WO2006116294A1 - A single ribozyme to catalyze both trimming and trans-acting catalysis - Google Patents
A single ribozyme to catalyze both trimming and trans-acting catalysis Download PDFInfo
- Publication number
- WO2006116294A1 WO2006116294A1 PCT/US2006/015443 US2006015443W WO2006116294A1 WO 2006116294 A1 WO2006116294 A1 WO 2006116294A1 US 2006015443 W US2006015443 W US 2006015443W WO 2006116294 A1 WO2006116294 A1 WO 2006116294A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- ribozyme
- sequence
- expression vector
- recombinant plasmid
- rna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1131—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/111—General methods applicable to biologically active non-coding nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/12—Type of nucleic acid catalytic nucleic acids, e.g. ribozymes
- C12N2310/122—Hairpin
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/12—Type of nucleic acid catalytic nucleic acids, e.g. ribozymes
- C12N2310/127—DNAzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/50—Methods for regulating/modulating their activity
Definitions
- a recombinant plasmid or expression vector encoding a cis- and trans-acting hairpin ribozyme is provided that produces an RNA transcript that undergoes self-catalyzed cleavage at the 5' and 3' sides of the ribozyme.
- HPVs Human papillomaviruses are small DNA viruses that induce hyperplasia of epithelial cells. HPVs have been well characterized and on a world-wide basis 20% of adult females are HPV positive (Koutsky, L.A. et al. 2002 N Engl J Med 347:1645-1651).
- HPVs such as types 16 and 18
- HPV- 16 type 16
- HPV- 16 the most common papillomavirus associated with cervical cancer
- Inhibition of p53 by E6 involves ubiquitin-mediated degradation of p53 and the consequent loss of p53 functions (Werness, B.A. et al. 1990 Science 248:76-79; Scheffner, M. et al. 1993 Cell 75:495-505).
- the E7 protein also .plays an important role in the viral life cycle by subverting the tight link between cellular differentiation and proliferation in normal epithelium, thus allowing viral replication in differentiating keratinocytes that would be otherwise be withdrawn from the cell cycle (Munger, K. et al. 2001 Oncogene 20:7888-7898).
- E7 protein from high-risk HPVs targets pRB107 and disrupts the E2F-mediated transcriptional regulation resulting in the up-regulation of genes required for Gl/S transition and DNA synthesis (Dyson, N. et al. 1989 Science 243:934-937; Duensing, S. et al. 2001 J Virol 75:7712-7716; Munger, K. & Phelps, W.C. 1993 Biochim Biophys Acta 1155:111-123).
- the combination of E6 and E7 activities cause genomic instability, cell immortalization and transformation leading to malignancy cancer (Pirisi, L. et al. 1987 J Virol 61:1061-1066; Duensing, S. & Munger, K.
- nucleic acids as biological catalysts (ribozymes) has been one of the most important advances in biochemistry. Progress has been obtained in understanding ribozyme reaction mechanisms, kinetics, active centers, conformational structure and minimal functional structures (Lilley, D.M. 1999 Curr Opin Struct Biol 9:330-338; Sun, L.Q. et al. 2000 Pharmacol Rev 52:325-347). The applications of small ribozymes have attracted considerable interest because of the potential methods for gene therapy through gene silencing (Birikh, K.R. et al. 1997 Eur J Biochem 245:1-16).
- ribozymes The extensively studied hammerhead and hairpin ribozymes are small cis-cleaving ribozymes found in some plant viroids and satellite RNAs. These ribozymes contain guide sequences that allow them to hybridize and subsequently cleave a specific substrate RNA. Furthermore, because ribozymes are catalytic they may bind other substrate molecules following cleavage of the first target. Such multiple turnover can result in more efficient inhibition (Kiehntopf, M. et al. 1994 EMBO J 13:4645-4652). Their small size and malleability make ribozymes excellent candidates as potential gene inhibitors. However, their eventual use will depend on whether they can be adapted to efficiently cleave substrates within the intracellular environment (Sullenger, B.A. 1995 ApplBiochem Biotechnol 54:57-61).
- the hairpin ribozyme is a 50 nt catalytic moiety derived from the minus strand of the satellite RNA associated with the tobacco ringspot virus (Haseloff, J. & Gerlach, W.L. 1988 Nature 334:585-591).
- the catalytic domain of hairpin ribozymes contains two short intramolecular helices (helix 3 and helix 4) that flank an internal loop (loop B) associated with the cleavage process.
- Ribozyme-substrate complex is stabilized by two intermolecular helices (helix I and helix II), flanking a symmetrical internal loop (loop A) containing the substrate cleavage site.
- ribozyme development as therapeutic agents has been their behavior within the intracellular environment. Variables such as nuclease sensitivity, target co-localization, endogenous ion concentration and ribozyme expression levels have hampered application of ribozymes as efficient therapeutic agents (Michienzi, A. & Rossi, JJ. 2001 Methods Enzymol 341:581-596). Nevertheless, ribozymes designed to cleave targets of HIV-I, HPV, HBV and several cellular genes have been successfully tested in vitro and in vivo (Taylor, N.R. & Rossi, JJ. 1991 Antisense Res Dev 1:173-186; Alvarez- Salas, L.M. et al.
- R434 ribozyme efficiently inhibits E6/E7 -mediated immortalization through the specific degradation of its mRNA when in cis-configuration (Alvarez-Salas, L.M. et al. 1998 Proc Natl Acad Sd U S A 95:1189-1194).
- the present work describes two effective triplex systems (TRL-5 and Rz434bis) directed against HPV-16 E6/E7 mRNA based on one or three hairpin ribozymes. Because of the modular structure of the hairpin ribozyme, the catalytic domain B can independently recognize cis or trans targets allowing the use of the same ribozyme for both trimming and therapeutic duties. Thus, one system was designed as a three-ribozyme unit in a canonical triplex using an inverted cleavage from one trimming ribozyme. The other used only one therapeutic ribozyme to self-release from the original transcript.
- a recombinant plasmid or expression vector includes a sequence encoding a 5' binding sequence containing a self-cleavage site, a cis- and trans-acting hairpin ribozyme and a target binding sequence, and a 3 1 binding sequence containing a self-cleavage site, which produces a RNA transcript that undergoes self-catalyzed cleavage at the 5' and 3' sides of the cis- and trans-acting hairpin ribozyme.
- a recombinant plasmid or expression vector encodes 1-100 units of a 5' binding sequence containing a self-cleavage site, a cis- and trans-acting hairpin ribozyme and a target binding sequence, and a 3' binding sequence containing a self- cleavage site, which produces an equivalent number of RNA transcripts connected in tandem that undergo self-catalyzed cleavage at the 5' and 3' sides of each cis- and transacting hairpin ribozyme.
- RNA transcripts self-cleaved at the 5' and 3' sides of the cis- and trans-acting hairpin ribozyme that involves subjecting the recombinant plasmid or expression vector to transcription conditions and allowing RNA transcripts to be self-cleaved.
- Another aspect of the invention includes a host cell transformed with the recombinant plasmid or expression vector.
- FIG. 1 A) Map of pTRL-5 plasmid. The relative positions of TRL, R434 and TRR ribozymes are shown within boxes. The arrow indicates the position and orientation of T3 promoter. Relevant restriction sites are marked. B) Map of pRz434bis plasmid. The relative positions of TR and TL target domains are shown within boxes.
- Figure 2 A) Secondary structure representation of full transcripts from pTRL-5 triplex system (SEQ ID NO: 1). The positions of R434 trans-acting ribozyme, mutant tRNAVal and trimming ribozymes TRL and TRR are shown.
- Figure 3 Schematic representation of triplex ribozyme processing.
- FIG. 4 Catalytic release of R434.
- A) Triplex ribozymes produced after in vitro transcription of Sad-linearized pTRL-5 and pRz434bis plasmids were purified through preparative gel electrophoresis. Eluted full transcripts TRL-R434-TRR and TL-R434-TR were incubated in RZ buffer for 0 to 120 min and loaded into analytical 6% polyacrylamide 7M urea denaturing gels. The position of full-length, intermediary and end-products is indicated by arrows.
- B) Triplex ribozymes produced from circular templates were incubated in RZ buffer as described above. Self-cleavage products were separated through 6% polyacrylamide 7M urea gels.
- FIG. 7 Triplex R434 cleavage of HPV-16 RNA.
- FIG. 10 In vivo processing of Rz434bis triplex cassette.
- C33-A cells were transiently transfected with plasmids pHl-Rz434bis, pHl-Rz434TR and pHl-Rz434ibis (containing the BamHI-SacI fragments from pRz434bis, Rz434TR and Rz434ibis, respectively) and harvested 48 hrs post-transfection. Total RNA was purified and incubated with a labeled antisense probes for pRz434bis (right panel) or human ⁇ -actin (left panel) in ribonuclease protection assays (RPAs).
- RPAs ribonuclease protection assays
- Rz434bis fragments were analyzed in 6% polyacrylamide-7M urea denaturing gels. Arrows indicate the relative migration of Rz434bis fragments and ⁇ -actin input control.
- IVP in vitro processed Rz434bis transcript.
- NT RNA from non-transfected cells.
- Probe intact labeled antisense Rz434bis probe.
- Control (+) RPA with unlabeled R434 transcript.
- RNase plus, Rz434bis antisense probe incubated with ribonucleases.
- RNase minus, Rz434bis antisense probe incubated with ribonuclease buffer only.
- FIG. 11 In vivo trans-cleavage of R434bis triplex cassette. SiHa cells were transiently transfected with plasmids pHl-R434bis, pHl-R434TR and pHl-R434ibis (containing the BamHI-SacI fragments from pR434bis, R434TR and R434i, respectively) and the reporter plasmid pCR3.1 GFP. Transfected cells were harvested 48 hrs post- transfection and sorted for GFP fluorescence by flow cytometry. Total RNA was purified and subjected to RT-PCR for HPV-16 E6 (upper panel) and human ⁇ -actin (lower panel). Amplicons were analyzed by 1.5% agarose gel electrophoresis.
- NT RNA from non- transfected cells. Control with no RNA (-RNA) and no reverse transcriptase (-RT) are indicated.
- HPV- 16 human papillomavirus type 16
- HPV- 16 human papillomavirus type 16
- engineered hairpin ribozymes R419 and R434 that caused down-regulation of HPV- 16 E6/E7 mRNA and inhibited growth of both HPV- 16 immortalized cells and tumor cells.
- R434 catalyzes both trimming and trans-acting catalysis, allowing for the individual activity of multiple ribozyme trans-acting units resulting in increased efficiency of degradation of E6 RNA when expressed from linear or circular templates.
- the release kinetics of the single hairpin ribozyme is slower than the canonical three-ribozyme cassette, the single hairpin ribozyme efficiently cleaves the target HPV- 16 mRNA.
- both systems have very similar cleavage kinetics even though the single hairpin ribozyme is performing two roles.
- duplex single hairpin ribozyme was more efficient in cleaving E6 than duplex R434 indicating that release of individual ribozymes enhances the kinetics of the single hairpin ribozyme.
- the use of a multimeric single hairpin ribozyme will ultimately result in a better in vivo E6/E7 mRNA degradation.
- a 5' block comprising a sequence encoding a 5' binding sequence containing a self- cleavage site
- a cis- and trans-acting ribozyme block comprising the sequence encoding a cis- and trans-acting hairpin ribozyme of interest and a target binding sequence
- a 3' block comprising the sequence encoding a 3' binding sequence containing a self-cleavage site.
- the 5' binding sequence is cleaved by the cis- and trans-acting ribozyme.
- the DNA sequence of the 5' binding sequence is ligated upstream of the cis- and trans-acting ribozyme block.
- the 3' binding site is also cleaved by the cis- and trans-acting ribozyme.
- the 3' binding site is located downstream of the cis-and trans-acting ribozyme block.
- RNA transcripts in vivo (yeast, plant cell, animal cell) as well as in vitro. Transcription starts at a transcription initiation site (+1) downstream of a promoter and moves in the 3' direction, optionally without stopping at the 3' end of the 3 ' block.
- the RNA transcript undergoes self-catalyzed cleavage at the 5' and 3' sides of the cis- and trans-acting ribozyme block and the resulting cis- and trans-acting hairpin ribozyme has substantially minimal extra sequences at both sides.
- the recombinant plasmid or expression vector is designed to produce the cis- and trans-acting hairpin ribozyme
- the recombinant plasmid can be used to produce various RNA transcripts such as silencing RNAs of various viruses and anti-sense RNAs simply by alternating the three blocks with a sequence of interest.
- Various promoters can be utilized as a promoter of the recombinant plasmid or expression vector.
- a suitable vector is one capable of producing an RNA transcript in various organisms and selected according to the organisms (e.g., plant, animal).
- a recombinant plasmid or expression vector can be designed to encode a number of various concatemeric units.
- a unit of the concatamer comprises a 5' block, a cis-and trans-acting hairpin ribozyme optionally embedded into a tRNA in order to stabilize the cis- and transacting ribozyme (herinafter referred to as cis-and trans-acting ribozyme/tRNA), and 3' block.
- the 5' and 3' blocks contain self cleavage sites that are cleaved by the cis- and trans-acting ribozyme/tRNA.
- the tRNA serves to stabilize the cis-and trans-acting ribozyme which cleaves an RNA target.
- the cis- and trans-acting hairpin ribozyme can be specially designed to target a specific RNA; each concatameric unit can be designed to target different RNAs.
- the recombinant plasmid or expression vector encoding various concatameric units targeted at different sites of the target RNA gene is therefore especially useful to target RNAs arising from microorganisms of a high mutation rate.
- the env gene of human immunodeficiency virus type 1 (HIV-I) and others are, for example, known to undergo mutation at a very rapid rate.
- the recombination plasmid may be used to cleave the RNAs of these viruses by simultaneously targeting various sites.
- the recombinant plasmid or expression vector containing the sequence encoding a cis- and trans-acting hairpin ribozyme can produce a cis-and trans-acting ribozyme substantially free of unwanted sequence at its 5' and 3' flanking region without digesting the plasmid or vector with restriction enzyme.
- the recombinant plasmid or expression vector does not require the time-consuming digestion step as in run-off transcription.
- the recombinant plasmid or expression vector can produce the cis- and trans-acting hairpin ribozyme in vivo as well as in vitro.
- the recombinant plasmid or expression vector can be amplified in vivo while producing the cis- and trans-acting hairpin ribozyme. Additionally, efficiency of cleavage of a covalently closed circular (ccc) form is far better than that of a linearized DNA, (i.e., run-off method). This is apparently because, in the case of a covalently closed circular form, transcription occurs by a rolling circle mechanism. As described above, the hairpin ribozyme is a 50 nt catalytic moiety derived from the minus strand of the satellite RNA associated with tobacco ringspot virus (Haseloff, J. and Gerlach, W.L. 1988 Nature 334:585-591).
- Ribozyme-substrate complex is stabilized by two intermolecular helices (helix I and helix II), flanking a symmetrical internal loop (loop A) containing the substrate cleavage site.
- the ribozyme binds to the target RNA through helix 1 (six base pairs) and helix 2 (four base pairs), separated by a NGUC loop in the substrate strand.
- the recognition sequence is bNGUC (SEQ ID NO: 4), where b is G, C, or U, N is any nucleotide, and cleavage occurs 5' to the G residue.
- the catalytic domain of hairpin ribozymes contains two short intramolecular helices (helix 3 and helix 4) that flank an internal loop (loop B) associated with the cleavage process.
- the triplex ribozymes of the present invention comprise a 5' binding sequence containing a self-cleavage site, a catalytic cis-and trans-acting ribozyme comprising a target RNA-specific binding site, and a 3' binding sequence containing a self-cleavage site.
- One example of such a triplex ribozyme is shown by its RNA content in Fig. 2B and SEQ ID NO: 2.
- the nucleotides numbered 1-267 encode the triplex ribozyme. This includes the 5' binding sequence containing a self-cleavage site (33 bases), the catalytic ribozyme protected by a tRNA (175 bases), and the 3' binding sequence containing a self-cleavage site (59 bases).
