WO2006098040A1

WO2006098040A1 - Method for production of recombinant dna molecule

Info

Publication number: WO2006098040A1
Application number: PCT/JP2005/005455
Authority: WO
Inventors: Yukio Nagano; Eiichi Iisasa
Original assignee: Saga University
Priority date: 2005-03-17
Filing date: 2005-03-17
Publication date: 2006-09-21
Also published as: JP4961563B2; JPWO2006098040A1

Abstract

A plasmid carrying two sets of replication origins and selective markers for a shuttle vector therein, in which, between a first replication origin and a first selective marker which function in a single microorganism, a second replication origin and a second selective marker which function in another microorganism are integrated.

Description

Recombinant DNA molecule production technology

The present invention relates to a method for producing a recombinant DNA molecule, and more particularly, to a method for simultaneously performing DNA fragment cloning and yeast shuttle vector construction. Background art

The traditional heterologous DNA cloning method using Escherichia coli, the so-called Cohen-Boyer method (Reference 1), cleaves DNA fragments to be cloned with cloning vectors with restriction enzymes, and ligates them with DNA ligation enzymes. This is a method of transforming to, and amplifying in E. coli, and is the basis of molecular biology research. In addition, due to the fact that the genome sequences of various organisms have been determined, the importance of research methods for cloning desired DNA fragments into cloning vectors is increasing. However, traditional DNA cloning methods require a lot of skill because they involve many ώ '0 operations. Even if the desired DNA fragment can be cloned, it takes time to select from a large number of E. coli colonies, so that the cloning efficiency is poor. Therefore, traditional DNA cloning methods hinder molecular biology research and are inappropriate for high-throughput comprehensive gene analysis required for post-genome analysis. This has led to the development of several new DNA cloning methods with higher cloning efficiency that can replace traditional DNA cloning methods. 1) Invitrogen Gateway method or Clontech Cre'loxP method in vitro homologous recombination method, 2) Inw'w homologous recombination method using E. coli (References 2 and 3), and 3) ώ 'ra homologous recombination method using baker's yeast (References 4 and 5).

The J ζ'ί / Ό homologous recombination method 1) is a method that uses a DNA sequence-specific recombination enzyme when cloning a DNA fragment into a cloning vector.

However, specific DNA sequences are required on the cloning vector side and the DNA fragment side to be cloned. This particular end of the DNA fragment you want to clone Although it is possible to add DNA sequences by PCR, etc., if the cloning vector does not have this specific DNA sequence, this sequence can be added to the cloning vector by traditional DNA cloning methods. Because it is necessary, it is not always easy. In addition, DNA sequence-specific recombinase is expensive.

2) The ώ w'o homologous recombination method using E. coli (References 2 and 3) is a method that utilizes the high homologous recombination ability of E. coli strains that express multiple proteins derived from phages. is there. This method is very similar to the baker's yeast homologous recombination method of FIG. First, PCR is performed with primers having a sequence homologous to the cloning vector, so that a sequence homologous to the cloning vector is added to both ends of the DNA fragment to be cloned. In addition, the cloning vector is cleaved with a restriction enzyme or the like at any site located in the middle of the portion where homologous recombination occurs. Next, when the target DNA fragment having a sequence homologous to the cloning vector at both ends and the cloned cloning vector are transformed into an E. coli strain with high homologous recombination ability, In other words, homologous recombination occurs in vivo, and the desired DNA fragment can be cloned into a cloning vector. Since this reaction occurs independently of the restriction enzyme site, it is possible to insert DNA fragments at various positions in the vector—sequence. In addition, the traditional DNA cloning method reduces the efficiency of cloning as the size of the DNA fragment desired to be cloned increases, whereas this method reduces the size of the DNA fragment desired to be cloned. It is also a feature that does not depend too much.

However, this method requires electrical transformation to obtain high transformation efficiency. Electroporation equipment and electroporation cuvettes are expensive, and accidents such as short-circuits and arcs are likely to occur during electroporation work. In order to prevent such an accident, it is necessary to thoroughly remove the salt from the DNA solution, but this operation is complicated.

3) The homologous recombination method using baker's yeast (References 4 and 5) utilizes the fact that baker's yeast has an extremely high homologous recombination ability (Fig. 1). In this method, first, PCR is performed with primers having a sequence homologous to the cloning vector, so that both ends of the DNA fragment to be cloned are homologous to the cloning vector. Appends an array. In addition, the cloning vector is cleaved with a restriction enzyme at any site located in the middle of the portion where homologous recombination occurs. Next, the target DNA fragment having a sequence homologous to the cloning vector at both ends and the cleaved cloning vector are transformed into baker's yeast. As a result, homologous recombination occurs in w'ra, and the desired DNA fragment can be cloned into a cloning vector. This reaction occurs independently of the restriction enzyme site in the same way as the homologous recombination method using E. coli in 2), so DNA fragments can be inserted at various positions in the vector sequence. It is. In addition, as in the / nwo homologous recombination method using E. coli, the cloning efficiency of the traditional DNA cloning method decreases as the size of the DNA fragment to be cloned increases. This method is also characterized in that it does not depend much on the size of the DNA fragment to be cloned. In this method, baker's yeast has an extremely high homologous recombination ability, so that a sufficient number of traits can be obtained even if transformation is performed by chemical transformation method (lithium acetate method) without relying on electroporation. A converter is obtained. In addition, the most important feature of clawing using ώ 'O homologous recombination method using baker's yeast is that multi-fragment ligation in Fig. 2 is easy (Reference 4). That is, by combining a plurality of DNA fragments having a homologous sequence of about 30 bp, a plurality of DNA fragments can be ligated and cloned into a cloning vector. It is useful for functional analysis of genes and proteins because fusion proteins can be easily created by linking multiple fragments. For example, it can be used to fuse the gene under study with the GFP gene, or to replace a protein domain. This method can also be applied to site-directed mutagenesis into proteins. That is, by mutating the primer corresponding to the red-red part in the center of Fig. 2, amplifying a DNA fragment by PCR, and ligating multiple fragments by ino homologous recombination method using baker's yeast It becomes possible.

