WO2006096498A2 - Regulation of runx1 for treatment of pain - Google Patents
Regulation of runx1 for treatment of pain Download PDFInfo
- Publication number
- WO2006096498A2 WO2006096498A2 PCT/US2006/007578 US2006007578W WO2006096498A2 WO 2006096498 A2 WO2006096498 A2 WO 2006096498A2 US 2006007578 W US2006007578 W US 2006007578W WO 2006096498 A2 WO2006096498 A2 WO 2006096498A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- runxl
- expression
- test
- ion channel
- amount
- Prior art date
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
- G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
- G01N33/502—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects
- G01N33/5023—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects on expression patterns
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/5308—Immunoassay; Biospecific binding assay; Materials therefor for analytes not provided for elsewhere, e.g. nucleic acids, uric acid, worms, mites
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6872—Intracellular protein regulatory factors and their receptors, e.g. including ion channels
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6875—Nucleoproteins
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/28—Neurological disorders
- G01N2800/2842—Pain, e.g. neuropathic pain, psychogenic pain
Definitions
- Nociceptors are a subgroup of primary sensory neurons with cell bodies in the dorsal root and trigeminal ganglia specialized to respond only to noxious/painful stimuli. They serve this function by virtue of the expression of diverse high threshold ion channels and G-protein coupled receptors (GPCRs) that transduce intense mechanical, thermal, or chemical stimuli into electrical activity.
- GPCRs G-protein coupled receptors
- the first step in the perception of pain is the transduction of noxious stimuli by specialized ion channels and receptors expressed by nociceptive sensory neurons.
- nociceptive ion channels and receptors Prior to the invention the mechanisms that regulate the expression of these nociceptive ion channels and receptors were not defined, and, accordingly, it has been unclear whether specific nociceptive transduction phenotypes of distinct nociceptive neurons are allocated in a coordinate or independent fashion.
- the present invention is based in part on the discovery by the inventor that the Runt domain transcription factor Runxl is expressed by a major subset of nociceptors and is required for the expression of many ion channels and receptors - TRP class thermal receptors, Na + and ATP-gated channels and Mrgpr/SNSR class G-protein coupled receptors - implicated in nociceptive processing. It has also been discovered according to the present invention that Runxl -deficient mice exhibit selective defects in thermal, neuropathic, and inflammatory pain. The invention thus is also based in part on the discovery by the inventor of Runxl -dependent coordinate transcriptional regulation of divergent nociceptor transduction phenotypes.
- the invention relates to a novel therapeutic strategy for pain treatment by targeting a Runxl -mediated core transcriptional control program that is required for the expression of a large cohort of nociceptive receptors and channels.
- Such strategy is likely more effective than conventional strategies of developing drugs based on targeting individual channels or receptors involved in nocieptive processing.
- the invention in general provides methods useful for the identification of agents that can be used to regulate expression and function of certain nociceptors and be used for intervention in pain management, including neuropathic pain, inflammatory pain, and other types of pain (such as cancer pain) that have inflammatory and neuropathic pain components. More particularly, the methods of the invention are useful for identifying agents which can be used to regulate expression and function of nociceptors whose expression is affected by Runxl.
- the invention provides a method for identifying a candidate inhibitor of Runxl -mediated expression of a nociceptive receptor or ion channel.
- the method according to this aspect of the invention includes the steps of contacting a test cell that expresses Runxl and comprises a nucleic acid encoding a nociceptive receptor or ion channel operatively linked to a Runxl -sensitive promoter, with a test agent and measuring a test amount of expression of the nociceptive receptor or ion channel; comparing the test amount of expression of the nociceptive receptor or ion channel to a control amount of expression of the nociceptive receptor or ion channel measured in a control cell that expresses Runxl and comprises the nucleic acid encoding the nociceptive receptor or ion channel operatively linked to the Runxl -sensitive promoter, wherein the control cell is not contacted with the test agent; and identifying the test agent as a candidate inhibitor of Runxl -mediated expression of a nocicept
- the invention provides a method for identifying a candidate inhibitor of Runxl -mediated expression of a nociceptive receptor or ion channel.
- the method according to this aspect of the invention includes the steps of contacting a test cell that expresses Runxl and comprises a nucleic acid encoding a reporter operatively linked to a Runxl -sensitive promoter, with a test agent and measuring a test amount of expression of the reporter; comparing the test amount of expression of the reporter to a control amount of expression of the reporter measured in a control cell that expresses Runxl and comprises the nucleic acid encoding the reporter operatively linked to the Runxl -sensitive promoter; and identifying the test agent as a candidate inhibitor of Runxl -mediated expression of a nociceptive receptor or ion channel when the control amount of expression is greater than the test amount of expression.
- the invention provides a method for identifying a candidate agent for use in inhibiting neuropathic pain and other types of pain.
- the method according to this aspect of the invention includes the steps of contacting a test cell that expresses Runxl and comprises a nucleic acid encoding a nociceptive receptor or ion channel operatively linked to a Runxl -sensitive promoter, with a test agent and measuring a test amount of expression of the nociceptive receptor or ion channel; comparing the test amount of expression of the nociceptive receptor or ion channel to a control amount of expression of the nociceptive receptor or ion channel measured in a control cell that expresses Runxl and comprises the nucleic acid encoding the nociceptive receptor or ion channel operatively linked to the Runxl -sensitive promoter, wherein the control cell is not contacted with the test agent; and identifying the test agent as a candidate agent for use in inhibiting neuropathic pain and other types of pain when the control amount of
- the invention provides a method for identifying a compound for use in inhibiting neuropathic pain and other types of pain.
- the method according to this aspect of the invention includes the steps of measuring a test amount of binding between Runxl and a Runxl -sensitive promoter for a nociceptor in presence of a test compound; comparing the test amount of binding to a control amount of binding between Runxl and the promoter for the nociceptor in absence of the test compound; and identifying the test compound as a compound for use in inhibiting neuropathic pain and other types of pain when the test amount of binding is less than the control amount of binding.
- the invention provides a method for identifying a candidate compound for use in inhibiting neuropathic pain and other types of pain.
- the method according to this aspect of the invention includes the steps of contacting a test cell that expresses Runxl with a test agent and measuring a test amount of Runxl protein or Runxl messenger RNA; comparing the test amount of Runxl protein or messenger RNA to a control amount of Runxl protein or Runxl messenger RNA measured in absence of the test compound; and identifying the test compound as a candidate compound for use in inhibiting neuropathic pain and other types of pain when the test amount of Runxl protein or Runxl messenger RNA is less than the control amount.
- the nucleic acid encoding the nociceptive receptor or ion channel operatively linked to the Runxl -sensitive promoter is a gene for the nociceptive receptor or ion channel, wherein the gene includes an intrinsic promoter.
- nucleic acid encoding the nociceptive receptor or ion channel operatively linked to the Runxl -sensitive promoter encodes a nociceptive receptor or ion channel chosen from TRPC3, TRPM8, TRPAl, Mrgprd, P2X3, Navl.9/SNS2, and any combination thereof.
- the nociceptive receptor or ion channel is TRPC3.
- test cell includes a Runxl expression vector.
- control cell includes a Runxl expression vector.
- test amount of expression and the control amount of expression are corresponding amounts of transcript for the nociceptive receptor or ion channel.
- test amount of expression and the control amount of expression are corresponding amounts of protein for the nociceptive receptor or ion channel.
- nucleic acid encoding the nociceptive receptor or ion channel operatively linked to the Runxl -sensitive promoter is part of an expression vector.
- control cell is a dorsal root ganglion cell derived from a Runxl ⁇ ' ⁇ Runxl F/F ;Wntl-Cre) mouse.
- the reporter expression is measured as fluorescence emitted by the reporter.
- the test compound is selected from the group consisting of small molecules, peptides, nucleic acids, and any combination thereof.
- the test compound is a small molecule.
- the test compound is a nucleic acid.
- the test compound inhibits expression of Runxl.
- the reporter is green fluorescent protein.
- Figure IA is a schematic illustration depicting projections of different classes of nociceptors into different laminae of spinal cord of wild-type mice, with levels I/IIo being most superficial. Ret+ nociceptors, which are involved in neuropathic pain, project to deeper laminae.
- Figure IB is a pair of photomicrographs depicting a transverse section through embryonic (E12 and E14.5) dorsal root ganglion (DRG) immunostained for Runxl (bright, originally green) and TrkA (less bright, originally red). All Runxl + cells at this stage coexpress TrIcA but not Ret, whereas a small subset of TrkA + neurons lacks Runxl expression.
- Figure 1C is a photomicrograph depicting a transverse section through a one- month old (P30) DRG double stained for Runxl protein (bright, originally green) and TrkA mRNA (less bright, originally red).
- Figure ID is a photomicrograph depicting a transverse section through a one- month old (P30) DRG double stained for Runxl protein (bright, originally green) and Ret mRNA (less bright, originally red).
- Figure IE is a photomicrograph depicting a transverse section through a one-month old (P30) DRG double stained for TrkA mRNA and Ret mRNA.
- DRG neurons expressing TrIcA alone appear bright, originally red, those expressing Ret alone appear brighter, originally green, and those expressing both TrkA and Ret appear brightest, originally partially yellow (arrows).
- Figure IF is a photomicrograph depicting a transverse section through a one-month old (P30) DRG double stained for Runxl protein (bright, originally green) and cell surface lectin IB4 (less bright, originally red). IB4 is a marker for a subset of Ret + neurons.
- Figure IG is a schematic diagram indicating that Runxl is expressed broadly in El 4.5 TrkA + neurons and that its expression persists in a subset of Ret neurons but extinguishes in TrIcA + neurons. TrkA expression also extinguishes in adult Runxl + ; Ret + neurons. The origin, identity and function of Runxl ⁇ ; TrIcA " ; Ret + cells remain obscure.
