WO2006123929A2

WO2006123929A2 - Site-specific integration in cells of the mesenchymal lineage

Info

Publication number: WO2006123929A2
Application number: PCT/NL2006/050117
Authority: WO
Inventors: Clemens Waltherus Gerardus Maria Löwik; Hermanus Bernardus Johannes Karperien; Geertje Van Der Horst
Original assignee: Leiden University Medical Center
Priority date: 2005-05-18
Filing date: 2006-05-17
Publication date: 2006-11-23
Also published as: WO2006123929A3

Abstract

The present invention relates to methods for gene expression or RNA interference-mediated gene knock down in mesenchymal cells. The cells of the mesenchymal lineage comprise in their genome a recognition sequence for a sequence-specific recombinase that allows stable and reproducible single copy integration of DNA constructs for expression of nucleic acids in the mesenchymal cells. The invention further relates to DNA constructs with improved RNA polymerase III promoters for the expression of small interfering RNA molecules for gene knock down purposes. Preferably the promoter is a type 3 RNA polymerase III promoter that comprises more than one distal sequence element of a type 3 RNA polymerase III promoter.

Description

Site-specific integration in cells of the mesenchymal lineage

Field of the invention

The present invention relates to methods for gene expression or RNA interference-mediated gene knock down in mesenchymal cells. The invention further relates to DNA constructs with improved RNA polymerase III promoters.

Background of the invention

Mesenchymal stem cells (MSCs) can give rise to cells of the osteoblast, chondrocyte and adipocyte lineage, upon the appropriate conditions in vitro and in vivo. These cells have great potential in bone tissue engineering and gene therapy. However, application of these cells is still hampered due to our incomplete understanding how cell fate is controlled. With the completion of the human and mouse genome projects, many new genes have been identified with unknown function potentially involved in the regulation of these processes (Lander et al., ( 2001) Nature 409, 860-921; Venter et al, (2001) Science 291, 1304-1351; Waterston et al., (2002) Nature 420, 520-562). Hence there is a need for rapid and reproducible models to study gene function in differentiating MSCs.

Stable cell lines have frequently been used for the study of gene function, either by overexpression of the gene product, or by gene knock down experiments using RNA interference. Generating stable cell lines, however, is time consuming and tedious because integration of DNA in the genome is uncontrolled. Stable transformants often show extreme variability in expression of the introduced transgene due to the highly variable number of copies integrated into the genome and from positional effects on gene expression. In addition, integration can occur at a genomic locus involved in the regulation of differentiation or other cellular functions, thereby interfering or even disrupting the function of these genes independently of the transgene. All this compromises direct comparison of different expression constructs in clones obtained from the same parental cell line. The drawbacks in generation of stable cell lines could be circumvented by site-specific integration of DNA at a pre-selected site in the genome. Homologous recombination mediated by the CRE/Lox, Flp/FRT, phage lambda (λ/Int) or phage φC31 system is a sequence specific process requiring the presence of short well-defined homologous DNA sequences in the two DNA fragments to recombine (Sauer, (1994) Curr. Opin. Biotechnol. 5, 521-527; Belteki et al, (2003) Nat. Biotechnol. 21, 321-324; Branda et al. (2004) Dev. Cell 6, 7-8; Christ et al., (2002) Gene 244, 47-54). The CRE/Lox and Flp/FRT systems are now widely used in sequence specific genetic engineering in vitro and in vivo (for review see (Branda et al. (2004) Dev. Cell 6, 7-8). Both systems could be used for the site-specific integration of DNA- fragments in the genome of a mammalian cell line. This requires the introduction of a unique LoxP or FRT site in the genome of the cell, respectively, since these sites are not present in the mammalian genome (Thyagaraja et al., (2000) Gene 244, 47-54; O'Gorman et al., (1991) Science 251, 1351-1355). Although pseudo loxP sites have been found in mouse, these sites do not appear to be a hindrance to the recombination event (Thyagaraja et al., (2000) Gene 244, 47-54). A loxP or FRT site introduced in the genome could subsequently be used for the targeted insertion of DNA by homologous recombination, for example by co-transfection of a vector containing a homologous recombination site and an expression vector for the respective recombinase. The recombination reaction, however, occurs at a relatively low frequency and is bidirectional. Thus, efficient generation of stable cell lines using this method requires both positive selection markers to select for clones generated by homologous recombination as well as negative selection markers to prevent isolation of clones generated by random integration.

It is an object of the present invention to provide for rapid and reproducible systems for genetic modification of mesenchymal cells, including differentiating mesenchymal stem cells. In particular it is an object of the invention to provide a system for site-specific integration of DNA at a pre-selected site in the genome so as to allow efficient selection and reproducible generation of isogenic and genetically stable mesenchymal cell lines including mesenchymal stem and progenitor cell lines that are capable of differentiation in vitro and in vivo after transplantation in mice. Such genetic modification may comprise overexpression of endogenous and/or exogenous genes as well as knock down of endogenous gene in mesenchymal cells using e.g. RNA interference. It is therefore a further object of the invention to provide for systems for more efficient expression of interfering RNA. Description of the invention General definitions

Cells of the mesenchymal lineage are herein defined as mesenchymal stem cells (MSC) and cells that originate from MSCs by differentiation. MSC are pluripotent progenitor cells that possess the ability to differentiate into a variety of mesenchymal tissues, including bone, cartilage, tendon, muscle, marrow stroma, fat and dermis as demonstrated in a number of organisms, including humans (Bruder, et al., J. Cellul. Biochem. 56:283-294 (1994). The formation of mesenchymal tissues is known as the mesengenic process, which continues throughout life, but proceeds much more slowly in the adult than in the embryo (Caplan, Clinics in Plastic Surgery 21:429-435 (1994). In vitro studies have determined that MSCs can differentiate along multiple mesodermal or mesenchymal lineage pathways. These include, but are not limited to, adipocytes (fat cells) (Gimble et al. (1990) Eur. J Immunol 20:379-386; Pittenger et al. (1999) Science 284:143-147; Nuttall et al. (1998) JBMR 13:371-382; Park et al. (1999) Bone 24:549-554), chondrocytes (cartilage forming cells) (Dennis et al. (1999) JBMR 14:700-709), hematopoietic supporting cells (Gimble et al. (1990) Eur. J. Immunol. 20:379-386), myocytes (skeletal muscle) (Phinney (1999) J. Cell. Biochem. 72:570- 585), myocytes (smooth muscle) (Remy-Martin et al. (1999) Exp. Hematol. 27:1782- 1795), and osteoblasts (bone forming cells) (Beresford (1989) Clin Orthop Res 240:270-280; Owen (1988) J. Cell. Sci. 10:63-76; Dorheim et al. (1993) J. Cell. Physiol. 154:317-328; Haynesworth et al. (1992) Bone 13:81-88, Kuznetsov et al. (1997) JBMR 12:1335-1347). Although the precise signals that trigger differentiation down a particular path are not fully understood, it is clear that a variety of chemo tactic, cellular, and other environmental signals come into play. Within the mesenchymal lineage, for example, MSCs cultured in vitro can be induced to differentiate into bone or cartilage in vivo and in vitro, depending upon the tissue environment or the culture medium into which the cells are placed. (See e.g. Wakitani et al., 1994, J. Bone Joint Surg. 76-A: 579-592; Goshima et al., 1991, Clin. Orthop. 262: 298-311; Nakahara et al., 1991, Exper. Cell Res. 195: 492-503).

The terms "sequence-specific recombinase" and "site-specific recombinase" refer to enzymes or recombinases that recognize and bind to a short nucleic acid sequence or a "sequence-specific recombinase target site", i.e., a recombinase recognition sequence, and catalyze the recombination of nucleic acids in relation to these sequences. These enzymes include recombinases, transposases and integrases. Site- or sequence-specific recombinases typically have at least the following four activities: (1) recognition of one or two specific DNA sequences; (2) cleavage of said DNA sequence or sequences; (3) DNA topoisomerase activity involved in strand exchange; and (4) DNA ligase activity to reseal the cleaved strands of DNA (see e.g. Sauer, B., 1994, Curr. Opinions Biotechnol. 5:521-527). Conservative site-specific recombination is distinguished from homologous recombination and transposition by a high degree of specificity for both partners. The strand exchange mechanism involves the cleavage and rejoining of specific DNA sequences in the absence of DNA synthesis (Landy, A., 1989, Ann. Rev. Biochem. 58:913-949). The term "sequence-specific recombinase recognition sequence" refers to short nucleic acid sites or sequences, i.e. recombinase recognition sequences, which are recognized by a sequence- or site-specific recombinase and which become the crossover regions during a sequence-specific recombination event. Examples of sequence-specific recombinase recognition sequences include, but are not limited to, lox sites, att sites, dif sites and frt sites. The term "frt site" as used herein refers to a nucleotide sequence at which the product of the FLP gene of the yeast 2 micron plasmid, FLP recombinase, can catalyze site-specific recombination. The term "lox site" as used herein refers to a nucleotide sequence at which the product of the ere gene of bacteriophage Pl, the Cre recombinase, can catalyze a site-specific recombination event. A variety of lox sites are known in the art, including the naturally occurring Io xP, loxB, loxL and loxR, as well as a number of mutant, or variant, lox sites, such as e.g. loxP511, loxP514, Ioxδ86, Ioxδl l7, loxC2, loxP2, loxP3 and lox P23.