As explained above, the in Vo homologous recombination method using baker's yeast has many excellent effects.

However, the ώ 'ra homologous recombination method using baker's yeast requires baker's yeast-E. Coli shuttle vector because it needs to be transferred to Escherichia coli when an operation for preparing a large amount of DNA is performed. The vectors used by researchers are often Since it is not the baker's yeast-E. Coli shuttle vector, it can often replicate in baker's yeast even though it can replicate in E. coli. Therefore, to perform baker's yeast homologous recombination with the target vector, first convert the vector to be used into baker's yeast-E. Coli shuttle vector, Must be placed in a cloning vector. Such an operation is time consuming and cumbersome. Disclosure of the invention

Therefore, an object of the present invention is to provide a method for cloning a DNA fragment by a homologous recombination method using baker's yeast into a general vector that is not a yeast shuttle vector. The present invention is a method for simultaneously performing cloning and construction of a yeast shuttle vector. This method can be applied to many commercially available vectors or to many vectors originally developed by each researcher.

Up to now, it has been desired to develop a method for easily producing a vector that can be propagated between different hosts while cloning a gene using a general cloning vector. As a result of diligent research to solve the above problems, the present inventor has developed a plasmid capable of propagating a general cloning vector that cannot be propagated between different hosts. It has been found that gene cloning and shuttle vector construction can be simultaneously performed by using the plasmid, and the present invention has been completed.

That is, the present invention is as follows.

(1) A plasmid containing two sets of replication origins for a shuttle vector and a selection marker, and a function that functions in another microorganism between the first replication origin that functions in one microorganism and the selection marker. A brass medium incorporating a second replication origin and a selection marker.

In the above plasmid, one microorganism is Escherichia coli. Examples of replication origins that function in E. coli include PUC origin, ColEl origin, pBR322 origin, pACYC origin, pSClOl origin, fl origin, M13 origin, BAC vector origin, PAC vector origin, and cosmid vector For example, Ampr, Tef, Cm ^r , Km ^r , Spc> \ can be selected as the selected marker. ^{^{^{Hyg r, Gm r, Rif r}}} , Zeocin r, and include the one selected from the group consisting of Blasticidin ^r.

In the above plasmid, other microorganisms include yeasts such as Saccharomyces cerevisiae. Examples of replication origins that function in yeast include 2 μ origins and any one selected from the group consisting of ARS.Selectable markers include, for example, URA3, TRP1, SUP4, ADE2, HIS3, LEU2, Any one selected from the group consisting of LYS2, KANMX, AURI C, CYH2, CAN1, PDR4, and hphMX can be mentioned.

The plasmid preferably contains, for example, the following DNA (a) or (b):

(a) DNA consisting of the base sequence represented by SEQ ID NO: 1

(b) A plasmid that can hybridize with DNA consisting of a base sequence complementary to the base sequence represented by SEQ ID NO: 1 under stringent conditions and function as a shuttle vector.

(2) A method for producing a recombinant DNA molecule comprising the following steps:

(a) a DNA fragment containing two sets of replication origins and selection markers prepared by cleaving the plasmid described in (1) above, a target DNA fragment for cloning, and a replication origin and selection marker The DNA sequence in the region of the origin of replication or selection marker of the cloning vector and the DNA fragment obtained by cleaving the DNA sequence in the region other than the origin of replication and selection marker are introduced into the host. Steps to perform, and

(b) A step of causing homologous recombination to a part of each DNA fragment to clone the target DNA fragment into a cloning vector and constructing a shuttle vector,

Including said method.

In the method of the present invention, the target DNA fragment is not limited to one type, and two or more types may be included. In this case, the two or more types of target DNA fragments contain sequences having homologous junctions so that they are linked in series to a cloning vector. As a host for integrating the above DNA fragment, for example, Saccharomyces Examples include yeasts such as Levisiae.

(3) Recombinant DNA produced by the method described in (2) above.

(4) A transformant comprising the recombinant DNA described in (3) above. The method of the present invention is extremely useful in that it can be applied to many commercially available vectors or vectors originally developed for the simultaneous construction of target DNA cloning and shuttle vectors. Brief Description of Drawings

FIG. 1 is a diagram showing a homologous recombination method in yeast.

FIG. 2 is a diagram showing an outline of multi-fragment linking.

Figure 3 shows the common structure of many vectors.

FIG. 4 is a diagram showing the matchmaker plasmid pSUO of the present invention.

FIG. 5 is a schematic diagram showing an outline of the method of the present invention.

FIG. 6 shows the DNA sequence (SEQ ID NO: 1) of the matchmaker plasmid pSUO of the present invention and its annotation. BEST MODE FOR CARRYING OUT THE INVENTION

Hereinafter, the present invention will be described in detail.