- Figure 2A is a schematic depiction of the conditional allele Runxl F (top) and the result of crossing the conditional allele Runxl F with Wntl-Cre (bottom), generating Rmu,r ⁇ mice lacking Runxl expression in neural crest cells. Numbered vertical bars represent exons. Exon 4 is flanked by loxP sequences (triangles), as is a neo cassette in the intron between exons 4 and 5.
- Figure 2B is a pair of photomicrographic images showing Runxl expression in sections of adult DRG taken from wild-type (Runxl F/F , left) and Runxl " ⁇ (right) mice.
- Figure 2C is a pair of photomicrographic images showing pan-neuronal marker SCGlO expression in sections of adult DRG taken from wild-type (R ⁇ mxl F/F , left) and RunxF ⁇ (right) mice.
- Figure 2D is a bar graph depicting the total number OfSCGlO + neurons in fifth lumbar DRG in wild-type (Runxl FF ) and Runxl ⁇ ⁇ mice.
- Figures 3 A and 3B are photomicrographs of transverse sections through DRGs of adult wild-type (A) and Runxl+ " (B) mice, stained by in situ hybridization for TrkA.
- Figures 3C and 3D are photomicrographs of transverse sections through DRGs of adult wild-type (C) and Runxl ⁇ f ⁇ (D) mice, stained by in situ hybridization for Ret.
- Figures 3E and 3F are photomicrographs of transverse sections through DRGs of adult wild-type (E) and Runxl+ " (F) mice, double stained by in situ hybridization for Ret (less bright, originally red) and IB4 binding (bright, originally green).
- Figures 3G and 3H are photomicrographs of transverse sections through DRGs of adult wild-type (G) and RunxV' ' (H) mice, double stained by in situ hybridization for TrkA (bright, originally green and/or yellow) and for IB4 binding (less bright, originally red). In wild-type DRG, IB4 + cells do not coexpress TrkA.
- Figure 31 is a bar graph depicting percentages of DRG neurons expressing TrIcA.
- FIG. 3J is a schematic diagram depicting transformation of prospective Ret+ into wild-type mice (Runxl F/F , filled bars) and RunxV ⁇ mice (unfilled bars).
- Figure 3J is a schematic diagram depicting transformation of prospective Ret+ into wild-type mice (Runxl F/F , filled bars) and RunxV ⁇ mice (unfilled bars).
- Figure 3J is a schematic diagram depicting transformation of prospective Ret+ into
- TrIcA+ nociceptors in RunxF ⁇ mice TrIcA+ nociceptors in RunxF ⁇ mice.
- Figure 4 is an array of paired photomicrographs of sections through adult wild-type and Runxr f ⁇ DRG, with in situ hybridization performed with indicated probes for (4 A:)
- FIG. 4E is a panel of four photomicrographic images of sections of P30 wild-type DRG double labeled for Runxl protein (bright, originally green) and the indicated probes (less bright, originally red).
- Figure 5 A is a pair of photomicrographic images depicting double labeling of
- Runxl protein (bright, originally green) and Calcitonin Gene Related Peptide (CGRP)
- Runxl + neurons do not express CGRP at El 6.5 (arrows) but some CGRP + neurons express a low level of Runxl at P30 (arrowhead).
- Figure 5B is a photomicrographic image depicting double labeling of Runxl protein (bright, originally green) and DRASIC (less bright, originally red) in P30 DRG sections from wild-type Runxl F/F mice. Runxl + neurons do not express DRASIC at P30
- Figure 5 C is a panel of six photomicrographic images depicting expression of CGRP, Substance P (SP), and combined IB4 and CGRP in sections of adult wild-type
- Figure 5D is a panel of six photomicrographic images depicting expression of mu- class opioid receptor (MOR), DRASIC, and ASIC in sections of adult wild-type (Runxl F/F )
- Figure 5E is a bar graph depicting the average ( ⁇ SEM) percentages of DRG neurons expressing the indicated markers in adult wild-type (Runxl F/F ) (filled bars) and
- Runxl+ (open bars) mice. * t test PO.001.
- Figure 5F is a schematic representation showing how Runxl activates and suppresses two separate groups of neuropeptides, ion channels, and sensory receptors.
- Figure 6A-6D are photomicrographic images depicting in situ hybridization of TRPAdS (A and B) and Mrgprd (C and D) in E16.5 sections of wild-type Runxl F/F (A and C) and RumF ⁇ (B and D) DRG.
- Figure 6E is a photomicrographic image depicting double immunostaining of Runxl protein (bright, originally green) with TrkA protein (less bright, originally red) in El 7 wild-type DRG.
- Figure 6F is a photomicrographic image depicting double immunostaining of Runxl protein (bright, originally green) with Ret protein (less bright, originally red) in El 7 wild-type DRG.
- Figure 6G-I are a panel of three photomicrographic images depicting double staining of TRPM8 mRNA (bright, originally green) and Ret protein (less bright, originally red) in El 7 wild-type DRG.
- Figures 7 A and 7B are a pair of photomicrographic images depicting staining for TRPM8 mRNA (bright, originally green) and Ret protein (less bright, originally red) in El 7 wild-type DRG.
- Figures 7 A and 7B are a pair of photomicrographic images depicting staining for
- IB4 originally green in P30 dorsal horn sections from wild-type (Rwvcl F/F ) mice (left) and Runxl ⁇ ⁇ mice (right). Arrowheads, superficial lamina; arrow, deep lamina.
- Figures 7C and 7D are a pair of photomicrographic images depicting staining for CGRP (originally red) in P30 dorsal horn sections from wild-type (Runxl F/F ) mice (left) and RunxV 1' mice (right). Arrowheads, superficial lamina; arrow, deep lamina.
- Figures 7E and 7F are a pair of merged photomicrographic images of Figures 7A and 7C and of Figures 7B and 7D, respectively.
- Figures 7G and 7H are a pair of photomicrographic images depicting double staining of IB4 (originally green) and Substance P (SP; originally red) in P30 dorsal horn sections from wild-type (Runxl F/F ) mice (left) and Rural '1' mice (right). Arrowhead, superficial lamina.
- Figures 71 and 7 J are a pair of photomicrographic images depicting double staining of IB4 (originally green) and protein kinase C-gamma (PKC-gamma; originally red) in P30 dorsal horn sections from wild-type (Runxl F/F ) mice (left) and RunxF ⁇ mice (right). Arrows, deep lamina.
- Figure 7K is a schematic drawing depicting deep lamina-specific innervation of IB4 + afferents in wild-type (Runxl F/F ) dorsal horn.
- Figure 7L is a schematic drawing depicting more superficial lamina-specific innervation of IB4 + afferents in RunxF ⁇ dorsal horn.
- Figures 8 A and 8B are bar graphs depicting behavioral sensitivity of control Runxl F F mice (open bars) and RunxF ⁇ mice (hatched bars) to heat at the indicated temperatures. *** PO.001.
- Figure 8C is a bar graph depicting behavioral sensitivity of control Runxl F F mice (open bars) and Rural '1' mice (hatched bars) to cold. ** PO.01.
- Figure 8D is a bar graph depicting behavioral sensitivity of control Rural FF mice (open bars) and RunxF f ⁇ mice (hatched bars) to capsaicin-induced chemical pain. * PO.05.
- Figures 8E and 8F are bar graphs depicting behavioral sensitivity of control Rural mice (open bars) and RunxF ⁇ mice (hatched bars) to mechanical pain induced with von Frey hair (E) or pin prick (F).
- Figure 8G is a graph depicting mechanical allodynia in control Rwal F/F mice (square symbols) and RuraF ⁇ mice (triangle symbols) in the spared nerve injury model of neuropathic pain.
- Figure 8H is a bar graph depicting behavioral sensitivity of control Ruwcl F/F mice (open bars) and RunxF 1" mice (hatched bars) to inflammatory pain. ** P ⁇ 0.01 and *** PO.001 compared to baseline; ⁇ PO.001 compared to control R ⁇ mxl F/F mice. CFA, complete Freund's adjuvant.
- Runxl (runt-related transcription factor 1) is a mammalian transcription factor that is encoded by Runxl, a gene related to the runt gene in Drosophila melanogaster . In Drosophila the runt gene has been reported to be involved in several developmental pathways, including segmentation, sex determination, and neurogenesis. In mammals Runxl encodes the DNA-binding subunit of the heterodimeric core-binding factor (CBF).
- CBF consists of a DNA-binding alpha ( ⁇ ) subunit that contacts DNA directly, and a beta ( ⁇ ) subunit that forms a complex with the ⁇ subunit and enhances CBF affinity for DNA without itself binding to DNA.
- CBF ⁇ subunits are encoded by at least three distinct genes (Cbfal, Cbfa2, and Cbfa3), while a single gene (Cb ⁇ ) encodes the CBF ⁇ subunit.
- Cbfal Chromosomal translocations involving the Cbfal gene, also known as Runxl and as AMLl, have been associated with common forms of leukemias and myelodysplasias in humans.
- transcription factor Runxl also known in the literature as AMLl, CBFA2, EVI-I, AMLCRl, PEBPc ⁇ , PEBP2 ⁇ B, and AMLl-EVI-I
- Runx3/ PEBP2 ⁇ C/AML2 de Bruijn MF et al.
- isoforms 1 451 amino acids
- isoform 4 465 amino acids
- Nucleic acid and amino acid sequences for these isoforms are available from GenBank, e.g., D13802 (isoform 1). See also GenBank Q03347.
- a genomic sequence for murine Runxl is available as GenBank accession number 193030.
- Runxl F mice carrying a / ⁇ xP-based conditional Runxl allele (referred to here as Runxl F ; FIG.
- the invention relates in certain aspects to methods of identifying a candidate inhibitor of Runxl -mediated expression of a nociceptive receptor or ion channel.
- Runxl is involved in the coordinate expression of a host of nociceptors of certain classes. These nociceptors relate especially to those involved in sensing painful thermal and mechanical stimuli.