The term "substantially identitical", "substantial identity" or "essentially similar" or "essential similarity" means that two amino acid or two nucleotide sequences, when optimally aligned, such as by the programs GAP or BESTFIT using default parameters, share at least a certain percentage of sequence identity as defined elsewhere herein. GAP uses the Needleman and Wunsch global alignment algorithm to align two sequences over their entire length, maximizing the number of matches and minimizes the number of gaps. Generally, the GAP default parameters are used, with a gap creation penalty = 50 (nucleotides) / 8 (proteins) and gap extension penalty = 3 (nucleotides) / 2 (proteins). For nucleotides the default scoring matrix used is nwsgapdna and for proteins the default scoring matrix is Blosum62 (Henikoff & Henikoff, 1992, PNAS 89, 915-919). It is clear than when RNA sequences are said to be essentially similar or have a certain degree of sequence identity with DNA sequences, thymine (T) in the DNA sequence is considered equal to uracil (U) in the RNA sequence. Sequence alignments and scores for percentage sequence identity may be determined using computer programs, such as the GCG Wisconsin Package, Version 10.3, available from Accelrys Inc., 9685 Scranton Road, San Diego, CA 92121-3752 USA. Alternatively percent similarity or identity may be determined by searching against databases such as FASTA, BLAST, etc.

The terms protein and peptide are used herein interchangeably. The term enzyme refers to a protein which has enzymatic activity.

The term "gene" means a DNA fragment comprising a region (transcribed region), which is transcribed into an RNA molecule (e.g. an mRNA) in a cell, operably linked to suitable regulatory regions (e.g. a promoter). A gene may thus comprise several operably linked fragments, such as a promoter, a 5' leader sequence, a coding region and a 3'nontranslated sequence (3 'end) comprising a polyadenylation site. "Expression of a gene" refers to the process wherein a DNA region which is operably linked to appropriate regulatory regions, particularly a promoter, is transcribed into an RNA, which is biologically active, i.e. which is capable of being translated into a biologically active protein or peptide. In one embodiment the 5 '-end of the coding sequence preferably encodes a secretion signal, so that the encoded protein or peptide is secreted out of the cell. The coding sequence is preferably in sense-orientation and encodes a desired, biologically active protein or protein fragment.

A "chimeric" or "recombinant" gene or nucleic acid refers to any gene or nucleic acid, which is not normally found in nature in a species, in particular a gene in which different parts of the nucleic acid region are not associated in nature with each other. For example the promoter is not associated in nature with part or all of the transcribed region or with another regulatory region.

A "transgene" is herein defined as a gene that has been newly introduced into a cell, i.e. a gene that does not normally occur in the cell. The transgene may comprise sequences that are native to the cell, sequences that naturally do not occur in the cell, and it may comprise combinations of both. A transgene may contain sequences coding for one or more proteins that may be operably linked to appropriate regulatory sequences for expression of the coding sequences in the cell. The transgene may be integrated into the host cell's genome.

The term "homologous" when used to indicate the relation between a given (recombinant) nucleic acid or polypeptide molecule and a given host organism or host cell, is understood to mean that in nature the nucleic acid or polypeptide molecule is produced by a host cell or organisms of the same species, preferably of the same variety or strain. If homologous to a host cell, a nucleic acid sequence encoding a polypeptide will typically (but not necessarily) be operably linked to another (heterologous) promoter sequence and, if applicable, another (heterologous) secretory signal sequence and/or terminator sequence than in its natural environment. It is understood that the regulatory sequences, signal sequences, terminator sequences, etc. may also be homologous to the host cell.

A "nucleic acid construct" or "nucleic acid vector" is herein understood to mean a man-made nucleic acid molecule resulting from the use of recombinant DNA technology. The term "nucleic acid construct" therefore does not include naturally occurring nucleic acid molecules although a nucleic acid construct may comprise (parts of) naturally occurring nucleic acid molecules.

The term "expression vector" refers to nucleotide sequences that are capable of affecting expression of a gene in host cells or host organisms compatible with such sequences. These expression vectors typically include at least suitable transcription regulatory sequences and optionally, 3' transcription termination signals. Additional factors necessary or helpful in effecting expression may also be present, such as expression enhancer elements. DNA encoding the polypeptides of the present invention will typically be incorporated into the expression vector. The expression vector will be introduced into a suitable host cell and be able to effect expression of the coding sequence in an in vitro cell culture of the host cell. The expression vector will be suitable for replication in a eukaryotic host cell or organism, such as a cultured mammalian, plant, insect, yeast, fungi or other eukaryotic cell line, or in a prokaryotic host, such as a bacterial host.

As used herein, the term "promoter" or "transcription regulatory sequence" refers to a nucleic acid fragment that functions to control the transcription of one or more coding sequences or a non-coding short RNA molecule, and is located upstream with respect to the direction of transcription of the transcription initiation site of the coding sequence, and is structurally identified by the presence of a binding site for DNA- dependent RNA polymerase, transcription initiation sites and any other DNA sequences, including, but not limited to transcription factor binding sites, repressor and activator protein binding sites, and any other sequences of nucleotides known to one of skill in the art to act directly or indirectly to regulate the amount of transcription from the promoter. A "constitutive" promoter is a promoter that is active in most tissues under most physiological and developmental conditions. An "inducible" promoter is a promoter that is physiologically or developmentally regulated, e.g. by the application of a chemical inducer. A "tissue specific" promoter is only active in specific types of tissues or cells.

The term "selectable marker" is a term familiar to one of ordinary skill in the art and is used herein to describe any genetic entity which allows one to select for or against a molecule or a cell that contains it, often under particular conditions. These markers can encode an activity, such as, but not limited to, production of RNA, peptide, or protein, or can provide a binding site for RNA, peptides, proteins, inorganic and organic compounds or compositions and the like. Examples of selectable markers include but are not limited to: (1) DNA segments that encode products which provide resistance against otherwise toxic compounds (e.g., antibiotics); (2) DNA segments that encode products which are otherwise lacking in the recipient cell (e.g., tRNA genes, auxotrophic markers); (3) DNA segments that encode products which suppress the activity of a gene product; (4) DNA segments that encode products which can be readily identified (e.g., phenotypic markers such as β-galactosidase, β-lactamase, HSV- TK, luciferase, Nitro-reductase, green fluorescent protein (GFP), and cell surface proteins or derivatives thereof); (5) DNA segments that bind products which are otherwise detrimental to cell survival and/or function; (6) DNA segments that otherwise inhibit the activity of any of the DNA segments described in Nos. 1-5 above (e.g., antisense oligonucleotides); (7) DNA segments that bind products that modify a substrate (e.g. restriction endonucleases); (8) DNA segments that can be used to isolate a desired molecule (e.g. specific protein binding sites); (9) DNA segments that encode a specific nucleotide sequence which can be otherwise non- functional (e.g., for PCR amplification of subpopulations of molecules); and/or (10) DNA segments, which when absent, directly or indirectly confer sensitivity to particular compounds. Selectable markers may thus be dominant or recessive and/or may be bidirectional. As used herein, the term "operably linked" refers to a linkage of polynucleotide elements in a functional relationship. A nucleic acid is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence. For instance, a transcription regulatory sequence is operably linked to a coding sequence if it affects the transcription of the coding sequence. Operably linked means that the DNA sequences being linked are typically contiguous and, where necessary to join two protein encoding regions, contiguous and in reading frame.

"Gene delivery" or "gene transfer" refers to methods for reliable introduction of recombinant or foreign DNA into host cells. The transferred DNA can remain non- integrated or preferably integrates into the genome of the host cell. Gene delivery can take place for example by transduction, using viral vectors, or by transformation of host cells, using known methods, such as electroporation, cell bombardment and the like.

The term "RNAi agent" as used herein, refers to an RNA (or analog thereof), comprising a sequence having sufficient complementarity to a target RNA (i.e., the RNA to be degraded) to modulate or effect RNA interference. A sequence having sufficient complementarity to a target RNA sequence to direct RNAi means that the RNAi agent has a sequence sufficient to trigger the destruction of the target RNA by the RNAi machinery (e.g., the RISC complex) or process. RNAi agents include e.g. double stranded siRNA, single stranded siRNA (sense and/or antisense), shRNA and stRNA, modified and unmodified.

Detailed description of the invention

In a first aspect the present invention relates to cells of the mesenchymal lineage that comprise in their genome a recognition sequence for a sequence-specific recombinase. In a preferred cell of the mesenchymal lineage according to the invention, the recognition sequence for the recombinase is integrated in a genomic locus that allows integration of exogenous DNA and transgenes without interference or disruption of the regulation of differentiation or other cellular functions. The present inventors have discovered several such permissive genomic loci in the mesenchymal progenitor cell line KS483. In particular such permissive loci are present in each of the cell lines KSfrt 3B2, KSfrt 4C3 and KSfrt 4D3. Thus, in a preferred cell of the mesenchymal lineage according to the invention, the recognition sequence for the recombinase is integrated in a genomic locus that has at least 30, 40, 50, 60, 70, 80, 90, 95, 98, or 99% nucleotide sequence identity with a genomic sequence that is present 1 kb upstream and 1 kb downstream of the nucleic acid construct comprising the FRT recombinase recognition sequence as integrated in the genome of a deposited cell line selected from KSfrt 3B2, KSfrt 4C3 and KSfrt 4D3. The cell lines have been deposited at DSMZ (Braunschweig, Germany) on 11 May 2005 in accordance with the Budapest Treaty and have been assigned accession numbers DSM ACC2720, DSM ACC2721 and DSM ACC2722, respectively. Preferably, in a mesenchymal cell of the invention, the cell comprises a single copy of the recognition sequence for the recombinase integrated in its genome, i.e. the recognition sequence is thus preferably unique in the cell's genome. Most preferably the mesenchymal cell of the invention is a cell of a deposited cell line selected from KSfrt 3B2, KSfrt 4C3 and KSfrt 4D3, i.e. DSM ACC2720, DSM ACC2721 and DSM ACC2722, respectively.

