom) Autoradiogram of total IDE levels in transfected cells. Beta-actin, detected with an anti-beta antibody, was used as a loading control (data not shown). Error bars show standard deviations and t test was used to determine p values.

[0014] Figure 8 shows that the interaction of IDE with g E is independent of its enzymatic activity.

(A) Purified IDE protein does not degrade the extracellular domain of gE (lane 2), but does degrade insulin (lane 5).

(B) gE from VZV-infected cells is not affected by addition of an IDE inhibitor (bacitracin) in a pulse-chase experiment with [35S] methionine. Cell lysates were immunoprecipitated with anti-gE antibody and bands were visualized by autoradiography.

[0015] Figure 9 shows that Bacitracin does not inhibit VZV virion maturation and trafficking to cell surface.

[0016] There was no effect on nucleocapsid formation (A) or virus budding to the cell surface (B) in cell treated with Bacitracin, compared with untreated cells. No reduction was seen on the number of cell surface virions (C) in cells treated with bacitracin, compared with untreated cells.

[0017] Figure (10) demonstrates that lysates from VZV-infected melanoma cells at various times after infection immunoprecipitated with anti-IDE antibody pull down VZV gE. [0018] Figure (11) shows increasing amounts of polyclonal antibody to IDE protein reduces VZV infectivity.

[0019] Melanoma cells were pre-incubated with varying amounts of anti-IDE (PRB-282C) for 60 min at 4oC and infected with cell-free VZV-LacZ for 3 days. The cells were fixed, and stained with X-gal. The experiment was carried out in triplicate and repeated three times.

[0020] Figure 12 shows that Bacitracin and Bacitracin fractions A8- 10 block gE/IDE Interaction and inhibits VZV infectivity. (A) Bacitracin was incubated with cell lysates in the presence of gE, complexes precipitated with anti-gE antibody and blot probed with anti-IDE antibody. (B) VZV Infection done in the presence of bacitracin and number of VZV foci expressing gE counted.

[0021] Figure 13 is a diagram of HA epitope tagged human soluble IDE construct in baculovirus.

[0022] Figure 14 shows (A) schematic showing production of HA-IDE in baculovirus.

[0023] (B) Fractions of HA-IDE protein.

[0024] Figure 15 shows recombinant HA-IDE protein in Coomasie stained gel.

[0025] Figure 16 is (A) a schematic showing binding assay used to show HA-IDE binds to gE.

[0026] (B) Graph showing binding capacity of VZV glycoproteins gB, gE, or gl to HA-IDE protein.

[0027] Figure 17 is a chart showing HA-IDE enhances infectivity of VZV expressing lacZ in melanoma cells (permissive for VZV).

[0028] Figure 18 is a chart showing HA-IDE enhances infectivity of Merck VZV vaccine viruses in melanoma cells (permissive for VZV).

[0029] Figure 19 is a chart showing HA-IDE enhances infectivity of VZV expressing lacZ in CHO cells (not permissive for VZV).

[0030] Figure 20 shows that soluble IDE increases VZV infectivity (more plaques) and promotes viral cell- to-cell spread (larger plaques).

[0031] Figure 21 shows that soluble IDE increases VZV infectivity and promotes viral cell to cell spread.

[0032] Figure 22 shows that soluble IDE increases VZV stability during incubation for 22 hours at 4 degrees Centigrade or 25 degrees centigrade and enhances infectivity.

[0033] Figure 23 shows that soluble IDE increases VZV stability after incubation for one hour at 37 degrees centigrade, or 22 hours at 25 degrees centigrade and enhances infectivity.

[0034] Figure 24 shows that sufonylurea compounds, which are IDE inhibitors, block VZV spread.

[0035] Figure 25 is a chart showing that glyburide and Bacitracin inhibit IDE and block VZV infection.

[0036] . Figure 26 is SEQ ID NO:1 , which is the full length amino acid sequence for IDE.

[0037] Figure 27 is SEQ ID NO:2, which is the amino acid sequence for HA-IDE.

[0038] Figure 28 is SEQ ID NO: 3, which is the DNA sequence for HA-IDE.

[0039] Figure 29 is SEQ ID NO:4, which is the amino acid sequence for full length gE.

[0040] Figure 30 is SEQ ID NO:5 which is the extracellular domain of gE to which IDE binds. It is amino acids 1-537 of SEQ ID NO:4. There is a signal sequence at the amino terminus of the protein that is cleaved off before gE is put onto the cell surface for binding to IDE.

Figure 31 shows that soluble IDE extracted from liver inhibits VZV infectivity.

Figure 32 shows that soluble IDE extracted from liver blocks cell-to-cell spread of VZV.

Summary of the Invention

[0041] In one embodiment, the invention relates to a method of identifying an anti-Varicella-zoster (VZV) compound comprising the steps of: contacting insulin degrading enzyme (IDE) or a fragment thereof that interacts with gE glycoprotein or a fragment thereof that interacts with IDE, in the presence of a test compound; and comparing the binding of said IDE or fragment thereof to said gE or fragment thereof in the presence of said test compound with the binding of said IDE or fragment thereof to said gE or fragment thereof in the absence of said test compound; wherein a decrease in said binding in the presence of said test compound indicates that said test compound is an anti-Varicella- zoster compound. Such test compound may be an antibody, including an anti-IDE or anti-gE antibody. Such compound may be an oligonucleotide, an antimicrobic, a polypeptide, a chemical moiety of a molecule or a chemical compound.

[0042] In another embodiment, the invention relates to a compound identified by the above method.

[0043] In another embodiment, the invention relates to a pharmaceutical composition comprising an isolated receptor for Varicella Zoster glycoprotein E(gE) comprising the insulin degrading enzyme (IDE) and a sterile solution such as Phosphate buffered saline orTris buffer (25mM Tris pH8.0 with 15OmM NaCI).

[0044] In another embodiment, the invention relates to an isolated complex comprising IDE and gE. Such complex is useful in screening for compounds that breakup the complex and, therefore, of potential use in inhibiting the spread of VZV.

[0045] In another embodiment, the invention relates to a method of inhibiting the entry of Varicella-zoster virus into a cell comprising contacting a composition comprising the cell with a compound that inhibits the binding of gE to IDE. Such compound may be a sulfonylurea, an antimicrobic or a polypeptide or polypeptide fragment, which binds the insulin degrading enzyme (IDE) or a fragment thereof or which binds gE or a fragment thereof.

[0046] In another embodiment, the invention relates to a method of inhibiting the entry of Varicella-zoster virus into a cell comprising reducing the amount of IDE present in the cell or on the extracellular surface of the membrane of the cell. Such method comprises reducing the cell's expression of IDE and may comprise contacting the intracellular portion of the cell with short interfering RNA (siRNA). In another embodiment, the method comprises contacting the intracellular portion of the cell with antisense sequences.

[0047] In another embodiment, the invention relates to a pharmaceutical composition for inhibiting or preventing the cell-to-cell spread of Varicella-zoster virus comprising an effective amount of a compound that inhibits or prevents Varicella-zoster glycoprotein E (gE) from binding to insulin degrading enzyme (IDE) and a pharmaceutically acceptable carrier. In one embodiment, such compound may comprise SEQ ID NO:1. In another embodiment, such compound may be an antibody.

[0048] In another embodiment, the invention relates to a method of increasing the stability of a Varicella-zoster vaccine comprising contacting said vaccine with soluble IDE or a functional derivative of IDE. Soluble IDE may be HA-IDE. In another embodiment, the invention relates to a composition for increasing the stability of a Varicella-zoster vaccine comprising a soluble IDE molecule or a functional derivative thereof.

[0049] In another embodiment, the invention relates to a composition for increasing the infectivity of a Varicella-zoster virus comprising a soluble IDE molecule. In another embodiment, the invention relates to a method of increasing the infectivity of a Varicella-zoster virus comprising contacting said virus with a soluble IDE molecule.

[0050] In yet another embodiment, the invention relates to a method of treating a Varicella-zoster infection comprising administering to a subject in need thereof an effective amount of a composition that inhibits or prevents gE from binding to IDE. Detailed Description of the Preferred Embodiments

[0051] The present invention relates to the identification of insulin degrading enzyme (IDE) as the cellular receptor for the VZV glycoprotein gE. IDE forms a complex with both the purified extracellular domain and the native form of gE in VZV-infected cells. See Figure 1.

[0052] IDE is a member of the zinc metalloproteinase family that was initially implicated in insulin degradation (Duckworth, 1988; Perlman and Rosner, 1994). It is highly conserved among different species, and has the ability to interact with a variety of functionally unrelated ligands that share little homology in their primary amino acid sequences. In addition to insulin, glucagon, insulin-like growth factor Il (IGF-II), atrial natriuretic peptide, transforming growth factor-α, and β-amyloid protein are substrates for IDE (Duckworth and Kitabchi, 1974; Farris et al., 2003; Hamel et al., 1997; Misbin and Almira, 1989; Muller et al., 1991). Several other proteins including epidermal growth factor and IGF-I bind to IDE but are not hydrolyzed by the enzyme (Duckworth et al., 1998). It has been hypothesized that these IDE ligands possess common conformational motifs for binding to IDE (Kurochkin, 1998).

[0053] Several other human viruses also use enzymes as receptors, notably human coronavirus 229E which uses aminopeptidase N (CD13) and human SARS-associated coronavirus which uses angiotensin-converting enzyme 2. Aminopeptidase N and angiotensin-converting enzyme 2 are, like IDE, members of the zinc metalloprotease family (Delmas et al., 1992; Li et al., 2003). Interestingly, VZV as well as the two coronaviruses use enzymes as receptors, independent of the activity of the enzyme. Although IDE is predominately a cytosolic protein, it is also present on the plasma membrane (Goldfine et al., 1984; Kuo et al., 1993; Yaso et al., 1987). It localizes to apical or basolateral regions in different tissues (Kuo et al., 1993). A novel isoform of IDE is associated with the surface of differentiated, but not undifferentiated, neurons (Vekrellis et al., 2000). This suggests that IDE may have a role in VZV infection of neurons. IDE is also found in endosomes (Duckworth et al., 1998; Hamel et al., 1991). HSV has recently been shown to enter certain cells by endocytosis in a pH-dependent pathway (Nicola et al., 2003). IfVZV is endocytosed in certain cells like HSV, then IDE might allow VZV in endosomes to penetrate into the cytosol. The tissue distribution of IDE is ubiquitous (Kuo et al., 1993), which correlates well with the broad tissue tropism of VZV, especially in vivo.