- nociceptor refers to any of a subgroup of primary sensory neurons with cell bodies in the dorsal root and trigeminal ganglia specialized to respond only to noxious stimuli. Nociceptors serve this function by virtue of their expression of diverse high threshold ion channels and G-protein coupled receptors (GPCRs) that transduce intense mechanical, thermal, or chemical stimuli into electrical activity.
- GPCRs G-protein coupled receptors
- the term "nociceptive receptor or ion channel” refers to any GPCR or high threshold ion channel that is expressed by a nociceptor and is involved in transducing mechanical, thermal, or chemical stimuli into electrical activity.
- Nociceptive receptors and ion channels specifically can include, but are not limited to, TRPA, TRPM8, TRPC3, TRPVl, TRPV2, P2X3, the Mrg family of GPCRs (encompassing a dozen or more receptors including Mrgpra, Mrgprb, Mrgprc, and Mrgprd family members), and tetrodotoxin-resistant sodium channels such as Navl.9. Certain methods of the invention involve contacting a test agent with a cell that expresses Runxl and includes a nucleic acid encoding a nociceptive receptor or ion channel operatively linked to a Runxl -sensitive promoter.
- nucleic acid encoding a nociceptive receptor or ion channel refers to any DNA or RNA molecule that encodes such receptor or ion channel.
- the nucleic acid is a genomic DNA encoding the nociceptive receptor or ion channel.
- the nucleic acid is a complementary DNA (cDNA) encoding the nociceptive receptor or ion channel.
- the encoding DNA can be operatively linked to an endogenous or exogenous (heterologous) promoter that is responsive to binding by Runxl .
- nucleic acid encoding a nociceptive receptor or ion channel is a gene, including at least a portion of its native or endogenous promoter, that encodes a nociceptive receptor or ion channel.
- the nucleic acid encoding a nociceptive receptor or ion channel is naturally expressed by a cell used in a method of the invention.
- the nucleic acid encoding a nociceptive receptor or ion channel is a gene, including its native or endogenous promoter, that encodes a nociceptive receptor or ion channel.
- the endogenous promoter is a Runxl -sensitive promoter.
- the nucleic acid encoding a nociceptive receptor or ion channel is not naturally expressed by a cell used in a method of the invention.
- the nucleic acid encoding a nociceptive receptor or ion channel is a nucleic acid that is artificially introduced into the cell, for example by transfection with a suitable expression vector for the receptor or ion channel.
- the nucleic acid encoding a nociceptive receptor or ion channel in one embodiment is operatively linked to an endogenous or exogenous (heterologous) promoter.
- the endogenous promoter is a Runxl - sensitive promoter.
- the exogenous (heterologous) promoter is a Runxl -sensitive promoter.
- Randomxl -sensitive promoter refers to a nucleic acid including a promoter of gene transcription, wherein the promoter includes a sequence specifically bound by a Runt domain of Runxl transcription factor. Promoters generally include 5' untranscribed, untranslated DNA sequence found upstream of (5' to) the coding sequence (open reading frame) of a gene. A promoter typically spans hundreds of nucleotides but can be longer or shorter. Promoters can include one or more transcription factor response elements, which are DNA sequences recognized and bound by transcription factors.
- the Runxl -sensitive promoter is a promoter for a gene encoding a nociceptive receptor or ion channel.
- Nociceptive receptors and ion channels include those disclosed above, and they can include those from human and other mammalian species.
- Nucleotide sequences for genes encoding such proteins are available from public databases such as GenBank.
- GenBank accession numbers NM_003305 and NM_019510 are available as GenBank accession numbers NM_024080 and NM_134252, respectively.
- Human and murine cDNA sequences for TRPVl are available as GenBank accession numbers NM_080706 and NM_001001445, respectively, and a genomic sequence for murine TRPVl is available as GenBank accession number AL663116.
- Human and murine cDNA sequences for TRP V2 are available as GenBank accession numbers NM_016113 and NM_011706, respectively, and a genomic sequence for human TRP V2 is available as GenBank accession number A94121.
- Human and murine cDNA sequences for P2X3 are available as GenBank accession numbers NM_002559 and NM_145526, respectively.
- Human and murine cDNA sequences for Mrgprd are available as GenBank accession numbers NM_198923 and NM_203490, respectively, and genomic sequences for murine Mrgprd are available as GenBank accession numbers AB 154412 and AY042209. Genomic and cDNA sequences for human Navl.9 are available as GenBank accession numbers AF 126739 and NM_014139, respectively.
- promoters or promoter sequences are not previously known, they can be obtained or determined using standard molecular biology techniques, beginning with knowledge of a complete or partial cDNA sequence of a nociceptive receptor or ion channel. It is noted in this regard that essentially complete genomic sequences are already available for a number of mammalian species, including humans and mice.
- test cell that expresses Runxl refers to any cell that expresses a Runxl protein.
- the Runxl protein includes a Runt domain that is capable of binding to DNA.
- the test cell that expresses Runxl is a neuronal cell, i.e., a neuron, that naturally expresses Runxl.
- the test cell is a neuron in or derived from a dorsal root ganglion or trigeminal ganglion.
- the test cell can be isolated, i.e., removed from its usual environment as it is found in nature.
- the test cell is an immortalized cell, e.g., a cell from a cell line.
- the test cell that expresses Runxl is a cell that has been altered to overexpress Runxl; such a cell can be a neuron or it can be a cell other than a neuron.
- a cell can be altered to overexpress Runxl by introduction into the cell of a nucleic acid that includes a coding sequence for Runxl, e.g., a Runxl expression vector.
- the nucleic acid that includes a coding sequence for Runxl can be incorporated into the genome of the cell or it can be present in the cell as a plasmid or other form of nucleic acid that is separate from the genomic DNA of the cell.
- test cell that has been altered to overexpress Runxl is a cell that is transiently transfected with a nucleic acid that includes a coding sequence for Runxl .
- test cell that has been altered to overexpress Runxl is a cell that is stably transfected with a nucleic acid that includes a coding sequence for Runxl .
- test cell that has been altered to overexpress Runxl is a cell that normally does not express Runxl .
- the overexpression of Runxl can be constitutive or it can be conditional, e.g., dependent on the presence or absence of an agent that regulates its expression by interaction with a control element associated with the nucleic acid coding for Runxl.
- the term "Runxl expression vector” refers to any nucleic acid construct that includes a nucleic acid that includes a coding sequence for Runxl, operatively linked to a gene expression sequence which is capable of directing the expression of the Runxl nucleic acid within a eukaryotic cell.
- the gene expression sequence is any regulatory nucleotide sequence, such as a promoter sequence or promoter-enhancer combination, which facilitates the efficient transcription and translation of the Runxl nucleic acid to which it is operatively linked.
- the gene expression sequence may be, for example, a mammalian or viral promoter, such as a constitutive or inducible promoter.
- Constitutive mammalian promoters include, but are not limited to, the promoters for the following genes: hypoxanthine phosphoribosyl transferase (HPRT), adenosine deaminase, pyruvate kinase, ⁇ -actin, and other constitutive promoters.
- HPRT hypoxanthine phosphoribosyl transferase
- adenosine deaminase pyruvate kinase
- ⁇ -actin constitutive promoters.
- Exemplary viral promoters which function constitutively in eukaryotic cells include, for example, promoters from the cytomegalovirus (CMV), simian virus (e.g., SV40), papilloma virus, adenovirus, human immunodeficiency virus (HIV), Rous sarcoma virus, the long terminal repeats (LTR) of Moloney leukemia virus and other retroviruses, and the thymidine kinase promoter of herpes simplex virus.
- CMV cytomegalovirus
- simian virus e.g., SV40
- papilloma virus e.g., SV40
- HIV human immunodeficiency virus
- Rous sarcoma virus HIV
- LTR long terminal repeats
- thymidine kinase promoter of herpes simplex virus thymidine kinase promoter of herpes simplex virus.
- the metallothionein promoter is induced to promote transcription and translation in the presence of certain metal ions.
- Other inducible promoters are known to those of ordinary skill in the art.
- the gene expression sequence shall include, as necessary, 5' non-transcribing and 5' non-translating sequences involved with the initiation of transcription and translation, respectively, such as a TATA box, capping sequence, CAAT sequence, and the like.
- 5' non-transcribing sequences will include a promoter region which includes a promoter sequence for transcriptional control of the operably joined Runxl nucleic acid.
- the gene expression sequences optionally include enhancer sequences or upstream activator sequences as desired.
- the Runxl nucleic acid is operatively linked to the gene expression sequence.
- a nucleic acid coding sequence and a gene expression sequence are said to be operatively linked when they are covalently linked in such a way as to place the expression or transcription and/or translation of the coding sequence under the influence or control of the gene expression sequence.
- the Runxl nucleic acid sequence and the gene expression sequence are said to be operatively linked when they are covalently linked in such a way as to place the expression or transcription and/or translation of the Runxl coding sequence under the influence or control of the gene expression sequence.
- Two DNA sequences are said to be operatively linked if induction of a promoter in the 5' gene expression sequence results in the transcription of the Runxl sequence and if the nature of the linkage between the two DNA sequences does not (1) result in the introduction of a frame-shift mutation, (2) interfere with the ability of the promoter region to direct the transcription of the Runxl sequence, or (3) interfere with the ability of the corresponding RNA transcript to be translated into a protein.
- a gene expression sequence would be operatively linked to a Runxl nucleic acid sequence if the gene expression sequence were capable of effecting transcription of that Runxl nucleic acid sequence such that the resulting transcript is translated into the desired protein or polypeptide.
- the Runxl nucleic acid of the invention may be delivered to the cell alone or in association with a vector.
- a vector is any vehicle capable of facilitating the transfer of the Runxl nucleic acid to a cell so that Runxl can be expressed by the cell.