In a cell according to the invention, the recognition sequence for the sequence- specific recombinase may be a recognition sequence for any sequence-specific recombinase known in the art or yet to be discovered. Preferably the recognition sequence is a recognition sequence for a recombinase selected from the yeast 2 micron plasmid FLP recombinase, the bacteriophage Pl Cre recombinase, the bacteriophage ΦC31 recombinase, the bacteriophage lambda int recombinase, the bacteriophage TP901-1 recombinase and the bacteriophage R4 recombinase. Other suitable combinations of recognition sequence and recombinase are described in US 6,270,969.

In a preferred mesenchymal cell of the invention the recognition sequence for the recombinase is present as part of a first DNA construct that comprises, in addition to the recognition sequence, a promoter that is capable of driving transcription in the mesenchymal cell. Preferably, in the first DNA construct, the recognition sequence is present (immediately) adjacent to the promoter, and preferably the recognition sequence is present downstream of the promoter with respect to the direction of transcription from the promoter. The recognition sequence is thus preferably present (immediately) downstream from of the promoter's transcription initiation site. The functional requirement of the configuration of the promoter and recognition sequence in the DNA construct is that recognition sequence-specific recombination with a second DNA construct comprising a recognition sequence immediately upstream of a coding sequence will produce a recombination product (between the first and second DNA constructs) in which the promoter in the first DNA construct is operably linked to the coding sequence in the second DNA construct. Suitable promoters for incorporation in the first DNA include e.g. SV40-early promoter, the cytomegalovirus (CMV-), Elongation factor Ia(EF Ia-), and phosphoglycerate kinase (PGK)-promoters or an hybrid cytomegalovirus enhancer/chicken beta-actin promoter. The coding sequence in the second DNA construct preferably encodes a selectable marker. Preferred selectable markers for selecton of mesenchymal cells of the invention include e.g. genes encoding resistance to blasticidin, hygromycin or G418. A review of the use of selectable markers in mammalian cell lines is provided in Sambrook and Russell (2001) "Molecular Cloning: A Laboratory Manual (3^rd edition), Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, New York. In a preferred embodiment, also the first DNA construct (that is integrated in the cell's genome prior to introduction of the second DNA construct) comprises a selectable marker. This marker in the first construct is preferably different from the marker in the second construct and is preferably located downstream of the recognition sequence of the first DNA construct and preferably operably linked to the promoter in the first DNA construct, this promoter being present upstream of the recognition sequence with respect to the direction of transcription (see Figure 1). More preferably, the selectable marker in the first DNA construct is a marker that allows counter selection; most preferably the marker is bidirectional.

A further preferred mesenchymal cell of the invention comprises a vector integrated into a recognition sequence for the recombinase. Preferably, the vector comprises a deficient selectable marker gene, the deficiency being restored only upon integration of the vector into the recognition sequence. This may be effected e.g. as outlined above by using a vector as second DNA construct that comprises a coding sequence for selectable marker immediately downstream of a recognition sequence for the recombinase.

Preferably the vector further comprises a nucleotide sequence encoding a desired polypeptide or a desired RNA molecule. Preferably the nucleotide sequence is operably linked to a promoter capable of driving transcription of the nucleotide sequence in the cell. Usually the promoter that is operably linked to the nucleotide sequence encoding the desired polypeptide or RNA molecule is not the one and the same promoter as the promoter that is operably linked to the selectable marker although such embodiments are also not excluded from the invention. The nucleotide sequence encoding the desired polypeptide or RNA molecule may thus be any nucleotide sequence that is useful in study of the biology and/or gene function in mesenchymal cells in vitro and/or in vivo. The nucleotide sequence may be for the expression or overexpression of a desired polypeptide or RNA, or it may be for knock down of a gene expressed in the mesenchymal cell. Nucleotide sequences for expression or overexpression may include in an frame fusion to e.g. a reporter construct (e.g. GFP or derivatives) or antibody recognition sites (e.g. His-tag, HA-tag or Myc- tag) or may be combined in a single RNA transcript linked by an interal ribosomal entry site (IRES) to a reporter construct, that can be used for the qualitative and quantitative detection of the expressed gene product. Nucleotide sequences for knock down of gene expression using RNA interference are further specified herein below. Reporter constructs to visualize and /or quantify gene expression are further specified herein below.

A variety of nucleotide sequences encoding desired polypeptides may be expressed or overexpressed in the mesenchymal cells of the invention. These include e.g. reporter polypeptides (proteins or enzymes) that may be used to visualize and/or quantify differentiation and/or signal transduction. Suitable reporter polypeptides include e.g. luminescent proteins such as luciferase and variants thereof, fluorescent proteins such as GFP and variants thereof, enzymes for cytochemistry such as E. coli β- galactosidase (lacZ), nitroreductase, β-lactamase and variants thereof, enzymes for radiochemistry such as e.g. thymidine kinase and variants thereof (HSV TK Gillies RJ. 2002 J Cell Biochem Suppl. 39: 231-8. ). These reporter polypeptides may also consist of multimodality reporters either by fusion of one or more of the above mentioned reporters, e.g. GFP-Luc fusion, LacZ-Luc fusion or by combining the reporters in a single RNA transcript linked by an internal ribosomal entry site (IRES). In addition, fusion polypeptides may be expressed comprising one of the above reporter functions in combination with other functions to visualize and study biological processes in MSC differentiation such as signal transduction. Examples of such constructs are e.g. the C2 domain of Protein Kinase C (Sakai N., et al. 1997 J Cell Biol. 139(6): 1465-76), Pleckstrin Homology domain (Nash MS, et al. 2001 Biochem J. 356(Pt 1): 137-42), protein phosphorylation sites (Kawai Y., et al. 2004 Anal Chem. 15;76(20):6144-9), and proteolytic cleavage sites e.g. to study apoptosis (Laxman et al., 2002 Proc Natl Acad Sci U S A.99(26): 16551-5) fused to fluorescent reporters as well as peptide recognition sites for antibodies such as e.g. a histidin tag or a HA-tag in frame fused to a reporter construct.

For expression of the nucleotide sequence encoding the desired polypeptide or RNA molecule the nucleotide sequence is operable linked to a promoter that is capable of driving transcription in the mesenchymal cell. The promoter may be a promoter that is constitutively active in the mesenchymal cell, a promoter the activity of which is regulated depending on the developmental, differentiation and/or cell cycle stage of the mesenchymal cell, or a promoter that may be induced by e.g. a hormone or another inducer. Suitable examples of promoters for constitutive expression are the CMV- promoter, the EFlα-promoter, the PGK-promoter and a hybrid cytomegalovirus enhancer/chicken beta-actin promoter. Suitable examples for cell lineage specific promoters are the osteocalcin promoter for osteoblast differentiation, the collagen 2 and -10 promoters for chondrocyte differentiation and the Fabp4-promoter for adipocyte differentiation. Suitable examples of promoters that can be induced by a hormone or another inducer are minimal promoters that contain transcription factor bindingsites for estrogen receptors (ERE) for induction by estrogen, SMAD-proteins (BRE, CAGA) for induction by BMP or TGFβ, respectively, and T-cell factors for induction by Wnt activity.

In a preferred cell of the invention, the nucleotide sequence encoding a desired RNA molecule is an RNAi agent, i.e. an RNA molecule having sufficient complementarity to a target RNA expressed in the cell to effect RNA interference of the target RNA. Suitable DNA constructs for knock down of gene expression in a mesenchymal cell of the invention are described in further detail herein below.

The cells of the mesenchymal lineage in the present invention preferably are mesenchymal stem cells (MSC). MSC are pluripotent progenitor cells that possess the ability to differentiate into a variety of mesenchymal tissues, preferably all mesenchymal tissues as defined herein above. MSC may be obtained from embryos or from adults, e.g. from bone marrow. Alternatively, the mesenchymal cells of the invention may have a more limited differentiation potential, e.g. being able to differentiate into only a selected number tissues of the mesenchymal lineage. Preferably such mesenchymal progenitor cell have at least the ability to differentiate towards or into osteoblasts, adipocytes and/or chondrocytes. A preferred cell of the invention may thus be selected from: (a) a cell of the adipocyte lineage; (b) a cell of the chondrocyte lineage; (c) a cell of the osteoblast lineage; (d) a terminally differentiated adipocyte; (e) a terminally differentiated chondrocyte; and, (f) a terminally differentiated osteoblast or osteocyte. Mesenchymal cells of the invention are preferably of vertebrate or mammalian origin, more preferably, the cells are of human or murine origin. Examples of such cells are cells of the murine mesenchymal progenitor cell lines MC 3T3, ST2, C3H10tl/2, C2C12, KS4 and KS438 or descendants from these cell lines.