- the invention provides ribozymes that have the unique characteristic of being target RNA-specific in their catalytic action.
- the target RNA specificity is conferred by an RNA binding site that specifically binds a sequence that is unique to human papillomavirus type 16 (HPV- 16) E6 and E7 mRNA.
- HPV- 16 human papillomavirus type 16
- an RNA sequence unique for any RNA can be the target of the present target RNA-specific ribozyme.
- the determination of unique sequences is routine given the availability of numerous computer databases (GenBank) and computer programs (Genetics Computer Group, PCGENE and BLAST) which can search for and find any matches between nucleic acid sequences. A unique DNA sequence located on one of the databases will have a corresponding unique RNA sequence.
- One example of the catalytic sequence of the present ribozyme is also shown as its
- Other catalytic sequences include those known in the art. A number of sequence variations have defined permissible nucleotide alterations in "stem” regions. Those skilled in the art will understand that any catalytic sequence, even those not yet discovered, can be used to construct a ribozyme of the invention when it is routinely combined with the autocatalytically cleaving ribozyme and RNA binding site as described herein.
- the 5' and 3' binding sequences are important for the expression of the catalytic ribozyme, because they permit the ribozyme to be cleaved from the ribozyme transcript as soon as it is transcribed to produce a catalytic ribozyme having substantially minimal extraneous 5' or 3' sequences.
- the target-specific binding site and the catalytic sequence that comprises the catalytic ribozyme are in the correct configuration to bind and cleave the target RNA.
- the extraneous sequences in the exemplified constructs are the result of the cloning procedure. It is understood that with the selection of an alternative cloning scheme some or all of these extraneous nucleotides can be eliminated.
- the invention also provides nucleic acids which encode the ribozymes of the invention. These nucleic acids can be used to express the ribozymes of the invention at the selected site.
- the site can be tissue-specific in the case of treating tissue-specific cancers, or it can be target-specific in the case of ribozymes that prevent replication of infectious agents to treat infection (e.g. papillomavirus, hepatitis, herpes, malaria, tuberculosis, etc.).
- the nucleic acids of the invention comprise a tissue-specific or non-tissue-specific promoter binding site upstream from a sequence encoding a 5' binding sequence containing a self-cleavage site, a catalytic cis- and trans-acting ribozyme comprising a target RNA- specific binding site, and a 3' binding sequence containing a self-cleavage site.
- the tissue-specific promoter binding site in the ribozyme-producing construct results in tissue-specific expression of the ribozyme in tissue(s) that actively transcribe RNA from the selected promoter. Thus, only the target RNA in tissue that utilizes the promoter will be cleaved by the ribozyme.
- the non-tissue-specific promoter results in non- tissue-specific expression and includes virus-specific promoters, such as a cytomegalovirus (CMV) promoter, and RNA polymerase III promoters.
- CMV cytomegalovirus
- RNA polymerase III promoters RNA polymerase III promoters.
- tissue-specific and non-tissue-specific promoters can be used in the present nucleic acid constructs. Examples of these promoters are known to those skilled in the art.
- target-specific promoters not yet identified can be used to target expression of the present ribozymes to the selected tissue(s) and non-tissue-specific promoters not yet identified can be used to express the present ribozymes.
- tissue-specific promoter and non-tissue-specific promoter Once a tissue- specific promoter and non-tissue-specific promoter is identified its binding sequence can be routinely determined by routine methods such as sequence analysis. The promoter is defined by deletion analysis, mutagenesis, footprinting, gel shift and transfection analyses.
- the nucleic acid encoding the 5' binding sequence containing a self-cleavage site of nucleotides 1-59 is shown in Fig. 2B and SEQ ID NO: 2.
- the nucleic acid encoding the 3' binding sequence containing a self-cleavage site of nucleotides 235-267 is shown in Fig. 2B and SEQ ID NO: 2.
- the present nucleic acid encodes a catalytic ribozyme that contains two separable functional regions: a highly conserved catalytic sequence which cleaves the target RNA (also known as the "catalytic core"), and flanking regions which include a target RNA- specific binding site.
- a catalytic ribozyme that contains two separable functional regions: a highly conserved catalytic sequence which cleaves the target RNA (also known as the "catalytic core"), and flanking regions which include a target RNA- specific binding site.
- the binding site directs the ribozyme core to cleave a specific site on the target RNA molecule.
- flanking sequences have implications not only for specificity, but also for the cleavage efficiency of the individual ribozyme molecules, hi the present catalytic ribozyme, the flanking sequences are highly specific for the target RNA, yet allow ready dissociation from the target RNA once cleavage occurs. This permits cycling of the ribozyme and reduces the amount of ribozyme required to be effective.
- the complexity of human RNA is about 100 fold lower than that for human DNA, and specificity can be achieved with as few as 12-15 base pairs.
- the stability of the RNA- RNA duplex is affected by several factors, such as GC content, temperature, pH, ionic concentration, and structure. Rules known to those in the art can provide a useful estimate of the stability of the duplex.
- the encoded RNA binding site is unique, so the encoding nucleic acid sequence will be the corresponding unique DNA sequence.
- the RNA binding site can comprise a sequence that binds to a HPV- 16 E6 and E7 mRNA.
- the HPV- 16 E6 and E7 binding site encoding RNA can have the sequence shown in Fig. 2B.
- the catalytic ribozyme of the invention also includes a catalytic sequence, which cleaves the target RNA near the middle of the site to which the target RNA-specif ⁇ c binding site binds, hi the hairpin type of ribozyme, the catalytic sequence is generally highly conserved.
- the conserved catalytic core residues are (SEQ ID NO: 3):
- RNA The most conserved and probably most efficiently cleaved sequence on the target RNA is 5' GUC 3'. Such cleavage sites are ubiquitous in most RNAs allowing essentially all RNA's to be targeted.
- target site secondary structure can have an effect on cleavage in vitro.
- the selected target molecule's sequence can be routinely screened for potential secondary structure, using the program RNAFOLD (from the PCGENE group of programs or available on the Internet).
- RNAFOLD from the PCGENE group of programs or available on the Internet.
- the catalytic ribozyme can be targeted to non-cellular RNAs necessary for growth of parasites, virus life cycles, etc., and expression can be driven with tissue-specific or non- tissue-specific promoters.
- nucleic acid of the invention has the nucleotides encoding the sequence shown as SEQ ID NO: 2.
- This exemplary nucleic acid includes a bacterial promoter, upstream from a sequence that encodes the 5' binding sequence containing a self- cleavage site having the sequence shown in SEQ ID NO: 2, the cis- and trans-acting hairpin ribozyme shown in SEQ ID NO: 2, the target binding site encoding RISfA having the sequence shown in SEQ ID NO: 2, and the 3' binding sequence containing a self- cleavage site having the sequence shown in SEQ ID NO: 2.
- nucleic acid having substantially the nucleotide sequence that encodes the ribozyme shown in SEQ ID NO: 2 is provided.
- the nucleic acid can vary based on the characteristics/definition of the target chosen, and will have 85%-99% sequence identity with the nucleotide sequence that encodes the ribozyme shown in SEQ ID NO: 2, more preferably, it will have 95%-99% sequence identity with the nucleotide sequence that encodes the ribozyme shown in SEQ ID NO: 2.
- modifications could include for example, substitutions (or deletion or addition) of nucleotides inserted for cloning purposes and linkers.
- the unpaired bases can be any base, determined only by the cloning scheme chosen. If one of the bases of a pair is changed, the other must be changed in a complementary fashion.
- the ribozyme-coding sequence can be altered in ways that modify the ribozyme sequence, but do not affect the ribozyme' s target RNA-specif ⁇ city or negate its cleavage activity.
- the cis- and trans-acting catalytic ribozyme may be incorporated into other constructs while maintaining catalytic activity. Industrial Applicability Thus, this invention has several applications.
- the self-cleavable ribozymes of the present invention have utility for RNA-targeted gene therapy in both plants and animals to down-regulate endogenous gene expression by cleaving mRNA transcripts produced by a gene of interest.
- the self-cleaving ribozymes of the present invention can be used to target and cleave viral RNA in order to inhibit the replication cycle of viruses such as HIV.
- the self-cleavable ribozymes of the present invention can also be used to inhibit expression of genes belonging to other infectious agents, including viruses, bacteria and protozoa, or genes whose products have deleterious effects on an organism in particular situations (e.g., inflammation in autoimmune diseases, vascular restenosis after angioplasty, defective metabolic enzymes such as the alpha-1-antitrypsin).
- the present invention also has application to genes involved in the control of cell growth and differentiation. These genes include those of cell cycle regulators (cyclins, cyclin dependent kinases), growth factors, growth factor receptors and second messengers, and the present invention has particular utility for the inhibition of oncogenes.
- a vector comprising DNA encoding the self-cleavable ribozymes of the present invention can be delivered to an appropriate location in a living organism, e.g., particular organs or cell types, and the DNA incorporated in the vector can be expressed.
- the self-cleavable ribozyme Upon expression, the self-cleavable ribozyme is cleaved into its individual monomeric units, and at least one of the monomeric units recognizes and cleaves a transcript including the target recognition sequence comprising the ribozyme cleavage site transcribed from the gene of interest or a portion thereof.
- the transcript is cleaved and expression of the gene is down-regulated or inhibited.
- RNA binding and core sequences are synthesized as reverse complementary oligonucleotides and are cloned into a vector that will allow production of the relevant RNA containing the ribozyme.
- the present ribozymes are prepared by synthesis of an oligonucleotide and its reverse complement. A restriction site is used in cloning. Following appropriate restriction digestion, the double-stranded DNA oligonucleotide is cloned into the cloning site within the parent vector. Functional Testing
- these ribozymes are functionally tested.
- the test can involve transcription of the ribozyme using bacterial promoters, e.g., T3, SP6 or T7, (in the presence of trace amounts of radioactivity) followed by evaluating the autocatalytic cleavage of the ribozyme by electrophoresis. Data from these tests are provided herein.
- Additional testing procedures encompass incubation of in vitro transcribed ribozymes with in vitro synthesized target RNA transcript or with cytoplasmic RNA preparations. Following incubations, RNAs are examined by standard SDS PAGE and autoradiography analyses to verify specific degradation of target RNA transcripts. Data from these tests are provided herein.
- the ribozymes of the invention can be further tested by subcloning behind a tissue-specific promoter that will drive expression of the vector in a tissue-specific manner or behind a non-tissue-specif ⁇ c promoter.
- the ribozyme experimental approach of this invention is further validated by doing in vivo studies in mice and, ultimately, in humans. Delivery
- the nucleic acids of the invention can be in a vector for delivering the nucleic acid to the site for expression of the ribozyme.
- the vector can be one of the commercially available preparations.
- Vector delivery can be by liposome, using commercially available liposome preparations or newly developed liposomes having the features of the present liposomes. Other delivery methods can be adopted and routinely tested in methods known to those skilled in the art.
- the modes of administration of the liposome will vary predictably according to the disease being treated and the tissue being targeted. For lung (e.g., tuberculosis, cancer) and liver (e.g., hepatitis and cancer) which are both sinks for liposomes, intravenous administration is reasonable.
- catheterization of an artery upstream from the organ is a preferred mode of delivery, because it avoids significant clearance of the liposome by the lung and liver.
- lesions at a number of other sites e.g., skin cancer, human papillomavirus infection, herpes (oral or genital) and precancerous cervical dysplasia
- topical delivery is expected to be effective and may be preferred, because of its convenience.
- Leukemias and other conditions, such as malaria may also be more readily treated by ex vivo administration of the ribozyme.
- the liposomes may be administered topically, parenterally (e.g., intravenously), by intramuscular injection, by intraperitoneal injection, transdermally, excorporeally or the like, although IV or topical administration is typically preferred.
- parenterally e.g., intravenously
- intramuscular injection by intraperitoneal injection, transdermally, excorporeally or the like
- topical administration is typically preferred.
- the exact amount of the liposomes required will vary from subject to subject, depending on the species, age, weight and general condition of the subject, the severity of the disease that is being treated, the particular compound used, its mode of administration, and the like. Thus, it is not possible to specify an exact amount. However, an appropriate amount may be determined by one of ordinary skill in the art using only routine experimentation given the teachings herein. Generally, dosage will approximate that which is typically given in antisense methodology
- hijectables can be prepared in conventional forms, either as liquid solutions or suspensions, solid forms suitable for solution or suspension in liquid prior to injection, or as emulsions.
- a more recently revised approach for parenteral administration involves use of a slow release or sustained release system, such that a constant level of dosage is maintained.
- Topical administration can be by creams, gels, suppositories and the like.
- Ex vivo (excorporeal) delivery can be as typically used in other contexts. Further, the effect of the present invention can also be obtained by incorporating the
- transgenic Animals The invention provides a transgenic non-human animal, containing, in a germ or somatic cell, a nucleic acid comprising a target-specific or RNA polymerase III promoter binding site upstream from a sequence encoding 5' binding sequence containing a self- cleavage site, a catalytic ribozyme comprising a target RNA-specific binding sequence, and a 3' binding sequence containing a self-cleavage site, wherein the animal expresses a 5' binding sequence containing a self-cleavage site, a catalytic ribozyme comprising a target RNA-specific binding sequence, and a 3' binding sequence containing a self-cleavage site.
- the nucleic acid can be the nucleic acid shown in the figures.
- silent base substitutions in the ribozyme encoding sequence can be made that express the same ribozyme.
- these substitutions can be as described above.
- the transgenic non-human animal of the invention is useful, because the animal does not express a phenotype associated with the target RNA ⁇ e.g., with the protein it encodes).
- phenotype includes morphology, biochemical profiles ⁇ e.g., changes in amounts of RNA or protein expressed, etc.) and other parameters that are affected by the knockout. For example, cell death of otherwise healthy cells can be a measure of altered phenotype resulting from ribozyme expression.
- the present ribozymes can be expressed in a transformed cell line.
- the transformed cell can be used to validate both the specificity of the ribozyme's expression and the specificity and cleavage activity against the target RNA. Examples of such a screening function are known in the art. Screening Methods
- the transgenic animals and transformed host cells of the invention can be used in a method of screening a compound for its ability to cause the animal or host cell to express a phenotype associated with the target RNA.
- the method requires administering the compound to the animal/cell and assessing the compounds ability to cause expression of the phenotype. If the phenotype is restored, the compound is considered to be effective.
- an L-dopa functional knockout transgenic animal can be made and used to screen for drugs that restore an L-dopa associated phenotype. Treating Proliferative Diseases
- a method of treating a subject having a proliferative disease is provided.
- the treatment is carried out by inhibiting cell proliferation, and this is accomplished by administering to the subject a nucleic acid encoding a ribozyme that is targeted to an RNA that is essential to cell growth.
- the ribozyme encoded by the nucleic acid is expressed, production of an essential RNA is inhibited, cell proliferation is inhibited, cell death ensues and the proliferative disease treated.
- the invention provides a method of treating a subject having cervical cancer comprising administering to the subject the nucleic acid encoding SEQ ID NO: 2, whereby the ribozyme encoded by the nucleic acid is expressed in the cervix and the cervical cancer is treated. Treating Viral Infection
- a method is provided of treating a viral infection in a subject, comprising administering to the subject a nucleic acid of the invention, wherein the encoded target RNA-specific binding site is specific for an RNA unique to the infectious agent, whereby the ribozyme encoded by the nucleic acid is expressed and the infectious agent is killed.
- Transcription can be driven using a non-tissue-specific promoter or a tissue-specific promoter which will selectively express the targeted ribozyme in virus-infected tissue, e.g., using the liver-specific albumin promoter for expression of a targeted ribozyme directed against hepatitis B virus.
- ribozyme expressing cell lines can be compared with their ribozyme negative counterparts for their ability to support viral infection/replication/yield. In a manner similar to that described above, ribozyme expressing cell lines can be obtained and assayed; and in all cases the abilities of the ribozyme to prevent infection can be determined.