- the vector generally transports the nucleic acid to the cell with reduced degradation relative to the extent of degradation that would result in the absence of the vector.
- the vector optionally includes the above-described gene expression sequence to enhance expression of the Runxl nucleic acid in cells.
- the vectors useful in the invention include, but are not limited to, plasmids, phagemids, viruses, and other vehicles derived from viral or bacterial sources that have been manipulated by the insertion or incorporation of the Runxl nucleic acid sequences.
- Viral vectors include, but are not limited to, nucleic acid sequences from the following viruses: retrovirus, such as Moloney murine leukemia virus, Harvey murine sarcoma virus, murine mammary tumor virus, and Rous sarcoma virus; adenovirus, adeno-associated virus; SV40-type viruses; polyoma viruses; Epstein-Barr viruses; papilloma viruses; herpes virus; vaccinia virus; polio virus; and RNA virus such as a retrovirus.
- retrovirus such as Moloney murine leukemia virus, Harvey murine sarcoma virus, murine mammary tumor virus, and Rous sarcoma virus
- adenovirus adeno-associated virus
- SV40-type viruses polyoma viruses
- Epstein-Barr viruses Epstein-Barr viruses
- papilloma viruses herpes virus
- vaccinia virus vaccinia virus
- polio virus RNA virus
- Non-cytopathic viral vectors are based on non-cytopathic eukaryotic viruses in which non-essential genes have been replaced with the gene of interest.
- Non-cytopathic viruses include retroviruses, the life cycle of which involves reverse transcription of genomic viral RNA into DNA with subsequent proviral integration into host cellular DNA.
- Retroviruses have been approved for human gene therapy trials. Most useful are those retroviruses that are replication-deficient (i.e., capable of directing synthesis of the desired proteins, but incapable of manufacturing an infectious particle).
- retroviral expression vectors have general utility for the high-efficiency transduction of genes in vivo.
- Standard protocols for producing replication-deficient retroviruses including the steps of incorporation of exogenous genetic material into a plasmid, transfection of a packaging cell line with plasmid, production of recombinant retroviruses by the packaging cell line, collection of viral particles from tissue culture media, and infection of the target cells with viral particles
- a preferred virus for certain applications is the adeno-associated virus, a double-stranded DNA virus.
- the adeno-associated virus can be engineered to be replication-deficient and is capable of infecting a wide range of cell types and species. It further has advantages, such as heat and lipid solvent stability; high transduction frequencies in cells of diverse lineages, including hematopoietic cells; and lack of superinfection inhibition, thus allowing multiple series of transductions. Reportedly, the adeno-associated virus can integrate into human cellular DNA in a site-specific manner, thereby minimizing the possibility of insertional mutagenesis and variability of inserted gene expression characteristic of retroviral infection.
- adeno-associated virus infections have been followed in tissue culture for greater than 100 passages in the absence of selective pressure, implying that the adeno-associated virus genomic integration is a relatively stable event.
- the adeno-associated virus can also function in an extrachromosomal fashion.
- Other vectors include plasmid vectors. Plasmid vectors have been extensively described in the art and are well-known to those of skill in the art. See, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, 1989. In the last few years, plasmid vectors have been found to be particularly advantageous for delivering genes to cells in vivo because of their inability to replicate within and integrate into a host genome.
- Plasmids having a promoter compatible with the host cell, can express a peptide from a gene operatively encoded within the plasmid.
- Some commonly used plasmids include pBR322, pUC18, pUC19, pRc/CMV, SV40, and pBlueScript.
- Other plasmids are well-known to those of ordinary skill in the art. Additionally, plasmids may be custom designed using restriction enzymes and ligation reactions to remove and add specific fragments of DNA.
- test agent refers to any suitable chemical compound or mixture of chemical compounds selected for assessment in a screening method of the invention.
- Test agents specifically include but are not limited to small molecules, nucleic acids, polysaccharides, peptides, polypeptides, proteins, lipids, and conjugates of any combination thereof.
- a test agents is a small molecule, i.e., a natural, synthetic, or semi-synthetic organic molecule with molecular weight less than 1.5 kDa.
- Many drugs are small molecules, and the test agent in one embodiment is a drug.
- the test agent is nucleic acid.
- the nucleic acid can be DNA, RNA, or a synthetic homolog thereof, e.g., a peptide nucleic acid or a phosphorothioate nucleic acid.
- the nucleic acid in one embodiment can be a competitor for a nucleic acid that is bound by the Runt domain of Runxl, e.g., a nucleic acid having a sequence 5'-
- 5'-YGYGGT-3' can be 5'-CGCGGT-3', 5'-CGTGGT-3', 5'-TGCGGT-3', or 5'-TGTGGT-3'.
- 5'-PYGPYGGT-3' can be 5'-GTGGTGGT-3', 5'-GCGGTGGT-3', 5'-ATGGTGGT-3', 5'-ACGGTGGT-3', 5'-GTGGCGGT-3', 5'-GCGGCGGT-3', 5'- ATGGCGGT-3', 5'-ACGGCGGT-S', 5'-GTGATGGT-3', 5'-GCGATGGT-3', 5'- ATGATGGT-3', 5'-ACGATGGT-S', 5'-GTGACGGT-3', 5'-GCGACGGT-3', 5'- ATGACGGT-3', or 5'-ACGACGGT-3'.
- test agent nucleic acid can be an antisense nucleic acid targeted to a DNA or RNA sequence encoding or regulating the expression of: Runxl; a Runxl cofactor (e.g., CBF ⁇ ); or a Runxl -dependent nociceptive receptor or ion channel.
- the test agent nucleic acid can be a short interfering RNA (siRNA) targeted to a DNA or RNA sequence encoding Runxl, a Runxl cofactor (e.g., CBF ⁇ ), or a nociceptive receptor or ion channel.
- siRNA short interfering RNA
- test agent nucleic acid encodes a protein for expression within a cell upon its introduction into the cell.
- the protein encoded by such a nucleic acid in one embodiment can be a protein that modulates the interaction between Runxl and a Runxl cofactor or other protein (such as CBF ⁇ ) that interacts with Runxl.
- the protein encoded by such a nucleic acid is a dominant negative CBF ⁇ .
- a test agent can belong to a library of small molecules or a library of test agents, where the library may include tens, hundreds, thousands, tens of thousands, or even hundreds of thousands of compounds.
- the library is or includes a number of compounds generated through combinatorial chemistry techniques.
- a library can be presented in the form of a physical array and may in one embodiment be accessed or otherwise manipulated using a robotic device, particularly for high throughput screening.
- Certain methods according to the invention involve comparison between a test cell and a control cell.
- the term "control cell" refers to any cell suitable for use in the methods of the invention for comparison with a test cell.
- the test cell and the control cell are derived from the same or homologous source of cells.
- a test cell that expresses Runxl is compared to a control cell that does not express Runxl , where the test cell and the control cell differ insofar as the test cell includes a Runxl expression vector but the control does not include the Runxl expression vector.
- a test cell that is contacted with a test agent is compared to a control cell that is not contacted with the test agent.
- measurements comparing the test cell to the control cell are performed under conditions (e.g., test conditions) that are identical.
- the test conditions can include such parameters as temperature, culture medium, concentration of test agent, cell density, duration, and the like.
- a candidate inhibitor of Runxl -mediated expression of a nociceptive receptor or ion channel identified according to a method of the invention is tested in a further assay designed to establish whether the inhibitory effect of the candidate agent is specifically attributable to inhibition of Runxl expression or function.
- Such an assay can compare, for example, the expression of the nociceptive receptor or ion channel in a cell that expresses Runxl versus the expression of the nociceptive receptor or ion channel in a cell that does not expresses Runxl .
- a candidate agent for use in inhibiting neuropathic pain identified according to a method of the invention is tested in a further assay designed to establish whether the inhibitory effect of the candidate agent is specifically attributable to inhibition of Runxl expression or function.
- Such an assay can compare, for example, the expression of the nociceptive receptor or ion channel in a cell that expresses Runxl versus the expression of the nociceptive receptor or ion channel in a cell that does not expresses Runxl.
- reporter refers to any nucleic acid or proteinaceous molecule, including a protein, that is produced in or by a cell and that can be measured, preferably by objective, quantitative measurement.
- the reporter is a protein that is normally not expressed by the cell.
- the reporter can be encoded by a nucleic acid sequence the expression of which is placed under the control of a promoter that is sensitive to a selected condition or compound, e.g., Runxl . Examples of such reporters are well known in the art.
- the reporter is a protein, such as green fluorescent protein, that emits light.
- the emitted light can be measured in a quantitative manner using a luminometer or other suitable device.
- the intensity of emitted light will be directly proportional to the amount of reporter protein that is expressed.
- the reporter is an enzyme that is capable of converting a suitable enzyme substrate into a product.
- the product can be measured using any suitable quantitative method, examples of which are well known in the art.
- the amount of product in the presence of nonlimiting substrate will be directly proportional to the amount of reporter enzyme that is expressed.
- Certain methods of the invention in some embodiments involve measuring expression of a particular protein or transcript.
- General methods and techniques for making such measurements are well known in the art and can include, without limitation, immunostaining, in situ hybridization, fluorescence microscopy, enzyme-linked immunosorbent assay (ELISA), immunoblotting (e.g., Western or dot blotting), Northern blotting, reverse transcriptase/polymerase chain reaction (RT/PCR), etc.
- ELISA enzyme-linked immunosorbent assay
- PCR enzyme-linked immunosorbent assay
- suitable target-specific binding agents and probes can be obtained commercially or prepared using standard techniques.
- nucleic acid probes can be prepared using publicly available sequences of target sequences and a suitable tagging agent.
- Antigen-specific polyclonal and monoclonal antibodies can be prepared and, optionally, labeled using suitable sources of antigen and standard techniques in molecular biology.
