WO2006098428A1

WO2006098428A1 - Method of lessening nonspecific amplification from primer dimer

Info

Publication number: WO2006098428A1
Application number: PCT/JP2006/305372
Authority: WO
Inventors: Yoshihide Hayashizaki; Yasumasa Mitani; Chiaki Kato
Original assignee: Kabushiki Kaisha Dnaform
Priority date: 2005-03-17
Filing date: 2006-03-17
Publication date: 2006-09-21
Also published as: JP2006254784A

Abstract

It is intended to provide a method of suppressing a nonspecific amplification reaction accompanying primer dimer formation in a nucleic acid amplification reaction characterized by comprising adding a substance capable of binding to the primer dimer to a sample. As the substance capable of binding to the primer dimer, use can be made of a substance capable of recognizing mismatch such as a mismatch-binding protein or a substance having a DNA recombination ability such as a DNA recombinase.

Description

Methods for reducing non-specific amplification from primer dimers

Technical field

The present invention relates to a method for improving a nucleic acid amplification method, and more particularly to a method for reducing non-specific amplification of a primer dimarker formed during nucleic acid amplification.

Background art

[0002] Nucleic acid amplification techniques such as PCR have various known powers. Primers are commonly used to form primer dimers in which all primers are paired. In particular, when two types of primers are used, there is a problem that when a primer dimer is generated, it acts as a cage DNA and a non-specific amplification product is produced. This is because primers are consumed in non-specific amplification reaction, which is not only the problem that other DNA fragments are mixed into the original DNA product, and the efficiency of the target DNA amplification is reduced. Cause problems.

In order to solve such a problem, it is important to first design a primer that is difficult to form a primer dimer. Primer design needs to take into account various factors such as oligonucleotide length, Tm value, physical sequence characteristics, and possible primer interactions. This alone completely solves the problem of primer dimers. I can't. In order to solve the problem of non-specific amplification products by primer dimers, the non-specific amplification product and the target DNA product are separated by electrophoresis, and the target amplification product band is cut out or amplified. There are methods such as applying the reaction solution after the reaction to a spin column. Examples of the latter include Ultra PCR Clean -Up kit (Nippon Genetec) and Bay Gene PCR Clean -Up Kit (Bay Gene). .

[0004] On the other hand, detection methods capable of distinguishing between non-specific amplification products and target products associated with primer dimer formation have also been developed. For example, when amplification is performed by PCR, there is a detection method that can distinguish between fluorescence derived from the target product and fluorescence caused by non-specific binding such as primer dimer by continuous monitoring. In addition, the dye QSY7 or QSY9 is bound to the 5 'end of the primer, and the fluores such as SYBR Green bound to the primer dimer. Primers designed to quench fluorescence near the mouth fore have also been developed. In the case of the target amplification product, the bound nucleic acid dye molecule such as SYBR Green fluoresces away from the quencher, but it is short like a primer dimer, and the strand is fluorescent by the quencher. Therefore, a signal of only the target amplification product can be obtained.

[0005] Furthermore, various methods for suppressing the reaction itself have been developed. When performing an amplification reaction, a primer-dimer is more likely to form non-specific nucleic acid amplification because a DNA-dimer is more likely to be formed at low temperatures, and DNA polymerases usually have some activity even at low temperatures. As a method for preventing this, a hot start method can be mentioned. This is a method in which the reaction of DNA polymerase occurs only after raising the temperature of the reaction solution. Specific examples include a method for adding components that are deficient at high temperatures, a wax barrier method, a method using a DNA polymerase antibody or an abutama, and a method using a DNA polymerase that is activated by heat treatment. . However, these methods have problems such as complicated operations and the need for expensive reagents such as antibodies. In addition, it cannot be used for amplification reactions that originally have a low reaction temperature.

Disclosure of the invention

[0006] As described above, a method for distinguishing a non-specific amplification product from a target product associated with primer dimer formation and a method for reducing the amplification of a non-specific amplification product have been developed. An easy and effective method has not yet been found.