- Triplex ribozymes focused on the human papillomavirus type 16 THPV- 16) E6/E7 mRNA It is acknowledged that human papillomaviruses (HPV) are the primary agent associated with cervical carcinomas. The life cycle of HPVs progresses with epithelial differentiation and may persist for decades.
- the E6 and E7 genes are responsible for two viral proteins that target p53 and Rb.
- the persistence of E6 and E7 in cervical carcinomas has led to them being recognized as the hallmark of cervical carcinoma and makes them excellent targets for therapy.
- R434 engineered hairpin ribozyme
- TRL-5 ribozyme expression systems (TRL-5) entirely based on cis-cleaving (trimming) hairpin ribozymes (triplex system) that release R434 from long transcripts.
- the R434bis system was designed to use a single R434 ribozyme to catalyze both trimming and trans-acting activities. This procedure resulted in a reduced-size triplex system that uses R434 catalytic domain to self-excise itself.
- RNA from R434bis and TRL-5 templates released R434 by a self-processing mechanism thus allowing for the individual activity of multiple trans-acting ribozymes.
- Both Rz434bis and TRL-5 systems produced an increased cleavage efficiency of HPV-16 target site nt 410 to 445 when expressed from linear or circular templates.
- duplex Rz434bis and TRL-5 were more efficient in cleaving E6 than duplex single R434. The use of triplex configurations with multi-target ribozymes will ultimately result in a better in vivo HPV- 16 E6/E7 mRNA degradation. Self-processing of the triplex ribozyme system
- the first system (pTRL-5) consisted of three hairpin ribozymes in a typical triplex configuration containing the R434 therapeutic ribozyme flanked by two trimming ribozymes (Fig. 2A).
- the trimming ribozymes TRL and TRR would release R434 by cis-cleavage.
- TRR must turn 180° at the 3' end to hybridize with the target strand (containing the scissile 5'-GUC-3').
- Such capacity has not been previously reported for hairpin ribozymes.
- the other system (pRz434bis) is a smaller RNA containing only one ribozyme
- Cis-cleavage specificity was established by using hairpin target 5'-GUC-3' sites contained in A domains lacking of catalytic domains flanking R434. This design would likely divert some R434 activity from the HPV- 16 target but greatly reduces the size of the triplex cassette leading to simpler secondary structures and easier cloning of multiple units (Fig. 2B).
- the self-cleavage process for the transcript produced by Sacl-linearized pTRL-5 templates would yield three end-products including R434 protected by a mutant tRNAVal (175 nt), plus TRL and TRR (89 and 70 nt, respectively).
- the full transcript TRL-R434- TRR (334 nt) and intermediary products TRL-R434 and R434-TRR (264 and 245 nt, respectively) may be also present as a part of the self-cleavage process (Fig. 3).
- transcripts from covalently closed circled (ccc) pTRL-5 and pRzR434bis templates were processed in cleavage reactions.
- the TRR and TR fragments and their associated intermediary products are linked to long transcripts and thus the corresponding bands would be absent from the electropherograms.
- the bands corresponding to the full-length transcripts from pTRL-5 and pRz434bis are also linked to long transcripts of undefined size leading to thick bands.
- bands corresponding to TRL-434, R434 and TRL products for pTRL-5 and TL- R434, R434 and TL for pRz434bis were clearly visible after 15min.
- DTR434 had the highest activity
- DR434bis presented the highest increase in cleavage activity relative to the single unit cassette (Table 1). This may reflect the advantage of using only one ribozyme to perform both trimming and therapeutic activities. Therefore, multiple triplex hairpin systems based on one or three ribozymes can be readily adapted to express several ribozymes against the same or different targets to result in increased overall cleavage activity.
- hairpin ribozyme application is best suited for viral delivery with the associated problems of expression and stability.
- powerful promoters have been used to improve ribozyme expression in vivo, there is a need to increase the amount of ribozyme produced and therefore novel expression systems are required.
- TRL-5 design held a typical triplex layout with two trimming ribozymes flanking R434 and required positioning of the target site 3' of the catalytic domain.
- Rz434bis cassette used a single ribozyme to perform both cis and trans-cleavage duties.
- Such designs are based on the modular nature of hairpin ribozymes that can form catalytic four-way junctions with isolated domains (Shin, C. et al. 1996 Nucleic Acids Res 24:2685-2689; Komatsu, Y. et al. 1997 Biochemistry 36:9935-9940; Walter, F. et al. 1998 Biochemistry 37: 17629-17636).
- TRL-5 and Rz434bis systems successfully released R434 resulting in increased R434 trans-cleavage efficiency when cloned in tandem.
- TRL-5 and Rz434bis designs displayed similar behaviors relative to each other and to previously reported triplex systems based on trimming hammerhead ribozymes (Yuyama, N. et al. 1994 Nucleic Acids Res 22:5060-5067; von Weizsacker, F. et al. 1992 Biochem Biophys Res Commun 189:743- 748). Nevertheless, the size constraints associated with the use of hairpin ribozymes should be considered when constructing multi-target systems.
- single-ribozyme triplex designs (such as Rz434bis) has advantages compared to three-ribozyme designs because it can be expected that the variables affecting cleavage of a single ribozyme can be better controlled in vitro and in vivo.
- tandem copies of Rz434bis cassette presented almost the same cleavage activity as triple-ribozyme tandems of TRL-5, suggesting that the use of several hairpin ribozymes can surpass trimming diversion allowing efficient trans- cleavage.
- the synergistic cleavage activity obtained with the triplex systems implies the possibility of using a cassette that would be more efficient than their non-triplex counterparts.
- the first triplex system using a single hairpin ribozyme to perform trimming and therapeutic activities is described. Therefore, implementation of the triplex systems that significantly enhanced R434 in vitro activity is proposed as an alternative to the antisense oligodeoxynucleotide treatment of cervical cancer.
- Plasmid pBtV5-434 contains the R434 ribozyme flanked by a mutated tRNAVal and a tetraloop cloned into the BamHFXhoI and Mlul/Sacl sites of pBtVl-434 plasmid, respectively (Alvarez-Salas, L.M. et al. 1998 Proc Natl Acad Sd U S A 95:1189-1194).
- Triplex ribozyme expression plasmid pTRL-5 was constructed by cloning the double stranded oligodeoxyribonucleotides (dsODN) 5'-
- Plasmid pRz434bis contains the pBtV5-434 expression cassette (tRNA Val -R434-tetraloop) flanked by the cis-cleavage domains TL (5'- AATTCAAACAGAGAAGTCAACCATGGTACCTCCTGACAGTCCTGTTTA-S') (SEQ ID NO: 7) and TR (5'-
- Plasmid pRz434TR was made by inserting the dsODN 5'- CGCGTGACAAAACTGTTTCCTCCAAACAGAGAAGTCAACCAGAGCT-S ' (SEQ ID NO: 9) (containing a mutation in the cleavage site 5'-GUC-3' of the TR domain) into the MluiySacI sites of pRz434bis.
- the pRz434ibis plasmid contains the inactive variant R434i in the Xhol and MM sites of pRz434bis.
- R434i has a triple nucleotide substitution (A 24 A 25 A 26 -»G 24 C 25 U 26 ) in the catalytic domain of R434 rendering it unable to cleave the target (Alvarez-Salas, L.M. et al. 1998 Proc Natl Acad Sd U S A 95:1189-1194).
- the duplex constructs pDR434, pDTR434 and pDR434bis contain two tandem copies of R434, TRL-5 and Rz434bis expression cassettes cloned in the pBSKS- vector (Stratagene, La Jolla CA), respectively.
- AU plasmids were manually sequenced prior to in vitro transcription experiments using Sequenase V.2.0 (Amersham Biosciences, Piscataway NJ). In vitro transcription
- Plasmid minipreps from template plasmids were linearized with the Sad restriction endonuclease and purified by phenol-chloroform-isoamyl alcohol (25:24:1) extraction.
- One ⁇ g of linearized plasmid DNA was incubated with the T3 RiboProbe in vitro transcription system (Promega Inc., Madison WI) in the presence of (X-[ 32 P]-UTP (3000Ci/mmol, Amersham Pharmacia Biotechnologies Inc.), as described by the manufacturer.
- Labeled transcripts were loaded into preparative 6% polyacrylamide 7M urea denaturing gels and electrophoresed at 250V. Dried gels were exposed to X-OMAT radiographic films (Kodak Inc., NJ).
- fragments were excised from the gels and eluted in 350 ⁇ l of E buffer (ImM EDTA, 0.5M ammonium acetate, 0.1% SDS, 2OU RNaseA inhibitor) overnight at 4°C.
- E buffer ImM EDTA, 0.5M ammonium acetate, 0.1% SDS, 2OU RNaseA inhibitor
- RNA In vitro transcribed ribozyme RNA was incubated with a radiolabeled and purified target RNA containing HPV- 16 nt 410-445 in RZ buffer at 37°C, as previously described (Alvarez-Salas, L.M. et al. 1998 Proc Natl Acad Sd U S A 95:1189-1194). Cleavage products were separated through denaturing polyacrylamide gel electrophoresis. For circular templates, one ⁇ g of plasmid DNA was incubated directly with the T3 RiboProbe system for 30 min before addition of labeled target RNA.
- the HPV-16-free cervical carcinoma cell line C33-A was transfected with Rz434bis, Rz434TR and Rz434ibis cassettes cloned in the pSilencer 3.0-H1 expression vector ( ⁇ Hl-R434bis, pHl-R434TR and pHl-R434ibis, respectively) and total RNA was analyzed by ribonuclease protection assays (RPA) 48 hrs post-transfection.
- RPA ribonuclease protection assays
- RNA from cells transfected with ⁇ Hl-Rz434bis, ⁇ Hl-R434TR and pHl-R434ibis shared bands of about 212 and 100 nt.
- the C33-A (ATCC HTB 31) cervical tumor line was cultured in D-MEM medium (hivitrogen Corp., Carlsbad CA) enriched with 5% fetal bovine serum. Transfections were done using lO ⁇ g of total plasmid DNA with Lipofectin reagent (Invitrogen). Cells were harvested for RNA extraction 48 lirs post-transfection. Oligodeoxynucleotides and plasmids
- Plasmid pBtV5-434 contains the R434 ribozyme flanked by a mutated tRNA Val and a tetraloop cloned into the BamHIIXhoI and MluIISacI sites of pBtVl-434 plasmid, respectively.
- Triplex ribozyme expression plasmid pTRL-5 was constructed by cloning the double stranded oligodeoxyribonucleotides (dsODN)
- Plasmid pRz434bis contains the pBtV5- 434 expression cassette (tRNA Yal -R434-tetraloop) flanked by the cis-cleavage domains TL (5'-AATTCAAACAGAGAAGTCAACCATGGTACCTCCTGACAGTCCTGTTTA-S') (SEQ ID NO: 7) and TR (5'-
- Plasmid pRz434TR was made by inserting the dsODN 5'- CGCGTGACAAAACTGTTTCCTCCAAACAGAGAAGTCAACCAGAGCT-S' (SEQ ID NO: 9) (containing a mutation in the cleavage site 5'-AGUC-3' of the TR domain) into the MluIISacI sites of pRz434bis.
- the pRz434ibis plasmid contains the inactive variant R434i in the Xhol and MIuI sites of pRz434bis.
- R434i has a triple nucleotide substitution (A 24 A 25 A 26 - ⁇ G 24 C 25 U 26 ) in the catalytic domain of R434 rendering it unable to cleave the target.
- the duplex constructs pDR434, pDTR434 and pDR434bis contain two tandem copies of R434, TRL-5 and Rz434bis expression cassettes cloned in the pBSKS- vector (Stratagene, La Jolla CA), respectively.
- RNA For ribozyme probing, 25 ⁇ g of total RNA were hybridized with a 32 P-labeled antisense RNA probe produced from T7-transcribed pRz434bis plasmid and processed with the Direct ProtectTM Lysate RPA kit as described by the manufacturer (Ambion). For ⁇ - actin probing, 15 ⁇ g of total RNA were used. Protected RNA fragments were separated through denaturing 7M urea 6% polyacrylamide gels. Dried gels were exposed to X- OMAT radiographic films.
- Example 3 In vivo triplex ribozyme performance
- the HPV-16 positive cell line SiHa was co-transfected with the reporter pCR3.1-GFP and plasmids pHl-R434bis, pHl-R434m and pHl-R434ibis expressing the single ribozyme triplex cassette, a partial processing mutant and an inactive ribozyme, respectively.
- Transfected cells were sorted by GFP fluorescence in a flow cytometer and total RNA extracted.
- Plasmid pBtV5-434 contains the R434 ribozyme flanked by a mutated tRNA Val and a tetraloop cloned into the BamHI/XhoI and Mlul/Sacl sites of pBtVl-434 plasmid, respectively.
- Triplex ribozyme expression plasmid pTRL-5 was constructed by cloning the double stranded oligodeoxyribonucleotides (dsODN) 5'-
- Plasmid pRz434bis contains the ⁇ BtV5-434 expression cassette (tRNA Val -R434-tetraloop) flanked by the cis-cleavage domains TL (5'- AATTCAAACAGAGAAGTCAACCATGGTACCTCCTGACAGTCCTGTTTA-S ') (SEQ ID NO: 7) and TR (5'-
- Plasmid pRz434TR was made by inserting the dsODN 5'- CGCGTGACAAAACTGTTTCCTCCAAACAGAGAAGTCAACCAGAGCT-S' (SEQ ID NO: 9) (containing a mutation in the cleavage site 5'-AGUC-3' of the TR domain) into the Mlul/Sacl sites of pRz434bis.
- the pRz434ibis plasmid contains the inactive variant R434i in the Xhol and MIuI sites of pRz434bis.
- R434i has a triple nucleotide substitution (A24A25A26-»G24C25U26) in the catalytic domain of R434 rendering it unable to cleave the target.
- the duplex constructs pDR434, pDTR434 and pDR434bis contain two tandem copies of R434, TRL-5 and Rz434bis expression cassettes cloned in the pBSKS- vector (Stratagene, La Jolla CA), respectively.
- HPV- 16 E6/E7 mRNA specific set of primers E6U (5'-CAGCAATACAACAAACCG-S') (SEQ ID NO: 10) nt 371-388 and E7L (S'-TAGATTATGGTTTCTGAGAACA-S') (SEQ ID NO: 11) hybridizing within the E7 gene nt 862-841, have been previously used to detect HPV-16 E6/E7 DNA and mRNA (Alvarez-Salas, L.M. et al. 1998 Proc Natl Acad Sd U S A 95:1189-1194; Alvarez-Salas, L.M. et al.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Biomedical Technology (AREA)
- General Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Chemical & Material Sciences (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Virology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
A recombinant plasmid or expression vector is provided that includes a sequence encoding a 5' binding sequence containing a self-cleavage site, a cis- and trans-acting hairpin ribozyme and a target binding sequence, and a 3' binding sequence containing a self-cleavage site, which produces a RNA transcript that undergoes self-catalyzed cleavage at the 5' and 3' sides of the cis- and trans-acting hairpin ribozyme. Also provided are methods of producing RNA transcripts self-cleaved at the 5' and 3' sides of the cis- and trans-acting hairpin ribozyme, host cells transformed with the recombinant plasmid or expression vector and a method of treating a subject with the recombinant plasmid or expression vector.
Description
A SINGLE RIBOZYME TO CATALYZE BOTH TRIMMING AND TRANSACTING CATALYSIS
Related Applications This application claims the benefit of U.S. Provisional Application No. 60/675,076,
Filed April 25, 2005 and U.S. Provisional Application No. 60/787,119, filed March 29, 2006, both of which are hereby incorporated by reference in their entireties.
Field of the Invention
A recombinant plasmid or expression vector encoding a cis- and trans-acting hairpin ribozyme is provided that produces an RNA transcript that undergoes self-catalyzed cleavage at the 5' and 3' sides of the ribozyme.