- the invention in certain aspects provides a method for identifying a candidate agent for use in inhibiting neuropathic pain and/or cancer pain.
- neuropathic pain refers to heightened pain sensitivity associated with peripheral nerve injury. The nerve injury may arise as a result of mechanical injury or disease affecting the nerve. In an important clinical setting, neuropathic pain is associated with cancer.
- Neuropathic pain can be associated with mechanical allodynia, i.e., pain stimulated by a normally innocuous tactile stimulus. Neuropathic pain typically has an unusual burning, tingling, or electric shock-like quality and can be triggered by very light touch. Damaged primary afferents, including nociceptors, become highly sensitive to mechanical stimulation and generate impulses even in the absence of stimulation.
- the invention in one aspect involves measuring an amount of binding between Runxl and a Runxl -sensitive promoter.
- the measuring can be performed using any suitable method, including but not limited to chromatin immunoprecipitation (ChiP) and surface plasmon resonance (SPR).
- ChiP chromatin immunoprecipitation
- SPR surface plasmon resonance
- Runxl and associated DNA can be precipitated or otherwise isolated from material not containing Runxl, and then bound DNA can be extracted from the Runxl, for example by heating. Quantitative PCR performed using extracted DNA as template and primers selected for specific nociceptive receptors and ion channels can then be performed to assess the amount of binding between Runxl and a Runxl -sensitive promoter.
- Runxl coordinately controls expression of a number of nociceptive receptors and ion channels.
- the methods of the invention can be used to assess the effect of a test agent on a number of nociceptive receptors and ion channels in parallel, thereby powerfully facilitating methods for discovery of candidate agents for use in inhibiting Runxl -mediated expression of nociceptive receptors and ion channels, as well as neuropathic pain.
- Runxl/PEBP2 ⁇ B/AMLl Runxl
- Runx3/PEBP2 ⁇ C/AML2 Runx3 ; de Bruijn MF et al. (2004) Oncogene 23 :4238-8
- DDG dorsal root ganglia
- Runx3 is implicated in the differentiation of proprioceptive sensory neurons.
- Runxl /oxP-based conditional Runxl allele
- Wntl-Cre transgenic mice have been described previously. Jiang X et al. (2000) Development 127:1607-16. The morning that vaginal plugs were observed was considered as EO.5.
- PCR-based genotyping was performed with the following primers: for Wntl-Cre allele, 5' TATCTCACGTACTGACGGTG 3' (SEQ ID NO:1) and 5' CTAGTCTAGACT- AATCGCCATCTTCCAGC 3' (SEQ ID NO:2); for Runxl wild-type and floxed alleles, 5' GAGTCCCAGCTGTCAATTCC 3' (SEQ ID NO: 3) and 5' GGTGATGGTCAGAGTGA- AGC 3 ' (SEQ ID NO:4), with floxed allele showing a larger size of DNA band after gel electrophoresis.
- Mrgpral-8, Mrgprd, Mrgprc, Mrgprb4-5 were gifts from X. Zhong and DJ. Anderson.
- the in situ signals were photographed under trans-luminescent light and converted into pseudo red fluorescent color.
- FIG. 2 A presents schematics of the conditional allele. Numbered vertical bars represent exons. Exon 4, encoding part of the DNA-binding Runt domain, is flanked with two loxP sequences (white triangles). Deletion of this exon is known to generate a null allele, de Bruijn MF et al. (2004) Oncogene 23:4238-8. The neo cassette in the intron region was also flanked with loxP sequences.
- FIG. 2 A presents schematics of the conditional allele. Numbered vertical bars represent exons. Exon 4, encoding part of the DNA-binding Runt domain, is flanked with two loxP sequences (white triangles). Deletion of this exon is known to generate a null allele, de Bruijn MF et al. (2004) Oncogene 23:4238-8. The neo cassette in the intron region was also flanked with loxP sequences.
- FIG. 2A illustrates how, after crossing with Wntl-Cre mice, the neo cassette and exon 4 were removed by Cre-mediated DNA recombination, thereby yielding RunxF ⁇ mice.
- FIG. 2B illustrates immunostaining of Runxl on sections through wild-type Runxl F/F (left) and Rural " ⁇ (right) adult DRG. A complete loss of Runxl protein was noted in mutants.
- FIG. 2C illustrates that expression of the pan- neuronal marker SCGlO, detected by in situ hybridization, was comparable in wild-type Runxl F/F (left) and RuiuV 1' (right) adult DRG.
- FIG. 2D illustrates that no difference was detected in numbers OfSCGlO + neurons in the fifth lumbar (L5) DRG between wild-type Ruml F/F and Runxl ⁇ f ⁇ mice.
- Runxl ⁇ ' ⁇ mice there was no detectable expression of Runxl in DRG neurons, suggesting complete penetrance of Cre-mediated recombination.
- RunxF ⁇ mice were viable and fertile with no overt abnormalities.
- DRG neuronal numbers were similar in Runxl ⁇ ⁇ and control Runxl FF mice, indicating that Runxl is not required for the genesis or survival of DRG neurons.
- Runxl Promotes Transition from TrM + to Ret + Phenotype
- transverse sections through DRGs or the dorsal horn of the spinal cords of adult mice were collected and prepared for in situ hybridization with digoxigenin-labeled TrIcA and Ret riboprobes.
- the in situ hybridization signal was detected by anti-digoxigenin antibody conjugated with alkaline phosphatase that can produce a purple color enzymatic reaction product (which was converted into pseudo red fluorescent color using Photoshop®).
- the tissue sections were incubated with fluorescein-conjugated IB4 lectin. Representative results are shown in FIG. 3.
- FIG. 3A- D show results of in situ hybridization with TrM (FIG. 3 A and FIG. 3B) or Ret (FIG. 3C and FIG. 3D) probes of adult DRGs in wild-type (FIG. 3A and FIG. 3C) and Runxl " ' ' (FIG. 3B and FIG. 3D) mice.
- FIG. 3E-H show results from double labeling for TrkA or Ret and IB4 binding in adult DRG in wild-type (FIG. 3E and FIG. 3G) and Riinxl " ' " (FIG. 3F and FIG. 3H) mice.
- FIG. 31 shows percentages of DRG neurons expressing the molecular markers in wild-type and RunxF f ⁇ mice.
- FIG. 3 J shows a schematic of the transformation of prospective Ret + into TrIcA + nociceptors in mutants (in comparison with the situation occurring in wild-type DRG, FIG. IG). In RunxF f ⁇ mice all nociceptors retain TrIcA. expression, although the "transformed" cells retain IB4 staining. In P60 DRG, the proportion of Ret + neurons decreased from 69% in control
- in situ hybridization was performed without proteinase K treatment, followed by immunostaining with Runxl antibody (gift from T. Jessell, Columbia University, New York; 1 :4000 in blocking solution) that was against the peptide sequence
- GRASGMTSLSAELSSRL SEQ ID NO:5
- the specificity of Runxl antibody was confirmed by the matching of its expression in wild-type DRG and the elimination of its staining in Runxl ⁇ ⁇ DRG.
- the in situ signals were photographed under trans-luminescent light and converted into pseudo red fluorescent color, while Runxl protein was detected with Alexa 488-conjugated secondary antibodies (Jackson Laboratories). Representative results are shown in FIG. 4.
- Runxl protein (bright, originally green) and indicated probes (less bright, originally red) for TRPC3, Mrgprd, P2X3, or Navl.9/SNS on adult P30 wild-type DRG sections demonstrated that Runxl was expressed in the majority of neurons expressing TRPC3, Mrgprd, P2X3, or Navl.9/SNS. Runxl was also expressed in the majority of neurons expressing TRPM8. TRP class ion channels transduce a wide range of thermal stimuli, including noxious cold or heat. Jordt SE et al. (2003) Curr Opin Neurobiol 13:487-92; Bandell M et al. (2004) Neuron 41 : 849-57.
- Mrgpr/SNSR The Mrgpr genes encode a large family of G-protein coupled receptors (GPCRs) expressed preferentially in Ret + nociceptors (Dong X et al. (2001) Cell 10 106:619-32; Lembo PM et al. (2002) Nat Neurosci 5:201-9), and activation of Mrgprc in rats causes hypersensitivity to heat and mechanical stimuli (Grazzini E et al. (2004) Proc Natl Acad Sci U S A 101 :7175-80). In RunxV ⁇ mice, expression of all twelve Mrgpr genes was either markedly reduced or absent (FIG. 4B, Table 1).
- Navl.9/SNS2 determines nociceptor membrane excitability (Dib-Hajj SD et al. (1998) Proc Natl Acad Sci USA 95:8963-8), 20 and again in Runxl ⁇ f ⁇ mice, Navl.9/SNS2 expression was markedly reduced (FIG. 4D, Table 1).
- FIG. 5 illustrates that Runxl is able to suppress the expression of markers normally expressed in TrIcA+ nociceptors.
- TrkA + neurons are peptidergic and 30 express the genes encoding the precursors for the neuropeptides Substance P (SP) and Calcitonin Gene Related Peptide (CGRP).
- SP neuropeptides Substance P
- CGRP Calcitonin Gene Related Peptide
- FIG. 5D and 5E show that not all nociceptor receptors or channels are affected in Runxl+ " mice. There was no increase or reduction in expression of the acid-sensing channel ASIC in RumF ⁇ mice as compared to wild-type mice. The expression of ion channel Navl .8/SNS was also unaffected in RunxF f ⁇ mice as compared to wild-type mice. Thus, Runxl deficiency results in a selective loss in expression of a subset of nociceptor transduction proteins.
- Runxl Initiates Expression of Some Ion Channels and Receptors Independent of TrkA and Ret
- Runxl initiates expression of some ion channels/receptors before it suppresses TrkA and maintains Ret expression postnatally (FIG. 6).
- TRPM8 + neurons do not co-express Ret (FIG. 6G-I), suggesting that initiation of TRPM8 expression is independent of Ret-mediated signaling.