[0054] The amino acid sequence for human IDE (SEQ ID NO: 1) and DNA sequence for IDE is disclosed in Affholer, J.A, et a/.,"lnsulin-degrading enzyme: stable expression of the human complementary DNA, characterization of its protein product, and chromosomal mapping of the human and mouse genes". MoI. Endocrinol. 4(8): 1125-1135 (1990), which is herein incorporated by reference. IDE can be purified from its natural source, it can be prepared recombinantly or synthesized by standard protein synthesis techniques, according to methods well known in the art. "IDE" also includes "functional derivatives" of IDE. "Functional derivatives" include "fragments," "variants," "analogues," or "chemical derivatives" of a molecule. A "fragment" of a molecule, such as any of the amino acid or DNA molecules of the present invention, is meant to refer to any contiguous amino acid or nucleotide sequence subset of the molecule. A "variant" of such molecule is meant to refer to a naturally occurring molecule substantially similar to either the entire molecule, or a fragment thereof. An "analog" of a molecule is meant to refer to a non-natural molecule substantially similar to either the entire molecule or a fragment thereof. Methods for making mutations in nucleotide sequences are well known in the art. A protein molecule is said to be "substantially similar" to another protein molecule if the sequence of amino acids in both molecules is substantially the same. Substantially similar amino acid molecules will possess a similar biological activity. Thus, provided that two molecules possess a similar activity, they are considered variants as that term is used herein even if one of the molecules contains additional or fewer amino acid residues not found in the other, or if the sequence of amino acid residues is not identical. As used herein, a molecule is said to be a "chemical derivative" of another molecule when it contains additional chemical moieties not normally a part of the molecule. Such moieties may improve the molecule's solubility, absorption, biological half life, etc. The moieties may alternatively decrease the toxicity of the molecule, eliminate or attenuate any undesirable side effect of the molecule, etc. Moieties capable of mediating such effects are disclosed, for example, in Remington's Pharmaceutical Sciences, 16th et., Mack Publishing Co., Easton, Pa. (1980). Similarly, a "functional derivative" of a the IDE gene of the present invention is meant to include "fragments," "variants," or "analogues" of the gene, which may be "substantially similar" in nucleotide sequence, and which encode a molecule possessing similar activity to, for example, binding gE.

[0055] The IDE or a functional derivative thereof of the present invention may be prepared by any of the known techniques, such as the following. They may be prepared using the solid-phase synthetic technique initially described by Merrifield in J. Am. Chem. Soc. 15:2149-2154 (1963), which is incorporated herein by reference. Other peptide synthesis techniques may be found, for example, in M. Bodanszky et al., (1976) Peptide Synthesis, John Wiley & Sons, 2d Ed., which is incorporated herein by reference; Kent and Clark-Lewis in Synthetic Peptides in Biology and Medicine, p. 295-358, eds. Alitalo, K., et al. Science Publishers, (Amsterdam, 1985) which is incorporated herein by reference; as well as other reference works known to those skilled in the art. A summary of peptide synthesis techniques may be found in J. Stuart and J. D. Young, Solid Phase Peptide Synthelia, Pierce Chemical Company, Rockford, III. (1984), which is incorporated herein by reference. The synthesis of peptides by solution methods may also be used, as described in The Proteins, Vol. II, 3d Ed., p. 105-237, Neurath, H. et ai, Eds., Academic Press, New York, N.Y. (1976), which is incorporated herein by reference. Appropriate protective groups for use in such syntheses will be found in the above texts, as well as in J. F. W. McOmie, Protective Groups in Organic Chemistry, Plenum Press, New York, N.Y. (1973), which is incorporated herein by reference.

[0056] In general, these synthetic methods involve the sequential addition of one or more amino acid residues or suitable protected amino acid residues to a growing peptide chain. Normally, either the amino or carboxyl group of the first amino acid residue is protected by a suitable, selectively-removable protecting group. A different, selectively removable protecting group is utilized for amino acids containing a reactive side group, such as lysine.

[0057] Using a solid phase synthesis as an example, the protected or derivatized amino acid is attached to an inert solid support through its unprotected carboxyl or amino group. The protecting group of the amino or carboxyl group is then selectively removed and the next amino acid in the sequence having the complementary (amino or carboxyl) group suitably protected is admixed and reacted with the residue already attached to the solid support. The protecting group of the amino or carboxyl group is then removed from this newly added amino acid residue, and the next amino acid (suitably protected) is then added, and so forth. After all the desired amino acids have been linked in the proper sequence, any remaining terminal and side group protecting groups (and solid support) are removed sequentially or concurrently, to provide the final peptide. The peptide of the invention are preferably devoid of benzylated or methylbenzylated amino acids. Such protecting group moieties may be used in the course of synthesis, but they are removed before the peptides are used. Additional reactions may be necessary, as described elsewhere, to form intramolecular linkages to restrain conformation.

[0058] The functional derivatives of the present invention include fragments of gE or IDE which bind to IDE or gE, respectively. Some embodiments of the invention are fragments which comprise at least three amino acids and which bind to gE or IDE. In some embodiments, fragments are less than 50 amino acids. In some embodiments, fragments of are less than 25 amino acids. In some embodiments, fragments are less than 20 amino acids. In some embodiments, fragments are less than 15 amino acids. In some embodiments, fragments are less than 13 amino acids. In some embodiments, fragments of are less than 10 amino acids. In some embodiments, fragments are less than 8 amino acids. In some embodiments, fragments are less than 5 amino acids.

[0059] Functional derivatives of the present invention encompass conservative substitutions of amino acid sequences of gE or IDE or fragments thereof. As used herein, the term "conservative substitutions" is meant to refer to amino acid substitutions of native residues with other residues which share similar structural and/or charge features. Those having ordinary skill in the art can readily design fragments with conservative substitutions for amino acids based upon well-known conservative groups.

[0060] In functional derivatives of the gE or IDE amino acid sequences of the present invention, at least 3 amino acids of the functional derivative is a contiguous sequence from the native sequence of gE or IDE. It is preferred that the functional derivative makes up at least 10% of the amino acid sequence of the native sequence. In some embodiments, it is preferred that greater than about 20-25% of the amino acid sequence of the functional derivative of the present invention are the native sequence, more preferably 30-40% and more preferably greater than 50%. In some embodiments, the proportion of amino acid sequence of the functional derivative of the present invention that are approaches about 60% or about 75% or more of the native sequence.

[0061] The functional derivatives of the present invention can be tested following the methods herein to determine whether they bind to gE of VZV. Those functional derivatives which bind to gE or IDE are useful for blocking the native IDE from binding gE. For instance, molecules that bind to gE can be identified by (a) Incubating compounds with cell lysates (which contain IDE) or recombinant IDE directly in the presence of the extracellular domain of gE, immune complexes are immunoprecipitated with anti-gE antibody and protein A-Sepharose and after separation on SDS-PAGE gels and transfer to membranes, the blots are probed with antibody to IDE. Compounds that inhibit gE-IDE complex formation are identified (see Figure 5A), or (b) by coating a 96 well plate with recombinant HA-IDE (or His tagged gE) and incubating each well with a different compound in the presence of recombinant His-gE (or HA-tagged-IDE). After washing, the wells are incubated with anti-His mouse antibody (or anti-HA mouse antibody) followed by anti-mouse antibody conjugated to an indicator molecule (e.g. horseradish peroxidase) and a substrate that is cleaved by the peroxidase (e.g. TMB) is added to identify wells in which His tagged gE (or HA tagged IDE) is unable to bind. Such wells would have inhibitory compounds (See Figure 1D). Mass screening can be accomplished by any high through-put screening method known or commercially available in the art.

[0062] A DNA sequence encoding IDE of the present invention, or its functional derivatives, may be recombined with vector DNA in accordance with conventional techniques, including blunt-ended or staggered-ended termini for ligation, restriction enzyme digestion to provide appropriate termini, filling in of cohesive ends as appropriate, alkaline phosphatase treatment to avoid undesirable joining, and ligation with appropriate ligases. Techniques for such manipulations are disclosed by Sambrook J, Fritsch E, and Maniatis, T., Molecular Cloning: A laboratory manual. Cold Spring Harbor Laboratory Press 1989 and are well known in the art. See Experimental Methods in the Examples, below.

[0063] The present invention encompasses the expression of IDE (or a functional derivative thereof) in either prokaryotic or eukaryotic cells, according to methods well known in the art. In the Examples below, IDE is expressed in a variety of cells.

[0064] In one embodiment, IDE is produced in soluble form. By "soluble" is meant that the molecule is able to remain dissolved in solution . Specifically, in Example 8, a recombinant baculovirus expressing human IDE with an N-terminal hemagglutinin (HA) tag termed HA-IDE (Figure 13) is generated. Soluble HA-IDE is purified by affinity purification with an anti-HA column and eluted with HA peptide (Figures 14 and 15). The

) amino acid sequence for HA-IDE is SEQ ID NO: 2; the nucleic acid sequence for HA-IDE is SEQ ID NO: 3.

[0065] By "gE" is meant glycoprotein E from VZE as described above. Glycoprotein E can be purified from its natural source, it can be prepared recombinantly or synthesized by standard protein synthesis techniques, according to methods well known in the art and describe above. The amino acid (SEQ ID NO:4) and DNA sequence for gE is set forth in Davison, A.J. and Scott, J. E. "The complete DNA sequence of varicella-zoster virus." J. Gen. Virol. 67, 1759-1816 (1986), which is herein incorporated by reference. See Figure 29.

[0066] "gE" also includes "functional derivatives" of gE. The definition of a "functional derivative" set forth above with regard to IDE is applicable to gE.

[0067] In one embodiment, the invention relates to a method of inhibiting the entry of VZV into a cell. Such cell is preferably a mammalian cell, most preferably a human cell. The present inventors discovered that when IDE is blocked by short interfering RNA (siRNA), a chemical inhibitor, soluble IDE, or antibody to IDE, VZV infectivity is impaired. See Example 7. The block occurs at the level of gE/IDE complex formation and during the early events of VZV infection such as viral binding and entry. Nonetheless, these inhibitors also block cell-to-cell spread of VZV. All studies were performed in cell culture, and since infectious virus is not secreted from cells in culture, cell-to-cell spread is the only method of transmission of the virus between cells in vitro.