Description of the Related Art
Experimental, epidemiological and molecular data has established that squamous cell cervical carcinomas are associated with "high" risk types of human papillomaviruses (HPVs) DNA. The most important viral oncogenes found as a result of cell transformation and formation of tumors in transgenic mice with malignant types of HPVs have been E6 and E7. Their presence has been confirmed in most cervical carcinomas worldwide
(Clifford, G.M. et al. 2003 Br J Cancer 88:63-73). The continued expression of these two genes is evidence of their importance and they are often referred to as the hallmark of cervical carcinoma (zur Hausen, H. & de Villiers, E.M. 1994 Annu Rev Microbiol 48:427-
447). Furthermore, E6/E7 suppression of cervical cancer cell lines results in growth inhibition (von Knebel Doeberitz, M. et al. 1988 Cancer Res 48:3780-3786).
Human papillomaviruses are small DNA viruses that induce hyperplasia of epithelial cells. HPVs have been well characterized and on a world-wide basis 20% of adult females are HPV positive (Koutsky, L.A. et al. 2002 N Engl J Med 347:1645-1651).
Some HPVs (such as types 16 and 18) are associated with malignant progression of genital mild dysplasia to cervical cancer with type 16 (HPV- 16) being the most common papillomavirus associated with cervical cancer (zur Hausen, H. 1996 Biochim Biophys Acta
1288:F55-78). In HPV-16, both genes are expressed from a single promoter resulting in polycistronic mRNA containing both E6 and E7 transcripts. E6 and E7 protein products functionally neutralize cell cycle regulatory proteins, so that cell proliferation continues.
Recently, E6 protein lias been shown able to interact with a number of transcription regulators (Zimmermann, H. et al. 1999 J Virol 73:6209-6219); however, the primary target of E6 is the suppression of the p53 growth inhibitor (Gardiol, D. et al. 1999 Oncogene 18:5487-5496; Foster, S.A. et al. 1994 J Virol 68:5698-5705). Inhibition of p53 by E6 involves ubiquitin-mediated degradation of p53 and the consequent loss of p53 functions (Werness, B.A. et al. 1990 Science 248:76-79; Scheffner, M. et al. 1993 Cell 75:495-505). The E7 protein also .plays an important role in the viral life cycle by subverting the tight link between cellular differentiation and proliferation in normal epithelium, thus allowing viral replication in differentiating keratinocytes that would be otherwise be withdrawn from the cell cycle (Munger, K. et al. 2001 Oncogene 20:7888-7898). E7 protein from high-risk HPVs targets pRB107 and disrupts the E2F-mediated transcriptional regulation resulting in the up-regulation of genes required for Gl/S transition and DNA synthesis (Dyson, N. et al. 1989 Science 243:934-937; Duensing, S. et al. 2001 J Virol 75:7712-7716; Munger, K. & Phelps, W.C. 1993 Biochim Biophys Acta 1155:111-123). The combination of E6 and E7 activities cause genomic instability, cell immortalization and transformation leading to malignancy cancer (Pirisi, L. et al. 1987 J Virol 61:1061-1066; Duensing, S. & Munger, K. 2002 Cancer Res 62:7075-7082). Additionally, E6 and E7 have been shown to induce carcinomas in transgenic mice (Herber, R. et al. 1996 J Virol 70:1873-1881; Song, S. et al. 1999 J Virol 73:5887-5893). Thus, interruption of these genes represents an ideal target for therapy.
The discovery of nucleic acids as biological catalysts (ribozymes) has been one of the most important advances in biochemistry. Progress has been obtained in understanding ribozyme reaction mechanisms, kinetics, active centers, conformational structure and minimal functional structures (Lilley, D.M. 1999 Curr Opin Struct Biol 9:330-338; Sun, L.Q. et al. 2000 Pharmacol Rev 52:325-347). The applications of small ribozymes have attracted considerable interest because of the potential methods for gene therapy through gene silencing (Birikh, K.R. et al. 1997 Eur J Biochem 245:1-16). The extensively studied hammerhead and hairpin ribozymes are small cis-cleaving ribozymes found in some plant viroids and satellite RNAs. These ribozymes contain guide sequences that allow them to hybridize and subsequently cleave a specific substrate RNA. Furthermore, because ribozymes are catalytic they may bind other substrate molecules following cleavage of the first target. Such multiple turnover can result in more efficient inhibition (Kiehntopf, M. et al. 1994 EMBO J 13:4645-4652). Their small size and malleability make ribozymes
excellent candidates as potential gene inhibitors. However, their eventual use will depend on whether they can be adapted to efficiently cleave substrates within the intracellular environment (Sullenger, B.A. 1995 ApplBiochem Biotechnol 54:57-61).
The hairpin ribozyme is a 50 nt catalytic moiety derived from the minus strand of the satellite RNA associated with the tobacco ringspot virus (Haseloff, J. & Gerlach, W.L. 1988 Nature 334:585-591). The catalytic domain of hairpin ribozymes contains two short intramolecular helices (helix 3 and helix 4) that flank an internal loop (loop B) associated with the cleavage process. Ribozyme-substrate complex is stabilized by two intermolecular helices (helix I and helix II), flanking a symmetrical internal loop (loop A) containing the substrate cleavage site. An interdomain interaction is necessary to produce catalytic activity over the target which requires minimal amounts OfMg4+ for correct positioning and no apparent dependence on co-factors for cleavage (Berzal-Herranz, A. et al. 1993 EMBO J 12:2567-2573). Cleavage occurs through a transesterifϊcation reaction pathway using the 2 '-hydroxy group at the scissile linkage primary nucleophile generating cleavage products with 5'-hydroxy and 2',3'-cyclophosphate termini (Berzal-Herranz, A. & Burke, J.M. 1997 Methods MoI Biol 74:349-355).
A major issue in ribozyme development as therapeutic agents has been their behavior within the intracellular environment. Variables such as nuclease sensitivity, target co-localization, endogenous ion concentration and ribozyme expression levels have hampered application of ribozymes as efficient therapeutic agents (Michienzi, A. & Rossi, JJ. 2001 Methods Enzymol 341:581-596). Nevertheless, ribozymes designed to cleave targets of HIV-I, HPV, HBV and several cellular genes have been successfully tested in vitro and in vivo (Taylor, N.R. & Rossi, JJ. 1991 Antisense Res Dev 1:173-186; Alvarez- Salas, L.M. et al. 1998 Proc Natl Acad Sd U S A 95:1189-1194; Feng, Y. et al. 2000 Biol Chem 382:655-660; Shore, S.K. et al. 1993 Oncogene 8:3183-3188; Me, A. et al. 1999 Antisense Nucleic Acid Drug Dev 9:341-349; Andang, M. et al. 1999 Proc Natl Acad Sci U SA 96:12749-12753; Alvarez-Salas, L.M. et al. 2003 Antivir Ther 8:265-278).
Our interest centers on the therapy of cervical cancer. For this purpose we also found that an antisense oligodeoxynucleotide directed to locus 434 of E6 of HPV- 16 inhibited tumor cell growth and has been patented (Alvarez-Salas, L.M. et al. 1999 Antisense Nucleic Acid Drug Dev 9:441-450; US patent 6,084,090). The R434 hairpin ribozyme produces in vitro degradation of HPV- 16 E6 RNA, confirming target site accessibility (US patent 5,683,902). It was also shown that R434 ribozyme efficiently
inhibits E6/E7 -mediated immortalization through the specific degradation of its mRNA when in cis-configuration (Alvarez-Salas, L.M. et al. 1998 Proc Natl Acad Sd U S A 95:1189-1194).
The evolution of expression systems has led to the engineering of multiple expression (multiplex) configurations harboring several trans-acting (therapeutic) ribozymes within a single RNA molecule transcribed from RNA polymerase III promoters. A particular multiplex system using cis-cleaving (trimming) ribozymes flanking therapeutic ribozymes allows independent action of each ribozyme thus increasing overall efficiency (Taira, K. et al. 1990 Protein Eng 3:733-737; Altschuler, M. et al. 1992 Gene 122:85-90; Ohkawa, J. et al. 1993 Proc Natl Acad Sd U S A 90:11302-11306). Such triplex configuration has been successfully applied to hammerhead ribozymes targeting HIV-I and HBV (Yuyama, N. et al. 1994 Nucleic Acids Res 22:5060-5067; Ruiz, J. et al. 1997 Biotechniques 22:338-345; Andang, M. et al. 2004 Oligonucleotides 14:11-21). In contrast, no hairpin ribozyme has been used as trimming ribozyme in any multiplex system although it can be readily adapted to a triplex system.
Segue to the Invention
The present work describes two effective triplex systems (TRL-5 and Rz434bis) directed against HPV-16 E6/E7 mRNA based on one or three hairpin ribozymes. Because of the modular structure of the hairpin ribozyme, the catalytic domain B can independently recognize cis or trans targets allowing the use of the same ribozyme for both trimming and therapeutic duties. Thus, one system was designed as a three-ribozyme unit in a canonical triplex using an inverted cleavage from one trimming ribozyme. The other used only one therapeutic ribozyme to self-release from the original transcript. Both systems contained R434 as a trans-acting moiety and were successfully tested for cis- and trans-cleavage of an HPV-16 E6 target mRNA. We demonstrated that triplex systems based exclusively on hairpin ribozymes result in higher cleavage activity of R434 leading to a more efficient destruction of E6/E7 mRNA than single-expressed R434 ribozymes. Moreover, the use of single triplex ribozymes to perform trimming activities resulted in minimal loss of R434 cleavage trans -activity indicating that such configuration may be used to express multiple anti-HPV-16 ribozymes.
Summary of the Invention
A recombinant plasmid or expression vector is provided that includes a sequence encoding a 5' binding sequence containing a self-cleavage site, a cis- and trans-acting
hairpin ribozyme and a target binding sequence, and a 31 binding sequence containing a self-cleavage site, which produces a RNA transcript that undergoes self-catalyzed cleavage at the 5' and 3' sides of the cis- and trans-acting hairpin ribozyme.
In one embodiment, a recombinant plasmid or expression vector encodes 1-100 units of a 5' binding sequence containing a self-cleavage site, a cis- and trans-acting hairpin ribozyme and a target binding sequence, and a 3' binding sequence containing a self- cleavage site, which produces an equivalent number of RNA transcripts connected in tandem that undergo self-catalyzed cleavage at the 5' and 3' sides of each cis- and transacting hairpin ribozyme. Also provided is a method of producing RNA transcripts self-cleaved at the 5' and 3' sides of the cis- and trans-acting hairpin ribozyme that involves subjecting the recombinant plasmid or expression vector to transcription conditions and allowing RNA transcripts to be self-cleaved.
Another aspect of the invention includes a host cell transformed with the recombinant plasmid or expression vector.
Also provided is a method of treating a subject with the recombinant plasmid or expression vector of the invention.
Brief Description of the Drawings
Figure 1. A) Map of pTRL-5 plasmid. The relative positions of TRL, R434 and TRR ribozymes are shown within boxes. The arrow indicates the position and orientation of T3 promoter. Relevant restriction sites are marked. B) Map of pRz434bis plasmid. The relative positions of TR and TL target domains are shown within boxes.
Figure 2. A) Secondary structure representation of full transcripts from pTRL-5 triplex system (SEQ ID NO: 1). The positions of R434 trans-acting ribozyme, mutant tRNAVal and trimming ribozymes TRL and TRR are shown. B) Secondary structure representation of full transcripts from pRz434bis single ribozyme triplex system (SEQ ID NO: 2). R434 trans-acting ribozyme, mutant tRNAVal, and domains TL and TR are shown. Arrows indicate ribozyme cleavage sites. HPV-16 target sequence (nt 430-445) is shown for reference. Figure 3. Schematic representation of triplex ribozyme processing. Left panel, for ρTRL-5 the full TRL-R434-TRR transcript would be cleaved into end-products R434, TRL, TRR and intermediaries TRL-R434 and R434-TRR. Right panel, for pRz434bis the
transcript TL-R434-TR would be processed into the intermediary products TL-R434 and R434-TR and then the end-products R434, TL and TR.
Figure 4. Catalytic release of R434. A) Triplex ribozymes produced after in vitro transcription of Sad-linearized pTRL-5 and pRz434bis plasmids were purified through preparative gel electrophoresis. Eluted full transcripts TRL-R434-TRR and TL-R434-TR were incubated in RZ buffer for 0 to 120 min and loaded into analytical 6% polyacrylamide 7M urea denaturing gels. The position of full-length, intermediary and end-products is indicated by arrows. B) Triplex ribozymes produced from circular templates were incubated in RZ buffer as described above. Self-cleavage products were separated through 6% polyacrylamide 7M urea gels.
Figure 5. Triplex cassette self-processing. Individual bands from in vitro transcribed pRz434bis (A) and pTRL-5 (B) plasmids were eluted and purified from preparative 6% polyacrylamide 7M urea gels and further incubated for 60 min in transcription buffer at 370C. The resulting fragments from self-processing were separated in denaturing 6% polyacrylamide gels. Lines indicate relative mobility and size of self- cleavage fragments.
Figure 6. Self-cleavage specificity. Transcripts from pRz434bis, pRz434TR (containing a mutated cleavage site on TR domain) and pRz434ibis (containing an inactive ribozyme) were incubated in RZ buffer for up to 120min and the resulting fragments were separated in 6% polyacrylamide 7M urea gels. The position of the resulting fragments is indicated by arrows.
Figure 7. Triplex R434 cleavage of HPV-16 RNA. A) Labeled HPV-16 target RNA (nt 415 to 445) was incubated with equimolar quantities of ribozyme RNA produced from linearized templates pBtV5-434 (triangles), pTRL-5 (squares) or pRz434bis (circles) at 370C. B) HPV-16 target RNA was incubated with ribozyme RNA produced from covalently closed circular (ccc) templates pBtV5-434ccc, pRz434bis and pTRL-5ccc. Cleavage was calculated as the mean of the percentage of radioactivity from cleaved products relative to the input. Error bars represent standard deviation.
Figure 8. Trimming activity enhances triplex R434 cleavage. In vitro transcribed RNA from Sacl-linearized templates pRz434bis (squares), pRz434TR (triangles) and the inactive mutant pRz434ibis (circles) was incubated with the HPV-16 415-445 target. Cleavage activity was plotted as the percentage of residual activity relative to the input. The results represent the mean with standard deviation of three independent experiments.
Figure 9. Trans-cleavage activity of double ribozyme cassettes, Equimolar quantities of ribozyme RNA from linear (A) and covalently closed circular templates (B) were incubated with the HPV-16 target 415-445 as described above. Kinetic plots for ρBtV5-434 (black triangles), pDR434 (white triangles), pTRL-5 (black squares), pDTR434 (white squares), pRz434bis (white circles) and pDR434bis (black circles) are shown.
Figure 10. In vivo processing of Rz434bis triplex cassette. C33-A cells were transiently transfected with plasmids pHl-Rz434bis, pHl-Rz434TR and pHl-Rz434ibis (containing the BamHI-SacI fragments from pRz434bis, Rz434TR and Rz434ibis, respectively) and harvested 48 hrs post-transfection. Total RNA was purified and incubated with a labeled antisense probes for pRz434bis (right panel) or human β-actin (left panel) in ribonuclease protection assays (RPAs). Fragments were analyzed in 6% polyacrylamide-7M urea denaturing gels. Arrows indicate the relative migration of Rz434bis fragments and β-actin input control. IVP, in vitro processed Rz434bis transcript. NT, RNA from non-transfected cells. Probe, intact labeled antisense Rz434bis probe. Control (+), RPA with unlabeled R434 transcript. RNase plus, Rz434bis antisense probe incubated with ribonucleases. RNase minus, Rz434bis antisense probe incubated with ribonuclease buffer only.