- the loss of many nociceptive ion channels in Runxl "f ⁇ DRG neurons is unlikely be explained solely by the loss of Ret or the gain of TrkA expression, which in turn implies a more direct function for Runxl in controlling the expression of these channels and receptors.
- Example 7 Runxl Controls Central Targeting of Nociceptive Afferents
- the precision in processing sensory information demands coordination between the specification of sensory modality and afferent central target selection.
- FIG. 7 shows that Runxl coordinates these two developmental processes.
- IB4 + (Ret + ) afferents project predominantly to inner lamina II (Hi) (FIG. 7A (arrow) and FIG. 7K)
- CGRP + and SP + peptidergic afferents TrIcA +
- Lamina I and outer layer II (Ho) FIG. 7C, arrowhead
- Lamina Hi FIG. 7C, arrowhead
- IB4 + afferents In wild-type mice, IB4 + afferents terminate in the lamina exactly abutting the territory enriched with PKC-gamma-positive neuronal cell bodies and processes (FIG. 71), but in RunxF 1" mice the density of IB4 + afferents in this area is greatly reduced (FIG. 7J versus FIG. 71, arrows).
- mice were placed on a hot plate (Ugo Basile, Italy) and the latency to hindpaw flicking, licking, or jumping measured.
- the hot plate was set to three different temperatures, 50, 52, and 55°C, and all animals were tested sequentially at each temperature with at least 5 min between tests. A cutoff time of 60 s was used for testing at
- Runxl -deficient mice exhibited a markedly diminished response to a noxious cold (acetone evaporation) stimulus (FIG. 8C).
- Runxl -deficient mice exhibited a significantly delayed reaction time to a noxious heat stimulus (5O 0 C and 52°C hot plate) that was most evident at the lowest stimulus temperature (FIG. 8A - FIG. 8B).
- Example 9 Rural -Deficient Mice Exhibit Markedly Diminished Neuropathic Pain
- Neuropathic pain represents a heightened pain sensitivity induced by peripheral nerve injury, and normally innocuous tactile stimuli can evoke pain or pain-like withdrawal response, a phenomenon termed mechanical allodynia. Woolf C (2004) Life Sci 74:2605-10. Abnormal activation of Ret + class nociceptors may possibly underlie peripheral neuropathic pain.
- SNI spared nerve injury
- the spared nerve injury (SNI) model was performed on RunxF ⁇ and control Runxl F/F mice as described for rats. Decosterd I et al. (2000) Pain 87:149-58. Briefly, animals were anesthetized using isoflurane (3% induction, 2% maintenance). An incision was made on the lateral thigh and the underlying muscle separated to expose the sciatic nerve. The three terminal branches of the sciatic nerve (tibial, common peroneal, and sural nerves) were carefully separated while minimizing any contact with or stretching of the sural nerve. The tibial and common peroneal nerves were then individually ligated with 6.0 silk and cut distally. 2-3 mm of each nerve distal to the ligation was removed.
- SNI spared nerve injury
- the muscle incision was closed using silk sutures and the skin with surgical staples. Animals were placed on an elevated wire grid and the lateral plantar surface of the hindpaw stimulated using von Frey monofilaments (0.0174 - 4.57 g). The withdrawal threshold for the von Frey assay was determined as the filament at which the animal withdrew its paw at least twice in 10 applications.
- Baseline data (and all non-procedural testing data) was taken as the mean of two tests performed.
- Post-surgery behavioral data were analyzed by Student's T-test when comparing two groups (Graphpad Prism, Graphpad, San Diego, CA) and 2-way repeated measures ANOVA followed by Bonferroni's post-test for time courses of two or more groups (R, v. 1.7.0, R Development Core Team, Vienna, Austria). P ⁇ 0.05 was accepted as statistical significance.
- CFA complete Freund's adjuvant
- mice were briefly anesthetized with isoflurane (2-3 min) and 15 ml of CFA injected into the plantar surface of the left hindpaw. Animals were placed on an elevated wire grid and the lateral plantar surface of the hindpaw stimulated using von Frey monofilaments (0.0174 - 4.57 g). The withdrawal threshold for the von Frey assay was determined as the filament at which the animal withdrew its paw at least twice in 10 applications.
Abstract
Methods are provided for identifying candidate agents for use in inhibiting expression of certain receptors and ion channels in nociceptors. Also provided are methods for identifying candidate agents for use in inhibiting neuropathic and other types of pain.
Description
REGULATION OF RUNXl FOR TREATMENT OF PAIN
FIELD OF THE INVENTION
Sensory neurons enable animals to respond to environmental stimuli, and their diversification into distinct functional subclasses expands perceptual and behavioral repertoires. Nociceptors are a subgroup of primary sensory neurons with cell bodies in the dorsal root and trigeminal ganglia specialized to respond only to noxious/painful stimuli. They serve this function by virtue of the expression of diverse high threshold ion channels and G-protein coupled receptors (GPCRs) that transduce intense mechanical, thermal, or chemical stimuli into electrical activity. Snider WD et al. (1998) Neuron 20:629-32; Hunt SP et al. (2001) Nat Rev Neurosci 2:83-91; Dong X et al. (2001) Cell 106:619-32; Lembo PM et al. (2002) Nat Neurosci 5:201-9; Jordt SE et al. (2003) Curr Opin Neurobiol 13:487-92; Wood JN (2004) Gut 53 Suppl 2, U9-12; Lewin GR et al. (2004) Curr Opin Neurobiol 14:443-9. However, the molecular mechanisms that regulate diverse nociceptor transduction phenotypes remain essentially unknown.
SUMMARY OF THE INVENTION
In mammals, the first step in the perception of pain is the transduction of noxious stimuli by specialized ion channels and receptors expressed by nociceptive sensory neurons. Prior to the invention the mechanisms that regulate the expression of these nociceptive ion channels and receptors were not defined, and, accordingly, it has been unclear whether specific nociceptive transduction phenotypes of distinct nociceptive neurons are allocated in a coordinate or independent fashion.
The present invention is based in part on the discovery by the inventor that the Runt domain transcription factor Runxl is expressed by a major subset of nociceptors and is required for the expression of many ion channels and receptors - TRP class thermal receptors, Na+ and ATP-gated channels and Mrgpr/SNSR class G-protein coupled receptors - implicated in nociceptive processing. It has also been discovered according to the present invention that Runxl -deficient mice exhibit selective defects in thermal, neuropathic, and inflammatory pain. The invention thus is also based in part on the discovery by the inventor of Runxl -dependent coordinate transcriptional regulation of divergent nociceptor transduction phenotypes. In particular, the invention relates to a
novel therapeutic strategy for pain treatment by targeting a Runxl -mediated core transcriptional control program that is required for the expression of a large cohort of nociceptive receptors and channels. Such strategy is likely more effective than conventional strategies of developing drugs based on targeting individual channels or receptors involved in nocieptive processing.
The invention in general provides methods useful for the identification of agents that can be used to regulate expression and function of certain nociceptors and be used for intervention in pain management, including neuropathic pain, inflammatory pain, and other types of pain (such as cancer pain) that have inflammatory and neuropathic pain components. More particularly, the methods of the invention are useful for identifying agents which can be used to regulate expression and function of nociceptors whose expression is affected by Runxl.
In one aspect the invention provides a method for identifying a candidate inhibitor of Runxl -mediated expression of a nociceptive receptor or ion channel. The method according to this aspect of the invention includes the steps of contacting a test cell that expresses Runxl and comprises a nucleic acid encoding a nociceptive receptor or ion channel operatively linked to a Runxl -sensitive promoter, with a test agent and measuring a test amount of expression of the nociceptive receptor or ion channel; comparing the test amount of expression of the nociceptive receptor or ion channel to a control amount of expression of the nociceptive receptor or ion channel measured in a control cell that expresses Runxl and comprises the nucleic acid encoding the nociceptive receptor or ion channel operatively linked to the Runxl -sensitive promoter, wherein the control cell is not contacted with the test agent; and identifying the test agent as a candidate inhibitor of Runxl -mediated expression of a nociceptive receptor or ion channel when the control amount of expression is greater than the test amount of expression.
In one aspect the invention provides a method for identifying a candidate inhibitor of Runxl -mediated expression of a nociceptive receptor or ion channel. The method according to this aspect of the invention includes the steps of contacting a test cell that expresses Runxl and comprises a nucleic acid encoding a reporter operatively linked to a Runxl -sensitive promoter, with a test agent and measuring a test amount of expression of the reporter; comparing the test amount of expression of the reporter to a control amount of expression of the reporter measured in a control cell that expresses Runxl and
comprises the nucleic acid encoding the reporter operatively linked to the Runxl -sensitive promoter; and identifying the test agent as a candidate inhibitor of Runxl -mediated expression of a nociceptive receptor or ion channel when the control amount of expression is greater than the test amount of expression. In one aspect the invention provides a method for identifying a candidate agent for use in inhibiting neuropathic pain and other types of pain. The method according to this aspect of the invention includes the steps of contacting a test cell that expresses Runxl and comprises a nucleic acid encoding a nociceptive receptor or ion channel operatively linked to a Runxl -sensitive promoter, with a test agent and measuring a test amount of expression of the nociceptive receptor or ion channel; comparing the test amount of expression of the nociceptive receptor or ion channel to a control amount of expression of the nociceptive receptor or ion channel measured in a control cell that expresses Runxl and comprises the nucleic acid encoding the nociceptive receptor or ion channel operatively linked to the Runxl -sensitive promoter, wherein the control cell is not contacted with the test agent; and identifying the test agent as a candidate agent for use in inhibiting neuropathic pain and other types of pain when the control amount of expression is greater than the test amount of expression.