The present invention relates to a method for simultaneously performing DNA fragment cloning and yeast shuttle vector construction.

The present inventor has developed a DNA fragment by a homologous recombination method using Saccharomyces cerevisiae (also referred to as baker's yeast, brewer's yeast or rice yeast) as a general vector that is not a yeast shuttle vector. We have developed a method that can be cloned efficiently. First, the present inventor thought that cloning and yeast shuttle vector construction could be performed at the same time, and constructed an optimal matchmaker plasmid for this purpose. The "matchmaker plasmid", the binding of a _£ black one Jung vector and the DNA fragment of interest in the sense that plasmid to mediate the binding of the target DNA fragment of the cloning vector and cloned likened to a "marriage", "matchmaker plus It is named “mid”.

Most of the commercially available cloning vectors or the cloning vectors originally developed by researchers have a common structure such as ampicillin resistance gene (Amp ^r , which encodes 3 lactamase). 'It has PUC origin or ColEl origin, etc., which is necessary for replication (Fig. 3). This common structure is derived from the vector pBR322 (Reference 7), the origin of many vectors. Since PUC origin is a substitution of one base in ColEl origin, there is almost no difference between the two in terms of homologous recombination.

The present inventor pays attention to the structure common to many of these vectors, and using a matchmaker plasmid as shown in FIG. 4, a commercially available cloning vector or a cloning vector developed independently by each researcher. We thought that most of this could be easily converted into baker's yeast-E. Coli shuttle vector.

1. Matchmaker Plasmid

The matchmaker plasmid of the present invention contains two sets of selection markers and replication origins used as shuttle vectors so that they can function as shuttle vectors. One is a selection marker having a replication function and an origin of replication in a first host (eg, E. coli, etc.). The other is a selection marker and an origin of replication having a replication function in a second host (for example, yeast) different from the first host.

Here, “selectable marker” means DNA used to select recombinants from non-recombinants in experiments such as transduction and transformation. Things are included. “Replication origin” refers to a replication control factor present on a chromosome or plasmid, and refers to a DNA region in which a DNA replication initiation reaction occurs. “Shuttle vector” means a vector that can grow independently in either cell of two species with different gene replication and expression mechanisms. For example, the E. coli-yeast shuttle vector is a DNA for yeast. As a replication mechanism, a yeast plasmid DNA or yeast chromosome replication unit (ARS) is inserted into an E. coli plasmid vector. In the matchmaker plasmid of the present invention, a selection marker that functions in a second host and a replication origin are linked between a selection marker that functions in the first host and the replication origin. It has a structure (Fig. 4). Therefore, the matchmaker plasmid of the present invention basically has a selection marker that functions in the first host, an origin of replication that functions in the second host, a selection marker that functions in the second host, and a function in the first host. It has a structure that includes the replication origins in this order. However, the order is not limited to this, and the structure may be such that the selection marker that functions in the first host and the replication origin are rearranged, and the selection marker that functions in the second host and the replication. Even the structure where the starting point is rearranged.

Figure 4 shows Ampr and PUC origin (origin) as selectable markers and replication origins that function in E. coli, respectively, and URA3 and 2 μorigin (origin) as selectable markers and origins of replication that function in yeast, respectively. However, it is not limited to these. Therefore, when E. coli is used as the first host, yeast can be used as the second host. Examples of yeast include Saccharomyces cerevisiae, Schizosaccaromyces pombe, and the like. When yeast is used as the first host, Escherichia coli, mammalian cells, etc. can be used as the second host. Accordingly, examples of selection markers and origins of replication that function in these hosts include the following.

Replication origin that functions in E. coli: PUC origin, ColEl origin, pBR322 origin, pACYC origin, pSClOl origin, fl origin, M13 origin, BAC vector origin, PAC vector origin, cosmid vector origin

Selectable marker that functions in E. ^{coli: Ampr, Tetr, Cm r,} Kmr, Spc r, Hyg r, Gm r, Rif r, Zeocin r, Blasticidin r

Replication origin functioning in Saccharomyces cerevisiae: 2 μ origin, ARS Saccharomyces' selection markers functioning in cerevisiae: URA3, TRP1, SUP4, ADE2, HIS3, LEU2, LYS2, KANMX, AUR1'C, CYH2, CAN1, PDR4 and hphMX

Replication origin that functions in Schizosaccharomyces bombs: ARS, 2 μ origin Selection marker that functions in Schizosaccharomyces bombs: LEU1, URA4, ADE6, HIS2, KA 匪 X, AURl ^r

Replication origin that functions in mammalian cells: SV40 origin Selectable markers that function in mammalian cells: Zeoci, Blasticidi, Hyg Neomvcin ^r Nakajin plasmid, which is introduced into DNA into the host to cause homologous recombination, as described later, makes it a linear DNA fragment. There is a need. Therefore, it is preferable that the matchmaker plasmid has a restriction enzyme cleavage site. The restriction enzyme sites are preferably present in regions other than the two replication origins and the selection marker. Examples of cleavage restriction enzymes include Eco RI, BamHl, Pst1, Hind III, Cla I, Kpn I, and Xho I, but are not limited thereto. Figure 4 shows EcoRI and BamHI cut sites.