Figure 11. In vivo trans-cleavage of R434bis triplex cassette. SiHa cells were transiently transfected with plasmids pHl-R434bis, pHl-R434TR and pHl-R434ibis (containing the BamHI-SacI fragments from pR434bis, R434TR and R434i, respectively) and the reporter plasmid pCR3.1 GFP. Transfected cells were harvested 48 hrs post- transfection and sorted for GFP fluorescence by flow cytometry. Total RNA was purified and subjected to RT-PCR for HPV-16 E6 (upper panel) and human β-actin (lower panel). Amplicons were analyzed by 1.5% agarose gel electrophoresis. Arrows indicate the relative migration of HPV-E6 (492bp) and β-actin (66 lbp) amplicons. NT, RNA from non- transfected cells. Control with no RNA (-RNA) and no reverse transcriptase (-RT) are indicated.
Brief Description of the Sequences
The oncoproteins E6 and E7 of human papillomavirus type 16 (HPV- 16) efficiently immortalize cervical keratinocytes, induce tumors in transgenic mice and correlate with cervical cancer. Previously, we reported engineered hairpin ribozymes (R419 and R434) that caused down-regulation of HPV- 16 E6/E7 mRNA and inhibited growth of both HPV- 16 immortalized cells and tumor cells. To increase efficiency, we constructed a triplex expression system using a canonical three-ribozyme cassette. Now, we have developed a unique triplex expression system based on a single hairpin ribozyme able to perform cis- cleaving (trimming) and trans-cleaving (therapeutic) functions. In this configuration, R434 catalyzes both trimming and trans-acting catalysis, allowing for the individual activity of multiple ribozyme trans-acting units resulting in increased efficiency of degradation of E6 RNA when expressed from linear or circular templates. Although the release kinetics of the single hairpin ribozyme is slower than the canonical three-ribozyme cassette, the single hairpin ribozyme efficiently cleaves the target HPV- 16 mRNA. Surprisingly, both systems have very similar cleavage kinetics even though the single hairpin ribozyme is performing two roles. Furthermore, the duplex single hairpin ribozyme was more efficient in cleaving E6 than duplex R434 indicating that release of individual ribozymes enhances the kinetics of the single hairpin ribozyme. The use of a multimeric single hairpin ribozyme will ultimately result in a better in vivo E6/E7 mRNA degradation. Single Ribozymes that Undergo Cis- and Trans-Acting Catalysis
Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. See, e.g., Singleton P and Sainsbury D., Dictionary of Microbiology and Molecular Biology 3rd ed., J. Wiley & Sons, Chichester, New York, 2001. In order to construct a recombinant plasmid or expression vector containing a sequence encoding a single cis- and trans-acting hairpin ribozyme, we have combined three blocks, a 5' block comprising a sequence encoding a 5' binding sequence containing a self- cleavage site, a cis- and trans-acting ribozyme block comprising the sequence encoding a cis- and trans-acting hairpin ribozyme of interest and a target binding sequence, and a 3' block comprising the sequence encoding a 3' binding sequence containing a self-cleavage site. The 5' binding sequence is cleaved by the cis- and trans-acting ribozyme. The DNA sequence of the 5' binding sequence is ligated upstream of the cis- and trans-acting
ribozyme block. The 3' binding site is also cleaved by the cis- and trans-acting ribozyme. The 3' binding site is located downstream of the cis-and trans-acting ribozyme block.
The recombinant plasmid or expression vector produces RNA transcripts in vivo (yeast, plant cell, animal cell) as well as in vitro. Transcription starts at a transcription initiation site (+1) downstream of a promoter and moves in the 3' direction, optionally without stopping at the 3' end of the 3 ' block. The RNA transcript undergoes self-catalyzed cleavage at the 5' and 3' sides of the cis- and trans-acting ribozyme block and the resulting cis- and trans-acting hairpin ribozyme has substantially minimal extra sequences at both sides. Although the recombinant plasmid or expression vector is designed to produce the cis- and trans-acting hairpin ribozyme, the recombinant plasmid can be used to produce various RNA transcripts such as silencing RNAs of various viruses and anti-sense RNAs simply by alternating the three blocks with a sequence of interest. Various promoters can be utilized as a promoter of the recombinant plasmid or expression vector. A suitable vector is one capable of producing an RNA transcript in various organisms and selected according to the organisms (e.g., plant, animal). hi addition, a recombinant plasmid or expression vector can be designed to encode a number of various concatemeric units. The whole concatameric unit (1-100 units) is placed after a promoter. A unit of the concatamer comprises a 5' block, a cis-and trans-acting hairpin ribozyme optionally embedded into a tRNA in order to stabilize the cis- and transacting ribozyme (herinafter referred to as cis-and trans-acting ribozyme/tRNA), and 3' block. The 5' and 3' blocks contain self cleavage sites that are cleaved by the cis- and trans-acting ribozyme/tRNA. The tRNA serves to stabilize the cis-and trans-acting ribozyme which cleaves an RNA target. The cis- and trans-acting hairpin ribozyme can be specially designed to target a specific RNA; each concatameric unit can be designed to target different RNAs. The recombinant plasmid or expression vector encoding various concatameric units targeted at different sites of the target RNA gene is therefore especially useful to target RNAs arising from microorganisms of a high mutation rate. The env gene of human immunodeficiency virus type 1 (HIV-I) and others are, for example, known to undergo mutation at a very rapid rate. The recombination plasmid may be used to cleave the RNAs of these viruses by simultaneously targeting various sites.
The recombinant plasmid or expression vector containing the sequence encoding a cis- and trans-acting hairpin ribozyme can produce a cis-and trans-acting ribozyme
substantially free of unwanted sequence at its 5' and 3' flanking region without digesting the plasmid or vector with restriction enzyme. The recombinant plasmid or expression vector does not require the time-consuming digestion step as in run-off transcription. In addition, the recombinant plasmid or expression vector can produce the cis- and trans-acting hairpin ribozyme in vivo as well as in vitro. The recombinant plasmid or expression vector can be amplified in vivo while producing the cis- and trans-acting hairpin ribozyme. Additionally, efficiency of cleavage of a covalently closed circular (ccc) form is far better than that of a linearized DNA, (i.e., run-off method). This is apparently because, in the case of a covalently closed circular form, transcription occurs by a rolling circle mechanism. As described above, the hairpin ribozyme is a 50 nt catalytic moiety derived from the minus strand of the satellite RNA associated with tobacco ringspot virus (Haseloff, J. and Gerlach, W.L. 1988 Nature 334:585-591). Ribozyme-substrate complex is stabilized by two intermolecular helices (helix I and helix II), flanking a symmetrical internal loop (loop A) containing the substrate cleavage site. The ribozyme binds to the target RNA through helix 1 (six base pairs) and helix 2 (four base pairs), separated by a NGUC loop in the substrate strand. The recognition sequence is bNGUC (SEQ ID NO: 4), where b is G, C, or U, N is any nucleotide, and cleavage occurs 5' to the G residue. The catalytic domain of hairpin ribozymes contains two short intramolecular helices (helix 3 and helix 4) that flank an internal loop (loop B) associated with the cleavage process. The triplex ribozymes of the present invention comprise a 5' binding sequence containing a self-cleavage site, a catalytic cis-and trans-acting ribozyme comprising a target RNA-specific binding site, and a 3' binding sequence containing a self-cleavage site. One example of such a triplex ribozyme is shown by its RNA content in Fig. 2B and SEQ ID NO: 2. The nucleotides numbered 1-267 encode the triplex ribozyme. This includes the 5' binding sequence containing a self-cleavage site (33 bases), the catalytic ribozyme protected by a tRNA (175 bases), and the 3' binding sequence containing a self-cleavage site (59 bases).
The invention provides ribozymes that have the unique characteristic of being target RNA-specific in their catalytic action. In the example shown in Fig. 2B and SEQ ID NO: 2, the target RNA specificity is conferred by an RNA binding site that specifically binds a sequence that is unique to human papillomavirus type 16 (HPV- 16) E6 and E7 mRNA. It will be understood that an RNA sequence unique for any RNA can be the target of the present target RNA-specific ribozyme. The determination of unique sequences is routine
given the availability of numerous computer databases (GenBank) and computer programs (Genetics Computer Group, PCGENE and BLAST) which can search for and find any matches between nucleic acid sequences. A unique DNA sequence located on one of the databases will have a corresponding unique RNA sequence. One example of the catalytic sequence of the present ribozyme is also shown as its
RNA coding sequences in Fig. 2B and SEQ ID NO: 2. Other catalytic sequences include those known in the art. A number of sequence variations have defined permissible nucleotide alterations in "stem" regions. Those skilled in the art will understand that any catalytic sequence, even those not yet discovered, can be used to construct a ribozyme of the invention when it is routinely combined with the autocatalytically cleaving ribozyme and RNA binding site as described herein.
One example of the 5' and 3' binding sequences is shown in Fig. 2B and SEQ ID NO: 2. As further described below, the 5' and 3' binding sequences are important for the expression of the catalytic ribozyme, because they permit the ribozyme to be cleaved from the ribozyme transcript as soon as it is transcribed to produce a catalytic ribozyme having substantially minimal extraneous 5' or 3' sequences. Thus, the target-specific binding site and the catalytic sequence that comprises the catalytic ribozyme are in the correct configuration to bind and cleave the target RNA. The extraneous sequences in the exemplified constructs are the result of the cloning procedure. It is understood that with the selection of an alternative cloning scheme some or all of these extraneous nucleotides can be eliminated. Ribozyme Encoding Nucleic Acids
The invention also provides nucleic acids which encode the ribozymes of the invention. These nucleic acids can be used to express the ribozymes of the invention at the selected site. The site can be tissue-specific in the case of treating tissue-specific cancers, or it can be target-specific in the case of ribozymes that prevent replication of infectious agents to treat infection (e.g. papillomavirus, hepatitis, herpes, malaria, tuberculosis, etc.).
The nucleic acids of the invention comprise a tissue-specific or non-tissue-specific promoter binding site upstream from a sequence encoding a 5' binding sequence containing a self-cleavage site, a catalytic cis- and trans-acting ribozyme comprising a target RNA- specific binding site, and a 3' binding sequence containing a self-cleavage site.
The tissue-specific promoter binding site in the ribozyme-producing construct results in tissue-specific expression of the ribozyme in tissue(s) that actively transcribe
RNA from the selected promoter. Thus, only the target RNA in tissue that utilizes the promoter will be cleaved by the ribozyme. The non-tissue-specific promoter results in non- tissue-specific expression and includes virus-specific promoters, such as a cytomegalovirus (CMV) promoter, and RNA polymerase III promoters. Various tissue-specific and non-tissue-specific promoters can be used in the present nucleic acid constructs. Examples of these promoters are known to those skilled in the art. It will also be clear that target-specific promoters not yet identified can be used to target expression of the present ribozymes to the selected tissue(s) and non-tissue-specific promoters not yet identified can be used to express the present ribozymes. Once a tissue- specific promoter and non-tissue-specific promoter is identified its binding sequence can be routinely determined by routine methods such as sequence analysis. The promoter is defined by deletion analysis, mutagenesis, footprinting, gel shift and transfection analyses. hi the ribozyme-encoding nucleic acid of the invention, the nucleic acid encoding the 5' binding sequence containing a self-cleavage site of nucleotides 1-59 is shown in Fig. 2B and SEQ ID NO: 2. The nucleic acid encoding the 3' binding sequence containing a self-cleavage site of nucleotides 235-267 is shown in Fig. 2B and SEQ ID NO: 2.
It is understood that other 5' and 3' binding sequences may be developed that can be encoded by the present nucleic acids. These blocks can be developed according to the methods known in the art. The present nucleic acid encodes a catalytic ribozyme that contains two separable functional regions: a highly conserved catalytic sequence which cleaves the target RNA (also known as the "catalytic core"), and flanking regions which include a target RNA- specific binding site. By nucleic acid complementarity, the binding site directs the ribozyme core to cleave a specific site on the target RNA molecule. The length of flanking sequences have implications not only for specificity, but also for the cleavage efficiency of the individual ribozyme molecules, hi the present catalytic ribozyme, the flanking sequences are highly specific for the target RNA, yet allow ready dissociation from the target RNA once cleavage occurs. This permits cycling of the ribozyme and reduces the amount of ribozyme required to be effective. The complexity of human RNA is about 100 fold lower than that for human DNA, and specificity can be achieved with as few as 12-15 base pairs. The stability of the RNA- RNA duplex is affected by several factors, such as GC content, temperature, pH, ionic
concentration, and structure. Rules known to those in the art can provide a useful estimate of the stability of the duplex.
As described above, the encoded RNA binding site is unique, so the encoding nucleic acid sequence will be the corresponding unique DNA sequence. The RNA binding site can comprise a sequence that binds to a HPV- 16 E6 and E7 mRNA. The HPV- 16 E6 and E7 binding site encoding RNA can have the sequence shown in Fig. 2B.
The catalytic ribozyme of the invention also includes a catalytic sequence, which cleaves the target RNA near the middle of the site to which the target RNA-specifϊc binding site binds, hi the hairpin type of ribozyme, the catalytic sequence is generally highly conserved. The conserved catalytic core residues are (SEQ ID NO: 3):
UAUAUUA A 3'
U G C U
GUG CUGG U CAC GACCA 5'
G A A
CAAAG
The most conserved and probably most efficiently cleaved sequence on the target RNA is 5' GUC 3'. Such cleavage sites are ubiquitous in most RNAs allowing essentially all RNA's to be targeted.
With regard to the selection of the appropriate sites on target RNA, it is known that target site secondary structure can have an effect on cleavage in vitro. Thus, the selected target molecule's sequence can be routinely screened for potential secondary structure, using the program RNAFOLD (from the PCGENE group of programs or available on the Internet). Thus, reasonable predictions of target accessibility can be made. Computer assisted RNA folding, along with computational analysis for 3 -dimensional modeling of RNA, is certainly effective in guiding the choice of cleavage sites.
The catalytic ribozyme can be targeted to non-cellular RNAs necessary for growth of parasites, virus life cycles, etc., and expression can be driven with tissue-specific or non- tissue-specific promoters.
One example of the nucleic acid of the invention has the nucleotides encoding the sequence shown as SEQ ID NO: 2. This exemplary nucleic acid includes a bacterial promoter, upstream from a sequence that encodes the 5' binding sequence containing a self- cleavage site having the sequence shown in SEQ ID NO: 2, the cis- and trans-acting
hairpin ribozyme shown in SEQ ID NO: 2, the target binding site encoding RISfA having the sequence shown in SEQ ID NO: 2, and the 3' binding sequence containing a self- cleavage site having the sequence shown in SEQ ID NO: 2.
Alternatively, silent base substitutions in the ribozyme encoding sequence can be made that express the same ribozyme. Thus a nucleic acid having substantially the nucleotide sequence that encodes the ribozyme shown in SEQ ID NO: 2 is provided. The nucleic acid can vary based on the characteristics/definition of the target chosen, and will have 85%-99% sequence identity with the nucleotide sequence that encodes the ribozyme shown in SEQ ID NO: 2, more preferably, it will have 95%-99% sequence identity with the nucleotide sequence that encodes the ribozyme shown in SEQ ID NO: 2. Other modifications could include for example, substitutions (or deletion or addition) of nucleotides inserted for cloning purposes and linkers. The unpaired bases can be any base, determined only by the cloning scheme chosen. If one of the bases of a pair is changed, the other must be changed in a complementary fashion. Furthermore, the ribozyme-coding sequence can be altered in ways that modify the ribozyme sequence, but do not affect the ribozyme' s target RNA-specifϊcity or negate its cleavage activity. For example, the cis- and trans-acting catalytic ribozyme may be incorporated into other constructs while maintaining catalytic activity. Industrial Applicability Thus, this invention has several applications. The self-cleavable ribozymes of the present invention have utility for RNA-targeted gene therapy in both plants and animals to down-regulate endogenous gene expression by cleaving mRNA transcripts produced by a gene of interest. For instance, the self-cleaving ribozymes of the present invention can be used to target and cleave viral RNA in order to inhibit the replication cycle of viruses such as HIV.