[0068] Based on this discovery, it is possible to inhibit the entry of VZV into a cell, and thereby prevent the cell-to-cell spread of VZV by preventing gE from forming a complex with IDE. "Binding to " and "forming a complex" are intended to used interchangeably herein. Such inhibitors of the binding of gE to IDE are, according to the present invention, "anti-Varicella-zoster virus" compounds. For instance, antibodies against gE or against IDE would block such complex formation. As used herein, the term "antibody" is meant to refer to complete, intact antibodies, and Fab fragments and F(ab)2 fragments thereof. Complete, intact antibodies include monoclonal antibodies such as murine monoclonal antibodies, chimeric antibodies and humanized antibodies. In some embodiments, the antibodies specifically bind to an epitope of SEQ ID NO:1 or to an epitope of SEQ ID NO: 4. Antibodies that bind to an epitope are useful to isolate and purify that protein from both natural sources or recombinant expression systems using well known techniques such as affinity chromatography. Such antibodies are useful to detect the presence of such protein in a sample and to determine if cells are expressing the protein. More importantly, however, within the context of the present invention, they are useful in preventing gE from forming a complex with IDE. By binding either gE or IDE, they prevent gE and IDE from forming a complex with each other.

[0069] The production of antibodies and the protein structures of complete, intact antibodies, Fab fragments and F(ab)2 fragments and the organization of the genetic sequences that encode such molecules are well known and are described, for example, in Harlow, E. and D. Lane (1988) ANTIBODIES: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, N. Y, which is incorporated herein by reference. Briefly, for example, gE or IDE, or an immunogenic fragment thereof, is injected into mice. The spleen of the mouse is removed, the spleen cells are isolated and fused with immortalized mouse cells. The hybrid cells, or hybridomas, are cultured and those cells which secrete antibodies are selected. The antibodies are analyzed and, if found to specifically bind to gE or IDE, the hybridoma which produces them is cultured to produce a continuous supply of antibodies. Antibodies against gE and IDE are commercially available. In a preferred embodiment, antibodies that inhibit the formation of a complex between gE and IDE are anti-IDE antibody PRB-282C, monoclonal antibody 9B12 (Covance, Berkely, CA) and C20-3.1A from Robert Bennett, University of Nebraska. Anti- IDE antibodies include a monoclonal antibody from Abnova Corp., and a polyclonal antibody available from Abeam Co. and Chemicon Corp.

[0070] Other anti-VZV compounds that inhibit the cell-to-cell transmission of VZV are antimicrobials, preferably antibiotics and more preferably Bacitracin. Most preferably, such inhibitors are polypeptides present in fractions A8-10 of Bacitracin as depicted in Figure 12 and described in Example 9.

[0071] In another embodiment, anti-VZV compounds that inhibit the entry of Varicella-zoster virus into a cell by reducing the amount of IDE present in the cell or on the extracellular surface of the membrane of said cell. IDE is in endosomes (vesicles) inside the cell. Many viruses including herpesviruses are endocytosed into cells in endosomes. VZV may be endocytosed and when in endosomes it would be exposed to IDE and this may activate gE and allow VZV to enter the cell. IDE in endosomes may be as important as IDE on the cell surface. The amount can be reduced by reducing the cell's expression of IDE. In one embodiment, expression of IDE is reduced by contacting the intracellular portion of the cell with short interfering RNA (siRNA), wherein the siRNA reduces the expression of IDE. Such method is described in Example 7. Antisense sequences and ribozymes may be used in a similar way to prevent or reduce the expression of IDE. One of skilled in the art would know how to make or where to commercially obtain such compounds. For instance, siRNA is available from Dharmacon Corp. (Lafayette, Indiana). In yet another embodiment, the anti-VZV compound is a chemical moiety of a molecule or a chemical compound. For instance, in one embodiment, the anti-VZV compound is a sulfonylurea. It has been shown that sulfonyureas, which are used to treat diabetes mellitus, have been found to inhibit IDE activity (L. Kesner, State University of New York, Downstate, unpublished data). The inventors have discovered that the administration of sulfonylurea compounds (glyburide or glipizide) either at the time of infection or shortly after infection to allow virus entry, results in reduction of plaque size indicating that the compounds inhibited cell-to-cell spread, compared to treatment with the solvent in which the compounds were dissolved (DMSO). Figures 24 and 25. Furthermore, glyburide also reduced the number of infectious foci in dose-dependent fashion, with 30% inhibition occurring at about 50 uJVI of glyburide. Similarly, compounds such as insulin or EDTA, N-ethylmaleimide and iodoacetamidecan, block IDE and could be useful. However, one of skilled in the art would understand that any given anti-VZV compound would have to meet safety and toxicity criteria for use therapeutically.

[0072] In yet another embodiment, a compound that inhibits gE from forming a complex with cellular IDE is isolated IDE comprising the full-length amino acid sequence (SEQ ID NO: 1) of IDE. Thus, in one embodiment, the invention relates to a composition comprising an effective amount of isolated IDE comprising SEQ ID No:1 , wherein said amount inhibits the formation of a complex between gE and cellular IDE. "Cellular IDE" is IDE that is in a living cell.

[0073] In yet another embodiment, an anti-VZV compound, i.e. a compound that inhibits gE from forming a complex with or binding to cellular IDE, is isolated gE comprising the full-length amino acid sequence (SEQ ID NO: 4). Thus, in one embodiment, the invention relates to a composition comprising an effective amount of isolated gE comprising SEQ ID No: 4, wherein said amount inhibits the formation of a complex between gE and cellular IDE. "Isolated gE" is gE that is separated from VZV-infected cells. In one embodiment, isolated gE and isolated IDE, are isolated from cells that have been engineered to express high levels of recombinant gE or IDE, according to methods well known in the art.

[0074] In another embodiment, the invention relates to anti-VZV compounds that are functional derivatives of gE that bind IDE, thereby preventing VZV gE from binding cellular IDE. Preferably, these functional derivatives are fragments of gE, particularly portions of the extracellular region of gE. In yet another embodiment, the invention relates to compounds that are functional derivatives of IDE that bind viral gE. "Viral gE" is gE in the intact VZV. Such functional derivatives that block complex formation may be detected by assays described herein. One such assay for identifying an anti-VZV compound is a method comprising the steps of contacting IDE or a fragment thereof that interacts with gE glycoprotein with gE glycoprotein of VZV or a fragment thereof that interacts with IDE, in the presence of a test compound; and comparing the binding of the IDE or fragment thereof to the gE or fragment thereof in the presence of the test compound with the binding of the IDE or fragment thereof to the gE or fragment thereof in the absence of the test compound; wherein a decrease in the binding in the presence of the test compound indicates that the test compound is an anti-varicella zoster compound. The "binding" or "decrease in binding" can be detected and/or measured by any method known to the skilled artisan. In one embodiment, the assay is a high throughput screening assay similar to that described in U.S. Patent No. 7,049,086, (which is incorporated herein by reference) but which is adapted for use with cells expressing IDE. High throughput screening systems are known to the skilled artisan and available commercially. Typically, such a screening assay is performed using a microtiter well format so that multiple test agents,. at various concentrations, can be evaluated simultaneously. For instance, cells expressing IDE are seeded into the wells of a microtiter plate, as described above.

[0075] The present invention provides pharmaceutical compositions that comprise the above compounds of the invention and pharmaceutically acceptable carriers, excipients or diluents. Such compositions may comprise buffers, such as neutral buffered saline, phosphate buffered saline and the like, carbohydrates such as glucose, mannose, sucrose or dextrans, mannitol, proteins, polypeptides or amino acids such as glycine, antioxidants, chelating agents such as EDTA or glutathione, adjuvants (e.g. aluminum hydroxide), penetration enhancers and preservatives. In addition, the pharmaceutical compositions of the present invention may include other active ingredients. Such other active ingredients may include, for instance, moisturizers, pain relievers, anti-inflammatory agents and other antimicrobials. In one embodiment, the invention relates to a pharmaceutical composition comprising isolated IDE comprising SEQ ID NO:1 and a sterile solution. Sterile solutions include but are not limited to buffered saline and the like. Such pharmaceutical composition may comprise an amount of a polypeptide comprising SEQ ID NO: 1 to effectively bind gE thereby preventing VZV gE from binding with cellular IDE .

[0076] The compositions of the present invention may be formulated for any manner of administration, including for example topical, nasal, subcutaneous, oral, and intraperitoneal. In a preferred embodiment, the compositions of the invention are formulated for topical administration. Topical formulations include, but are not limited to, creams, ointments, suspensions, emulsions and sprays and transdermal products. Such formulations and methods of making the same are known to the skilled artisan and are found in texts such as Remington, The Science and Practice of Pharmacy (20th Edition) pp. 836-857, Gennaro (Editor), A. Lippincott Williams & Wilkins, Baltimore, Md. (2000), which is incorporated herein by reference.

[0077] Thus, in one embodiment, the present invention relates to a method of treating a subject with a VZV infection with an effective amount of a pharmaceutical composition of the invention. "Treating" is intended to include preventing or reducing cell- to-cell spread of VZV. With the reduction in cell-to-cell spread of VZV the presentation of shingle lesions would also be reduced or eliminated. Effective amounts or dosages and protocols for treatment would vary depending upon the age and physical condition of the subject and the stage of VZV infection. One of skill in the art would know how to formulate and administer the pharmaceutical of the present invention in a manner appropriate to the subject being treated. However, in one embodiment, the compositions of the invention may be administered at the site of a VZV infection repeatedly throughout the day for many continuous days, for instance every few hours for four days or more. In one embodiment, the concentration of the active ingredient of the pharmaceutical compositions may be from 1 % to 5%. In one embodiment, the pharmaceutical composition of the invention comprises about 500 U/gram of the active ingredient.

[0078] In yet another embodiment, the present invention relates to a method of "increasing" or "enhancing" the stability of a VZV vaccine. "Stability" means retention of functional properties. The inventors discovered that HA-IDE, which lacks the first 41 amino acids from the native amino acid sequence of IDE (SEQ ID NO: 2) enhanced VZV infectivity. See Examples 8 and 9, where HA-IDE was recombinantly produced in a baculovirus expression system. By "enhanced" is meant "increased" which means that the VZV vaccine treated with HA-IDE remains stable outside of freezing conditions for longer than the same vaccine that is not treated with HA-IDE. Vaccine packaging recommends that the vaccines be used immediately after removal from the freezer. Pretreatment of the vaccine with HA-IDE would lengthen the time that vaccine could be stored after removal from the freezer. Pretreatment might also lengthen the shelf-life of a vaccine and the time it could remain stored before use (this might include time in a freezer or in a refrigerator or at room temperature). Pretreatment of either cell-free recombinant VZV expressing lacZ or cell - free Merck VZV vaccine virus with soluble HA-IDE also enhanced the infectivity of the virus in human melanoma cells and in CHO cells. Other experiments showed that soluble HA-IDE increased the stability of recombinant VZV expressing lacZ when the virus was incubated for several hours before the virus was used to infect cells. Cell- free VZV was mixed with soluble HA-IDE or controls (buffer, BSA, or filtrate) at 4⁰C or 25⁰C for 22 hours and then used to infect cells (Figure 22). VZV incubated with soluble IDE, but not with the controls, showed large numbers of plaques indicated that soluble IDE enhanced the stability of the virus . In a second experiment, cell-free VZV was mixed with soluble HA-IDE or controls for 1 hour at 37⁰C or for 22 hours at 25⁰C then used to infect cells (Figure 23 ). VZV incubated with soluble IDE but not with controls, showed large numbers of plaques indicating that soluble IDE enhanced the stability of the virus during the incubation periods.