In the present invention, the pSUO matcher brass (pSUO plasmid) shown in FIG. 4 is preferable because it is overwhelmingly versatile. Figure 6 shows the DNA sequence of pSUO plasmid (SEQ ID NO: 1) and its annotation. The pSUO plasmid is composed of 2 μ origin, the yeast origin of replication, and Amp, which is a common selection marker for commercially available vectors, and PUC origin, which is a common replication origin for commercially available vectors. It contains URA3, which is a selection marker, and has a restriction enzyme site that is cleaved by restriction enzymes EcoRI and BamHI. This pSUO plasmid is also effective when performing yeast shuttle vector production alone.

Further, the pSUO plasmid of the present invention hybridizes under stringent conditions with a base sequence complementary to the base sequence shown in SEQ ID NO: 1 as well as the base sequence shown in SEQ ID NO: 1, and Contains DNA that can function as a vector. Examples of the “stringent conditions” include 1 X SSC to 2 X SSC, 0.1% to 0.5% SDS, and 42 ° C to 68 ° C, and more specifically, 60 to 68 ° C. Examples include conditions in which 5 to 15 minutes of washing is performed 4 to 6 times in 2 X SSC and 0.1% SDS at room temperature after prehybridization for 30 minutes or more.

Further, the matchmaker plasmid of the present invention is not limited to the above pSUO. For example, a matchmaker plasmid can be designed corresponding to a cloning vector having the replication origin f 1 origin and the selection marker 1 Amp ¹ ”. The force of the matchmaker plasmid illustrated in Fig. 4, fl origin, yeast-derived replication control factor 2 origin, yeast-derived selection marker URA3 and A plasmid containing Amp ^r in this order is also included in the present invention. This plasmid shows a cloning efficiency similar to pSUO.

The matchmaker plasmid can be obtained using a conventional homologous recombination method. That is, pSUO plasmid can be constructed by the following method. Amplify DNA fragment containing Ampr, DNA fragment containing URA3 and 2 μ origin (origin), and DNA fragment containing PUC origin (origin) by PCR. At this time, the 3 ′ DNA sequence of the DNA fragment containing Ampr and the 5 ′ DNA sequence of the DNA fragment containing URA3 and 2 μ origin (origin) should be homologous over 40 bp. In addition, the DNA fragment 3'-side DNA sequence containing URA3 and 2 μ origin (origin) should be homologous with the DNA fragment containing PUC origin (origin) 5'-side for 40 bp. Similarly, the 3 ′ DNA sequence of the DNA fragment containing PUC origin and the 5 ′ DNA sequence of the DNA fragment containing Amp ^r should be homologous over 60 bp. The EcoRI and BamHI cleavage sites should be included in this 60 bp sequence. PSUO can be constructed by transforming these three DNA fragments into yeast.

2. Cloning vector

A vector for cloning a desired DNA fragment of interest may be a commercially available vector or a vector originally developed by a researcher. These vectors are often derived from pBR322 (Reference 7) as described above, in which case the selection marker — Ampicillin resistance gene (Ampr, which encodes lactamase) ₃ ′ side,

It has a common structure where PUC origin or ColEl origin is located. Vectors of pBR strains include E. coli plasmid vectors such as pET strains, pUC strains, and Bluescript strains. However, the present invention is not limited to pBR vectors such as the above-mentioned pBR322, but pACYC vectors, pSClOl vectors, fl or M13 vectors, BAC vectors, PAC vectors, cosmid vectors. An Escherichia coli plasmid vector or the like can be used.

Vector-derived selection markers for cloning the desired DNA fragment include Amp ^r , Tet ^r , C Km ^r , Spc ^r , Hyg ^r , Gm ^r , Rif as described in the matchmaker plasmid above. Zeoci, including but not limited to Blasticidinr Rather, it can be selected as appropriate.

3. Cloning purpose DNA

Cloning purpose DNA is an arbitrary gene and is not particularly limited. For example, a gene encoding a protein, a gene encoding an enzyme, a gene encoding a functional RNA, and the like can be mentioned.

Examples of the gene encoding the protein include green fluorescent protein and red fluorescent protein.

Examples of the gene encoding the enzyme include amylase and cellulase.

Examples of genes encoding functional RNA include double-stranded RNA.

These genes can be obtained by any method based on information such as GenBank accession numbers (for example, Molecular cloning 2nd ed., Sambrook, J., et al., Cold Spring Harbor Laboratory Press USA, (See 1989).

4. Simultaneous DNA cloning and shuttle vector construction

FIG. 5 is a schematic diagram for carrying out the “simultaneous execution method of clawing and yeast shuttle vector construction” using the matchmaker plasmid of the present invention.

(1) Purpose of cloning Preparation of DNA fragment

The target DNA fragment can be prepared by the method described in 3 above. In the present invention, a plurality of types of target DNA can be cloned. In the present invention, this is called “multi-fragment ligation”. For example, when two types of target DNA fragments are linked and cloned, homologous recombination occurs between the target DNA fragments, and a homologous sequence is added to one end of the target DNA fragment. Add a sequence homologous to the cloning vector sequence (cloning vector cleavage site sequence).

When cloning more than two types of target DNA fragments, connect them to the cloning vector of the target DNA so that these DNA fragments are linked in tandem. For the product, add a sequence homologous to the cloning vector sequence at one end, and add a sequence homologous to the target DNA. As a method of adding a homologous sequence, a PCR method or a method of ligating chemically synthesized nucleotide sequences with ligase or the like is employed.

(2) Cloning vector processing

The cloning vector is cleaved at two locations with a restriction enzyme. The first point is an arbitrary position located in the middle of the portion where homologous recombination with the DNA fragment to be cloned occurs (referred to as cleavage site 1). The cleavage site is preferably one of the multiple cloning sites. Further, in order to further increase the cloning efficiency, it is preferable to cleave at another multi-cylinder site.