The cells of the invention are particularly useful for the study of gene function in the mesenchymal lineage, either by (over)expression or by gene silencing (RNA interference). The present invention provides a fast and efficient method for generating stable and isogenic cells and cell lines of the mesenchymal lineage. The term stable in this context refers to the stably integrated transgene or DNA construct, as opposed to episomal DNA constructs for transient expression. One embodiment of the invention thus relates to a set of at least two different cells of the invention as defined above, whereby the different cells are isogenic except for the integrated vector, DNA construct or nucleotide sequence comprised therein. Such a set of two or more different cells may be used in a method for determining the biological effect of expression of a nucleotide sequence on a mesenchymal cell as defined above, by comparing at least two different cells, whereby the cells differ in expression level of the nucleotide sequence.

In another aspect the invention relates to a non-human animal, preferably a mammal like a rodent, comprising a cell of the mesenchymal lineage of the present invention. Such animal may be used for in vivo studies with the cells of the mesenchymal lineage of the invention whereby the cells may be visualized by any known means in the art (see above). Such studies may include methods of surgery or treatment of the non- human animal body that are not (potentially) suitable for, or aimed at restoring or maintaining the health, the physical integrity or physical well-being of the animal.

In a further embodiment, the invention pertains to DNA construct comprising improved RNA polymerase III promoters. The RNA polymerase III (pol III) is responsible for the synthesis of a large variety of small nuclear and cytoplasmic non- coding RNAs including 5S, U6, adenovirus VAl, Vault, telomerase RNA, and tRNAs. The promoter structures of a large number of genes encoding these RNAs have been determined and it has been found that RNA pol III promoters fall into three types of structures (for a review see Geiduschek and Tocchini-Valentini, 1988 Annu. Rev. Biochem. 57: 873-914; Willis, 1993 Eur. J. Biochem. 212: 1-11; Hernandez, 2001, J. Biol. Chem. 276: 26733-36). In types 1 and 2, typified by the 5S and tRNA genes, respectively, the promoter elements are entirely within the transcribed region. In type 3 of the RNA pol III promoters, transcription is driven by cis-acting elements found only in the 5'-fianking region, i.e. upstream of the transcription start site. Upstream sequence elements include a traditional TATA box (Mattaj et al, 1988 Cell 55, 435-442), proximal sequence element and a distal sequence element (DSE; Gupta and Reddy, 1991 Nucleic Acids Res. 19, 2073-2075). Examples of genes under the control of the type 3 pol III promoter are U6 small nuclear RNA (U6 snRNA), 7SK, Y, MRP, Hl and telomerase RNA genes (see e.g. Myslinski et al., 2001, Nucl. Acids Res. 2]_: 2502-09).

Thus, a type 3 RNA pol III promoter is herein defined as an RNA pol III promoter wherein the cis-acting element necessary for transcription are located upstream from the transcription inititation site. A typical type 3 RNA pol III promoter comprises: (a) a TATA box (herein defined as a DNA sequence that can be bound by the TATA box binding protein); (b) a proximal sequence element; and (c) a distal sequence element. A TATA box is a promoter-sequence element that is well known in the art as it is also present in many RNA polymerase II promoters. A TATA box is herein functionally defined as a DNA sequence that can be bound by the TATA box binding protein. Usually the TATA box is present 22-30 nucleotides upstream from the transcription initiation site. The proximal sequence element (PSE) is usually present 50-70 nucleotides upstream from the transcription start site. The factor binding to this element is best characterized in the human system and is known as PBP, PTF or SNAP_C (for review see Hernandez, 2001, J. Biol. Chem. 276: 26733-36). An example of a PSE is given in Table 1. The distal sequence element (DSE) of the type 3 RNA pol III promoter is usually present 190-260 nucleotides upstream from the transcription start site, although this may be much less as e.g. in the human HlRNA gene it is present within 100 nucleotides from the transcription start site. DSEs are composed of several functional submotifs that can either be present simultaneously or separately. Two of these are often the octamer and the Staf motifs (see Table 1).

The present invention thus relates to a DNA construct that comprises: (a) a type 3 RNA polymerase III promoter; and (b) an additional distal sequence element. A type 3 RNA pol III promoter for use in the present invention thus preferably comprises: (a) a TATA box; (b) a proximal sequence element; and (c) more than one distal sequence element. The distal sequence elements are preferably located in the DNA construct within 1000, 500, 250, 150, 125 or 100 nucleotides from transcription start site of the RNA polymerase III promoter. The distal sequence elements may be homologous (native) to the RNA polymerase III promoter, they may heterologous to the promoter or they may consist of a combination of elements that are homologous and heterologous to the promoter. In the DNA construct the distal sequence elements may be present in the same orientation or in the reverse orientation with respect to the RNA polymerase III promoter. The DNA construct may alternatively comprise elements in both orientations.

In a preferred a DNA construct according to the invention, the RNA polymerase III promoter is a promoter from a gene selected from: U6, 7SK, Y, MRP, Hl and telomerase RNA genes. Particularly preferred are the Hl and U6 promoters. Preferably, the promoter in the DNA construct is a mammalian, human or murine promoter.

The DNA constructs of the invention further may comprises one or more restriction sites (immediately) downstream of transcription initiation site of the promoter for insertion of a desired nucleotide sequence to be transcribed from the promoter. The restriction site is preferably located downstream of the initiation site such that a desired nucleotide sequence that is inserted into the restriction site will be operably linked to the promoter. Restriction site that is immediately down stream of the transcription initiation site will preferably be less than 10, 12, 15, 20, 25, 30 or 40 nucleotides from the initiation site. Preferably the restriction site is unique in the DNA construct in order to facilitate insertion of the desired nucleotide sequence.

A preferred DNA construct of the invention comprises a desired nucleotide sequence operably linked to the RNA polymerase III promoter. The desired nucleotide sequence preferably encodes an RNAi agent, i.e. an RNA molecule that is capable of RNA interference or that is part of an RNA molecule that is capable of RNA interference. Such RNA molecules are referred to as siRNA (short interfering RNA, including e.g. a short hairpin RNA). The desired nucleotide sequence comprises an antisense code DNA coding for the antisense RNA directed against a region of the target gene mRNA, and/or a sense code DNA coding for the sense RNA directed against the same region of the target gene mRNA. In the DNA constructs of the invention, the antisense and sense code DNAs are operably linked to one or more promoters as herein defined above that are capable of expressing the antisense and sense RNAs, respectively. "siRNA" means a small interfering RNA that is a short- length double-stranded RNA that are not toxic in mammalian cells (Elbashir et al, 2001, Nature 411: 494-98; Caplen et al., 2001, Proc. Natl. Acad. Sci. USA 98: 9742- 47). The length is not necessarily limited to 21 to 23 nucleotides. There is no particular limitation in the length of siRNA as long as it does not show toxicity. "siRNAs" can be, e.g. at least 15, 18 or 21 nucleotides and up to 25, 30, 35 or 49 nucleotides long. Alternatively, the double-stranded RNA portion of a final transcription product of siRNA to be expressed can be, e.g. at least 15, 18 or 21 nucleotides and up to 25, 30, 35 or 49 nucleotides long.

"Antisense RNA" is an RNA strand having a sequence complementary to a target gene mRNA, and thought to induce RNAi by binding to the target gene mRNA. "Sense RNA" has a sequence complementary to the antisense RNA, and annealed to its complementary antisense RNA to form siRNA. The term "target gene" in this context refers to a gene whose expression is to be silenced due to siRNA to be expressed by the present system, and can be arbitrarily selected. As this target gene, for example, genes whose sequences are known but whose functions remain to be elucidated, and genes whose expressions are thought to be causative of diseases are preferably selected. A target gene may be one whose genome sequence has not been fully elucidated, as long as a partial sequence of mRNA of the gene having at least 15 nucleotides or more, which is a length capable of binding to one of the strands (antisense RNA strand) of siRNA, has been determined. Therefore, genes, expressed sequence tags (ESTs) and portions of mRNA, of which some sequence (preferably at least 15 nucleotides) has been elucidated, may be selected as the "target gene" even if their full length sequences have not been determined.

The double-stranded RNA portions of siRNAs in which two RNA strands pair up are not limited to the completely paired ones, and may contain nonpairing portions due to mismatch (the corresponding nucleotides are not complementary), bulge (lacking in the corresponding complementary nucleotide on one strand), and the like. Nonpairing portions can be contained to the extent that they do not interfere with siRNA formation. The "bulge" used herein preferably comprise 1 to 2 nonpairing nucleotides, and the double-stranded RNA region of siRNAs in which two RNA strands pair up contains preferably 1 to 7, more preferably 1 to 5 bulges. In addition, the "mismatch" used herein is contained in the double-stranded RNA region of siRNAs in which two RNA strands pair up, preferably 1 to 7, more preferably 1 to 5, in number. In a preferable mismatch, one of the nucleotides is guanine, and the other is uracil. Such a mismatch is due to a mutation from C to T, G to A, or mixtures thereof in DNA coding for sense RNA, but not particularly limited to them. Furthermore, in the present invention, the double-stranded RNA region of siRNAs in which two RNA strands pair up may contain both bulge and mismatched, which sum up to, preferably 1 to 7, more preferably 1 to 5 in number. Such nonpairing portions (mismatches or bulges, etc.) can suppress the below-described recombination between antisense and sense code DNAs and make the siRNA expression system as described below stable. Furthermore, although it is difficult to sequence stem loop DNA containing no nonpairing portion in the double-stranded RNA region of siRNAs in which two RNA strands pair up, the sequencing is enabled by introducing mismatches or bulges as described above. Moreover, siRNAs containing mismatches or bulges in the pairing double-stranded RNA region have the advantage of being stable in E. coli or animal cells.