[0007] Accordingly, an object of the present invention is to provide an efficient and easy-to-operate method for preventing amplification of a non-specific amplification product due to formation of a primer dimer.

[0008] The present invention provides a novel method for suppressing non-specific amplification due to the formation of the primer dimer as described above.

[0009] The inventors added a substance that binds to a dimer dimer, such as a mismatch binding protein or a recombinant enzyme protein, to the amplification reaction solution, thereby non-specific due to the formation of the primer dimer. It has been found that amplification can be significantly reduced. These proteins bind to the non-complementary pairing part of the primer dimer and stop the DNA strand extension reaction from the 3 ′ end by the DNA polymerase. As a result, primer dimer From one, non-specific amplification is reduced.

[0010] That is, the present invention provides a method for suppressing a nonspecific amplification reaction associated with primer dimer formation, which comprises adding a substance that binds to a primer dimer in a nucleic acid amplification reaction to a sample.

In this method, as a substance that binds to the primer dimer, a substance having mismatch recognition ability, preferably a mismatch binding protein can be used. Examples of the mismatch binding protein include MutS, MSH2, MSH6, or a mixture thereof. The substance that binds to the primer dimer can be added to the sample at a concentration of 0.1% to 10%, preferably 0.5% to 2%, more preferably 0.7% to 1.3%.

[0012] In this method, a substance having a DNA recombination ability, preferably a DNA recombination enzyme, can be used as the substance that binds to the primer dimer. Examples of DNA recombinant enzymes include RecA protein, T4 gene or single-stranded binding protein

[0013] In addition, as another aspect of the present invention, a nucleic acid of interest comprising a substance that binds to a primer dimer, a step of adding a primer to a sample, and a step of incubating the sample. A method for amplifying a region, a method for determining the presence or absence of a target nucleic acid sequence, or a method for determining the presence or absence of a mutation, deletion and Z or insertion in a target nucleic acid sequence are provided.

[0014] In these methods, a substance having mismatch recognition ability, preferably a mismatch binding protein can be used as the substance that binds to the primer dimer. Examples of the mismatch-binding protein include MutS, MSH2, MSH6, or a mixture thereof.

[0015] In these methods, a substance having DNA recombination ability, preferably a DNA recombination enzyme, can be used as the substance that binds to the primer dimer. An example of the DNA recombination enzyme is RecA protein.

[0016] As a nucleic acid amplification method in these methods, a PCR method or an isothermal amplification method can be used.

Examples of isothermal amplification reactions include the SDA method, 3SR method, NASBA method, TMA method, Q beta-replicase method, LAMP method, and ICAN method. [0017] Further, the primer used in the isothermal amplification method includes at least two kinds of primer sets capable of amplifying the target nucleic acid sequence, and the first primer included in the primer set is a target nucleic acid sequence. A sequence (Ac ') that hybridizes to the sequence (A) of the 3' terminal portion of the first primer on the 3 'side of the first primer, and a sequence that is 5' to the target nucleic acid sequence from the sequence (A) A sequence (Β ′) that hybridizes to the complementary sequence (Be) of (B) is included on the 5 ′ side of the sequence (Ac ′), and the second primer included in the primer set is the target nucleic acid. The two nucleic acid sequences that hybridize to the sequence (Cc ') of the 3' end part of the complementary sequence (Cc) in the 3 'end part and that mutually hybridize and hybridize on the same strand Including the folded array (D—Dc ′) 5 ′ of the array (Cc ′) Those which comprise the use. Such a primer set is described in detail in PCTZJP04Z019349.

[0018] According to the present invention, a mismatch binding protein or a recombinant enzyme protein binds to a mismatch sequence that is a force between primers, suppresses the amplification, and further causes only the target sequence-specific amplification, The effect of improving sensitivity and specificity for amplifying the target sequence can be obtained.

[0019] This method can be applied to a wide range of amplification and detection fields from infectious diseases to SNPs and mutations.