The cleavage site at the second force point is an arbitrary place on the sequence of the selection marker or the replication origin (referred to as cleavage site 2). However, it is preferable that the selection marker or the origin of replication is cleaved at an inner position at least 20 bp from the end of the marker or origin of replication, preferably 30-40 bp in length. That is, when the cloning vector is cleaved, the marker or the origin of replication sequence should remain at least 20 bp, preferably 30 bp to 40.

Here, the target DNA fragment for cloning is inserted into the cleavage site 1 of the cloning vector. At this time, PCR is performed with a primer having a sequence homologous to the cloning vector, and a sequence homologous to the cloning vector is added to both ends of the DNA fragment to be cloned. The length of the base sequence to be added is such that at least 20 bp, preferably 30 to 40 bp remain.

(3) Preparation of DNA fragment of Nakajin plasmid

Nakajin plasmid is cleaved with one or two restriction enzymes, and the cleaved fragments are recovered and purified by agarose gel electrophoresis.

(4) Introduction into the host

Each of the above DNA fragments (1) to (3) (a total of 4 DNA fragments) is introduced into the host for transformation. For transformation, for example, chemical transformation methods such as lithium acetate method and protoplast method can be employed. An electrical transformation method can also be employed. In the present invention, the lithium acetate method is preferred because of its simplicity. When transformed, homologous recombination takes place in the yeast at the four positions indicated by the “X” in FIG. 5. The cloning vector binds to the target DNA at the above-mentioned cleavage site 1 and the cleavage site 2 The cloning vector replaces the yeast shuttle vector by binding the matchmaker plasmid to this region. This means that cloning of the target DNA fragment and yeast shuttle vector construction are performed simultaneously. “Simultaneously” means that (a) integration of the target DNA fragment into the cloning vector and (b) integration of the cloning vector into the matchmaker plasmid are carried out in one process. It does not mean that the contents of (a) and (b) above are performed at the same time. Example

Hereinafter, the present invention will be described more specifically with reference to examples. However, the present invention is not limited to these examples.

[Example 1] Objective DNA cloning and yeast shuttle vector construction simultaneously

In this embodiment, PSUO plasmid, and using GFP gene as a target DNA fragment cloned, this time _c embodying cloning and yeast shuttle vector construction at the same time, as a cloning vector, vectors for protein expression in E. coli pET32a (+) (Novagen) was used. pET32a (+) is a vector commonly used in various research fields to express various proteins in the form of a thioredoxin fusion protein. The DNA fragment of the GFP gene was amplified by PCR in such a way that it had a sequence homologous to the 40 bp cloning vector at both ends and matched the reading frame with thioredoxin.

Next, pET32a (+)-cut, pSUO-cut, and GFP gene DNA fragments were mixed at a molar ratio of 1: 1: 6 and transformed into baker's yeast. The experimental example is described in detail below.

(1) Materials and methods

(1-1) Strains used The baker's yeast YPH499 used was 7k, ade2-10l, Jiis3-A200, Jeu2Al, lys2-801, trpl-63, ura3'529, and the Escherichia coli DH5o (TOYOBO) used was F- ^ 80d ladL ΔΜ15 AOac

ZYA-argF) U 169 deoR recAl endAl Aso¾17 (rK-, mK +) supE44-thr l gyrAQG reJAl, BL2lStar (DE3) (Invitrogen) is F-o / 7¾t7T hsdSB (i "m -B) gaJ dcm ^ (ΟΕ3).

(1-2) Construction of pSUO matchmaker plasmid

Construction of pSUO Nakajin plasmid was performed using baker's yeast homologous recombination. Specifically, first, pYES2 (Invitrogen) is used as a DNA fragment containing the Amp ^r gene, the backbone of pSUO, the DNA fragment containing PUC origin, and the DNA fragment containing 2 μ origin and URA3 gene. Amplified by PCR. The DNA fragment containing Ampr gene was amplified by primers pSUO-1 and pSUO-4, and the DNA fragment containing PUC orgin was amplified by primers pSUO-3 and pSUO-6, respectively.

The base sequences of these primers are shown below.

pSU0-l (5'-CGGGATCCATCGGAATTCATAATTGAAAAAGGAAGAGTATG-3 ') (SEQ ID NO: 2)

pSU0-4 (5 'GCCCCAAAAACAGGAAGATTATTATCAAAAAGGATCTTCT-3')

(SEQ ID NO: 3)

pSUO-3 (AATTATATCAGTTATTACCCCTCATGACCAAAATCCCTTA-3 ') (sequence number 4)

pSU0-6 (ATGAATTCCGATGGATCCCGGCGGTAATACGGTTATCCAC-5 ') (sequence number 5)