[0079] Based on this work, the inventors discovered that soluble IDE, as described above, improves the stability of VZV vaccines, such as the Merck vaccine (VARIVAX^®), that must be stored frozen and used promptly after removal from the freezer. Additionally, soluble IDE improves the infectivity of the VZV vaccines. Thus, in one embodiment, the invention relates to a method of improving the stability of VZV vaccines and in another embodiment relates to the enhanced infectivity of the VZV vaccine with treatment of such vaccine with soluble IDE, preferably a functional derivative of IDE and most preferably a truncated form or fragment of IDE. In the preferred embodiment, the soluble IDE is HA-IDE. In another embodiment, the invention relates to a composition comprising HA-IDE.

Because Soluble IDE allows the frozen virus to be stored at a higher temperature of perhaps 4°C, it extends the shelf life of the vaccine, i.e. the time it can be stored frozen or at 4°C and still used.

[0080] In yet another embodiment, the invention relates to kits comprising the above described molecules, including IDE, gE and anti-VZV compounds, as well as HA-IDE. Such kits comprise a container and may further comprise storage solutions and labels.

[0081] The following Examples are intended to be illustrative only and in no way limit the scope of the inventions described herein.

EXAMPLES

[0082] The following experimental procedures were followed in the Examples set forth below. The products, sources of products and methods listed below also are intended to exemplify the various embodiments described above.

Cells and viruses

[0083] Human fibroblasts (MRC-5), melanoma (MeWo, from C. Grose, University of Iowa), HeLa, CV-1/EBNA (ATCC, Manassas, VA), T (II-23) cells (from C. Ware, La JoIIa Institute for Allergy and Immunology) which are susceptible to VZV infection (Zerboni L, 2000), B78H1 mouse melanoma cells (from N. Frasier, University of Pennsylvania), Chinese hamster ovary (CHO) cells, B3 CHO cells that express human IDE (Vekrellis et al., 2000) (from R. W. Farris, Harvard University), 3T3, and SK-6 A7 cells (from O. Fuller, University of Michigan), were used.

[0084] VZV strains ROka (recombinant derived Oka), Molly (a low passage isolate), and ROka-lacZ (expressing beta-galactosidase) (Cohen et al., 1998) were grown on MeWo cells. VZV expressing GFP or 17 polymerase was constructed by inserting a cassette containing the GFP gene with the human cytomegalovirus promoter from plasmid EGFP-N1 (Clontech-BD Biosciences, Palo Alto, CA) or a cassette with the SV40 promoter driving the T7 polymerase gene from plasmid pAR3126 (provided by W. Studier, Brookhaven National Laboratory) into the Avrll site of cosmid VZV Mstll-A. Cosmid VZV-MstllA GFP or VZV Mstll-A T7 pol was transfected with cosmids NotlA, NotlBD, and M stl I B into MeWo cells and the resulting viruses were termed ROka-GFP or ROka-T7. HSV-1 expressing b-galactosidase was a gift from P. Schaffer (Cai and Schaffer, 1991).

[0085] Cell-free virus was prepared by scraping cells from flasks in SPGC buffer (10 % fetal bovine serum, 0.1% sodium glutamate, 5% sucrose in PBS), freeze-thawing the cells once, sonicating the lysate, centrifuging the lysate at 1 ,240 x g for 10 minutes at 4oC, and transferring the supernatant to a new tube for use as cell-free virus.

Antibodies and reagents

[0086] Rabbit polyclonal anti-IDE-1 (provided by R.W. Ferris), murine monoclonal anti-IDE 9B12 and rabbit polyclonal anti-IDE antibody PRB-282C (both from Covance, Berkeley, CA) were used to detect IDE. Anti-VZV monoclonal antibodies to gE (Chemicon, Temecula, CA), gl, gB (Biodesign, Saco, Maine), and gH (from C. Grose) were used. Bacitracin (Sigma-Aldrich, St. Louis, MO) was dissolved in water. Control Fc fusion proteins including P7.5-Fc (encoding the vaccinia 7.5 protein), were provided by M. Spriggs. Soluble IDE protein purified from liver was provided by Dr. R. Bennett (University of Nebraska).

Plasmids

[0087] The extracellular domain of gE (amino acids 1-537) was amplified by PCR with Sail and BamHI linkers and inserted into plasmid pDC409 (Giri JG, 1994) to generate plasmid pDC409-gEt. The extracellular domain of gE, along with an in-frame C-terminal human Ig Fc tag, was cloned into pDC409 to generate plasmid pDC409-gE-Fc. The extracellular domain of gl (amino acids 1-271) was amplified by PCR and cloned into pDC409 to create plasmid pDC409-glt. PEF6/V5-His-HA-IDE (Vekrellis et al., 2000) encoding HA-tagged human IDE was provided by R.W. Farris. A 3.3 kb (BamHI-Notl) fragment encoding HA-IDE from plasmid pEF6/V5-His-HA-IDE was inserted into baculovirus vector pVL1393 (BD Biosciences Pharmingen, San Diego, CA). Plasmid expressing full length HSV-2 gE (pcDNA3-gE) was provided by J. Weir (FDA, Bethesda, MD).

Recombinant gE and biotinylation of proteins

[0088] CV-1/EBNA cells were transfected with plasmids expressing gEt or gE-Fc using Lipofectamine (Invitrogen, Carlsbad, CA) with low Ig FBS (HyClone, Logan, Utah). Five days after transfection, tissue culture supernatants were collected. For biotinylation of cell surface proteins, cell monolayers were incubated with 0.5 mg/ml of EZ-Link Sulfo-NHS-Biotin (Pierce) in PBS (pHδ.O) for 30 minutes at 250C followed by three washes with cold PBS.

RNA interference and ligand binding assay

[0089] IDE specific siRNA SmartPools (siRNA-IDE1 and siRNA-IDE2) and two non-specific control pools (Duplex-13 and C8-scrumple) were synthesized by Dharmacon (Lafayette, CO). Each pool contains four individual siRNA duplex sequences. IDE-specific individual siRNA duplex IDE-02 contains sequence

ACACUGAGGUUGCAUAUUUUU (sense sequence). Cells were transfected with 100 nM of individual siRNA or siRNA pools using nucleofection (Amaxa, Gaithersburg, MD).

[0090] Histidine (His)-tagged soluble gE and gl (Kimura et al., 1997), gB (Williams and Straus, unpublished data), and HA-tagged IDE were each cloned into baculovirus and proteins were purified from Sf9 infected cells. HA-IDE protein was coated onto 96 well plates at 4OC for 18 hrs. After washing, equal amounts of gEt-His, glt-His or gBt-His protein (normalized by ELISA using anti-His antibody) were added and incubated at 4OC for 3 hrs. The plates were washed, anti-His-HRP secondary antibody was added, TMB one-step substrate (Dakocytomation, Carpinteria, CA) was added, and binding capacity was detected at OD450 nm by an ELISA reader.

Reagents

[0091] Human insulin was obtained from EIi Lilly (Indianapolis, IN).

Mutagenesis

[0092] pEF6/V5-His-HA-IDE was mutagenized in two sequential reactions, using the QuikChange Site-Directed Mutagenesis Kit (Stratagene, Cedar Creek, TX) to create plasmid HIDE2-2-B that has nucleotide mutations that do not alter the amino acid sequence of IDE.

[0093] Primers δ'-GACAGAGATAACACCGAGGTTGCATACTTAAAGACACTTACC and δ'-GGTAAGTGTCTTTAAGTATGCAACCTCGGTGTTATCTCTGTC were used in the first reaction, and 5'-GACAGAGATAATACCGAGGTCGCGTACTTAAAGACACTTACCAAGG and 5'-CCTTGGTAAGTGTCTTTAAGTACGCGACCTCGGTATTATCTCTGTC were used in the second reaction. The mutations were confirmed by DNA sequencing.

Electron microscopy and protein sequencing

[0094] Melanoma cells were infected with VZV for 8 hrs, bacitracin (1 mg/ml) was added and 24 hrs after infection the cells were harvested by scraping and fixed in 2% glutaraldehyde in 0.1 M cacodylate buffer (pH 7.0). The samples were processed and electron microscopy was performed.

[0095] Protein excised from a polyacrylamide gel was subjected to trypsin digestion and protein sequencing by mass spectrometry at the Protein Sequencing Unit of the National Institute of Allergy and Infectious Diseases, NIH₁ Bethesda, MD.

Pull-down assays, immunoprecipitations, and immunoblotting

[0096] CV-1/EBNA cells were transfected with plasmids encoding soluble gE-Fc or gEt using Lipofectamine. Five days later, cell culture supematants were collected and incubated with protein A-Sepharose (Sigma) to precipitate gE-Fc or with anti-gE monoclonal antibody and protein A-Sepharose to precipitate gEt. After extensive washing, gE proteins bound to Protein A-Sepharose were incubated with cell lysates (1 X 107 cells/ml in lysis buffer, see below for composition) at 4oC for 3 hr, washed, and resolved on 4-20% SDS-PAGE gels under reducing conditions. The proteins were transferred to nitrocellulose membranes, probed with primary antibodies and horseradish peroxidase conjugated secondary antibodies, and visualized by chemilumescence (SuperSignal; Pierce, Rockford, IL).

[0097] Immunoprecipitations were performed by lysing virus-infected cells in lysis buffer (25 mM Tris-HCI pH 7.4, 5 mM EDTA, 15 mM NaCI, and 0.1 % NP40), centrifuging the lysate to remove insoluble material, and incubation with gE antibody. After boiling the samples in SDS loading buffer, separation on SDS-PAGE, and transfer to nitrocellulose membranes, the blots were incubated with antibody to IDE.