In one aspect the invention provides a method for identifying a compound for use in inhibiting neuropathic pain and other types of pain. The method according to this aspect of the invention includes the steps of measuring a test amount of binding between Runxl and a Runxl -sensitive promoter for a nociceptor in presence of a test compound; comparing the test amount of binding to a control amount of binding between Runxl and the promoter for the nociceptor in absence of the test compound; and identifying the test compound as a compound for use in inhibiting neuropathic pain and other types of pain when the test amount of binding is less than the control amount of binding.
In one aspect the invention provides a method for identifying a candidate compound for use in inhibiting neuropathic pain and other types of pain. The method according to this aspect of the invention includes the steps of contacting a test cell that expresses Runxl with a test agent and measuring a test amount of Runxl protein or Runxl messenger RNA; comparing the test amount of Runxl protein or messenger RNA to a control amount of Runxl protein or Runxl messenger RNA measured in absence of the test compound; and identifying the test compound as a candidate compound for use in
inhibiting neuropathic pain and other types of pain when the test amount of Runxl protein or Runxl messenger RNA is less than the control amount.
In one embodiment the nucleic acid encoding the nociceptive receptor or ion channel operatively linked to the Runxl -sensitive promoter is a gene for the nociceptive receptor or ion channel, wherein the gene includes an intrinsic promoter.
In one embodiment the nucleic acid encoding the nociceptive receptor or ion channel operatively linked to the Runxl -sensitive promoter encodes a nociceptive receptor or ion channel chosen from TRPC3, TRPM8, TRPAl, Mrgprd, P2X3, Navl.9/SNS2, and any combination thereof. In one embodiment the nociceptive receptor or ion channel is TRPC3.
In one embodiment the test cell includes a Runxl expression vector. In one embodiment the control cell includes a Runxl expression vector. In one embodiment the test amount of expression and the control amount of expression are corresponding amounts of transcript for the nociceptive receptor or ion channel.
In one embodiment the test amount of expression and the control amount of expression are corresponding amounts of protein for the nociceptive receptor or ion channel.
In one embodiment the nucleic acid encoding the nociceptive receptor or ion channel operatively linked to the Runxl -sensitive promoter is part of an expression vector.
In one embodiment the control cell is a dorsal root ganglion cell derived from a Runxl^' {RunxlF/F;Wntl-Cre) mouse.
In one embodiment the reporter expression is measured as fluorescence emitted by the reporter. In one embodiment the test compound is selected from the group consisting of small molecules, peptides, nucleic acids, and any combination thereof. In one embodiment the test compound is a small molecule. In one embodiment the test compound is a nucleic acid. In one embodiment the test compound inhibits expression of Runxl. In one embodiment the reporter is green fluorescent protein.
Each of the limitations of the invention can encompass various embodiments of the invention. It is, therefore, anticipated that each of the limitations of the invention involving any one element or combinations of elements can be included in each aspect of the invention. This invention is not limited in its application to the details of construction and the arrangement of components set forth in the following description or illustrated in the drawings. The invention is capable of other embodiments and of being practiced or of being carried out in various ways. Also, the phraseology and terminology used herein is for the purpose of description and should not be regarded as limiting. The use of "including", "comprising", "having", "containing", "involving", and variations thereof herein, is meant to encompass the items listed thereafter and equivalents thereof as well as additional items.
BRIEF DESCRIPTION OF THE DRAWINGS
The figures are illustrative only and are not required for enablement of the invention disclosed herein.
Figure IA is a schematic illustration depicting projections of different classes of nociceptors into different laminae of spinal cord of wild-type mice, with levels I/IIo being most superficial. Ret+ nociceptors, which are involved in neuropathic pain, project to deeper laminae. Figure IB is a pair of photomicrographs depicting a transverse section through embryonic (E12 and E14.5) dorsal root ganglion (DRG) immunostained for Runxl (bright, originally green) and TrkA (less bright, originally red). All Runxl+ cells at this stage coexpress TrIcA but not Ret, whereas a small subset of TrkA+ neurons lacks Runxl expression. Figure 1C is a photomicrograph depicting a transverse section through a one- month old (P30) DRG double stained for Runxl protein (bright, originally green) and TrkA mRNA (less bright, originally red).
Figure ID is a photomicrograph depicting a transverse section through a one- month old (P30) DRG double stained for Runxl protein (bright, originally green) and Ret mRNA (less bright, originally red).
Figure IE is a photomicrograph depicting a transverse section through a one-month old (P30) DRG double stained for TrkA mRNA and Ret mRNA. DRG neurons expressing
TrIcA alone appear bright, originally red, those expressing Ret alone appear brighter, originally green, and those expressing both TrkA and Ret appear brightest, originally partially yellow (arrows).
Figure IF is a photomicrograph depicting a transverse section through a one-month old (P30) DRG double stained for Runxl protein (bright, originally green) and cell surface lectin IB4 (less bright, originally red). IB4 is a marker for a subset of Ret+ neurons.
Figure IG is a schematic diagram indicating that Runxl is expressed broadly in El 4.5 TrkA+ neurons and that its expression persists in a subset of Ret neurons but extinguishes in TrIcA+ neurons. TrkA expression also extinguishes in adult Runxl+; Ret+ neurons. The origin, identity and function of Runxl~; TrIcA"; Ret+ cells remain obscure. Figure 2A is a schematic depiction of the conditional allele RunxlF (top) and the result of crossing the conditional allele RunxlF with Wntl-Cre (bottom), generating Rmu,rμ mice lacking Runxl expression in neural crest cells. Numbered vertical bars represent exons. Exon 4 is flanked by loxP sequences (triangles), as is a neo cassette in the intron between exons 4 and 5.
Figure 2B is a pair of photomicrographic images showing Runxl expression in sections of adult DRG taken from wild-type (RunxlF/F, left) and Runxl"^ (right) mice. Figure 2C is a pair of photomicrographic images showing pan-neuronal marker SCGlO expression in sections of adult DRG taken from wild-type (RιmxlF/F, left) and RunxF ~ (right) mice.
Figure 2D is a bar graph depicting the total number OfSCGlO+ neurons in fifth lumbar DRG in wild-type (RunxlFF) and Runxl~ ~ mice.
Figures 3 A and 3B are photomicrographs of transverse sections through DRGs of adult wild-type (A) and Runxl+" (B) mice, stained by in situ hybridization for TrkA. Figures 3C and 3D are photomicrographs of transverse sections through DRGs of adult wild-type (C) and Runxl~f~ (D) mice, stained by in situ hybridization for Ret.
Figures 3E and 3F are photomicrographs of transverse sections through DRGs of adult wild-type (E) and Runxl+" (F) mice, double stained by in situ hybridization for Ret (less bright, originally red) and IB4 binding (bright, originally green). Figures 3G and 3H are photomicrographs of transverse sections through DRGs of adult wild-type (G) and RunxV'' (H) mice, double stained by in situ hybridization for
TrkA (bright, originally green and/or yellow) and for IB4 binding (less bright, originally red). In wild-type DRG, IB4+ cells do not coexpress TrkA.
Figure 31 is a bar graph depicting percentages of DRG neurons expressing TrIcA.,
Ret, and IB4 in wild-type mice (RunxlF/F, filled bars) and RunxV^ mice (unfilled bars). Figure 3J is a schematic diagram depicting transformation of prospective Ret+ into
TrIcA+ nociceptors in RunxF^ mice.
Figure 4 is an array of paired photomicrographs of sections through adult wild-type and Runxrf~ DRG, with in situ hybridization performed with indicated probes for (4 A:)
TRPAl, TRPM8, TRPC3, TRPVl, TRPV2; (4B:) Mrgprb4, Mrgprb5, Mrgprad; (C:) Navl.9; and (D:) P2X3. Arrows point out selective reduction of high-level expression of
TRPVl, TRPV2 and Navl.9 in Runxl~ ~ mice. Arrowheads point out intermediate expression of TRPVl, TRPV2 and Navl.9 in Runxl~μ mice. Figure 4E is a panel of four photomicrographic images of sections of P30 wild-type DRG double labeled for Runxl protein (bright, originally green) and the indicated probes (less bright, originally red). Figure 5 A is a pair of photomicrographic images depicting double labeling of
Runxl protein (bright, originally green) and Calcitonin Gene Related Peptide (CGRP)
(less bright, originally red) in El 6.5 and P30 DRG sections from wild-type RurιxlF/F mice.
Runxl+ neurons do not express CGRP at El 6.5 (arrows) but some CGRP+ neurons express a low level of Runxl at P30 (arrowhead). Figure 5B is a photomicrographic image depicting double labeling of Runxl protein (bright, originally green) and DRASIC (less bright, originally red) in P30 DRG sections from wild-type RunxlF/F mice. Runxl+ neurons do not express DRASIC at P30
(arrow).
Figure 5 C is a panel of six photomicrographic images depicting expression of CGRP, Substance P (SP), and combined IB4 and CGRP in sections of adult wild-type
(RuwclF/F) (left) and Runxl+ (right) DRG. Arrows, CGRP+; arrowheads, CGRP~.
Figure 5D is a panel of six photomicrographic images depicting expression of mu- class opioid receptor (MOR), DRASIC, and ASIC in sections of adult wild-type (RunxlF/F)
(left) and Runxl+ (right) DRG. Figure 5E is a bar graph depicting the average (± SEM) percentages of DRG neurons expressing the indicated markers in adult wild-type (RunxlF/F) (filled bars) and
Runxl+ (open bars) mice. * t test PO.001.
Figure 5F is a schematic representation showing how Runxl activates and suppresses two separate groups of neuropeptides, ion channels, and sensory receptors. Figure 6A-6D are photomicrographic images depicting in situ hybridization of TRPAdS (A and B) and Mrgprd (C and D) in E16.5 sections of wild-type RunxlF/F (A and C) and RumF^ (B and D) DRG.
Figure 6E is a photomicrographic image depicting double immunostaining of Runxl protein (bright, originally green) with TrkA protein (less bright, originally red) in El 7 wild-type DRG.