Brief Description of Drawings

[0020] FIG. 1 is a diagram showing the positional relationship of each primer region with respect to the human STS DYS237 gene.

FIG. 2 is a diagram showing the three-dimensional structure of forward primer F1.

FIG. 3 is a graph showing the results of Example 1.

FIG. 4 is a diagram showing the positional relationship of each primer with respect to the CYP2C 19 sequence.

FIG. 5 shows the results of Example 2.

BEST MODE FOR CARRYING OUT THE INVENTION

[0021] When a (mismatch) base pair is generated that cannot be partially paired with a double strand of DNA, bacteria and yeast already have a mechanism for repairing this. Are known. This repair is called a “mismatch binding protein” (“mismatch recognition protein”). MutS protein bound to MutS protein (JP 9-504699), MutM protein (JP 2000-300265), GFP (Green Fluore scence Protein) The use of various mismatch binding proteins such as (WO99 / 06591 pamphlet) has been reported. Furthermore, in recent years, genetic diagnostic methods that detect mismatches using mismatch binding proteins have been developed (M. Gotoh et al., Genet. Anal., 14, 47-50, 1997). Methods for detecting polymorphisms and mutations at specific nucleotides in nucleic acids include, for example, non-mutated control nucleic acids and mutations.

There is known a method of detecting a mismatch by hybridizing with a test nucleic acid suspected to be performed and introducing a mismatch recognition protein therein.

[0022] In the present invention! / “Mismatch” means a set of base pairs selected from adenine (Α), guanine (G), cytosine (C), and thymine (T) (uracil (U) in the case of RNA). Is not a normal salt pair (a combination of Α and Τ or a combination of G and C). Mismatches include not only one mismatch, but also multiple consecutive mismatches, mismatches caused by insertions and deletions of one or more bases, and combinations thereof.

[0023] A primer dimer has a double-stranded structure in which a part or the whole of a primer is paired with another primer and includes a non-complementary region. Such a heteroduplex structure results in a false amplification product that should not be produced. Therefore, if a mismatch binding protein is added to the reaction solution used for the nucleic acid amplification reaction, the mismatch binding protein binds to the heteroduplex structure as described above, and the subsequent amplification reaction is hindered. Therefore, by using a mismatch binding protein, it is possible to prevent the generation of an erroneous amplification product.

[0024] The mismatch binding protein used in the present invention may be any protein known to those skilled in the art as long as it is a protein that recognizes a mismatch in a double-stranded nucleic acid and can bind to the mismatch site. It may be a thing. Mismatch binding proteins used include MutS, MutH, MutL, HexA, MSH1-6, Rep3, RNaseA, uracil DNA glycosidase, T4 endonuclease VII, and resolvase. Preferably, it is MutS, MSH2 or MSH6, or a mixture of two or more thereof, more preferably a force that is MutS, but is not limited thereto.

[0025] In addition, the mismatch binding protein used in the present invention has one or more amino acid substitutions, deletions, additions, and Z in the amino acid sequence of the wild-type protein as long as the mismatch in the double-stranded nucleic acid can be recognized. Alternatively, it may be an inserted amino acid sequence protein (variant). Such mutants can also be created artificially by forces that may occur in nature.