Virus binding assay

[0098] MRC-5 cells were infected with cell-associated VZV or an equal number of uninfected cells (mock) for 8 hr, labeled with [35S]methionine for 24 hr, and cell-free virus or mock lysate was prepared by sonication as described in Experimental procedures. CHO cells were transfected with an HA-tagged human IDE plasmid or control plasmid using nucleofection (Amaxa, Gaithersburg, MD). At 18 hr post-transfection the cells were incubated with radiolabeled cell free-virus or uninfected cell sonicate for 90 min on ice, washed, lysed, and counts per min were determined using a liquid scintillation counter.

Example 1 : Identification of IDE as the gE Receptor

[0099] We tested whether IDE interacts with VZV gB, gH, or gl, or HSV gE. Lysates from VZV-infected cells were immunoprecipitated with antibodies to VZV gE, gB, or gH and immunoblotted with anti-IDE antibody. While gE coimmunoprecipitated with IDE, gB and gH did not interact with IDE (Fig. 1C, lanes 7-9). Transfection of CV-1 cells with plasmids expressing VZV gE, VZV gl, or HSV gE followed by immunoprecipitation with the corresponding antibody and immunoblotting with anti-IDE antibody showed that the extracellular domain of VZV gl, which functions as a gE chaperone but lacks sequence homology with gE, also interacted with IDE, although at a much weaker level than gE (Fig. 1C, lanes 1 , 2). This was confirmed using an ELISA based ligand binding assay. When similar levels of His-tagged soluble gE, gl, or gB were incubated with HA-IDE, the latter bound significantly greater to gE than to either gB or gl over a range of concentrations (Fig. 1D). HSV gE, which has 32% amino acid identity with VZV gE within a 170 amino acid region, interacted very weakly with IDE (Fig. 1C, lane 4).

[0100] Immunoprecipitation of IDE from infected cells followed by immunoblotting with antibody to gE showed that the amount of gE-IDE complexes increased during the course of VZV infection (Figure 10), which was in parallel with the increasing amounts of gE produced in these infected cells over time, even though the total amount of IDE remained unchanged (data not shown).

Example 2: A portion of IDE that interacts with gE is located on the plasma membrane

[0101] Computer analysis indicates that the predicted sequence of IDE contains a putative amino terminal signal peptide with a potential cleavage site between residues 22 and 23, and the majority of the sequence might be extracellular; however, a typical transmembrane domain is not apparent (TMHMM program, Technical University of Denmark). Cell fractionation studies showed that IDE is localized primarily in the cytosol (Akiyama et al., 1988), with a small amount present on the cell surface plasma membrane (Seta and Roth, 1997; Yaso et al., 1987). Vekrellis et al. identified a -115 kDa cell surface membrane-associated IDE isoform on neuronal cells (Vekrellis et al., 2000). To verify that IDE is present on the surface of cells, we biotinylated cell surface proteins followed by immunoprecipitation with streptavadin-coated agarose beads and immunoblotting with anti-IDE antibody. A protein of about 120 kDa was present on the surface of HeLa and melanoma cells (Fig. 2A, lanes 1 , 2).

[0102] To determine whether gE interacts with IDE on the plasma membrane, cell surface proteins were biotinylated and incubated with gEt. The IDE-gE complex was immunoprecipitated with gE antibody followed by immunoblotting with streptavidin-conjugated HRP to detect cell surface IDE, or anti-IDE antibody to detect total IDE. A portion of the total IDE in the gE-IDE complex was derived from IDE on the cell surface (Fig. 2B, lanes 2, 6). Controls lacking antibody to gE showed that the IDE-gE interaction was required for detection of IDE on the cell surface in this assay (Fig. 2B, lanes 3, 4).

Example 3: Anti-IDE antibodies reduce VZV infectivity and cell-to-cell spread

[0103] Polyclonal and monoclonal IDE antibodies were tested for their ability to block VZV infection. Commercially available polyclonal anti-IDE antibody PRB-282C and monoclonal antibody 9B12 (Covance, Berkeley, CA) were used. In several experiments, addition of either antibody (50 ug/ml for 9B12 and 1/200 dilution for PRB-282C serum) to MeWo cells prior to VZV infection resulted in 40 to 50% inhibition of virus infectivity (Fig. 3A and B), while a control antibody (anti-CD3) or pre-immune serum showed little or no effect. Polyclonal antibody (Figure 11) blocked VZV infection in a dose-dependent manner.

[0104] To determine if IDE antibody affects cell-to-cell spread of VZV, we pre-incubated cells with the polyclonal antibody at 1/100 and 1/200 dilutions at 4oC for 60 minutes followed by infection with cell-free ROka-IacZ in the presence of the antibody. Three days later the cells were stained with X-gal. IDE antibody markedly reduced plaque sizes compared to the cells treated with control pre-immune serum (Fig. 3C). Therefore, IDE antibody inhibits cell-to-cell spread of VZV.

[0105] Since IDE interacts with gE, and IDE degrades several proteins including insulin (Farris et al., 2003; Goldfine et al., 1984) and amylin (Bennett et al., 2000; Farris et al., 2003; Vekrellis et al., 2000), we determined whether IDE degrades gE. Incubation of purified IDE with gE at 37oC for 4 hr did not reduce the amount of the glycoprotein, while IDE degraded insulin when incubated at 37oC for 30 min (Figure 8(A)). Conversely, addition of bacitracin (1 mg/ml), an IDE inhibitor that reduces degradation of insulin and amylin by IDE (Bennett et al., 2000; Bennett et al., 2003; Hammons et al., 1982), did not change the turn-over rate of gE in VZV-infected cells during a pulse-chase experiment with [35S]methionine labeled cells (Figure 8 (B)). These results suggest that IDE is not important for degradation of gE in cells. Example 4: Knock-down of IDE expression inhibits VZV infection and cell-to-cell spread

[0106] To determine the role of IDE in VZV infection, we used small interfering RNA (siRNA) to reduce endogenous IDE expression. Human fibroblasts (MRC-5 cells), that are susceptible to productive VZV infection, were transfected with two_/ independent pools of IDE-specific siRNAs (siRNA-IDE1 , siRNA-IDE2) or two independent control siRNA pools (siRNA-1 , siRNA-2). Dharmacon Corporation, Lafayette, CO. At 2.5 days after transfection, half of the cells were harvested for immunoblotting to determine the level of IDE, and the remainder of the cells was infected with cell-free VZV ROka-lacZ. IDE-specific siRNA knocked down the IDE level by about 95% compared with control siRNAs, as calculated by densitometry (Fig. 4A). To determine the effect of IDE knock-down on VZV infection, the cells infected with cell-free ROka-lacZ were stained with X-gal 4 days later. VZV infectivity in the cells transfected with IDE-specific siRNA was reduced by about 70% compared with the cells transfected with control siRNA (Fig. 4B). Interestingly, most of the X-gal positive foci in the cells transfected with IDE-specific siRNA consisted of only single isolated blue cells (Fig. 4C, panels 3-4); in contrast, larger foci involving multiple cells, due to cell-to-cell spread of virus, were present in the cells transfected with control siRNA (Fig. 4C, panels 1-2). Knock-down of IDE with siRNA also inhibited infectivity of cell-associated wild-type VZV (Fig.4D). Transfection with IDE-specific siRNA did not reduce cell viability compared with control siRNA.

Example 5: Bacitracin, which inhibits IDE, blocks gE-IDE complex formation, VZV infection, and cell-to-cell spread

Bacitracin, an antibiotic, has previously been shown to be an inhibitor of insulin degrading enzyme (IDE). Bacitracin is a mixture of at least 20 different polypeptides. Previous published work showed that the IDE inhibiting activity of Bacitracin is present in a specific fraction after HPLC separation of the mixture, and that this fraction is independent of the fractions that exhibit antibiotic activity. In an attempt to identify the IDE inhibiting component(s) in Bacitracin, we sub-fractionated Bacitracin on HPLC columns. Figure 12 shows several such bacitracin fractions that can inhibit the binding of varicella-zoster virus (VZV) gE to IDE (left panel) or that can reduce the infectivity of cell-free VZV (right panel).

[0107] Since bacitracin inhibits IDE (Bennett et al., 2003; Hammons et al., 1982), we examined the effect of the antibiotic on the interaction of gE with IDE, VZV infectivity, and cell-to-cell spread. Bacitracin was incubated with cell lysates in the presence of gEt, immune complexes were immunoprecipitated with anti-gE antibody and protein A-Sepharose, and after separation on SDS-PAGE gels and transfer to membranes, the blots were probed with antibody to IDE. Bacitracin inhibited gEt-IDE complex formation in a dose-dependent manner (Fig. 5A). Bacitracin also inhibited the interaction of IDE with gE-Fc fusion protein (unpublished data).

[0108] VZV infectivity with cell-free VZV ROka-lacZ was measured 4 days post-infection by counting the number of plaques. Bacitracin inhibited plaque formation in a dose-dependent manner with -90% reduction in infectivity at 5 mg/ml of antibiotic (Fig. 5B).

[0109] Plaque size in the presence of 1 mg/ml of bacitracin, added either at the time of infection or 8 hrs after infection to allow virus entry, was reduced indicating that the drug also reduced cell-to-cell spread of VZV. This effect was observed in cells infected with either wild-type cell-associated virus (Fig. 5C) or with vaccine-derived (ROka-laz) cell-free virus (Fig. 5D). In contrast, bacitracin did not inhibit either infectivity or cell-to-cell spread of HSV-1 , but the same dose of antibiotic inhibited cell-to-cell spread and infectivity of VZV (Fig. 5E). Bacitracin did not cause apparent cytotoxicity and did not inhibit adenovirus infectivity at the doses used (data not shown). Thus, the effect of bacitracin was specific for VZV and was not seen with HSV-1 , another human a-herpesvirus.

[0110] To ensure that the effects of bacitracin on VZV entry and cell-to-cell spread were not due to an effect on virus replication, we performed electron microscopy on VZV ROka-infected cells in the presence or absence of bacitracin. Bacitracin (1.0 mg/ml) was added to melanoma cells at 8 hrs post-infection to allow viral entry. The cells were then incubated for an additional 20 hrs. Bacitracin did not reduce nucleocapsid formation, virion maturation, or transport to the cell surface (Figure 9) when compared with untreated controls. The number of cell surface virions was not reduced in cells treated with bacitracin, compared with control cells. These data indicate that bacitracin did not inhibit VZV replication or trafficking to the cell surface.