The terminal structure of siRNA may be either blunt or cohesive (overhanging) as long as siRNA enables to silence the target gene expression due to its RNAi effect. The cohesive (overhanging) end structure is not limited only to the 3' overhang, and the 5' overhanging structure may be included as long as it is capable of inducing the RNAi effect. In addition, the number of overhanging nucleotide is not limited to the already reported 2 or 3, but can be any numbers as long as the overhang is capable of inducing the RNAi effect. For example, the overhang consists of 1 to 8, preferably 2 to 4 nucleotides. Herein, the total length of siRNA having cohesive end structure is expressed as the sum of the length of the paired double-stranded portion and that of a pair comprising overhanging single- strands at both ends. For example, in the case of 19 bp double-stranded RNA portion with 4 nucleotide overhangs at both ends, the total length is expressed as 23 bp. Furthermore, since this overhanging sequence has low specificity to a target gene, it is not necessarily complementary (antisense) or identical (sense) to the target gene sequence. Furthermore, as long as siRNA is able to maintain its gene silencing effect on the target gene, siRNA may contain a low molecular weight RNA (which may be a natural RNA molecule such as tRNA, rRNA or viral RNA, or an artificial RNA molecule), for example, in the overhanging portion at its one end. In addition, the terminal structure of the "siRNA" is necessarily the cut off structure at both ends as described above, and may have a stem-loop structure in which ends of one side of double-stranded RNA are connected by a linker RNA (a "shRNA"). The length of the double-stranded RNA region (stem-loop portion) can be, e.g. at least 15, 18 or 21 nucleotides and up to 25, 30, 35 or 49 nucleotides long. Alternatively, the length of the double-stranded RNA region that is a final transcription product of siRNAs to be expressed is, e.g. at least 15, 18 or 21 nucleotides and up to 25, 30, 35 or 49 nucleotides long. Furthermore, there is no particular limitation in the length of the linker as long as it has a length so as not to hinder the pairing of the stem portion. For example, for stable pairing of the stem portion and suppression of the recombination between DNAs coding for the portion, the linker portion may have a clover-leaf tRNA structure. Even though the linker has a length that hinders pairing of the stem portion, it is possible, for example, to construct the linker portion to include introns so that the introns are excised during processing of precursor RNA into mature RNA, thereby allowing pairing of the stem portion. In the case of a stem- loop siRNA, either end (head or tail) of RNA with no loop structure may have a low molecular weight RNA. As described above, this low molecular weight RNA may be a natural RNA molecule such as tRNA, rRNA, snRNA or viral RNA, or an artificial RNA molecule.

To express antisense and sense RNAs from the antisense and sense code DNAs respectively, the DNA constructs of the present invention comprise a promoter as defined above. The number and the location of the promoter in the construct can in principle be arbitrarily selected as long as it is capable of expressing antisense and sense code DNAs. As a simple example of a DNA construct of the invention, a tandem expression system can be formed, in which a promoter is located upstream of both antisense and sense code DNAs. This tandem expression system is capable of producing siRNAs having the aforementioned cut off structure on both ends. In the stem-loop siRNA expression system (stem expression system), antisense and sense code DNAs are arranged in the opposite direction, and these DNAs are connected via a linker DNA to construct a unit. A promoter is linked to one side of this unit to construct a stem-loop siRNA expression system. Herein, there is no particular limitation in the length and sequence of the linker DNA, which may have any length and sequence as long as its sequence is not the termination sequence, and its length and sequence do not hinder the stem portion pairing during the mature RNA production as described above. As an example, DNA coding for the above-mentioned tRNA and such can be used as a linker DNA.

In both cases of tandem and stem-loop expression systems, the 5' end may be have a sequence capable of promoting the transcription from the promoter. More specifically, in the case of tandem siRNA, the efficiency of siRNA production may be improved by adding a sequence capable of promoting the transcription from the promoters at the 5' ends of antisense and sense code DNAs. In the case of stem-loop siRNA, such a sequence can be added at the 5' end of the above-described unit. A transcript from such a sequence may be used in a state of being attached to siRNA as long as the target gene silencing by siRNA is not hindered. If this state hinders the gene silencing, it is preferable to perform trimming of the transcript using a trimming means (for example, ribozyme as are known in the art). It will be clear to the skilled person that the antisense and sense RNAs may be expressed in the same vector or in different vectors. To avoid the addition of excess sequences downstream of the sense and antisense RNAs, it is preferred to place a terminator of transcription at the 3' ends of the respective strands (strands coding for antisense and sense RNAs). The terminator may be a sequence of four or more consecutive adenine (A) nucleotides.

Another embodiment of the present invention relates to a system for intracellularly expressing an siRNA library. siRNAs expressed by "siRNA library" of the present invention are composed of RNA strands comprising adenine, guanine, cytosine or uracil in any order and having a length of siRNA to be expressed or those encoded by (random) cDNA or genomic DNA fragments having a length of siRNA to be expressed as defined herein above. Herein, such siRNAs as described above are also referred to as "random siRNA." That is, "random siRNAs" used herein is composed of any sequences, or any sequences selected from specific cDNA sequences, sequences contained in a specific cDNA library, or genome sequences.

The "random siRNAs" in the siRNA library of the invention are basically the same as the above-decribed siRNA's, except that they contain any sequences, or any sequences selected from specific cDNA sequences, sequences included in a specific cDNA library, or genomic sequences, and composed of double-stranded RNAs of such short strands as expressing no toxicity in mammalian cells. However, the DNA constructs comprising the random siRNAs are in essence the same as described above. An siRNA library of the invention is thus basically a collection of the above-described DNA constructs wherein the constructs in the collection encode a different siRNAs from a collection of random siRNAs.

The RNA pol III promo ter-DNA constructs of the invention further preferably comprise a recognition sequence for a sequence-specific recombinase. The recognition sequence may be as defined above. Similarly, the construct may comprise a selectable marker as defined above.

In another aspect the present invention relates to a "kit" containing elements for use in the methods of the invention. Such a kit may comprise a carrier to receive therein one or more containers, such as tubes or vials. The kit may thus comprise DNA constructs and/or cells of the invention, which may be contained in one or more of the containers. The DNA constructs may be present in lyophilized form, or in an appropriate buffer. One or more enzymes or reagents for using the DNA constructs in restriction, ligation and/or amplification reactions may be contained in one or more of the containers. The enzymes or reagents may be present alone or in admixture, and in lyophilised form or in appropriate buffers. The kit may also contain any other component necessary for carrying out the present invention, such as buffers, culture media, enzymes, pipettes, plates, nucleic acids, nucleoside triphosphates, filter paper, gel materials, transfer materials, and autoradiography supplies. Such other components for the kits of the invention are known per se.

The term "comprising" is to be interpreted as specifying the presence of the stated parts, steps or components, but does not exclude the presence of one or more additional parts, steps or components. A nucleic acid sequence comprising region X, may thus comprise additional regions, i.e. region X may be embedded in a larger nucleic acid region. In addition, reference to an element by the indefinite article "a" or "an" does not exclude the possibility that more than one of the element is present, unless the context clearly requires that there be one and only one of the elements. The indefinite article "a" or "an" thus usually means "at least one". Description of the Figures

Figure 1 schematically illustrates the generation of isogenic stable cell lines by FIp- mediated homologous recombination.

Figure 2 schematically depicts four different hRNAHl polymerase III promoter constructs, three of which have additional Distal Sequence Elements (DSE) in various locations with respect to the promoter.

Figure 3 schematically depicts three different mU6 polymerase III promoter constructs, two of which have additional Distal Sequence Elements (DSE) in various locations with respect to the promoter.

Figures 4 and 5 present the results of transient transfection assays demonstrating the increased efficiency of knock down of lucif erase expression by improved versions of the human RNAse Hl promoter based RNAi vectors. The bars represent the results of transient transfection data in which decreasing amounts of the RNAi vectors (expression an RNAi molecule capable of inhibiting luciferase expression) were co- transfected with 100 ng of a CMV-luc expression vector. 48 hours after transfection luciferase activity was determined, corrected for transfection efficiency using renilla luciferase and expressed as % inhibition of luciferase activity compared to control which was set to 0%. In contrast to the control vectors (mtLuc), 25 ng of the improved RNAi vectors significantly repressed luciferase activity.

Examples 1. Example 1 1.1. Material and Methods 1.1.1 Plasmids

Expression vectors pcDNA5.1 FRT, pEF5/FR17V5-DEST, pTR6 and pOG44 were derived from Invitrogen (Invitrogen, USA). pSG5-FRT was created by insertion of a double stranded oligonucleotide in the EcoRI/Bglll restriction sites.