[0026] Many methods are known for introducing amino acid mutations into proteins. For example, site-directed mutagenesis methods include WP DengiJ. A. Nickoloff's method (An al. Biochem., 200, 81, 1992), KL Makamaye and F. Eckstein's method (Nucleic Adids Res., 14 , 9679-9698, 1986), and random mutagenesis methods include methods using E. coli XL1-Red strain (Stratagene) deficient in the basic repair system, sodium nitrite, etc. CF. — J. Diaz et al., BioTechnique, 11, 204— 211, 1991). There are many known mismatch binding proteins such as MutM, MutS and their analogs (Radman, M. et al., Annu. Rev. Genet. 20: 523 -538 ( 1986); Radaman, M. etal., Sci. Amer., August 1988, pp40-46; Modrich, P., J. Biol. Chem. 264: 6597-6600 (1989); Lahue, RS et al., Science245 : 160-164 (1988); Jiricny, J. et al,. Nucl. Acids Res. 16: 7843-7853 (1988); Su, SS et al., J. Biol. Chem. 263: 6829— 6835 (1 988); Lahue, RS et al., Mutat. Res. 198: 37—43 (1988); Dohet, C. et al., Mol. Gen. Gent. 206: 181-184 (1987); Jones, M. et al., Gentics 11 5: 605-610 (1987); Salmonella typhimurium Muts (Lu, AL, Genetics 118: 593-600 (1988); HaberL. T. et al., J. Bacteriol. 170: 197 — 202 (1988); Pang, PP et al., J. Bacteriol. 163: 1007—1015 (1985)); and Priebe SD et al., J. Bacterilo. 170: 190—196 (1988)).

[0027] The mismatch binding protein may also bind to a single-stranded nucleic acid, and the binding of such a mismatch binding protein to a single-stranded nucleic acid is inhibited by the single-stranded binding protein. It is known that Therefore, when a mismatch binding protein is used in the mutation detection method according to the present invention, it is preferable to use a single chain binding protein in combination.

[0028] The single-stranded binding protein (SSB) used to inhibit the binding of the mismatch binding protein to the single-stranded nucleic acid can be any SSB known in the art. Preferred SSBs include single-stranded binding proteins from E. coli, Drosophila, and Xenopus laevis, and the gene 32 protein from T4 butteriophage, and their equivalents from other species. It is not limited to.

[0029] In addition, the single-stranded binding protein used in the present invention has one or more amino acid substitutions, deletions, attached calories and Z in the amino acid sequence of the wild-type protein as long as it can bind to the single-stranded nucleic acid. Alternatively, it may be a protein (mutant) having an inserted amino acid sequence ability. Such mutants can also be created artificially by forces that may occur in nature.

[0030] In addition, the mismatch binding protein may bind to a double-stranded nucleic acid that does not contain a mismatch, and the mismatch binding protein is activated by using an activator. It is known that such mismatch binding protein can be prevented from erroneous binding. Therefore, when a mismatch binding protein is used in the mutation detection method according to the present invention, it is preferable to use a protein that has been activated by a mismatch binding protein activator.

[0031] An active agent for activating the mismatch binding protein can be appropriately selected by those skilled in the art. As active agents for activating mismatch binding proteins, ATP (adenosine 5, monotriphosphate), ADP (adenosine 5, monodiphosphate), ATP—γ S (adenosine 5,- 0- (3-thiotriphosphate)), AMP-ΡΝΡ (adenosine 5, mono [β, y imido] triphosphate), or one of the nucleotides that can bind to mismatch-binding proteins. It is not limited to these. The activity of the mismatch binding protein can be performed by incubating the mismatch binding protein and the active agent at room temperature for several seconds to several minutes.

[0032] The recombinant enzyme protein used in the present invention can be appropriately selected by those skilled in the art. Example For example, RecA protein can be used.

[0033] The present invention will be described in more detail with reference to the following examples. However, the present invention is not intended to be limited or limited by the examples.

Example 1

[0034] [Amplification of target nucleic acid sequence in human STS DYS237 gene]

In this example, human genomic DNA (manufactured by Clontech) was used as a cage, and the target nucleic acid sequence in the human STS DYS237 gene contained therein was amplified. As a primer, a primer pair having the following sequence was used. The positional relationship of each primer region with respect to the saddle type was as shown in FIG. 1 (SEQ ID NO: 1). In the forward primer F1, the sequence on the 3 'end side (22mer: underlined portion) anneals in a saddle shape, and the sequence on the 5' end side (16mer: other than the underlined portion) is folded within that region. It is designed to take the structure shown in. Reverse primer R1 has its 3 terminal sequence (20mer: underlined) annealed in a saddle shape, and after extension reaction, 5 'terminal sequence (lOmer: other than underlined) 1S depends on the primer It is designed to hybridize to the region on the extension strand that begins 16 bases downstream of the 3 'terminal residue of the primer.