Example 6: Expression of exogenous human IDE increases VZV infectivity and entry

[0111] To further investigate the function of IDE in VZV infection a series of "gain of function" experiments was performed. CHO cells, which do not support productive VZV infection, were transiently transfected with either a plasmid expressing HA-tagged human IDE or empty vector and infected with cell-free VZV-GFP virus. This virus encodes GFP under a CMV promoter so that productive infection is not required for expression of GFP. Two days later cells transfected with human IDE showed a 3 fold increase in infectivity (Fig. 6A). A modest amount of virus was able to enter the cells (vector control) in the absence of human IDE indicating that the cells are not completely defective for entry. Similar results were obtained with mouse melanoma cells (B78H1) infected with VZV (data not shown). Since CHO and mouse melanoma cells do not support productive infection, the ability of human IDE to increase the number of GFP-positive cells after incubation with VZV suggests that the IDE is important for a very early step in virus infection.

[0112] To measure entry of VZV into cells, CHO cells which stably express human IDE (B3 cells), or their parental control cell line, were transfected with a reporter plasmid that encodes GFP under a T7 promoter. The CHO cells were then incubated for 18 hours with melanoma cells infected with VZV encoding T7 polymerase (ROka-T7). Expression of the T7 promoter-driven GFP is turned on in cells infected with ROka-T7. The level of GFP expression was detected by anti-GFP antibody in immunoblot and the bands were quantified by densitometry. Cells stably expressing IDE showed a three-fold increase in GFP expression, indicative of enhanced entry when compared with control cells (Fig. 6B). A three-fold increase in GFP expression was also seen when porcine cells (SK-6 A7), which do not support productive VZV infection, cotransfected with the GFP reporter plasmid and plasmid expressing human IDE or empty vector were used in place of CHO and CHO B3 cells in the assay described above (unpublished data).

[0113] To determine whether exogenous expression of human IDE in CHO cells enhances stable binding of VZV to the cells, we transfected CHO cells with a plasmid expressing HA-tagged human IDE or control plasmid and 2 days later the cells were incubated with radiolabeled cell-free VZV in the presence of heparin at 4oC for 1.5 hr to assay for stable binding. Expression of human IDE increased heparin-resistant binding of VZV to CHO cells by ~1.6 fold (Fig. 6C). While the ability of exogenous human IDE to increase VZV infectivity and binding was reproducible, the overall effect was somewhat modest. Endogenous IDE in CHO cells may have interfered with expression of exogenous human IDE and obscured the effect or expression of the human protein.

Example 7: Expression of exogenous human IDE corrects the defect in cell-to-cell spread in IDE knock-down cells

[0114] Since IDE knock-out cells could not be obtained for "gain of function" experiments, we cotransfected human fibroblasts (MRC-5 cells) with IDE-specific siRNA to knock-down endogenous human IDE and with a modified plasmid expressing human IDE that should be resistant to the IDE-specific siRNA. Plasmid HA-IDE2-2-B was constructed that encodes an HA epitope tagged human IDE with an altered nucleotide sequence that does not change the predicted amino acid sequence of IDE, but should resist down-regulation by siRNA IDE-02. Cotransfection of fibroblasts with siRNA IDE-02 and control plasmid followed by infection with cell-free ROka-lacZ resulted in reduced size of foci at 4 days after infection indicative of impaired cell-to-cell spread, compared with cells cotransfected with control siRNA and control plasmid (Fig. 6D, lines 1 , 3). The impairment in cell-to-cell spread was rescued by transfection of cells with plasmid expressing siRNA-resistant IDE (HA-IDE2-2-B) (Fig. 6D, lines 3, 4).

[0115] We cotransfected CHO cells with specific siRNA to knock-down endogenous CHO IDE and infected the cells with cell-free VZV ROka-GFP 2 days later. Aliquots of the cells were immunoblotted with anti-IDE Ab to verify the level of IDE protein. Cotransfection of CHO cells with IDE specific siRNA and a control plasmid resulted in reduced levels of endogenous IDE compared with cotransfection of the cells with control siRNA and control plasmid (Fig 7, lanes 4 vs. 1). VZV infectivity in the cells was low. In contrast, cotransfection of CHO cells with control siRNA and either plasmid expressing unmodified (HA-IDE) or modified (HA-IDE2-2-B) IDE resulted in increased levels of IDE and a corresponding increase in VZV infectivity (lanes 2, 3). Cotransfection of cells with IDE-specific siRNA and unmodified plasmid (HA-IDE) resulted in a modest increase in IDE levels and virus infectivity compared with control siRNAand control plasmid (lanes 1 , 5). In contrast, cotransfection of cells with IDE-specific siRNA and siRNA resistant plasmid (HA-IDE2-2-B) resulted in a more substantial increase in IDE levels and virus infectivity (lane 6). Thus, the level of VZV infectivity correlated with the level of IDE expression.

Example 8: Construction of a recombinant baculovirus expressing HA-tagged human insulin degrading enzyme (HA-IDE) and purification of HA-IDE

[0116] Plasmid PEF6/V5-His-HA-IDE (Vekrellis et al., 2000) encoding hemagglutinin (HA)-tagged human IDE was provided by R.W. Farris (Harvard University). The plasmid contains the human IDE gene fused to an HA epitope at the amino terminus of IDE as a 3.3 kb BamHI fragment. Since there is an internal BamHI site in IDE, a two step procedure was used to clone HA-IDE into baculovirus vector pVL1393 (BD Biosciences, Palo Alto, CA). First, a 2.95 kb BamHI-Not I fragment containing part of HA-IDE was inserted into the BamHI-Notl site of pVL1393. This latter plasmid was then cut with BamHI and a 350 bp BamHI fragment containing the remainder of HA-IDE was inserted to create plasmid pVL-HA-IDE. The correct orientation of the inserted HA-IDE fragment was confirmed by sequencing.

[0117] Recombinant baculovirus expressing human HA-IDE was generated using the BD BaculoGold transfection kit (BDBioSciences) according to the manufacturer's instructions. Briefly, 0.5ug of BaculoGold viral DNA was mixed with 2 ug of pVL1393-HA-IDE plasmid, and added to 2.5X106 Sf9 cells in a 60 mm tissue culture dish. HA-IDE is driven from the baculovirus polyhedron promoter of the recombinant virus.

[0118] At 4-days after transfection, the recombinant baculovirus was amplified. Virus-infected Sf9 cells and supernatant were analyzed for HA-IDE production. HA-IDE protein was detected the cell lysates, but not cell supernatants, as determined by Western blotting.

[0119] Lysates of baculovirus-infected Sf9 cells were applied to an anti-HA antibody affinity column and after washing, HA-IDE was eluted from the column using HA peptide. The eluate was centrifuged in a Centricon device with a 10 kDa cutoff, so that HA-IDE (but not the smaller HA peptide) was retained in the Centricon. The HA-IDE was then removed from the Centricon apparatus and used for subsequent experiments.

[0120] Example 9: HA-tagged human insulin degrading enzyme (HA-IDE) Produced in Baculovirus Enhances Entry of Varicalla-Zoster Virus into Cells, Increases Cell-to-Cell Spread, and Enhances Stability of the Virus

[0121] Numerous studies have shown that purified soluble viral receptors can either block or enhance virus infectivity. Soluble receptors can affect infectivity of several retroviruses including HIV, SIV and Avian leukosis virus; for the latter virus, pre-loading virus with soluble receptor increased virus stability at 37oC. For herpes simplex virus (HSV), the most closely related human virus to VZV, a soluble isoform of the major virus entry receptor nectin-1 can either enhance or inhibit HSV entry.

[0122] We generated a recombinant baculovirus expressing human IDE with an N-terminal hemagglutinin (HA) tag termed HA-IDE (Fig. 13). Soluble HA-IDE protein was purified by affinity purification with an anti-HA column, and eluted with HA peptide (Figs. 14 and 15). Soluble HA-IDE protein bound to gE in a dose-dependent fashion (Fig. 16). Pretreatment of either cell-free recombinant VZV expressing lacZ (Fig. 17) or cell-free Merck VZV vaccine virus (Fig. 18) with soluble HA-IDE enhanced the infectivity of the virus in human melanoma cells. Similarly, pretreatment of recombinant VZV expressing lacZ with soluble HA-IDE enhanced the infectivity of the virus in Chinese hamster ovary (CHO) cells that do not permit VZV replication (Fig.19). Soluble HA-IDE increased infectivity of recombinant VZV expressing lacZ (as evidenced by an increased number of plaques upon infection), and also promoted cell-to-cell spread of the virus (as evidenced by larger plaques) (Fig. 20). These effects were seen after preincubation of virus with soluble HA-IDE for 1 hr at 37oC (Fig. 20 left panels), or after preincubation for 3 hr at 37oC (Fig. 20, right panels). Soluble HA-IDE also increased the infectivity of recombinant VZV expressing green fluorescent protein (GFP) and enhanced cell-to-cell spread of the VZV-GFP virus (Fig. 21).

[0123] Soluble HA-IDE increased the stability of recombinant VZV expressing lacZ when the virus was incubated for several hours before the virus was used to infect cells. Cell-free VZV was mixed with soluble HA-IDE or controls (buffer, BSA, or filtrate) at 4oC or 25oC for 22 hrs and then used to infect cells (Fig.22). VZV incubated with soluble IDE, but not with the controls, showed large numbers of plaques indicating that soluble IDE enhanced the stability of the virus during the 22 hr incubation period. In a second experiment, cell-free VZV was mixed with soluble HA-IDE or controls for 1 hr at 37oC or 22 hrs at 25oC and then used to infect cells (Fig. 23). VZV incubated with soluble HA-IDE₁ but not with the controls, showed large numbers of plaques indicating that soluble HA-IDE enhanced the stability of the virus during the incubation periods. The current Merck vaccine is very heat labile and must be kept frozen. After thawing it must be given to patients promptly. Soluble IDE might improve the shelf-life (storage) of the virus. Example 10: Soluble IDE derived from liver inhibits VZV infectivity and cell-to cell spread

[0124] To determine whether soluble purified from liver can inhibit entry of

VZV, we incubated cell-free VZV ROka-lacZ (derived from sonicated cells) with soluble IDE extracted from liver, or uninfected sonicated control cell protein as a control, at 37°C for 30 min before infection of melanoma cells. Four days post-infection, the cells were stained with X-gal and the number of blue foci, indicative of infectivity by cell-free virus, were scored. Soluble IDE inhibited infectivity by about 70%, while control protein had no effect (Fig. 31 ). In 3 independent experiments, IDE inhibited VZV infectivity by 50 to 70%. In contrast, when soluble IDE was added, at 1.5 hours after infection, it failed to reduce the number of VZV foci, suggesting that the native form of soluble IDE extracted from liver blocks VZV entry during the initial stages of infection.