The self-cleavable ribozymes of the present invention can also be used to inhibit expression of genes belonging to other infectious agents, including viruses, bacteria and protozoa, or genes whose products have deleterious effects on an organism in particular situations (e.g., inflammation in autoimmune diseases, vascular restenosis after angioplasty, defective metabolic enzymes such as the alpha-1-antitrypsin). The present invention also has application to genes involved in the control of cell growth and differentiation. These genes include those of cell cycle regulators (cyclins, cyclin dependent kinases), growth
factors, growth factor receptors and second messengers, and the present invention has particular utility for the inhibition of oncogenes.
A vector comprising DNA encoding the self-cleavable ribozymes of the present invention can be delivered to an appropriate location in a living organism, e.g., particular organs or cell types, and the DNA incorporated in the vector can be expressed. Upon expression, the self-cleavable ribozyme is cleaved into its individual monomeric units, and at least one of the monomeric units recognizes and cleaves a transcript including the target recognition sequence comprising the ribozyme cleavage site transcribed from the gene of interest or a portion thereof. Thus, the transcript is cleaved and expression of the gene is down-regulated or inhibited.
The ribozymes of the present invention can also be used in virtually any application in which highly efficient, sequence-specific cleavage and destruction of RNA transcripts is desired. Synthesis of the Ribozyme Producing Construct Typically, the RNA binding and core sequences are synthesized as reverse complementary oligonucleotides and are cloned into a vector that will allow production of the relevant RNA containing the ribozyme. hi one embodiment, the present ribozymes are prepared by synthesis of an oligonucleotide and its reverse complement. A restriction site is used in cloning. Following appropriate restriction digestion, the double-stranded DNA oligonucleotide is cloned into the cloning site within the parent vector. Functional Testing
Once sequenced, these ribozymes are functionally tested. The test can involve transcription of the ribozyme using bacterial promoters, e.g., T3, SP6 or T7, (in the presence of trace amounts of radioactivity) followed by evaluating the autocatalytic cleavage of the ribozyme by electrophoresis. Data from these tests are provided herein.
Additional testing procedures encompass incubation of in vitro transcribed ribozymes with in vitro synthesized target RNA transcript or with cytoplasmic RNA preparations. Following incubations, RNAs are examined by standard SDS PAGE and autoradiography analyses to verify specific degradation of target RNA transcripts. Data from these tests are provided herein.
The ribozymes of the invention can be further tested by subcloning behind a tissue- specific promoter that will drive expression of the vector in a tissue-specific manner or behind a non-tissue-specifϊc promoter.
The ribozyme experimental approach of this invention is further validated by doing in vivo studies in mice and, ultimately, in humans. Delivery
The nucleic acids of the invention can be in a vector for delivering the nucleic acid to the site for expression of the ribozyme. The vector can be one of the commercially available preparations. Vector delivery can be by liposome, using commercially available liposome preparations or newly developed liposomes having the features of the present liposomes. Other delivery methods can be adopted and routinely tested in methods known to those skilled in the art. The modes of administration of the liposome will vary predictably according to the disease being treated and the tissue being targeted. For lung (e.g., tuberculosis, cancer) and liver (e.g., hepatitis and cancer) which are both sinks for liposomes, intravenous administration is reasonable. For many other localized pathologic conditions including cancers, infections (e.g., hepatitis, cystitis, proctitis, cervicitis, etc.) as well as precancerous conditions, catheterization of an artery upstream from the organ is a preferred mode of delivery, because it avoids significant clearance of the liposome by the lung and liver. For lesions at a number of other sites (e.g., skin cancer, human papillomavirus infection, herpes (oral or genital) and precancerous cervical dysplasia), topical delivery is expected to be effective and may be preferred, because of its convenience. Leukemias and other conditions, such as malaria, may also be more readily treated by ex vivo administration of the ribozyme.
The liposomes may be administered topically, parenterally (e.g., intravenously), by intramuscular injection, by intraperitoneal injection, transdermally, excorporeally or the like, although IV or topical administration is typically preferred. The exact amount of the liposomes required will vary from subject to subject, depending on the species, age, weight and general condition of the subject, the severity of the disease that is being treated, the particular compound used, its mode of administration, and the like. Thus, it is not possible to specify an exact amount. However, an appropriate amount may be determined by one of ordinary skill in the art using only routine experimentation given the teachings herein. Generally, dosage will approximate that which is typically given in antisense methodology
Parenteral administration, if used, is generally characterized by injection, hijectables can be prepared in conventional forms, either as liquid solutions or suspensions, solid forms suitable for solution or suspension in liquid prior to injection, or as emulsions.
A more recently revised approach for parenteral administration involves use of a slow release or sustained release system, such that a constant level of dosage is maintained.
Topical administration can be by creams, gels, suppositories and the like. Ex vivo (excorporeal) delivery can be as typically used in other contexts. Further, the effect of the present invention can also be obtained by incorporating the
DNA of the present invention into a suitable viral gene vector and administering said vector into the body to express the ribozyme polyribonucleotide in cells. Recombinant retrovirus and vaccinia virus are examples of such vectors. Transgenic Animals The invention provides a transgenic non-human animal, containing, in a germ or somatic cell, a nucleic acid comprising a target-specific or RNA polymerase III promoter binding site upstream from a sequence encoding 5' binding sequence containing a self- cleavage site, a catalytic ribozyme comprising a target RNA-specific binding sequence, and a 3' binding sequence containing a self-cleavage site, wherein the animal expresses a 5' binding sequence containing a self-cleavage site, a catalytic ribozyme comprising a target RNA-specific binding sequence, and a 3' binding sequence containing a self-cleavage site.
The nucleic acid can be the nucleic acid shown in the figures. Alternatively, silent base substitutions in the ribozyme encoding sequence can be made that express the same ribozyme. For example, these substitutions can be as described above. The transgenic non-human animal of the invention is useful, because the animal does not express a phenotype associated with the target RNA {e.g., with the protein it encodes). As used herein the term "phenotype" includes morphology, biochemical profiles {e.g., changes in amounts of RNA or protein expressed, etc.) and other parameters that are affected by the knockout. For example, cell death of otherwise healthy cells can be a measure of altered phenotype resulting from ribozyme expression. Transformed Host Cells
The present ribozymes can be expressed in a transformed cell line. The transformed cell can be used to validate both the specificity of the ribozyme's expression and the specificity and cleavage activity against the target RNA. Examples of such a screening function are known in the art. Screening Methods
The transgenic animals and transformed host cells of the invention can be used in a method of screening a compound for its ability to cause the animal or host cell to express a
phenotype associated with the target RNA. The method requires administering the compound to the animal/cell and assessing the compounds ability to cause expression of the phenotype. If the phenotype is restored, the compound is considered to be effective. For example an L-dopa functional knockout transgenic animal can be made and used to screen for drugs that restore an L-dopa associated phenotype. Treating Proliferative Diseases
A method of treating a subject having a proliferative disease is provided. The treatment is carried out by inhibiting cell proliferation, and this is accomplished by administering to the subject a nucleic acid encoding a ribozyme that is targeted to an RNA that is essential to cell growth. The ribozyme encoded by the nucleic acid is expressed, production of an essential RNA is inhibited, cell proliferation is inhibited, cell death ensues and the proliferative disease treated. For example, the invention provides a method of treating a subject having cervical cancer comprising administering to the subject the nucleic acid encoding SEQ ID NO: 2, whereby the ribozyme encoded by the nucleic acid is expressed in the cervix and the cervical cancer is treated. Treating Viral Infection
A method is provided of treating a viral infection in a subject, comprising administering to the subject a nucleic acid of the invention, wherein the encoded target RNA-specific binding site is specific for an RNA unique to the infectious agent, whereby the ribozyme encoded by the nucleic acid is expressed and the infectious agent is killed. Transcription can be driven using a non-tissue-specific promoter or a tissue-specific promoter which will selectively express the targeted ribozyme in virus-infected tissue, e.g., using the liver-specific albumin promoter for expression of a targeted ribozyme directed against hepatitis B virus. hi the context of determining anti-viral efficacy, ribozyme expressing cell lines can be compared with their ribozyme negative counterparts for their ability to support viral infection/replication/yield. In a manner similar to that described above, ribozyme expressing cell lines can be obtained and assayed; and in all cases the abilities of the ribozyme to prevent infection can be determined. Triplex ribozymes focused on the human papillomavirus type 16 THPV- 16) E6/E7 mRNA It is acknowledged that human papillomaviruses (HPV) are the primary agent associated with cervical carcinomas. The life cycle of HPVs progresses with epithelial differentiation and may persist for decades. The E6 and E7 genes are responsible for two
viral proteins that target p53 and Rb. The persistence of E6 and E7 in cervical carcinomas has led to them being recognized as the hallmark of cervical carcinoma and makes them excellent targets for therapy. Previously, we reported an engineered hairpin ribozyme (R434) that caused down-regulation of HPV- 16 E6/E7 mRNA and inhibited growth of both HPV- 16 immortalized cells and tumor cells. To increase efficiency of R434 we constructed ribozyme expression systems (TRL-5) entirely based on cis-cleaving (trimming) hairpin ribozymes (triplex system) that release R434 from long transcripts. The R434bis system was designed to use a single R434 ribozyme to catalyze both trimming and trans-acting activities. This procedure resulted in a reduced-size triplex system that uses R434 catalytic domain to self-excise itself. RNA from R434bis and TRL-5 templates released R434 by a self-processing mechanism thus allowing for the individual activity of multiple trans-acting ribozymes. Both Rz434bis and TRL-5 systems produced an increased cleavage efficiency of HPV-16 target site nt 410 to 445 when expressed from linear or circular templates. Furthermore, duplex Rz434bis and TRL-5 were more efficient in cleaving E6 than duplex single R434. The use of triplex configurations with multi-target ribozymes will ultimately result in a better in vivo HPV- 16 E6/E7 mRNA degradation. Self-processing of the triplex ribozyme system
The initial development of triplex hairpin ribozymes has led to the design of two different configurations. The first system (pTRL-5) consisted of three hairpin ribozymes in a typical triplex configuration containing the R434 therapeutic ribozyme flanked by two trimming ribozymes (Fig. 2A). In the native configuration of the pTRL-5 transcript, the trimming ribozymes TRL and TRR would release R434 by cis-cleavage. hi order to cleave, TRR must turn 180° at the 3' end to hybridize with the target strand (containing the scissile 5'-GUC-3'). Such capacity has not been previously reported for hairpin ribozymes. The other system (pRz434bis) is a smaller RNA containing only one ribozyme
(R434) with the dual role of trimming and trans-cleavage. Cis-cleavage specificity was established by using hairpin target 5'-GUC-3' sites contained in A domains lacking of catalytic domains flanking R434. This design would likely divert some R434 activity from the HPV- 16 target but greatly reduces the size of the triplex cassette leading to simpler secondary structures and easier cloning of multiple units (Fig. 2B).
The self-cleavage process for the transcript produced by Sacl-linearized pTRL-5 templates would yield three end-products including R434 protected by a mutant tRNAVal (175 nt), plus TRL and TRR (89 and 70 nt, respectively). The full transcript TRL-R434-
TRR (334 nt) and intermediary products TRL-R434 and R434-TRR (264 and 245 nt, respectively) may be also present as a part of the self-cleavage process (Fig. 3). In the case of a Sacl-linearized pRz434bis template, self-processing would yield R434 (175 nt) and the cleaved TL (62 nt) and TR (37 nt) targets in addition to the intermediary products TL-R434 (237 nt) and R434-TR (212 nt) (Fig. 3).
Initial experiments showed that the full pTRL-5 transcript self-digestion yielded the six expected products from a linearized template in a time-dependent fashion. For both pTRL-5 and pRz434bis templates, the intensity of the end-products correlated with a decrease in the full-length transcripts and intermediary products suggesting self-cleavage (Fig. 4A).
To confirm self-cleavage, transcripts from covalently closed circled (ccc) pTRL-5 and pRzR434bis templates were processed in cleavage reactions. Here, the TRR and TR fragments and their associated intermediary products are linked to long transcripts and thus the corresponding bands would be absent from the electropherograms. The bands corresponding to the full-length transcripts from pTRL-5 and pRz434bis are also linked to long transcripts of undefined size leading to thick bands. As with transcripts from linear templates, bands corresponding to TRL-434, R434 and TRL products for pTRL-5 and TL- R434, R434 and TL for pRz434bis were clearly visible after 15min. incubation thus confirming self-cleavage (Fig. 4B). Further evidence of self-processing was obtained through elution of individual RNA fragments followed by one hour incubation at 37°C in RZ buffer. Fragment TL-R434 from pRzR434bis template yielded fragments corresponding in size with end-products R434 and TL (Fig. 5A). For pTRL-5, TRL-R434 processed into R434 and TRL ribozymes whereas TRL, R434 and TRR end products showed no self-processing (Fig. 5B). Therefore, TRL and TRR trimming ribozymes efficiently release R434 ribozyme.
Specificity of self-cleavage of pRz434bis was tested by introducing a mutation in the cleavage site of TR domain (pRz434TR) resulting in the inhibition of R434 cleavage of TR. A mutation in the catalytic domain of R434 (pRz434ibis) completely inhibited self- processing further confirming that Rz434bis transcript undergoes cis-cleavage on both flanks of R434 (Fig. 6).
Trans-cleavage activity of R434 ribozyme expressed from triplex cassettes
The effect of trimming activity on R434 was tested by incubating equimolar amounts of triplex (pTRL-5 and pRz434bis) and single (pBtV5-434) R434 ribozymes
produced from linear or covalently closed circular (ccc) templates using a radiolabeled transcript from HPV-16 R434 target site (nt 410 to 445). As expected, all kinetics were very similar although TRL-5-expressed R434 from linear templates was marginally more efficient than that expressed from single or R434bis cassettes. Interestingly, the R434bis cassette produced the lowest efficiency, probably reflecting the dual role of R434 in this design (Fig. 7A). Using ccc templates did not dramatically affect overall cleavage efficiency. However, both triplex designs were more efficient than the single-expressed R434 suggesting that the long transcripts may affect R434 trans-activity (Fig. 7B). These differences reflect a minor (although significant) enhancing effect of trimming activity on the trans-cleavage activity of R434.
This hypothesis was tested using the pRz434TR mutant, which is unable to cleave the 3' trimming site of Rz434bis. Trans-cleavage by pRz434TR transcript was less efficient than the wild-type, confirming an enhancing role for cis-cleavage. An inactive control (pRz434ibis) presented no trans-cleavage (Fig. 8). Expression of two R434 ribozymes was tested using constructs pDR434, pDTR434 and pDR434bis containing tandem copies of the R434, TRL-5 and Rz434bis expression cassettes. Adequate release of R434 from DTR434 and DR434bis transcripts was confirmed by self-digestion assays, hi linear templates, cleavage activity was expected to be higher in all double ribozyme constructs than in one-unit cassettes. However, tandem- cloned ribozymes from pDR434did not exhibit significant changes in cleavage activity rate relative to single ribozymes from pBtV5-434. Interestingly, pDTR434 and pDR434bis had marginally better cleavage efficiency rate (<20%) than pTRL-5 and pRz434bis suggesting that the co-existence of trimming activity may enhance trans-cleavage (Fig. 9A).
Because expression from circular templates entraps R434 in long transcripts and trimming activity was expected to be a critical factor in triplex ribozyme activity, we performed cleavage assays with ccc templates. The double R434 construct (pDR434) had very poor performance because of the longer transcripts produced relative to single R434 (pBtV5-434). hi contrast, double triplex cassettes DTR434 and DR434bis greatly increased (>20%) the cleavage rate of R434 relative to their single-units (TRL-5 and R434bis, respectively) (Fig. 9B). These results indicate that individual R434 units released by trimming activity perform independently over the target. Moreover, although DTR434 had the highest activity, DR434bis presented the highest increase in cleavage activity relative to the single unit cassette (Table 1). This may reflect the advantage of using only one
ribozyme to perform both trimming and therapeutic activities. Therefore, multiple triplex hairpin systems based on one or three ribozymes can be readily adapted to express several ribozymes against the same or different targets to result in increased overall cleavage activity.