[0035] Primer pair: No. 1)

R1: GCAGCATCACCAACCCAAAAGCACTGAGTA (SEQ ID NO: 2)

[0036] A 25 μL reaction solution having the following composition was prepared and incubated at 60 ° C for 1 hour. The type 反応 was allowed to react with double strands. The same experiment was performed on a solution to which sterilized water was added instead of the bowl.

[0037] The composition of the reaction solution is as follows. Tris-HCl (20mM, pH8.8), KCl (10m

M) ゝ (NH) SO (lOmM) ゝ MgSO (8 mM) ゝ DMSO (3%), Triton X—100 (1

4 2 4 4

%), DNTP (l. 4 mM), 2000 nM of each of the above primer pairs and saddle type (100 ng), 16 U of Bst DNA polymerase (NEW ENGLAND BioLabs), SYBR GREEN I (Molecular Probe) (100 , 000 times dilution), MutS (0.8 g) in 25 L. Table 1 shows the composition of each sample. [0038] [Table 1]

[0039] The results are shown in FIG. In the figure, san represents sample 1, ○ represents sampnore 2, and ▲ represents sample 4. Samples 3, 5, and 6 always had a fluorescence intensity of 0 during the measurement period. Comparing the results of sample 1 and sample 2, the amplification rate of sample 2 is slightly slower. When MutS is not added, the primer is consumed by a non-specific amplification reaction using the formed primer dimer as a cage, which may have a slight effect on the amplification efficiency of the target region. Possible reason. In sample 4, amplification is seen over the course of the force time, which should not occur in the amplification reaction, since it is essentially free of cage DNA. This is thought to be nonspecific amplification due to the formation of primer dimers. In contrast, no amplification was observed in sample 3, indicating that MutS is effective in suppressing nonspecific amplification.

Example 2

[0040] [Detection of human CYP2C19 gene]

Human CYP2C19 gene was detected. As a primer, a primer having the following base sequence ability was designed. The relationship between each primer and the target base sequence is as shown in FIG.

[0041] RA (R1 + R2) Z SEQ ID NO: 3

TTTCTCCAAAATATC one 3,

Outer primer R3Z SEQ ID NO: 4 5,-AGGGTTGTTG ATGTCC ATC 3 '

FA (F1 + F2) Z SEQ ID NO: 5

AATAAATTATTGTTTTCTCTTAG-3 '

Outer primer F3Z SEQ ID NO: 6

5 CCAGAGCTTGGCATATTGTATC 3 '

[0042] pBlues cript II (linearized with EcoRI) 10-19 molZtube (approx. 60,000 molecules) with the human CPY2C gene incorporated into the cocoon shape at 60 ° C The reaction was performed for 2 hours. The vertical type was allowed to react with two strands. The composition of the reaction solution is as follows.

[0043] · Reaction solution composition (in 25 μL)

20 mM Tris-HCl pH 8.8

10 mM KC1

10 mM (NH) SO

4 2 4

4 mM MgSO

Four

1M Betaine

0.1% TritonX—100

0.4 mM dNTP

8U Bst DNA polymerase (NEW ENGLAND BioLabs)

SYBR GREEN I (Molecular Probe) (concentration at which the final dilution is 100,000)

)

0.e ^ g MutS

[0044] Primer:

1600nM FA

1600nM RA

200nM F3

200nM R3

Table 2 shows the composition of each sample reaction solution. [0045] [Table 2]

[0046] The results are shown in FIG. In the figure, 參 represents sample 1, ▲ represents sample 2, and X represents sample 3. Sample 4 always had a fluorescence intensity of 0 during the measurement period. Comparing the results of amplifying samples 3 and 4, the non-specific amplification was observed after 1 hour in the absence of MutS and in the absence of 铸 -type DNA. It turned out that it can suppress almost completely. As a result, MutS is considered to have the effect of improving sensitivity and specificity for detecting specific sequences.