To determine if soluble IDE extracted from liver affects cell-to-cell spread of VZV, we infected cells with cell-free ROka-lacZ in the presence of soluble IDE or control protein (37.5 ug/ml each) and added the proteins again on the second day of infection. Two days later the cells were stained with X-gal. Soluble IDE markedly reduced plaque sizes compared to the cells treated with control protein or no added protein (Fig. 32). Therefore, soluble IDE inhibits cell-to-cell spread of VZV.

As noted in Examples 9 and 10, VZV infectivity and cell-to cell spread were enhanced when the virus was pre-treated with recombinant soluble HA-IDE derived from baculovirus infected insect cells (Figs. 17-21 ), but inhibited when virus incubated with IDE purified from .human liver (Figs 26,27). The recombinant soluble HA-IDE is initiated from the second ATG of the IDE ORF, and thus is missing the first 41 amino acids. Since the recombinant soluble HA-IDE was produced from baculovirus, it may be processed differently than the IDE purified from liver. Thus, differences in the construct or post-translational processing may explain the differences in activities of the different forms of IDE. As noted above, there are numerous examples in the art demonstrating that soluble receptor molecules can block or promote viral infection.

References

[0125] Each of the references or cited patents or applications set forth above or each reference included in this list of references is herein incorporated in their entirety.

[0126] Akiyama, H., Shii, K., Yokono, K., Yonezawa, K., Sato, S., Watanabe, K., and Baba, S. (1988). Cellular localization of insulin-degrading enzyme in rat liver using monoclonal antibodies specific for this enzyme. Biochem Biophys Res Commun 155, 914-922.

[0127] Akula, S. M., Pramod, N. P., Wang, F. Z., and Chandran, B. (2002). lntegrin alpha3beta1 (CD 49c/29) is a cellular receptor for Kaposi's sarcoma-associated herpesvirus (KSHV/HHV-8) entry into the target cells. Cell 108, 407-419.

[0128] Arvin, A. M. (2001). Varicella-Zoster Virus. In Fields Virology, D. M. Knipe, and P. M. Howley, eds. (Philadelphia, Lippincott Williams & Wilkins), pp. 2731-2768.

[0129] Bennett, R. G., Duckworth, W. C, and Hamel, F. G. (2000). Degradation of amylin by insulin-degrading enzyme. J Biol Chem 275, 36621-36625.

[0130] Bennett, R. G., Hamel, F. G., and Duckworth, W. C. (2003). An insulin-degrading enzyme inhibitor decreases amylin degradation, increases amylin-induced cytotoxicity, and increases amyloid formation in insulinoma cell cultures. Diabetes 52, 2315-2320.

[0131] Browne, H., Bruun, B., and Minson, T. (2001). Plasma membrane requirements for cell fusion induced by herpes simplex virus type 1 glycoproteins gB, gD, gH and gl_. J Gen Virol 82, 1419-1422.

[0132] Cai, W., and Schaffer, P. A. (1991). A cellular function can enhance gene expression and plating efficiency of a mutant defective in the gene for ICPO, a transactivating protein of herpes simplex virus type 1. J Virol 65, 4078-4090.

[0133] Chen, J. J., Zhu, Z., Gershon, A. A., and Gershon, M. D. (2004). Mannose 6-phosphate receptor dependence of varicella zoster virus infection in vitro and in the epidermis during varicella and zoster. Cell 119, 915-926.

[0134] Cocchi, R, Menotti, L, Mirandola, P., Lopez, M., and Campadelli-Fiume, G. (1998). The ectodomain of a novel member of the immunoglobulin subfamily related to the poliovirus receptor has the attributes of a bona fide receptor for herpes simplex virus types 1 and 2 in human cells. J Virol 72, 9992-10002.

[0135] Cohen, J. I., and Nguyen, H. (1997). Varicella-zoster virus glycoprotein I is essential for growth of virus in Vero cells. J Virol 71 , 6913-6920.

[0136] Cohen, J. I., and Straus, S. (2001). Varicella-Zoster Virus and its Replication. In Fields Virology, D. M. Knipe, and P. M. Howley, eds. (Philadelphia, Lippincott Williams & Wilkins), pp: 2707-2730.

[0137] Cohen, J. I., Wang, Y, Nussenblatt, R., Straus, S. E., and Hooks, J. J. (1998). Chronic uveitis in guinea pigs infected with varicella-zoster virus expressing Escherichia coli beta-galactosidase. J Infect Dis 177, 293-300.

[0138] Cole, N. L., and Grose, C. (2003). Membrane fusion mediated by herpesvirus glycoproteins: the paradigm of varicella-zoster virus. Rev Med Virol 13, 207-222.

[0139] Collins, W. J., and Johnson, D. C. (2003). Herpes simplex virus gE/gl expressed in epithelial cells interferes with cell-to-cell spread. J Virol 77, 2686-2695.

[0140] Delmas, B., Gelfi, J., L'Haridon, R., Vogel, L. K., Sjostrom, H., Noren, O., and Laude, H. (1992). Aminopeptidase N is a major receptor for the entero-pathogenic coronavirus TGEV. Nature 357, 417-420.

. [0141] Dingwell, K. S., Brunetti, C. R., Hendricks, R. L., Tang, Q., Tang, M., Rainbow, A. J., and Johnson, D. C. (1994). Herpes simplex virus glycoproteins E and I facilitate cell-to-cell spread in vivo and across junctions of cultured cells. J Virol 68, 834-845.

[0142] Dingwell, K. S., and Johnson, D. C. (1998). The herpes simplex virus gE-gl complex facilitates cell-to-cell spread and binds to components of cell junctions. J Virol 72, 8933-8942.

[0143] Duckworth, W. C. (1988). Insulin degradation: mechanisms, products, and significance. Endocr Rev 9, 319-345.

[0144] Duckworth, W. C, Bennett, R. G., and Hamel, F. G. (1998). Insulin degradation: progress and potential. Endocr Rev 19, 608-624.

[0145] Duckworth, W. C₁ and Kitabchi, A. E. (1974). Insulin and glucagon degradation by the same enzyme. Diabetes 23, 536-543.

[0146] Farris, W., Mansourian, S., Chang, Y, Lindsley, L., Eckman, E. A., Frosch, M. P., Eckman, C. B., Tanzi, R. E., Selkoe, D. J., and Guenette, S. (2003). Insulin-degrading enzyme regulates the levels of insulin, amyloid beta-protein, and the beta-amyloid precursor protein intracellular domain in vivo. Proc Natl Acad Sci U S A 100, 4162-4167.

[0147] Gabel, C. A., Dubey, L., Steinberg, S. P., Sherman, D., Gershon, M. D., and Gershon, A. A. (1989). Varicella-zoster virus glycoprotein oligosaccharides are phosphorylated during posttranslational maturation. J Virol 63, 4264-4276.

[0148] Geraghty, R. J., Krummenacher, C, Cohen, G. H., Eisenberg, R. J., and Spear, P. G. (1998). Entry of alphaherpesviruses mediated by poliovirus receptor-related protein 1 and poliovirus receptor. Science 280, 1618-1620.

[0149] Giri JG, A. M., Eisenman J, Shanebeck K, Grabstein K, Kumaki S, Namen A, Park LS, Cosman D, Anderson D. (1994). Utilization of the beta and gamma chains of the IL-2 receptor by the novel cytokine IL-15. EMBO J 13, 2822-2830.

[0150] Goldfine, I. D., Williams, J. A., Bailey, A. C, Wong, K. Y₁ Iwamoto, Y₁ Yokono, K., Baba, S., and Roth, R. A. (1984). Degradation of insulin by isolated mouse pancreatic acini. Evidence for cell surface protease activity. Diabetes 33, 64-72.

[0151] Hambleton, S., Gershon, M. D., and Gershon, A. A. (2004). The role of the trans-Golgi network in varicella zoster virus biology. Cell MoI Life Sci 61 , 3047-3056.

[0152] Hamel, F. G, Gehm, B. D., Rosner, M. R., and Duckworth, W. C. (1997). Identification of the cleavage sites of transforming growth factor alpha by insulin-degrading enzymes. Biochim Biophys Acta 1338, 207-214.

[0153] Hamel, F. G., Mahoney, M. J., and Duckworth, W. C. (1991 ). Degradation of intraendosomal insulin by insulin-degrading enzyme without acidification. Diabetes 40, 436-443.

[0154] Hammons, G. T., Smith, R. M., and Jarett, L. (1982). Inhibition by bacitracin of rat adipocyte plasma membrane degradation of 1251-insulin is associated with an increase in plasma membrane bound insulin and a potentiation of glucose oxidation by adipocytes. J Biol Chem 257, 11563-11570.

[0155] Kimura, H., Straus, S. E., and Williams, R. K. (1997). Varicella-zoster virus glycoproteins E and I expressed in insect cells form a heterodimer that requires the N-terminal domain of glycoprotein I. Virology 233, 382-391.

[0156] Kuo, W. L., Montag, A. G., and Rosner, M. R. (1993). Insulin-degrading enzyme is differentially expressed and developmentally regulated in various rat tissues. Endocrinology 132, 604-611.

[0157] Kurochkin, I. V. (1998). Amyloidogenic determinant as a substrate recognition motif of insulin-degrading enzyme. FEBS Lett 427, 153-156.

[0158] Li, W., Moore, M. J., Vasilieva, N., Sui, J., Wong, S. K., Berne, M. A., Somasundaran, M., Sullivan, J. L., Luzuriaga, K., Greenough, T. C, et al. (2003). Angiotensin-converting enzyme 2 is a functional receptor for the SARS coronavirus. Nature 426, 450-454.

[0159] Lowry, P. W., Solem, S., Watson, B. N., Koropchak, C. M., Thackray, H. M., Kinchington, P. R., Ruyechan, W. T., Ling, P., Hay, J., and Arvin, A. M. (1992). Immunity in strain 2 guinea pigs inoculated with vaccinia virus recombinants expressing varicella-zoster virus glycoproteins I, IV, V or the protein product of the immediate early gene 62. J Gen Virol 73 (Pt 4), 811-819.