The sequence of these oligonucleotides is:

(forw: aattctaccATGgagaagttcctattccgaagttcctattctctagaaagtataggaacttca)

(revxtagagaataggaacttcggaataggaacttctccatggtaggatctgaagttcctatacttt).

The vector contained an in frame ATG start codon (capitals) directly in front of the FRT recombination site (underlined). A full-length blasticidin cDNA was isolated by PCR using the following primer set (forw: ttcagatctaatggccaagcctttgtctc; rev:ttcagatctcgtagcacgtgtcagtcc) and pTR6 as a template. The cDNA was cloned in frame with the ATG start codon in front of the FRT site using the BgIII restriction site creating pSG5 FRT BLAST.

A 226bp human RNAse HI promoter fragment was isolated by PCR on genomic DNA using the following primer combination (forw: ccatggaattcgaacgctgacgtc; rev: agatctgtggtctcatacagaacttataagattccc). The promoter fragment was cloned in pcDNA5FRT after removing the CMV promoter by Nrul/Nhel digestion and religation and removal of the BgIII restriction site by digestion, blunting and religation, creating pHI. As a result of the cloning strategy unique Bglll/Spel restriction sites are available for the insertion of double stranded hairpin oligonucleotides directly downstream of the RNAse Hl promoter transcription start site. To increase the efficiency of the gene knock down, pHI was modified as follows: a tandemcopy of a double stranded oligonucleotide encoding nucleotides -101 to -66 of the hRNAseHl promoter was dimerized and cloned in reverse orientation in front of the RNAseHI promoter This fragment encodes the distal enhancer of the RNAseHI promoter. This created construct p5HI. The following hairpin oligonucleotides were used to silence luciferase (5' ccc cgtacgcggaatacttcga ttcaagaga tcgaagtattccgcgtacg tttttggaaa 3'), a mutant luciferase control (5' ccc cttacgcggaatacttcga ttcaagaga tcgaagtattccgcgtaag tttttggaaa 3 '(changed nucleotides are underlined), RunX2 (5' ccc tcttcagcgcagtgacacc ttcaagaga ggtgtcactgcgctgaaga tttttggaaa 3') and a mutated RunX2 control (5' ccc tctgcagcgcagtgagacc ttcaagaga ggtctcactgcgctgcaga tttttggaaa 3' (changed nucleotides are underlined).

The pGL3 basic vector was derived from Promega. The FRT-site and the hygromycin resistance gene were isolated by PCR using the following primer set (forw. 5' cttccgatttagtgctttacgg and rev. 5' ctttttgtgatgctcgtcagg) and pcDNA5.1 FRT as a template. This fragment was cloned in the Sail restriction site of pGL3 basic which was blunted using the Klenow fragment of DNA polymerase creating pGL3 basic FRT. A 5604bp Fabp4 promoter fragment was cloned in the polylinker of this vector.

Using gateway cloning an fusion protein of the C2 domain of Protein Kinase C and YFP was inserted in pEF5/FRT/V5 dest (Sakai N., et al. 1997 J Cell Biol. 139(6): 1465-76).

All DNA constructs were sequence verified.

1.1.2 Cell culture

KS483 cells were cultured routinely in phenol red free ccMEM supplemented with 10% FCS and penicillin/streptomycin as described previously (van der Horst et al., 2002 Bone 31: 661-669) KSFrt host cell lines were kept in ccMEM supplemented with 10% FCS, penicillin/streptomycin and blasticidin S HCl (2 μg/ml; Invitrogen, USA), stable transfected KSFrt cell lines were kept in ccMEM supplemented with 10% FCS, penicillin/streptomycin and hygromycin B (100 μg/ml; Invitrogen).

1.1.3 Generation of KSFrt host cell lines

For generation of the KSFrt Host cell lines we adapted the manufacturer's protocol (Invitrogen). KS483 cells were seeded at a density of 9,500/cm² in a 6-wells plate, and transiently transfected with 1 μg of the pSG5 FRT Blast vector using Fugene™6 transfection reagent according to the manufacturer's protocol. 12hrs after transfection, fresh αMEM medium was added. One day later, selection of stable integrants was initiated by supplementation of the medium with blasticidin S HCl (2 μg/ml). One week later, single colonies were picked, and used for further characterization.

1.1.4 Flp-mediated recombination in KSFrt host cells

For generation of stable integrants in KSFrt cells, the host cells were seeded at a density of 9,500/cm² in a 6-wells plate, and transiently transfected with 100 ng of an FIp recombinase expression vector (pOG44) in combination with 1 μg of either the pcDNA5.1 FRT, the pEF5/FRT/V5 dest vector, or the pGL3 basic FRT vector or derivatives thereof. These 3 vectors contain an FRT site in frame with a crippled hygromycin B gene lacking an ATG start codon and a functional promoter. 12hrs after transfection, fresh αMEM medium was added. The cells were kept in this medium for 1 day, and then cells were selected in αMEM medium containing hygromycin B. In cells in which site-specific recombination had occurred at the FRT site, a functional hygromycin gene is reconstituted resulting in hygromycin resistant cells and loss of blasticidin resistancy. In contrast, random integration did not result in hygromycin resistance, since only an incomplete resistancy gene is integrated lacking a promoter and an ATG start codon. Two weeks of selection yielded an isogenic cell line. Site- specific integration in the genomic FRT site was routinely checked in all recombinant clones by Southern blotting. 1.1.5 Differentiation assays

For differentiation assays towards osteoblasts and adipocytes, KS483 cells were cultured as described earlier (van der Horst et al, 2003 Bone 33; 899-910). In brief, cells were seeded at a density of 12.000 cells/cm . For osteoblastogenesis, at confluence (day 4 after seeding), medium was supplemented with ascorbic acid and when nodules appeared (day 11 after seeding) with β-glycerol phosphate. At day 7 or 11 of culture, cells were lysed and ALP activity and DNA content were measured. At day 18, cultures were washed with PBS, fixed in 10% formalin in PBS and stained for alkaline phosphatase. Thereafter, ALP staining was removed and cultures were stained for mineralization with 2% Alizarin Red S.

For adipogenic differentiation, KS483 cells were cultured for 10 days in αMEM medium supplemented with 10% charcoal stripped FCS in the presence or absence of indomethacin (Dang et al. 2002 J. Bone Min. Res. 17: 394-405; van der Horst et al., 2003 Bone 33; 899-910). Cultures were washed with PBS and fixed with 10% formalin in PBS. Lipid droplets were stained with 0.3% Oil Red O.

To induce chondrogenic differentiation, 300.000 cells were pelleted by centrifugation in a polystyrene tube (Greiner) and cultured in 1 ml high-glucose DMEM (Gibco), supplemented with 40 μg/ml proline (Sigma), 100 μg/ml pyruvate (Sigma), 50 mg/ml ITS + premix (Becton Dickinson), 50 μg/ml ascorbic acid (Merck, inc), 10^"7 M dexamethasone, and 10 ng/ml TGFβ-3 (R&D systems). The medium was replaced every 3 to 4 days. After 28 days of culture, pellets were fixed, embedded in paraffin and sectioned. Sections were stained with toluidine blue or used in immunohistochemistry. In brief, sections were deparaffinized, hydrated and pre-treated for 30 min at 37⁰C with 2 mg/ml hyaluronidase (Sigma, St Louis, USA) in H₂O. As a primary antibody the mouse monoclonal IgGl for Collagen X (Quartett, Berlin, Germany) was used, and as a secondary antibody, biotinylated rabbit anti-mouse IgG (DAKO) was used. Subsequently, sections were incubated with horseradish peroxidase- conjugated streptavidin (Amersham, 1:200) at 37°C for 30 min. followed by AEC staining.

1.1.6 Luciferase and proliferation assays

Luciferase measurements were performed with the Dual-Luciferase Reporter assay (Pro mega) according to the protocol, using the Wallac 1450 Microbeta Trilux luminescence counter (PerkinElmer, Boston, USA).

For proliferation assays, the CellTiter 96^® AQueous Non-Radioactive Cell Proliferation Assay (Promega, Madison, WI, USA), was used. KS cells were seeded at a density of 2500/cm². At day 3, 20 μl of MTS was added to the medium and the mitochondrial activity was measured at 490 nm after 2 hr incubation at 37°C.

1.1.7 Transplantation assays and bio luminescent imaging

A suspension of 2,5 x 10⁵ KSFrt cells overexpressing luciferase (clone 4C3 or 4D3 EF lα- luciferase) was injected into the right tibia of nude mice as described previously (Wetterwald et al, 2002 Am. J. Pathol. 160; 1143-1153). In brief, two holes, distant 4 to 5 mm from each other and each with a diameter ~ 0.35 mm, were made through the bone cortex of the upper right tibia with a 25 GA needle. After space was created in the bone marrow by flushing out the bone marrow from the proximal end of the shaft, 2,5 x 10⁵ KSFrt/luciferase cells/10 μl PBS were slowly inoculated via a 30- gauge needle through the lower hole. Finally, the holes were sealed with surgical wax and the cutaneous wound was sutured. The progression of cell growth was monitored weekly by whole body bio luminescent reporter imaging (BLI). In brief, 2 mg D- luciferin (Perbio Science Nederland B.V., Etten-Leur, The Netherlands) was intra- peritoneally injected under anesthesia and the animals were transferred to a light-tight chamber and reference gray-scale body-surface images were taken using a CCD camera. Five minutes after administration of D-luciferin photon emission was measured using the Berthold NightOWL imaging system (back illuminated). Gray-scale images and bio luminescent images were superimposed using Einlight 32 software (Berthold technology, Bad Wildbad, Germany). The relative light intensity was visualized by pseudocolors. Values are expressed as relative light units (RLU).