This PCR reaction was performed at 95 ° C for 1 minute using Pfu DNA polymerase according to the manufacturer's instructions, followed by 15 cycles of 95 ° C for 30 seconds, 55 ° C for 30 seconds, and 72 ° C for 1 minute. For 5 minutes at 72 ° C. Subsequently, in order to add a homologous sequence containing ^ THHI and £ toRI sites to the DNA fragment containing the Ampr gene and the DNA fragment containing PUC origin, the above PCR product was used as a saddle and the primers pSUO-4 And pSUO-7 (complementary strand of pSUO'6), and pSUO-3 and pSU-8 (complementary strand of pSUl), respectively, were amplified by PCR. This PCR reaction uses Pfu DNA polymerase according to the manufacturer's instructions. Then, after reacting at 95 ° C for 1 minute, the reaction was performed at 95 ° C for 30 seconds, 55 ° C for 30 seconds and 72 ° C for 1 minute for 35 sites, and finally at 72 ° C for 5 minutes. On the other hand, using pYES2 / CT as a saddle and a DNA fragment containing 2μ origin and URA3 gene using primers pSU0-2 (complementary strand of pSU0-4) and pSU0-5 (complementary strand of pSU0-3) Amplified by PCR reaction. This reaction was performed using Pfu DNA polymerase according to the manufacturer's instructions for 1 minute at 95 ° C, followed by 35 cycles of reactions at 95 ° C for 30 seconds, 55 ° C for 30 seconds, and 72 ° C for 1 minute. Finally, the reaction was performed at 72 ° C for 5 minutes. The three amplified PCR fragments were purified using Sephaglas BandPrep Kit (Amersham Pharmacia) according to the manufacturer's instructions.

Next, these PCR fragments were mixed, transformed into yeast according to the TRAFO protocol (Reference 6), and plated on a plate containing no URA. From the colonies thus obtained, plasmids were extracted and purified using QIAprep Miniprep (QIAGEN) according to the manufacturer's instructions. This plasmid was transformed into a DH5a competent cell, and the plasmid was grown. Finally, one colony was selected, cultured in 1 晚 liquid culture, extracted with QIAprep Miniprep (QIAGEN), and cut with Nd and EcdRl to confirm that the pSUO matchmaker plasmid was produced. .

Figure 1 shows the DNA sequence of pSUO matchmaker plasmid and its annotation.

(1-3) PCR

PCR was performed using PyroBest DNA polymerase (TAKARA) according to the manufacturer's instructions. In the experiment of cloning the GFP gene into pET32a (+), the following sequences were added to the 5 ′ side and 3 ′ side of the GFP gene.

Additional sequence on the 5 'side: GGCCATGGCTGATATCGGATCCGAATTCGAGCTCCGTCGA (Tatsumi column number 6)

3'-side additional sequence: ACTCAGCTTCCTTTCGGGCTTTGTTAGCAGCCGGATCTCA (Tatsumi column number 7)

In experiments in which multiple fragments of GFP and RFP genes were linked to pET32a (+), the following sequences were added to the 5 'and 3' sides of each gene.

GFP gene

5, side additional sequence: GGCCATGGCTGATATCGGATCCGAATTCGAGCTCCGTCGA (Column number 6)

3 'additional sequence: ATGACGTTCTCGGAGGAGGC (SEQ ID NO: 8)

RP gene

5 'additional sequence: GCATGGATGAGCTCTACAAA (SEQ ID NO: 9)

3 'additional sequence: ACTCAGCTTCCTTTCGGGCTTTGTTAGCAGCCGGATCTCA (sequence number 7)

The composition of the PCR solution and the cycle conditions are shown below.

Composition: lO x Pyrobest Knuffer II 5μ1, 2.5mM each dNTP mix 4μ1, primer 4μ1, water 31μ1, template DNA 2 l, Pyrobest DNA polymerase 0.25μ1 Cycle conditions: (98 ° C for 10 seconds, 55 ° C for 30 seconds, 72. C for 1 minute) X 35 cycles

(1-4) DNA purification

The PCR amplified fragment and pSUO Nakajin plasmid cleaved with the restriction enzyme were subjected to 1% agarose gel electrophoresis, and the target band was recovered and purified using Sephaglas BandPrep Kit (Amersham Pharmacia). pET32a (+) was cleaved only with restriction enzymes M and Not \ and was not further purified.

(1-5) Transformation

Transformation of baker's yeast was performed with the TRAFO protocol (Reference 6). For E. coli, transformable E. coli DH5ot (TOYOBO) and BL21Star (DE3) (Invitrogen) were purchased and transformed according to the manufacturer's instructions. The expression of thioredoxin fusion GFP and thioredoxin fusion GFP-RFP was confirmed visually.

(2) Results

As a result of transformation, 401 colonies were obtained.

Next, all yeast transformants were collected from the plate, and without passing through liquid culture, brass DNA was directly extracted and transformed into DH50C, and the plasmid was extracted as in the case of yeast. The specific extraction method is as follows.

Add glass beads and water to the yeast plate to suspend the colony and Collected in Yubu. Subsequently, the yeast was collected and suspended in buffer P1 of QIAprep 'Miniprep (QIAGEN), glass beads for cell disruption were added, and the mixture was vigorously stirred to destroy the yeast cells. The supernatant was collected by centrifuging it, and the plasmid was then extracted according to the manufacturer's instructions. The plasmid was transformed into DH5C, the plasmid was amplified in large quantities, and the plasmid was extracted with QIAprep Miniprep (QIAGEN) according to the manufacturer's instructions.

When the extracted plasmid DNA was transformed into E. coli BL2lStar (DE3), 59% of the resulting colonies expressed GFP (Table 1).