Table 1. Reaction rates for R434 ribozyme expressed from different cassettes
Cleavage rate (min"1)2 Relative activity to single R434 (%)
Cassette
Linear Circular Linear Circular
pBtV5-434 0.21 0.27 ρTRL-5 0.30 0.36 141.05 132.21 pRz434bis 0.28 0.27 132.70 98.64 pDR434 0.16 0.11 73.64 40.17 pDTR434 0.36 0.46 168.41 168.86 pDTR434bis 0.38 0.42 177.48 157.13
a Cleavage rates were estimated from adjusted cleavage plots from at least three independent experiments.
Discussion The concept of using various therapeutic nucleic acids (TNAs) against specific targets is an area that we have been investigating as an approach for the treatment of cervical cancer (Alvarez-Salas, L.M. et al. 1998 Proc Natl Acad Sci USA 95:1189-1194; Alvarez-Salas, L.M. et al. 1999 Antisense Nucleic Acid Drug Dev 9:441-450). For therapeutic purposes hairpin ribozymes require a stable and predictable behavior in vivo. However, a major obstacle for hairpin ribozyme therapeutics is their larger size relative to hammerhead ribozymes that limits efficient chemical synthesis. Currently, hairpin ribozyme application is best suited for viral delivery with the associated problems of expression and stability. Although powerful promoters have been used to improve ribozyme expression in vivo, there is a need to increase the amount of ribozyme produced and therefore novel expression systems are required.
Conventional triplex systems use hammerhead ribozymes as trimming moieties because their catalytic domain is centered between two hybridization domains favouring
design (Altschuler, M. et al. 1992 Gene 122:85-90; Yuyama, N. et al. 1992 Biochem Biophys Res Commun 186:1271-1279). Multiple triplex expression systems based on hammerhead ribozymes consisting of both trimming and therapeutic ribozymes have increased the overall cleavage efficiency of HIV-I and retinoblastoma gene mRNA (Ohkawa, J. et al. 1993 Proc Natl Acad Sd U S A 90:11302-11306; Benedict, CM. et al. 1998 Carcinogenesis 19:1223-1230). However, such triplex designs have not yet been applied to hairpin ribozymes possibly because of the ribozyme structure itself. Wild-type hairpin ribozymes hybridize and cleave a target sequence asymmetrically located 5' of the catalytic domain B. This architecture complicates a triplex design either because one of the trimming ribozymes requires a loop 3' of the catalytic domain to position the target sequence, or that the target sequence itself be located 3' of the catalytic domain. The latter approach has been successfully tested on twin hairpin ribozymes using reverse-joined domains (Schmidt, C. et al. 2000 Nucleic Acids Res 28:886-894). The designs presented here use two different approaches to exploit the natural features of hairpin ribozymes. TRL-5 design held a typical triplex layout with two trimming ribozymes flanking R434 and required positioning of the target site 3' of the catalytic domain. Rz434bis cassette used a single ribozyme to perform both cis and trans-cleavage duties. Such designs are based on the modular nature of hairpin ribozymes that can form catalytic four-way junctions with isolated domains (Shin, C. et al. 1996 Nucleic Acids Res 24:2685-2689; Komatsu, Y. et al. 1997 Biochemistry 36:9935-9940; Walter, F. et al. 1998 Biochemistry 37: 17629-17636).
Both TRL-5 and Rz434bis systems successfully released R434 resulting in increased R434 trans-cleavage efficiency when cloned in tandem. TRL-5 and Rz434bis designs displayed similar behaviors relative to each other and to previously reported triplex systems based on trimming hammerhead ribozymes (Yuyama, N. et al. 1994 Nucleic Acids Res 22:5060-5067; von Weizsacker, F. et al. 1992 Biochem Biophys Res Commun 189:743- 748). Nevertheless, the size constraints associated with the use of hairpin ribozymes should be considered when constructing multi-target systems. The use of single-ribozyme triplex designs (such as Rz434bis) has advantages compared to three-ribozyme designs because it can be expected that the variables affecting cleavage of a single ribozyme can be better controlled in vitro and in vivo. In this regard, tandem copies of Rz434bis cassette presented almost the same cleavage activity as triple-ribozyme tandems of TRL-5, suggesting that the use of several hairpin ribozymes can surpass trimming diversion allowing efficient trans- cleavage.
The synergistic cleavage activity obtained with the triplex systems implies the possibility of using a cassette that would be more efficient than their non-triplex counterparts. Independent activity of trimming ribozymes from triplex systems offers the possibility of multi-targeting the same or several transcripts using different types of ribozymes and other therapeutic RNAs to produce a more efficient gene silencing. Such a possibility has been recently shown in transgenic mice with β2-microglobulin and HIV-I targets (Andang, M. et al. 2004 Oligonucleotides 14:11-21). In the case of TRL-5, the two trimming ribozymes may release other hairpin or hammerhead ribozymes directed against HPV- 16 mRNA or even other types of TNAs such as siRNAs or even aptamers. The present results confirm the feasibility of using hairpin ribozymes as trimming moieties in triplex designs. Moreover, the first triplex system using a single hairpin ribozyme to perform trimming and therapeutic activities is described. Therefore, implementation of the triplex systems that significantly enhanced R434 in vitro activity is proposed as an alternative to the antisense oligodeoxynucleotide treatment of cervical cancer.
Example 1 Oligodeoxynucleotides and plasmids
Plasmid pBtV5-434 contains the R434 ribozyme flanked by a mutated tRNAVal and a tetraloop cloned into the BamHFXhoI and Mlul/Sacl sites of pBtVl-434 plasmid, respectively (Alvarez-Salas, L.M. et al. 1998 Proc Natl Acad Sd U S A 95:1189-1194). Triplex ribozyme expression plasmid pTRL-5 was constructed by cloning the double stranded oligodeoxyribonucleotides (dsODN) 5'-
AATTCAAACAGAGAAGTCAACCAGAGAAACACACGTTGTGGTATATTACCTGG TACCTCCTGACAGTCCTGTTTA-3' (SEQ ID NO: 5) and 5'-CG CGTGACAGTCCTGTTTCCTCCAAACAGAGAAGTCAACCAGAGAAACACACGTT GTGGTATATTACCTGGTAGAGCT-S' (SEQ ID NO: 6) into the EcoRI/Hindlll and Mlul/Sacl sites of pBtV5-434, respectively (Fig. IA). Plasmid pRz434bis contains the pBtV5-434 expression cassette (tRNAVal-R434-tetraloop) flanked by the cis-cleavage domains TL (5'- AATTCAAACAGAGAAGTCAACCATGGTACCTCCTGACAGTCCTGTTTA-S') (SEQ ID NO: 7) and TR (5'-
CGCGTGACAGTCCTGTTTCCTCCAAACAGAGAAGTCAACCAGAGCT-S ') (SEQ ID NO: 8) (Fig IB). Plasmid pRz434TR was made by inserting the dsODN 5'-
CGCGTGACAAAACTGTTTCCTCCAAACAGAGAAGTCAACCAGAGCT-S ' (SEQ ID NO: 9) (containing a mutation in the cleavage site 5'-GUC-3' of the TR domain) into the MluiySacI sites of pRz434bis. The pRz434ibis plasmid contains the inactive variant R434i in the Xhol and MM sites of pRz434bis. R434i has a triple nucleotide substitution (A24A25A26-»G24C25U26) in the catalytic domain of R434 rendering it unable to cleave the target (Alvarez-Salas, L.M. et al. 1998 Proc Natl Acad Sd U S A 95:1189-1194). The duplex constructs pDR434, pDTR434 and pDR434bis contain two tandem copies of R434, TRL-5 and Rz434bis expression cassettes cloned in the pBSKS- vector (Stratagene, La Jolla CA), respectively. AU plasmids were manually sequenced prior to in vitro transcription experiments using Sequenase V.2.0 (Amersham Biosciences, Piscataway NJ). In vitro transcription
Plasmid minipreps from template plasmids were linearized with the Sad restriction endonuclease and purified by phenol-chloroform-isoamyl alcohol (25:24:1) extraction. One μg of linearized plasmid DNA was incubated with the T3 RiboProbe in vitro transcription system (Promega Inc., Madison WI) in the presence of (X-[32P]-UTP (3000Ci/mmol, Amersham Pharmacia Biotechnologies Inc.), as described by the manufacturer. Labeled transcripts were loaded into preparative 6% polyacrylamide 7M urea denaturing gels and electrophoresed at 250V. Dried gels were exposed to X-OMAT radiographic films (Kodak Inc., NJ). Alternatively, fragments were excised from the gels and eluted in 350μl of E buffer (ImM EDTA, 0.5M ammonium acetate, 0.1% SDS, 2OU RNaseA inhibitor) overnight at 4°C. Ribozyme self-cleavage assays
Labeled full transcripts from triplex cassettes were purified through preparative denaturing gels and incubated in RZ buffer (1OmM Tris-HCl pH 7.0, 7mM MgCl2, 2mM spermidine) at 370C. Cleavage products were separated through 6% polyacrylamide 7M urea denaturing gels. Dried gels were exposed to X-OMAT films (Kodak). Ribozyme trans-cleavage assays
In vitro transcribed ribozyme RNA was incubated with a radiolabeled and purified target RNA containing HPV- 16 nt 410-445 in RZ buffer at 37°C, as previously described (Alvarez-Salas, L.M. et al. 1998 Proc Natl Acad Sd U S A 95:1189-1194). Cleavage products were separated through denaturing polyacrylamide gel electrophoresis. For circular templates, one μg of plasmid DNA was incubated directly with the T3 RiboProbe system for 30 min before addition of labeled target RNA. Dried gels were exposed to X-
OMAT films and percentages of the cleavage were determined by a Typhoon 8600 fluorographic scanner (Amersham BioSciences). Cleavage rates were estimated from adjusted cleavage plots from at least three independent experiments.
Example 2 In vivo triplex ribozvme performance
For in vivo Rz434bis self-processing testing, the HPV-16-free cervical carcinoma cell line C33-A was transfected with Rz434bis, Rz434TR and Rz434ibis cassettes cloned in the pSilencer 3.0-H1 expression vector (ρHl-R434bis, pHl-R434TR and pHl-R434ibis, respectively) and total RNA was analyzed by ribonuclease protection assays (RPA) 48 hrs post-transfection. These vectors use a RNA pol II promoter (human Hl) which is most appropriate to express small RNA not bound for translation in mammalian cells. Because R434 is protected from endogenous ribonuclease attack with a 5' tRNAVal mutant and a 3' hairpin, it was expected that the RPAs would reveal only the status of R434.
As indicated by the controls (Plus RNase and Minus RNase), the experimental conditions for the RPAs allowed the total degradation of the single-stranded probe RNA during the assay assuring that the observed bands were not due to incomplete ribonuclease digestions (Fig. 10). A control (Control +) was made by hybridizing unlabeled R434 ribozyme RNA with the pRz434bis T7 probe yielding a major 175 nt fragment corresponding to full R434 and a minor 160 nt fragment, probably reflecting some ribonuclease accessibility within R434 cassette. RNA from non-transfected and empty vector controls showed no ribozyme-specifϊc fragments. Low molecular weight bands were observed in all cellular RNA samples corresponding in size to tRNAs hybridizing with the tRNAVal antisense contained within the pRz434bis T7 probe. Interestingly, cells transfected with R434 ribozyme coding sequences had very low levels of full Rz434bis transcripts (TL- R434-TR), suggesting rapid endogenous nuclease degradation or self-processing. On the contrary, RNA from cells transfected with ρHl-Rz434bis, ρHl-R434TR and pHl-R434ibis shared bands of about 212 and 100 nt. Because these fragments appeared in the inactive ribozyme control (pHl-R434ibis), their presence is not related to self-processing but rather to endogenous nuclease activity over the full TL-R434-TR transcript. This is further confirmed by the presence of an additional 90 nt fragment in the inactive pHl-R434ibis mutant which carries no active ribozyme and thus only reflects the intracellular decay of Rz434bis transcripts. Nevertheless, a fragment corresponding in size to the isolated R434 ribozyme (175 nt) was only observed in the pHl-R434bis transfected cells. Because neither
pHl-R434TR nor pHl-R434ibis can produce isolated R434, the presence of the 175 nt fragment suggests self-processing by the Rz434bis cassette. No effects were observed in the β-actin RPAs controls. Therefore, these results show that Rz434bis cassette can self- process within the intracellular environment. MATERIALS AND METHODS Cell culture
The C33-A (ATCC HTB 31) cervical tumor line was cultured in D-MEM medium (hivitrogen Corp., Carlsbad CA) enriched with 5% fetal bovine serum. Transfections were done using lOμg of total plasmid DNA with Lipofectin reagent (Invitrogen). Cells were harvested for RNA extraction 48 lirs post-transfection. Oligodeoxynucleotides and plasmids
Plasmid pBtV5-434 contains the R434 ribozyme flanked by a mutated tRNAVal and a tetraloop cloned into the BamHIIXhoI and MluIISacI sites of pBtVl-434 plasmid, respectively. Triplex ribozyme expression plasmid pTRL-5 was constructed by cloning the double stranded oligodeoxyribonucleotides (dsODN)
5'-AATTCAAACAGAGAAGTCAACCAGAGAAACACACGTTGTGGTATATTACCT GGTACCTCCTGACAGTCCTGTTTA-3' (SEQ ID NO: 5) and 5'-CGCGTGACAGTCCTGTTTCCTCCAAACAGAGAAGTCAACCAGAGAAACACA CGTTGTGGTATATTACCTGGTAGAGCT-S' (SEQ ID NO: 6) into the EcoRIIHindIII and MluIISacI sites of pBtV5-434, respectively. Plasmid pRz434bis contains the pBtV5- 434 expression cassette (tRNAYal-R434-tetraloop) flanked by the cis-cleavage domains TL (5'-AATTCAAACAGAGAAGTCAACCATGGTACCTCCTGACAGTCCTGTTTA-S') (SEQ ID NO: 7) and TR (5'-
CGCGTGACAGTCCTGTTTCCTCCAAACAGAGAAGTCAACCAGAGCT-S ') (SEQ ID NO: 8). Plasmid pRz434TR was made by inserting the dsODN 5'- CGCGTGACAAAACTGTTTCCTCCAAACAGAGAAGTCAACCAGAGCT-S' (SEQ ID NO: 9) (containing a mutation in the cleavage site 5'-AGUC-3' of the TR domain) into the MluIISacI sites of pRz434bis. The pRz434ibis plasmid contains the inactive variant R434i in the Xhol and MIuI sites of pRz434bis. R434i has a triple nucleotide substitution (A24A25A26-^G24C25U26) in the catalytic domain of R434 rendering it unable to cleave the target. The duplex constructs pDR434, pDTR434 and pDR434bis contain two tandem copies of R434, TRL-5 and Rz434bis expression cassettes cloned in the pBSKS- vector (Stratagene, La Jolla CA), respectively. In vivo ribozyme expression was tested using the
pHl-R434bis, pHl-R434TR and pHl-R434ibis plasmids containing the BamHI-SacI fragments from pRz434bis, pRz434TR and pRz434ibis plasmids cloned in the eukaryotic expression vector pSilencer™ 3.0-H1 (Ambion Inc., Austin TX)5 respectively. AU plasmids were manually sequenced prior in vitro transcription experiments using Sequenase™ V.2.0 (Amersham Biosciences, Piscataway, NJ). RNase protection assays (RPAs)
For ribozyme probing, 25μg of total RNA were hybridized with a 32P-labeled antisense RNA probe produced from T7-transcribed pRz434bis plasmid and processed with the Direct Protect™ Lysate RPA kit as described by the manufacturer (Ambion). For β- actin probing, 15 μg of total RNA were used. Protected RNA fragments were separated through denaturing 7M urea 6% polyacrylamide gels. Dried gels were exposed to X- OMAT radiographic films.