1.1.8 Northern and Southern blots

RNA was isolated from clones at day 4 of culture using Trizol LS following the manufacturer's protocol (Invitrogen Life Technologies). The Northern Blot was performed as described earlier (Deckers et al., 2002 Endocrinology 143: 1545-1553). The full length RunX2 cDNA was used as a probe.

For Southern Blot analysis, 15 μg of genomic DNA was digested with either Xbal or EcoRI, electrophorized and blotted on Hybond N using standard techniques. The blot was hybridized with respectively a full-length hygromycin and blasticidin probe.

1.1.9 Bandshift assay

Bandshift assays were performed using whole cell extracts and a double stranded oligonucleotide encoding the RunX2 bindingsite (wild type 5' agcttgcaatcaccaaccacagcagagct; and mutant 5' agcttgcaatcaccagacacagcagagct) in the osteocalcin promoter as a probe as described earlier (Karperien et al., 1997 MoI. Endocrinol. 11;: 1435-1448).

1.1.10 Statistics

Values represent mean ± SEM. Differences were examined by one way analysis of variance (ANOVA) followed by the post-hoc least significant difference test (LSD). Results were considered significant at p< 0.05. 1.2 Results 1.2.1 Generation of KSFrt Host cell lines

To obtain a multipotent MSC-like cell line suitable for targeted insertion by FIp- mediated recombination, murine KS483 cells were stably transfected with pSG5 Frt Blast. We picked 48 blasticidin resistant clones and selected 19 clones for more detailed characterization. The clones displayed considerable variation in basal and BMP-induced ALP activity as well as in the formation of a mineralized bone matrix when cultured in osteogenic conditions, supporting the notion that stable transfections result in clonal variation. Subsequently, a Southern Blot using a full length blasticidin probe was performed to determine the number of FRT integration sites in the genome. Nine clones contained a single integration site, of which 3B2, 4C3 and 4D3 were selected for further characterization. The 3 Frt host clones were able to form alkaline phosphatase positive and mineralized bone nodules, fat droplets containing adipocytes and a cartilaginous matrix. There were, however, some remarkable differences between the clones. The 3B2Frt clone was indistinguishable from the parental KS483 cells in osteogenic and adipogenic culture conditions, whereas the amount of cartilaginous matrix deposition was increased. On the contrary, the basal amount of ALP positive and mineralized nodules was lower in the 4C3 clone, although BMP-induced differentiation was augmented. In addition, more adipocytes were found in both basal and indomethacin stimulated 4C3 cultures, whereas chondrogenic differentiation of 4C3 was similar to the parental KS483 cells.

The 4D3 clone displayed more ALP positive and mineralized nodules in basal conditions, which could still be induced by BMP-4. Basal adipogenic properties of the 4D3 clone did not differ from the wild type KS483 cells, while indomethacin induced adipogenesis was modestly increased. The amount of cartilaginous matrix was increased in 4D3, when compared to KS483 cells.

The differentiation characteristics and the phenotypic differences between the three host clones remained stable for at least 15 cell passages. It is likely that these differences are a direct consequence of the selection procedure and may be caused by the integration of the FRT cassette in different genomic regions involved in MSC differentiation. 1.2.2 Generation of isogenic stable Frt subclones

To determine the efficiency and reproducibility of the targeting procedure, the 3 KSFrt clones were cotransfected with the FIp expression vector and transgene constructs varying in size between 7 and 15 kb. Isogenic clones were generated and DNA was extracted and subjected to Southern blot analysis using a full length hygromycin probe. In all clones a single hybridizing DNA fragment of the expected molecular weight was observed, indicating the specific integration of the transgene in the genomic FRT site.

To test which promoter could drive suitable levels of overexpression, we compared a CMV and an EFl α promoter driven luciferase expression construct. Both promoters work equally well in transient transfection experiments using KS483 cells. The CMV-luc Frt lines expressed low levels of luciferase, in marked contrast to the EFlα-luc Frt clones, which expressed luciferase to a high extent. This is in line with data showing that the CMV promoter can undergo transcriptional inactivation in several tissues, whereas the EF lα promoter is capable of driving persistent gene expression (Loser et al, 1998 J. Virol. 72: 180-190; Gill et al, 2001 Gene Ther. 8: 1539-1546). Promoter activity remained stable over at least 10 cell passages.

Subsequently, we tested whether EF lα promoter activity could drive persistent expression of the luciferase reporter during the whole differentiation period of MSC- like KSFrt clones into various cell lineages. Luciferase activity remained constant at all stages of osteoblastic and adipogenic differentiation. However, during chondrogenic differentiation, luciferase activity decreased during the last two weeks of culture in clones 4C3 and 4D3, while the activity in 3B2 remained relatively constant. This demonstrates that the EF lα promoter could be used for persistent overexpression of genes during all stages of differentiation in the osteoblastic, adipogenic and chondrogenic lineage. It furthermore indicated the absence of positional effects on EFlα-promoter activity exerted by the genomic environment surrounding the integrated FRT cassette, at least in osteoblast and adipocyte differentiation. 1.2.3 The genomic FRT site can be used for gene function studies by overexpression

Next, we investigated whether the level of overexpression accomplished by a single copy of an EFlα-driven transgene inserted in the genomic FRT site was sufficient to elicit a biological effect. For this, stable Frt clones were generated that overexpressed the osteoblast specific transcription factor Runx2 (MASN splice variant). This gene was chosen since it has well defined effects on differentiation into the osteoblast, adipocyte and chondrocyte lineage (reviewed in (Komori 2003 J. Bone Miner. Metb. 21: 193-197; Kobayashi et al., 2000 Biochem. Biophys. Res. Commun. 273: 630-636). Northern Blot analysis showed abundant RunX2 transgene mRNA in the overexpressing clones. Interestingly, the endogenous message was low in the parental host cell lines and was marked upregulated in the RunX2 overexpressing clones in line with the described autoregulation of RunX2 expression (Drissi et al., 2000 J. Cell Physiol. 184: 341-350). The increased mRNA expression resulted in a 2 to 3 -fold overexpression of RunX2 protein in the 3 cell lines as shown by a bandshift assay.

Phenotypically, the 3 clones demonstrated a lower proliferation rate than the mock-transfected EF lα clones which served as control. Moreover, the RunX2 overexpressing cells displayed a cuboidal morphology in line with a more osteoblastic phenotype even in uninduced conditions. In osteogenic differentiation assays, the RunX2 clones demonstrated increased osteoblast differentiation as shown by a strongly increased level of ALP activity after 7 days, as well as by a strong increase in size and number of alkaline phosphatase positive and mineralized nodules after 18 days of culture.

When cultured in adipogenic culture conditions, RunX2 overexpression abolished adipocyte differentiation in both basal and indomethacin induced conditions. Instead there was abundant formation of osteoblastic bone nodules. In RunX2 overexpressing clones cultured in chondrogenic culture conditions, staining with toluidine blue, which is indicative for the cartilaginous matrix deposited by undifferentiated chondrocytes, was reduced. In contrast, only the overexpressing clones expressed collagen 10, which is a marker for differentiated chondrocytes. Advanced differentiation was in line with the larger cell volume observed in these clones, which is indicative for hypertrophic chondrocytes.

1.2.4 The genomic FRT site can be used for gene function studies using RNA interference

We next tested whether KSFrt clones could also be used for knock down studies using RNA interference. For this purpose, the CMV-promoter in the FRT targeting vector pcDNA5.1 FRT was replaced by a 226bp human RNAse Hl promoter capable of driving the expression of short hairpin RNAs (siRNA) (Brummelkamp 2002 Science 296: 550-553). This construct (pHl) was first tested using siRNA silencing luciferase mRNA (luc_sl). In transient trans fections, the luc_sl but not a mtluc_sl construct, significantly decreased luciferase expression dose-dependently with a maximal inhibition of 70%. However, when introduced as a single copy in the KSFrt clones no inhibition of luciferase activity was found when stable cells were transfected with a luciferase expression vector. To increase the efficiency of siRNA in the stable clones, we modified the siRNA vector by introducing a tandem copy of the distal enhancer of the human RNAse Hl promoter upstream of the promoter fragment. In transient transfection experiments in KS483 cells, this vector (p5Hl) was between 50 and 100- fold more potent in eliciting a knock down of luciferase expression. Co-transfection of p5Hl with a luciferase expression vector in ratios of 5:1, 1:1 and 0,25:1 knocked down luciferase activity by 75, 68 and 69%, respectively, compared to knock downs of 51, 18 and 4% by pHl. In KSFrt clones generated with the p5Hl vector that were transiently trans fected with 100 ng luciferase expression vector, the luc_sl clones efficiently reduced luciferase activity by 56, 64, or 40 % in respectively 3B2, 4C3 and 4D3 luc_sl. compared to the mtluc_sl clones. The mtluc_sl clones modestly inhibited luciferase activity. In these clones only one nucleotide mismatch was introduced. This construct may therefore still be able to elicit a small RNAi response.