In the conventional method, the transformation efficiency is often 10% or less, and this result shows that the DNA fragment can be cloned with relatively high efficiency. table 1

pSUO: H "Kuta-: GFP: RFP Yeast transformant Number of thio fusion protein expressing Percentage of E. coli colonies

0: 1: 0: 0 50 0

1: 1: 0: 0 135 0

1: 1: 6: 0 401 59

1: 1: 6: 6 323 37 As a control experiment, (i) an experiment in which only pET32a (+) was cleaved was transformed, and (ii) a transformation without adding the desired DNA fragment for cloning. An experiment was conducted. In the control experiment, pET32a (+) was cleaved and pSUO was cleaved at a molar ratio of 1: 1. As a result, 50 and 135 colonies were obtained by the experiments (i) and (ii), respectively. The number of colonies was relatively high at 12% and 34% of the experiments for cloning the GFP gene, but this is thought to be due to the strong effect of non-homologous end joining in these experiments.

[Example 2] Multi-fragment ligation The advantage of cloning using 相同 o homologous recombination method using baker's yeast is that multi-fragment ligation in Fig. 2 is easy. Therefore, in this example, a multi-fragment ligation was performed by the same experimental system as in Example 1, and a thioredoxin-GFP-RFP fusion gene was constructed. The 5 ′ side of the DNA fragment of the GFP gene and the 3 ′ side of the DNA fragment of the RFP gene have a sequence homologous to the 40 bp cloning vector. The 3 'side of the DNA fragment of the GFP gene and the 5' side of the DNA fragment of the RFP gene have 40 bp sequences that are homologous to each other. When pET32a (+) was cut, pSUO was cut, GFP gene DNA fragment, and RFP gene DNA fragment were mixed at a molar ratio of 1: 1: 6: 6 and transformed into baker's yeast 323 colonies were obtained. Plasmid DNA recovered from baker's yeast was transformed into E. coli DH5a, and plasmid DNA was recovered from the resulting colonies and transformed into E. coli BL21Star (DE3). 37% of the resulting colonies Had GFP and RFP activity (Table 1). This result shows that multi-fragment ligation is possible with high efficiency using the method of the present invention. [Example 3] Simultaneous execution of cloning of target DNA and construction of yeast shuttle vector (when pSU0 and pET32a (+) are cleaved with two kinds of restriction enzymes) In this example, pSUO is a restriction enzyme £; _C0 R1, It was cleaved with both BamRl, and the multi-cloning site of pET32a (+) was cleaved with two kinds of restriction enzymes _n氣 Xhol, and further cleaved with an ampr gene contained in pET32a (+). The target DNA was cloned by the same experimental system as in Example 1. When pET32a (+) was cleaved, pSUO was cleaved, and the DNA fragment of the GFP gene was mixed at a molar ratio of 1: 1: 1 and transformed into baker's yeast, 3968 colonies were obtained. The plasmid DNA recovered from baker's yeast was transformed into E. coli DH5a, and the plasmid DNA recovered from the colonies obtained there was further transformed into E. coli BL2lStar (DE3). % Had GFP activity (Table 2). This result shows that the target DNA can be cloned with higher efficiency when pSU0 and pET32a (+) are cleaved with two types of restriction enzymes (Table 2). Table 2

pSUO: He "Kuta-: GFP: RFP Yeast transformant Number of thio fusion protein expressing Percentage of E. coli colonies

0: 1: 0: 0 55 0

1: 1: 0: 0 70 0

1: 1: 1: 0 3968 97

1: 1: 1: 1 430 70

[Example 4] Multi-fragment ligation (when pSU0 and pET32a (+) are cleaved with two kinds of restriction enzymes) In this example, cloning of the target DNA was carried out using the same experimental system as in Example 3. Plasmid DNA recovered from baker's yeast by mixing pET32a (+), pSUO, GFP DNA fragment, and RFP DNA fragment in a 1: 1: 1: 1 molar ratio. Was transformed into E. coli DH5a. The plasmid DNA recovered from the obtained colonies was further transformed into E. coli BL2lStar (DE3). As a result, 70% of the obtained colonies had GFP and RFP activities (Table 2). This result shows that multi-fragment ligation can be performed with higher efficiency when pSU0 and pET32a (+) are cleaved with two types of restriction enzymes (Table 2). As described above, the present inventor has developed a method for cloning a DNA fragment by a homologous recombination method using baker's yeast to a general vector that is not a yeast shuttle vector. We have also developed pSUO matchmaker plasmids to make this method applicable to many commercially available vectors or to many of the vectors that each researcher independently developed. When the developed method was tested using the GFP gene as a model, it was found that DNA fragments could be cloned with high efficiency. In addition, we attempted to construct a fusion protein of GFP and RFP as a model to determine whether multi-fragment ligation is possible, and found that this can also be performed with relatively high efficiency.

In vitro homologous recombination methods such as Gateway have the disadvantage that the cloning vector that you want to use for research needs to have a specific DNA sequence. Therefore, it was necessary to add a specific sequence to the vector using traditional cloning methods. In addition, the conventional power The yeast homologous recombination method had the same drawbacks. In other words, after converting the vector to be used for research into a baker's yeast-E. Coli shuttle vector, it was necessary to put the desired DNA fragment into the cloning vector by the baker's yeast homologous recombination method.

On the other hand, since the method of the present invention utilizes a common structure for many cloning vectors, it is not affected by the above disadvantages. In addition, since the method of the present invention does not use an expensive enzyme, it is less expensive than a homologous recombination method such as Gateway. However, it is superior to the in 'iro homologous recombination method in that the operation in in w'iro is relatively few and simple.