Example 3 In vivo triplex ribozyme performance For in vivo analysis of Rz434bis trans-cleavage, the HPV-16 positive cell line SiHa was co-transfected with the reporter pCR3.1-GFP and plasmids pHl-R434bis, pHl-R434m and pHl-R434ibis expressing the single ribozyme triplex cassette, a partial processing mutant and an inactive ribozyme, respectively. Transfected cells were sorted by GFP fluorescence in a flow cytometer and total RNA extracted. RT-PCR analysis showed that pHl-R434bis and ρHl-R434ibis significantly diminished the HPV-16 E6/E7 mRNA levels relative to the non-transfected control (NT) (Fig. 11). The partial processing control pHl- R434m had a minor effect. Although the three ribozymes affected in some degree the HPV-16 E6/E7 levels, the greatest effect was produced by pHl-R434bis and pHl-R434ibis. The effect of the R434ibis inactive ribozyme has been previously reported by us and is associated to a passive antisense effect (Alvarez-Salas, L.M. et al. 1998 Proc Natl Acad Sd USA 95:1189-1194). Surprisingly, the R434m control had lesser effect suggesting that the intracellular structure of R434m RNA does not favor hybridization with the target. MATERIALS AND METHODS Cell culture The SiHa (ATCC HTB-35) cervical tumor line was cultured in D-MEM medium
(Invitrogen Corp., Carlsbad CA) enriched with 5% fetal bovine serum. Transfections were done using lOμg of total plasmid DNA with Lipofectin reagent (Invitrogen). Cells were harvested for RNA extraction 48 hrs post-transfection.
Oligodeoxynucleotides and plasmids
Plasmid pBtV5-434 contains the R434 ribozyme flanked by a mutated tRNAVal and a tetraloop cloned into the BamHI/XhoI and Mlul/Sacl sites of pBtVl-434 plasmid, respectively. Triplex ribozyme expression plasmid pTRL-5 was constructed by cloning the double stranded oligodeoxyribonucleotides (dsODN) 5'-
AATTCAAACAGAGAAGTCAACCAGAGAAACACACGTTGTGGTATATTACCTGG TACCTCCTGACAGTCCTGTTTA-3' (SEQ ID NO: 5) and 5'- CGCGTGACAGTCCTGTTTCCTCCAAACAGAGAAGTCAACCAGAGAAACACACG TTGTGGTATATTACCTGGTAGAGCT-S ' (SEQ ID NO: 6) into the EcoRI/Hindlll and Mlul/Sacl sites of pBtV5-434, respectively. Plasmid pRz434bis contains the ρBtV5-434 expression cassette (tRNAVal-R434-tetraloop) flanked by the cis-cleavage domains TL (5'- AATTCAAACAGAGAAGTCAACCATGGTACCTCCTGACAGTCCTGTTTA-S ') (SEQ ID NO: 7) and TR (5'-
CGCGTGACAGTCCTGTTTCCTCCAAACAGAGAAGTCAACCAGAGCT-S ') (SEQ ID NO: 8). Plasmid pRz434TR was made by inserting the dsODN 5'- CGCGTGACAAAACTGTTTCCTCCAAACAGAGAAGTCAACCAGAGCT-S' (SEQ ID NO: 9) (containing a mutation in the cleavage site 5'-AGUC-3' of the TR domain) into the Mlul/Sacl sites of pRz434bis. The pRz434ibis plasmid contains the inactive variant R434i in the Xhol and MIuI sites of pRz434bis. R434i has a triple nucleotide substitution (A24A25A26-»G24C25U26) in the catalytic domain of R434 rendering it unable to cleave the target. The duplex constructs pDR434, pDTR434 and pDR434bis contain two tandem copies of R434, TRL-5 and Rz434bis expression cassettes cloned in the pBSKS- vector (Stratagene, La Jolla CA), respectively. In vivo ribozyme expression was tested using the pHl-R434bis, pHl-R434TR and pHl-R434ibis plasmids containing the BamHI-SacI fragments from pRz434bis, pRz434TR and pRz434ibis plasmids cloned in the eukaryotic expression vector pSilencer™ 3.0-H1 (Ambion Inc., Austin TX), respectively. AU plasmids were manually sequenced prior in vitro transcription experiments using Sequenase™ V.2.0 (Amersham Biosciences, Piscataway NJ). Reverse transcription coupled PCR assays (RT-PCR) Total RNA was obtained from SiHa cells using the TRIZOL reagent as described by the manufacturer (Life Technologies). RT-PCR was performed with one μg of total RNA using the Superscript II One Shot kit (Invitrogen). Briefly, the first strand cDNA synthesis at 45°C for 30 min was followed by a denaturation step at 92°C for 2 min and 25
amplification cycles using denaturation step at 920C for one min, hybridization step at 45°C for 45 sec and polymerization step at 720C for one min. The HPV- 16 E6/E7 mRNA specific set of primers E6U (5'-CAGCAATACAACAAACCG-S') (SEQ ID NO: 10) nt 371-388 and E7L (S'-TAGATTATGGTTTCTGAGAACA-S') (SEQ ID NO: 11) hybridizing within the E7 gene nt 862-841, have been previously used to detect HPV-16 E6/E7 DNA and mRNA (Alvarez-Salas, L.M. et al. 1998 Proc Natl Acad Sd U S A 95:1189-1194; Alvarez-Salas, L.M. et al. 1999 Antisense Nucleic Acid Drug Dev 9:441- 450.). This amplification produced a HPV-16 E6/E7-specific DNA fragment of 492 bp. As a RNA integrity control, the β-actin gene was probed with the oligonucleotide set 5'- TGACGGGGTCACCCACACTGTGCCCATCTA-S' (SEQ ID NO: 12) and 5'- CTAGAAGCATTTGCGG TGGACGATGGAGGG-S1 (SEQ ID NO: 13), using the PCR conditions described by the manufacturer (Stratagene, La Jolla CA). Amplified products were separated in 1.5% agarose gels and visualized with long-wave UV-light after ethidium bromide staining.
While the present invention has been described in some detail for purposes of clarity and understanding, one skilled in the art will appreciate that various changes in form and detail can be made without departing from the true scope of the invention. All figures, tables, and appendices, as well as patents, applications, and publications, referred to above, are hereby incorporated by reference.
Claims
1. A recombinant plasmid or expression vector comprising a sequence encoding a 5' binding sequence containing a self-cleavage site, a cis- and trans-acting hairpin ribozyme and a target binding sequence, and a 3' binding sequence containing a self-cleavage site, which produces a RNA transcript that contains only one ribozyme and that undergoes self-catalyzed cleavage at the 5' and 3' sides of the cis- and trans-acting hairpin ribozyme.
2. A recombinant plasmid or expression vector encoding 1-100 units of a 5' binding sequence containing a self-cleavage site, a cis- and trans-acting hairpin ribozyme and a target binding sequence, and a 3' binding sequence containing a self-cleavage site, which produces an equivalent number of RNA transcripts connected in tandem that each contain only one ribozyme and that undergo self-catalyzed cleavage at the 5' and 3' sides of each cis- and trans-acting hairpin ribozyme.
3. A method of producing RNA transcripts self-cleaved at the 5' and 3' sides of the cis- and trans-acting hairpin ribozyme comprising subjecting the recombinant plasmid or expression vector of Claims' 1 or 2 to transcription conditions and allowing RNA transcripts to be self-cleaved.
4. A transformant comprising a cell of a host which is transformed with the recombinant plasmid or expression vector of Claims 1 or 2.
5. The recombinant plasmid or expression vector of Claims 1 or 2 further comprising a tissue-specific or virus-specific promoter binding site upstream from the sequence encoding the 5' binding sequence containing the self-cleavage site, the cis- and trans-acting hairpin ribozyme and the target binding sequence, and the 3' binding sequence containing the self-cleavage site.
6. The recombinant plasmid or expression vector of Claims 1 or 2 comprising a sequence that encodes the 5' binding sequence containing the self-cleavage site, the cis- and trans-acting hairpin ribozyme, and the 3' binding sequence containing the self-cleavage site having the sequence shown in SEQ ID NO:2.
7. The recombinant plasmid or expression vector of Claims 1 or 2 comprising the nucleotide sequence that encodes the ribozyme shown in SEQ ID NO: 2.
8. The recombinant plasmid or expression vector of Claims 1 or 2 comprising a sequence having 85%-99% sequence identify with the nucleotide sequence that encodes the ribozyme shown in SEQ ID NO: 2, wherein the target binding site binds to a different RNA sequence.
9. The recombinant plasmid or expression vector of Claims 1 or 2 comprising a sequence having 95%-99% sequence identity with the nucleotide sequence that encodes the ribozyme shown in SEQ ID NO: 2, wherein the target binding site binds to a different RNA sequence.
10. The recombinant plasmid or expression vector of Claims 1 or 2 comprising a sequence having 85%-99% sequence identify with the nucleotide sequence that encodes the ribozyme shown in SEQ ID NO: 2.
11. The recombinant plasmid or expression vector of Claims 1 or 2 comprising a sequence having 95%-99% sequence identity with the nucleotide sequence that encodes the ribozyme shown in SEQ ID NO: 2.
12. The recombinant plasmid or expression vector of Claims 1 or 2, wherein the catalytic domain of the cis- and trans-acting hairpin ribozyme has the sequence of SEQ ID NO: 3.
13. The recombinant plasmid or expression vector of Claims 1 or 2 encoding SEQ ID NO: 2, wherein the target binding site binds to a different RNA sequence.
14. The transcript encoded by the recombinant plasmid or expression vector of Claims 1 or 2.
15. A liposome preparation comprising the recombinant plasmid or expression vector of Claims 1 or 2 in combination with a liposome.
16. A recombinant virus comprising the sequence of the recombinant plasmid or expression vector of Claims 1 or 2 in combination with a viral gene vector.
17. A method of treating a subject having a proliferative disease by inhibiting cell proliferation comprising administering to the subject the recombinant plasmid or expression vector of Claims 1 or 2 in which the cis- and trans-acting hairpin ribozyme is targeted to an RNA that is essential to cell growth, whereby the transcript is expressed, production of an essential RNA is inhibited, cell proliferation is inhibited, and the proliferative disease is treated.
18. A method of treating a subject having cervical cancer comprising administering to the subject the recombinant plasmid or expression vector of Claims 1 or 2 encoding SEQ ID NO: 2, whereby the transcript is expressed in the cervix and the cervical cancer is treated.
19. A method of treating a viral infection in a subject comprising administering to the subject the recombinant plasmid or expression vector of Claims 1 or 2, wherein the encoded target RNA-specific binding site is specific for an RNA unique to the infectious agent, whereby the transcript is expressed and the infectious agent is killed.
20. A transgenic non-human animal, containing, in a germ or somatic cell, the recombinant plasmid or expression vector of Claims 1 or 2.
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US67507605P | 2005-04-25 | 2005-04-25 | |
| US60/675,076 | 2005-04-25 | ||
| US78711906P | 2006-03-29 | 2006-03-29 | |
| US60/787,119 | 2006-03-29 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2006116294A1 true WO2006116294A1 (en) | 2006-11-02 |
Family
ID=36681436
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2006/015443 Ceased WO2006116294A1 (en) | 2005-04-25 | 2006-04-24 | A single ribozyme to catalyze both trimming and trans-acting catalysis |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2006116294A1 (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1995031552A2 (en) * | 1994-05-13 | 1995-11-23 | The Government Of The United States Of America, Represented By The Secretary, Department Of Health And Human Services | Human papilloma virus inhibition by a hairpin ribozyme |
| WO2004027044A2 (en) * | 2002-09-23 | 2004-04-01 | The Government Of The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Triplex hairpin ribozyme |
-
2006
- 2006-04-24 WO PCT/US2006/015443 patent/WO2006116294A1/en not_active Ceased
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1995031552A2 (en) * | 1994-05-13 | 1995-11-23 | The Government Of The United States Of America, Represented By The Secretary, Department Of Health And Human Services | Human papilloma virus inhibition by a hairpin ribozyme |
| WO2004027044A2 (en) * | 2002-09-23 | 2004-04-01 | The Government Of The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Triplex hairpin ribozyme |
Non-Patent Citations (3)
| Title |
|---|
| ALVAREZ-SALAS L M ET AL: "Inhibition of HPV-16 E6/E7 immortalization of normal keratinocytes by hairpin ribozymes", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF USA, NATIONAL ACADEMY OF SCIENCE, WASHINGTON, DC, US, vol. 95, no. 3, 3 February 1998 (1998-02-03), pages 1189 - 1194, XP002317756, ISSN: 0027-8424 * |
| KOMATSU Y ET AL: "A new type of hairpin ribozyme consisting of three domains", BIOCHEMISTRY, AMERICAN CHEMICAL SOCIETY. EASTON, PA, US, vol. 36, no. 32, 12 August 1997 (1997-08-12), pages 9935 - 9940, XP002090345, ISSN: 0006-2960 * |
| KOMATSU YASUO ET AL: "Modification and application of self-trimming hairpin ribozymes to targeting a transcribed RNA in vitro", JOURNAL OF BIOCHEMISTRY (TOKYO), vol. 124, no. 5, November 1998 (1998-11-01), pages 986 - 991, XP002392145, ISSN: 0021-924X * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Lieber et al. | Selection of efficient cleavage sites in target RNAs by using a ribozyme expression library | |
| EP3222723B1 (en) | Development of universal cancer drugs and vaccines | |
| EP0360257B1 (en) | RNA catalyst for cleaving specific RNA sequences | |
| Hoeprich et al. | Bacterial virus phi29 pRNA as a hammerhead ribozyme escort to destroy hepatitis B virus | |
| JP4463554B2 (en) | In vitro synthesis method of short double-stranded RNA | |
| US20090311788A1 (en) | Multiple-compartment eukaryotic expression systems | |
| CN109642241B (en) | Trans-splicing RNA (tsRNA) | |
| KR20120008094A (en) | Multiple Promoter Expression Cassettes for Simultaneous Delivery of JRAi Formulations | |
| CA2346155A1 (en) | Enzymatic synthesis of ssdna | |
| WO2006096018A1 (en) | Small interfering rna and pharmaceutical composition for treatment of hepatitis b comprising the same | |
| Venturini et al. | Kinetic selection of HPV 16 E6/E7-directed antisense nucleic acids: anti-proliferative effects on HPV 16-transformed cells | |
| JP4908631B2 (en) | Allosteric trans-splicing group I ribozyme whose target-specific RNA replacement activity is regulated by theophylline | |
| US20080207539A1 (en) | Self-Processing Rna Expression Cassette | |
| Ploner et al. | Methodological obstacles in knocking down small noncoding RNAs | |
| JP2003511025A (en) | Modification of gene expression by ssDNA produced in vivo | |
| US20050260163A1 (en) | Triplex hairpin ribozyme | |
| Peng et al. | shRNA driven by Pol II/T7 dual-promoter system effectively induce cell-specific RNA interference in mammalian cells | |
| WO2006116294A1 (en) | A single ribozyme to catalyze both trimming and trans-acting catalysis | |
| Li et al. | Effective inhibition of human cytomegalovirus gene expression and growth by intracellular expression of external guide sequence RNA | |
| KR20100038429A (en) | Linear double-stranded rna molecule interfering with different target genes | |
| JP2006500017A (en) | Adenoviral VA1 PolIII expression system for RNA expression | |
| KR102696359B1 (en) | Systems and methods for cell-type-specific translation of RNA molecules in eukaryotes | |
| Liu et al. | Engineering of highly active gene targeting RNase P ribozyme against human cytomegalovirus infection | |
| WO2006130976A1 (en) | Interfering rnas, methods for their production, and use | |
| Puerta-Fernández et al. | Anchoring hairpin ribozymes to long target RNAs by loop–loop RNA interactions |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| NENP | Non-entry into the national phase |
Ref country code: RU |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 06751226 Country of ref document: EP Kind code of ref document: A1 |