Subsequently, we tested whether integration of a single copy of the p5Hl vector containing RunX2 siRNA in the genomic FRT site could silence the expression of the endogenous RunX2 gene in the 3 KSFrt clones. The effects were compared with a mtRunX2_sl construct in which two nucleotide mismatches at position 4 and 16 were introduced in the hairpin. As expected, the amount of RunX2 protein in the RunX2_sl clones was reduced as shown with a bandshift assay, while the morphology as well as the proliferation rate was not affected. The presence of two nucleotide mismatches efficiently abolished an RNAi response. In addition, osteoblastic differentiation was efficiently blocked in the RunX2_sl clones, but not in the mtRunX2_sl clones, as shown by decreased levels of ALP activity after 7 days and reduced numbers of alkaline phosphatase positive and mineralized nodules after 18 days of culture. In contrast to overexpression of RunX2, silencing of RunX2 did not affect adipogenic differentiation. These data indicated that genomic integration of 1 copy of the p5Hl vector could efficiently and sequence specific knock down expression of endogenous genes. 1.2.5 The genomic FRT site can be used for reporter studies

To study whether KSFrt cells could also be used for the generation of promoter reporter cell lines, a 5.6 kb fragment of the Fabp4 promoter was introduced in the pGL3 basic FRT vector. This fragment contained the whole promoter region of Fabp4. The resulting vector was subsequently used for the generation of an isogenic stable cell line in clone 4D3. No luciferase activity was measured in cells stably transfected with the promoter-less pGL3 basic FRT vector at different phases of adipogenic differentiation, demonstrating absence of leakage. As expected luciferase activity increased with adipogenic differentiation in 4D3 cells with the stable integration of the Fabp4 promoter fragment. Luciferase activity in this cell line was induced by addition of indomethacin (25 μM), which potently stimulates adipogenesis. These data demonstrate that the KSFrt cells can be used for the generation of lineage-specific promoter-reporter cell lines. To test whether KSfrt cells could be used for the imaging of signal transduction in living cells, an in frame fusion product consisting of the C2 domain of Protein Kinase C and yellow fluorescent protein (YFP) was cloned in pEF5/FRT/V5 dest and used for the generation of an isogenic stable cell line. Upon an increase in intracellular calcium concentrations, the C2 domain translocates from the cytoplasm to the cell membrane (Sakai N., et al. 1997 J Cell Biol. 139(6): 1465-76). Introduction of the C2- YFP construct in the genomic FRT site resulted in cells with a homogenous distrubution of fluorescence over the cytoplasm. Addition of ionomycin, which induces an influx of calcium, rapidly induced translocation of the C2-YFP fusion protein to the cell membrane. These data demonstrate that the KSFrt cells can be used for imaging of signal transduction events in living cells using fluorescence. 1.2.6. KSfrt cells can be used for transplantation experiments in nude mice

To examine whether the KSFrt model system could also be used for in vivo experiments, we conducted bone marrow ablation experiments using tibiae from Balb/C nu/nu mice. For this purpose bone marrow was ablated and 250,000 KSFrt cells overexpressing luciferase under control of the EF lα were injected in the bone marrow cavity. Luciferase activity was measured weekly using whole-body bio luminescent reporter imaging as described previously (Wetterwald et al., 2002 Am. J. Pathol. 160; 1143-1153). Luciferase activity increased during the first two weeks, and decreased thereafter. Very low levels of luciferase activity remained in the tibiae, indicating the stable incorporation of the KSFrt cells in bone. The increase in luciferase expression paralleled the sequential events during bone formation after bone marrow ablation. In brief, first a clot is formed, followed by capillary invasion of the cavity, the appearance of primitive mesenchymal cells, differentiation to osteoblasts, cancellous bone formation without a cartilaginous phase, reappearance of hematopoietic tissue, and ultimately osteoclastic bone resorption that precedes the appearance of regenerated normal bone marrow (Amsel et al., 1969 Anat. Rec. 164: 101-111; Patt et al. 1975 Exp. Hematol. 3: 135-148). Importantly, no bone tumors were found after 6 weeks using X- ray analysis. This experiment demonstrates that the KSFrt cells can be used for transplantation studies and that their fate can be followed by in vivo imaging. Table 1

Claims

1. A cell of the mesenchymal lineage comprising in its genome a recognition sequence for a sequence-specific recombinase.

2. A cell according to claim 1, wherein the recognition sequence for the recombinase is integrated in a genomic locus of the cell and wherein the genomic locus has at least 50% nucleotide sequence identity with a genomic sequence that is present 1 kb upstream and 1 kb downstream the construct comprising the FRT recombinase recognition sequence as present in a deposited cell line selected from KSfrt 3B2, KSfrt 4C3 and KSfrt 4D3.

3. A cell according to claims 1 or 2, wherein the cell comprises a single copy of the recognition sequence for the recombinase in its genome.

4. A cell according to any one of claims 1 - 3, wherein the recognition sequence is a recognition sequence for a recombinase selected from the yeast 2 micron plasmid FLP recombinase, the bacteriophage Pl Cre recombinase, the bacteriophage ΦC31 recombinase, the bacteriophage lambda int recombinase, the bacteriophage TP901-1 recombinase and the bacteriophage R4 recombinase.

5. A cell according to any one of claims 1 - 4, wherein the recognition sequence is comprised in a DNA construct that comprises a promoter capable of driving transcription in the mesenchymal cell and wherein the recognition sequence is present downstream of the promoter with respect to the direction of transcription from the promoter.

6. A cell according to claim 5, wherein the cell is a cell of a deposited cell line selected from DSM ACC2720, DSM ACC2721 and DSM ACC2722.

7. A cell according to any one of claims 1 - 7, wherein the cell comprises a vector integrated into a recognition sequence for the recombinase.

8. A cell according to claim 7, wherein the vector comprises a deficient selectable marker gene, the deficiency being restored only upon integration of the vector into the recognition sequence.

9. A cell according to claims 7 or 8, wherein the vector further comprises a nucleotide sequence encoding a desired polypeptide or a desired RNA molecule and wherein the nucleotide sequence is operably linked to a promoter capable of driving transcription of the nucleotide sequence in the cell.

10. A cell according to claim 9, wherein the nucleotide sequence comprises sequences coding for a reporter polypeptide, the expression of which may be visualized and/or quantified.

11. A cell according to claims 9, wherein the desired RNA molecule is an RNA molecule having sufficient complementarity to a target RNA expressed in the cell to effect RNA interference of the target RNA.

12. A cell according to any one of the preceding claims, wherein the cell is mesenchymal stem cell or mesenchymal progenitor cell.

13. A cell according to claim 12, wherein the cell is a murine cell.

14. A cell according to claim 13, wherein the cell is a KS438 cell or a descendant from the KS438 cell line.

15. A cell according to any one of claims 12 - 14, the cell is selected from:

(a) a cell of the adipocyte lineage;

(b) a cell of the chondrocyte lineage;

(c) a cell of the osteoblast lineage;

(d) a terminally differentiated adipocyte;

(e) a terminally differentiated chondrocyte; and,

(f) a terminally differentiated osteoblast and / or osteocyte.

16. A non-human animal comprising a cell as defined in any one of claims 8 - 15.

17. A set of at least two different cells as defined in any one of claims 8 - 15, whereby the different cells are isogenic except for the nucleotide sequence in the vector.

18. A method for determining the biological effect of expression of a nucleotide sequence on a cell as defined in claims 8 - 15, by comparing at least two different cells in a set as defined in claim 17.

19. A DNA construct comprising:

(a) a type 3 RNA polymerase III promoter; and,

(b) more than one distal sequence element of a type 3 RNA polymerase III promoter.

20. A DNA construct comprising according to claim 19, wherein the distal sequence elements are located in the DNA construct within 1000 nucleotides from the transcription start site of the RNA polymerase III promoter.

21. A DNA construct comprising according to claims 19 or 20, wherein the construct further comprises a restriction site downstream of transcription initiation site of the promoter for insertion of a desired nucleotide sequence to be transcribed from the promoter, whereby optionally the restriction site is unique in the DNA construct.

22. A DNA construct according to any one of claims 19 - 21, wherein the construct further comprises a desired nucleotide sequence operably linked to the promoter.

23. A DNA construct according to claim 22, wherein the desired nucleotide sequence encodes an RNA molecule that is an RNAi agent.

24. A DNA construct according to any one of claims 19 - 23, wherein the RNA polymerase III promoter is a promoter from a gene selected from the U6, 7SK, Y, MRP, Hl and telomerase RNA genes.

25. A DNA construct according to any one of claims 19 - 24, wherein the construct further comprises a recognition sequence for a sequence-specific recombinase.

26. A DNA construct according to claim 25, wherein the recognition sequence is a recognition sequence for a recombinase selected from the yeast 2 micron plasmid FLP recombinase, the bacteriophage Pl Cre recombinase, the bacteriophage ΦC31 recombinase, the bacteriophage lambda int recombinase, the bacteriophage TP901-1 recombinase and the bacteriophage R4 recombinase.

27. A collection of two or more DNA constructs as defined in claims 23 - 26, wherein the desired nucleotide sequences in the constructs encode different siRNAs from a collection of random siRNAs.

28. A cell according to any one of claims 8 - 15, wherein the vector is a DNA construct as defined in any one of claims 19 - 26.