Furthermore, the method of the present invention is superior to the in ro homologous recombination method in which multi-fragment ligation is impossible in that multi-fragment ligation is possible. A fusion protein can be easily created by ligating multiple fragments, so it can be applied to the fusion of the gene under study with the GFP gene, or the replacement of a protein domain. In addition, site-directed mutagenesis can be easily performed on proteins by ligating multiple fragments.

In addition, the method of the present invention may have a relatively short sequence homologous to the cloning vector compared to the ώW'KO homologous recombination method using E. coli, and the electroporation apparatus. It is excellent in that it does not require special equipment. Industrial applicability

The method of the present invention is useful in that the cloning of the target DNA fragment and the construction of the shuttle vector can be performed simultaneously. In addition, when the plasmid of the present invention is used, a target gene can be inserted into a desired vector, and a fusion protein can be created or a site-specific mutation can be introduced. It is. Sequence listing free text

Sequence number 1: pSUO plasmid

Sequence number 2: Synthetic DNA

Sequence number 3: Synthetic DNA

Sequence number 4: Synthetic DNA

Sequence number 5: Synthetic DNA Sequence number 6: Synthetic DNA

Sequence number 7: Synthetic DNA

Sequence number 8: Synthetic DNA

SEQ ID NO: 9: Synthetic DNA The following documents are incorporated herein by reference in their entirety.

Literature

1. Cohen SN, Chang AC, Boyer HW, and Helling RB. (1973) Construction of biologically functional bacterial plasmids in vitro. Proc Natl Acad Sci USA. 70, 3240-3244.

2. Zhang Y, Buchholz F, Muyrers JP, and Stewart AF. (1998) A new logic for DNA engineering using recombination in Escherichia coli. Nat Genet. 20, 123-128.

3. Yu D, Ellis HM, Lee EC, Jenkins NA, Copeland NG, and Court DL. (2000) An efficient recombination system for chromosome engineering in

Escherichia coli. Proc Natl Acad Sci USA. 97, 5978-5983.

4. Marykwas DL, and Passmore SE. (1995) Mapping by multifragment cloning in vivo. Proc Natl Acad Sci USA. 92, 11701-11705.

5. Oldenburg KR, Vo KT, Michaelis S, and Paddon C. (1997) Recombination-mediated PCR-directed plasmid construction in vivo in yeast. Nucleic Acids Res. 25, 451-452.

6. Gietz RD, and Woods RA (2002) Transformation of Yeast by the Lithium Acetate / Single-Stranded carrier DNA / Polyethylene Glycol method.Methods in Enzymology.350, 87-96.

7. Bolivar F, Rodriguez RL, Greene PJ, Betlach MC, Heyneker HL, and Boyer HW. (1977) Construction and characterization of new cloning vehicles. II. A multipurpose cloning system. Gene. 2, 95-113.

Claims

The scope of the request. A plasmid containing two sets of replication origins and selection markers for the shuttle vector, between the first replication origin that functions in one microorganism and the selection marker. A plasmid that incorporates a second origin of replication and a selectable marker that function in other microorganisms.

The plasmid according to claim 1, wherein the microorganism of — is Escherichia coli.

The first replication origin is selected from the group consisting of PUC origin, ColEl origin, pBR322 origin, pACYC origin, pSClOl origin, fl origin, M13 origin, BAC vector origin, PAC vector origin, and cosmid vector origin The plasmid according to claim 2, which is any one of the above.

The primary selection marker is Amp ^r , Tet ^r , Cm Km ^r , Spc Hyg ^r , Gm ^r , Rif ^r , Zeoci, and Blasticidi force. The plasmid according to claim 2.

The plasmid according to claim 1, wherein the other microorganism is yeast.

6. The plasmid according to claim 5, wherein the yeast is Saccharomyces cerevisiae. The plasmid according to claim 5 or 6, wherein the second origin of replication is one selected from the group consisting of 2 µ origin and ARS.

· The second selection marker is URA3, TRP1, SUP4, ADE2, HIS3, LEU2, LYS2,

The plasmid according to claim 5 or 6, wherein the plasmid is selected from the group consisting of KANMX, AURI C, CYH2, CAN1, PDR4, and hphMX.

A plasmid containing the DNA of (a) or (b) below.

(a) DNA consisting of the base sequence represented by SEQ ID NO: 1

(b) A plasmid that can be hybridized with DNA comprising a nucleotide sequence complementary to the nucleotide sequence represented by SEQ ID NO: 1 under stringent conditions and function as a shuttle vector.

0. A method for producing a recombinant DNA molecule comprising the following steps:

(a) a DNA fragment containing two sets of replication origins and a selection marker prepared by cleaving the plasmid according to any one of claims 1 to 9, and a clone; The cloning sequence that includes the DNA fragment and the replication origin and selection marker, cuts the DNA sequence in the replication origin or selection marker region, and the DNA sequence in the region other than the replication origin and selection marker. A step of introducing the obtained DNA fragment into a host, and

(b) A step in which homologous recombination is caused in a part of each DNA fragment to clone the target DNA fragment into a cloning vector and construct a shuttle vector,

Including said method.

1 1. The method according to claim 10, wherein two or more kinds of target DNA fragments are contained.

1 2. The method according to claim 11, wherein the two or more kinds of target DNA fragments contain sequences having homologous linkages so that they are linked in series to a cloning vector.

13. The method according to claim 10, wherein the host is yeast.

14. The method according to claim 13, wherein the yeast is Saccharomyces cerevisiae. 1 5. Recombinant produced by the method according to any one of claims 10 to 14

16. A transformant comprising the recombinant DNA according to claim 15.