Claims

The scope of the claims

[I] A method for suppressing nonspecific amplification reaction associated with primer dimer formation, which comprises adding a substance that binds to primer dimer to a sample in a nucleic acid amplification reaction.

[2] The method according to claim 1, wherein the substance that binds to the primer dimer is a substance having mismatch recognition ability.

[3] The method according to claim 2, wherein the substance having mismatch recognition ability is a mismatch binding protein.

[4] The method of claim 3, wherein the mismatch binding protein is MutS, MSH2, MSH6, or a mixture thereof.

[5] The method according to any one of claims 1 to 4, wherein a substance that binds to the primer dimer is added to the sample at a concentration of 0.1% to 10%.

[6] The method of claim 5, wherein a substance that binds to the primer dimer is added to the sample at a concentration of 0.5% to 2%.

[7] The method of claim 6, wherein the substance that binds to the primer dimer is added to the sample at a concentration of 0.7% to 1.3%.

[8] The method of claim 1, wherein the substance that binds to the primer dimer is a substance having DNA recombination ability.

[9] The method according to claim 8, wherein the substance having DNA recombination ability is a DNA recombination enzyme.

[10] The method according to claim 9, wherein the enzyme is a DNA recombination enzyme, a RecA protein, a T4 gene, or a single-stranded binding protein.

[II] A method for amplifying a target nucleic acid region, comprising the steps of adding a substance that binds to a primer dimer and a primer to a sample, and incubating the sample.

[12] A method for determining the presence or absence of a target nucleic acid sequence, comprising: adding a substance that binds to a primer dimer and a primer to a sample; and incubating the sample. how to.

[13] A method for determining the presence or absence of mutations, deletions, and Z or insertions in a target nucleic acid sequence. Adding a substance that binds to a primer dimer and a primer to the sample, and incubating the sample.

[14] The method according to any one of [11] to [13], wherein the substance that binds to the primer dimer is a substance having mismatch recognition ability.

[15] The method according to claim 14, wherein the substance having mismatch recognition ability is a mismatch binding protein.

[16] The method of claim 15, wherein the mismatch binding protein is MutS, MSH2, MSH6, or a mixture thereof.

[17] The substance that binds to the primer dimer is a substance having DNA recombination ability.

11. The method according to any one of 11 to 13, wherein force.

18. The method according to claim 17, wherein the substance having DNA recombination ability is a DNA recombination enzyme.

[19] The method according to claim 18, wherein the enzyme is a DNA recombination enzyme, RecA protein, T4 gene or single-stranded binding protein.

[20] The method according to any one of claims 11 to 19, wherein the nucleic acid amplification method is a PCR method.

[21] The method according to any one of [11] to [19], wherein the nucleic acid amplification reaction is an isothermal amplification method.

[22] The method according to claim 21, wherein the isothermal amplification reaction is a method in which a group force including an SDA method, a 3SR method, a NASBA method, a TMA method, a Q beta replicase method, a LAMP method, and an ICAN method is selected.

[23] The primer comprises at least two primer sets capable of amplifying the target nucleic acid sequence,

The first primer included in the primer set includes a sequence (Ac,) to be sequenced (Ac) in the 3 'end portion of the target nucleic acid sequence (A) on the 3rd side of the first primer, A sequence (Β ′) that hybridizes to the complementary sequence (Be) of the sequence (B) existing 5 ′ to the target nucleic acid sequence is located 5 ′ to the sequence (Ac ′). The second primer included in the primer set includes a sequence (Cc ′) that hybridizes to the sequence (C) of the 3 ′ end portion of the complementary sequence of the target nucleic acid sequence in the 3 ′ end portion. And a folded sequence (D—Dc ′) containing two nucleic acid sequences that are mutually and hybridized on the same strand, on the 5 ′ side of the sequence (Cc ′). 11-2 The method according to item 1 above.