[0160] Maresova, L., Pasieka, T. J., and Grose, C. (2001). Varicella-zoster Virus gB and gE coexpression, but not gB or gE alone, leads to abundant fusion and syncytium formation equivalent to those from gH and gL coexpression. J Virol 75, 9483-9492.

[0161] Misbin, R. I., and Almira, E. C. (1989). Degradation of insulin and insulin-like growth factors by enzyme purified from human erythrocytes. Comparison of degradation products observed with A14- and B26-[125l]monoiodoinsulin. Diabetes 38, 152-158.

[0162] Mo, C, Lee, J., Sommer, M., Grose, C₁ and Arvin, A. M. (2002). The requirement of varicella zoster virus glycoprotein E (gE) for viral replication and effects of glycoprotein I on gE in melanoma cells. Virology 304, 176-186.

[0163] Montgomery, R. I., Warner, M. S., Lum, B. J., and Spear, P. G. (1996). Herpes simplex virus-1 entry into cells mediated by a novel member of the TNF/NGF receptor family. Cell 87, 427-436.

[0164] Muller, D., Baumeister, H., Buck, R₁ and Richter, D. (1991). Atrial natriuretic peptide (ANP) is a high-affinity substrate for rat insulin-degrading enzyme. Eur J Biochem 202, 285-292.

[0165] Nicola, A. V., McEvoy, A. M., and Straus, S. E. (2003). Roles for endocytosis and low pH in herpes simplex virus entry into HeLa and Chinese hamster ovary cells. J Virol 77, 5324-5332.

[0166] Perlman, R. K., and Rosner, M. R. (1994). Identification of zinc ligands of the insulin-degrading enzyme. J Biol Chem 269, 33140-33145.

[0167] Pertel, P. E., Fridberg, A., Parish, M. L., and Spear, P. G. (2001 ). Cell fusion induced by herpes simplex virus glycoproteins gB, gD, and gH-gL requires a gD receptor but not necessarily heparan sulfate. Virology 279, 313-324.

[0168] Polcicova, K., Goldsmith, K., Rainish, B. L., Wisner, T. W., and Johnson, D. C. (2005). The extracellular domain of herpes simplex virus gE is indispensable for efficient cell-to-cell spread: evidence for gE/gl receptors. J Virol 79, 11990-12001.

[0169] Santos, R. A., Hatfield, C. C, Cole, N. L., Padilla, J. A., Moffat, J. R, Arvin, A. M., Ruyechan, W. T., Hay, J., and Grose, C. (2000). Varicella-zoster virus gE escape mutant VZV-MSP exhibits an accelerated cell-to-cell spread phenotype in both infected cell cultures and SCID-hu mice. Virology 275, 306-317.

[0170] Seta, K. A., and Roth, R. A. (1997). Overexpression of insulin degrading enzyme: cellular localization and effects on insulin signaling. Biochem Biophys Res Commun 231 , 167-171.

[0171] Shukla, D., Liu, J., Blaiklock, P., Shworak, N. W., Bai, X., Esko, J. D., Cohen, G. H., Eisenberg, R. J., Rosenberg, R. D., and Spear, P. G. (1999). A novel role for 3-O-sulfated heparan sulfate in herpes simplex virus 1 entry. Cell 99, 13-22.

[0172] Vekrellis, K., Ye, Z., Qiu, W. Q., Walsh, D., Hartley, D., Chesneau, V., Rosner, M. R., and Selkoe, D. J. (2000). Neurons regulate extracellular levels of amyloid beta-protein via proteolysis by insulin-degrading enzyme. J Neurosci 20, 1657-1665.

[0173] Wu, L., and Forghani, B. (1997). Characterization of neutralizing domains on varicella-zoster virus glycoprotein E defined by monoclonal antibodies. Arch Virol 142, 349-362.

[0174] Yaso, S., Yokono, K., Hari, J., Yonezawa, K., Shii, K., and Baba, S. (1987). Possible role of cell surface insulin degrading enzyme in cultured human lymphocytes. Diabetologia 30, 27-32.

[0175] Zerboni L, S. M., Ware CF, Arvin AM (2000). Varicella-zoster virus infection of a human CD4-positive T-cell line. Virology 270, 278-285.

[0176] Zhu, Z., Gershon, M. D., Ambron, R., Gabel, C₁ and Gershon, A. A. (1995). Infection of cells by varicella zoster virus: inhibition of viral entry by mannose 6-phosphate and heparin. Proc Natl Acad Sci U S A 92, 3546-3550.

Kwon, H., Bai, Q., Baek, H. J., Felmet, K., Burton, E. A., Goins, W. F., Cohen, J. B., and Glorioso, J. C. (2006). Soluble V Domain of Nectin-1/HveC Enables Entry of Herpes Simplex Virus Type 1 (HSV-1 ) into HSV-Resistant Cells by Binding to Viral Glycoprotein D. J Virol 80, 138-148.

Lopez, M., Cocchi, F., Avitabile, E., Leclerc, A., Adelaide, J., Campadelli-Fiume, G., and Dubreuil, P. (2001). Novel, soluble isoform of the herpes simplex virus (HSV) receptor nectini (or PRR1-HlgR-HveC) modulates positively and negatively susceptibility to HSV infection. J Virol 75, 5684-5691.

Sattentau, Q. J., and Moore, J. P. (1991). Conformational changes induced in the human immunodeficiency virus envelope glycoprotein by soluble CD4 binding. J Exp Med 774, 407-415.

Smith, D. H., Byrn, R. A., Marsters, S. A., Gregory, T., Groopman, J. E., and Capon, D. J. (1987). Blocking of HIV-1 infectivity by a soluble, secreted form of the CD4 antigen. Science 238, 1704-1707.

Claims

We Claim:

[0177] 1. A method of identifying an anti-Varicella-zoster (VZV) compound comprising the steps of: contacting insulin degrading enzyme (IDE) or a fragment thereof that interacts with gE glycoprotein of Varicella-zoster (gE), with gE glycoprotein of Varicella-zoster (gE) or a fragment thereof that interacts with IDE in the presence of a test compound; and comparing the binding of said IDE or fragment thereof to said gE or fragment thereof in the presence of said test compound with the binding of said IDE or fragment thereof to said gE or fragment thereof in the absence of said test compound; wherein a decrease in said binding in the presence of said test compound indicates that said test compound is an anti-Varicella- zoster compound.

[0178] 2. The method of claim 1 , wherein the test compound is an polypeptide.

[0179] 3. The method of claim 1 , wherein the test compound is an antibody.

[0180] 4. The method of claim 3, wherein the antibody is an anti-IDE antibody or an anti-gE antibody.

[0181] 5. The method of claim 1 , wherein the test compound is an oligonucleotide.

[0182] 6. The method of claim 1 , wherein the test compound is an antimicrobic.

[0183] 7. The method of claim 1 , wherein the test compound is a chemical moiety of a molecule.

[0184] 8. The method of claim 1 , wherein the test compound is a chemical compound. [0185] 9. A compound identified by the method of claim 1.

[0186] 10. A composition comprising an isolated receptor for Varicella Zoster glycoprotein E (gE) comprising the insulin degrading enzyme (IDE) and a sterile solution.

[0187] 11. An isolated complex comprising IDE and gE.

[0188] 12. A method of inhibiting the entry of Varicella Zoster virus into a cell comprising contacting a composition comprising said cell with a compound that inhibits the binding of gE to IDE.

[0189] 13. The method of claim 12, wherein said compound is an antimicrobic.

[0190] 14. The method of 12, wherein said compound is sulfonylurea

[0191] 15. The method of claim 12, wherein said compound is a polypeptide or polypeptide fragment which binds to insulin degrading enzyme (IDE) or a fragment thereof.

[0192] 16. The method of claim 12, wherein said compound is a polypeptide or polypeptide fragment which binds to gE or a fragment thereof.

[0193] 17. The method of claim 16, wherein the polypeptide comprises SEQ ID NO:1.

[0194] 18. The method of claim 12, wherein said compound is an antibody selected from the group consisting of an anti-gE antibody and an anti-IDE antibody.

[0195] 19. The method of claim 18, wherein said antibody is a monoclonal antibody.

[0196] 20. A method of inhibiting the entry of Varicella-zoster virus into a cell comprising reducing the amount of IDE present in said cell or on said cell.

[0197] 21. The method of claim 20, wherein said reducing comprises reducing the cell's expression of IDE. [0198] 22. The method of claim 21 , wherein the expression of IDE is reduced by contacting the intracellular portion of said cell with short interfering RNA (siRNA), wherein said siRNA reduces the expression of IDE.

[0199] 23. A pharmaceutical composition for inhibiting or preventing the cell-to-cell spread of Varicella-zoster virus comprising an effective amount of a compound that inhibits or prevents Varicella-zoster glycoprotein E (gE) from binding insulin degrading enzyme (IDE) and a pharmaceutically acceptable carrier.

24. The pharmaceutical composition of claim 22, wherein said compound is isolated IDE comprising SEQ ID NO: 1.

[0199] 25. The pharmaceutical composition of claim 24, wherein said compound is an antibody.

[0200] 26. The pharmaceutical composition of claim 25, wherein said antibody is an anti-gE or anti-IDE antibody.

[0201] 27. The pharmaceutical composition of claim 26, wherein said antibody is a monoclonal antibody.

[0202] 28. The pharmaceutical composition of claim 23, wherein said compound is a polypeptide or oligonucleotide.

[0203] 29. The pharmaceutical composition of claim 23, which is in a topical formulation.

[0204] 30. A method of increasing the stability of a Varicella-zoster vaccine comprising contacting said vaccine with soluble IDE or a functional derivative of IDE.

[0205] 31. The method of claim 30, wherein said soluble IDE is HA-IDE.

[0206] 32. The method of claim 31, wherein HA-IDE comprises SEQ ID NO: 2.

[0207] 33. A composition for increasing the stability of Varicella-zoster vaccine comprising a soluble IDE molecule or a functional derivative thereof.

[0208] 34. A composition for increasing the infectivity of a Varicella-zoster virus comprising a soluble IDE molecule or a functional derivative thereof.

[0209] 35. A method of increasing the infectivity of a Varicella-zoster virus comprising contacting said virus with a soluble IDE molecule or a functional derivative thereof.

[0210] 36. A method of treating a Varicella-zoster infection comprising administering to a subject in need thereof an effective amount of a composition that inhibits gE from binding to IDE.

37. The method of any of claims 30 or 35, wherein said functional derivative of IDE is a fragment of IDE.

38. The compositions of any of claims 33 or 34, wherein said functional derivative of IDE is a fragment of IDE.