Figure 6F is a photomicrographic image depicting double immunostaining of Runxl protein (bright, originally green) with Ret protein (less bright, originally red) in El 7 wild-type DRG.
Figure 6G-I are a panel of three photomicrographic images depicting double staining of TRPM8 mRNA (bright, originally green) and Ret protein (less bright, originally red) in El 7 wild-type DRG. Figures 7 A and 7B are a pair of photomicrographic images depicting staining for
IB4 (originally green) in P30 dorsal horn sections from wild-type (RwvclF/F) mice (left) and Runxl~ ~ mice (right). Arrowheads, superficial lamina; arrow, deep lamina.
Figures 7C and 7D are a pair of photomicrographic images depicting staining for CGRP (originally red) in P30 dorsal horn sections from wild-type (RunxlF/F) mice (left) and RunxV1' mice (right). Arrowheads, superficial lamina; arrow, deep lamina.
Figures 7E and 7F are a pair of merged photomicrographic images of Figures 7A and 7C and of Figures 7B and 7D, respectively.
Figures 7G and 7H are a pair of photomicrographic images depicting double staining of IB4 (originally green) and Substance P (SP; originally red) in P30 dorsal horn sections from wild-type (RunxlF/F) mice (left) and Rural'1' mice (right). Arrowhead, superficial lamina.
Figures 71 and 7 J are a pair of photomicrographic images depicting double staining of IB4 (originally green) and protein kinase C-gamma (PKC-gamma; originally red) in P30 dorsal horn sections from wild-type (RunxlF/F) mice (left) and RunxF^ mice (right). Arrows, deep lamina.
Figure 7K is a schematic drawing depicting deep lamina-specific innervation of IB4+ afferents in wild-type (RunxlF/F) dorsal horn.
Figure 7L is a schematic drawing depicting more superficial lamina-specific innervation of IB4+ afferents in RunxF^ dorsal horn.
Figures 8 A and 8B are bar graphs depicting behavioral sensitivity of control RunxlF F mice (open bars) and RunxF ~ mice (hatched bars) to heat at the indicated temperatures. *** PO.001.
Figure 8C is a bar graph depicting behavioral sensitivity of control RunxlF F mice (open bars) and Rural'1' mice (hatched bars) to cold. ** PO.01.
Figure 8D is a bar graph depicting behavioral sensitivity of control RuralFF mice (open bars) and RunxFf~ mice (hatched bars) to capsaicin-induced chemical pain. * PO.05.
Figures 8E and 8F are bar graphs depicting behavioral sensitivity of control Rural mice (open bars) and RunxF ~ mice (hatched bars) to mechanical pain induced with von Frey hair (E) or pin prick (F).
Figure 8G is a graph depicting mechanical allodynia in control RwalF/F mice (square symbols) and RuraF^ mice (triangle symbols) in the spared nerve injury model of neuropathic pain.
Figure 8H is a bar graph depicting behavioral sensitivity of control RuwclF/F mice (open bars) and RunxF1" mice (hatched bars) to inflammatory pain. ** P<0.01 and *** PO.001 compared to baseline; ^ PO.001 compared to control RιmxlF/F mice. CFA, complete Freund's adjuvant.
DETAILED DESCRIPTION OF THE INVENTION
Runxl (runt-related transcription factor 1) is a mammalian transcription factor that is encoded by Runxl, a gene related to the runt gene in Drosophila melanogaster . In Drosophila the runt gene has been reported to be involved in several developmental pathways, including segmentation, sex determination, and neurogenesis. In mammals Runxl encodes the DNA-binding subunit of the heterodimeric core-binding factor (CBF). CBF consists of a DNA-binding alpha (α) subunit that contacts DNA directly, and a beta (β) subunit that forms a complex with the α subunit and enhances CBF affinity for DNA without itself binding to DNA. In mammals CBFα subunits are encoded by at least three distinct genes (Cbfal, Cbfa2, and Cbfa3), while a single gene (Cbβ) encodes the CBFβ subunit. Chromosomal translocations involving the Cbfal gene, also known as Runxl and
as AMLl, have been associated with common forms of leukemias and myelodysplasias in humans.
CBF has been reported to bind to 5'-YGYGGT-3' or 5'-PYGPYGGT-3' (P= purine, Y=pyrimidine) sites found in the promoters and enhancers of many genes encoding a diverse set of proteins including cytokines, cell surface differentiation markers, and myeloid-specific proteins. In addition to their expression in hematopoietic cells, transcription factor Runxl (also known in the literature as AMLl, CBFA2, EVI-I, AMLCRl, PEBPcώ, PEBP2αB, and AMLl-EVI-I) and another Runt class transcription factor, Runx3/ PEBP2βC/AML2 (de Bruijn MF et al. (2004) Oncogene 23:4238-48), have been reported to be expressed by cutaneous and proprioceptive sensory neurons, respectively, in the dorsal root ganglia (DRG), and Runx3 has been implicated in the differentiation of proprioceptive sensory neurons. Inoue K et al. (2002) Nat Neurosci 5:946-954; Levanon D et al. (2002) EMBO J21 :3454-63; Theriault FM et al. (2004) Proc Natl Acad Sci USA 101 :10343-8. The cDNA sequences of at least two transcript variants of human Runxl are known. These include a longer isoform (a), encoding a 480 amino acid transcription factor protein, and a shorter isoform (b), encoding a 453 amino acid transcription factor protein. Nucleotide sequences for these two isoforms are available as GenBank accession numbers NM_001754 and NM_001001890, respectively. A genomic sequence for human Runxl is available as GenBank accession number AF025841.
At least five isoforms of murine Runxl have been reported, including isoforms 1 (451 amino acids) and isoform 4 (465 amino acids). Nucleic acid and amino acid sequences for these isoforms are available from GenBank, e.g., D13802 (isoform 1). See also GenBank Q03347. A genomic sequence for murine Runxl is available as GenBank accession number 193030.
Until now efforts to elucidate further the function of Runxl through the use of Runxl -deficient mice have been impeded by the fact that such mutations are lethal during development. More specifically, it has been reported that disruption of the Runxl gene such that its expression product no longer can bind DNA causes necrosis and hemorrhaging in the central nervous system and blocks definitive hematopoiesis during embryogenesis. Wang Q et al. (1996) Proc Natl Acad Sci USA 93:3444-9.
As disclosed in greater detail below in Example 1, in order to examine the influence of Runxl on the differentiation of nociceptive sensory neurons, mice carrying a /øxP-based conditional Runxl allele (referred to here as RunxlF; FIG. 2A) were crossed with a Wntl-Cre mouse strain that directs Cre expression in neural crest progenitors of DRG neurons. Jiang X et al. (2000) Development 127:1607-16. In Runxl~ ~ mice so derived there is no detectable expression of Runxl in DRG neurons, suggesting complete penetrance of Cre-mediated recombination. Runxl~ ~ mice are viable and fertile with no overt abnormalities. Moreover, DRG neuronal numbers are similar in Runxl+ and control RurιxlF/F mice, indicating that Runxl is not required for the genesis or survival of DRG neurons.
Soon after their generation, most embryonic nociceptive neurons express the high affinity nerve growth factor (NGF) receptor TrkA, but later in development about half of these neurons extinguish TrkA and begin to express Ret, a glial-derived growth factor (GDNF) receptor (Snider WD et al. (1998) Neuron 20:629-32; Molliver DC et al. (1997) Neuron 19:849-61) (FIG. 1). In wild-type mice, Runxl expression is first detected in DRG neurons at embryonic day (E) 11.5, after the onset of TrkA expression, and until E14.5, Runxl expression is confined to TrkA+ neurons (FIG. IB), with -90% of TrkA+ neurons expressing Runxl (FIG. IB, FIG. IG). By postnatal day (P) 6.5, extinction of TrkA expression from some Runxl+ neurons begins, and by P30 Runxl+ neurons only rarely co-express TrkA (FIG. 1C) and most co-express Ret instead (FIG. ID). Thus, in wild-type mice, the persistence of Runxl expression is associated with sensory neurons that undergo the developmental transition from a TrkA+ to a Ret+ nociceptor phenotype (FIG. IG).
The invention relates in certain aspects to methods of identifying a candidate inhibitor of Runxl -mediated expression of a nociceptive receptor or ion channel. As disclosed herein, it has been discovered according to the invention that Runxl is involved in the coordinate expression of a host of nociceptors of certain classes. These nociceptors relate especially to those involved in sensing painful thermal and mechanical stimuli. As used herein, the term "nociceptor" refers to any of a subgroup of primary sensory neurons with cell bodies in the dorsal root and trigeminal ganglia specialized to respond only to noxious stimuli. Nociceptors serve this function by virtue of their expression of diverse high threshold ion channels and G-protein coupled receptors
(GPCRs) that transduce intense mechanical, thermal, or chemical stimuli into electrical activity.
As used herein, the term "nociceptive receptor or ion channel" refers to any GPCR or high threshold ion channel that is expressed by a nociceptor and is involved in transducing mechanical, thermal, or chemical stimuli into electrical activity. Nociceptive receptors and ion channels specifically can include, but are not limited to, TRPA, TRPM8, TRPC3, TRPVl, TRPV2, P2X3, the Mrg family of GPCRs (encompassing a dozen or more receptors including Mrgpra, Mrgprb, Mrgprc, and Mrgprd family members), and tetrodotoxin-resistant sodium channels such as Navl.9. Certain methods of the invention involve contacting a test agent with a cell that expresses Runxl and includes a nucleic acid encoding a nociceptive receptor or ion channel operatively linked to a Runxl -sensitive promoter.
As used herein, the term "nucleic acid encoding a nociceptive receptor or ion channel" refers to any DNA or RNA molecule that encodes such receptor or ion channel. In one embodiment the nucleic acid is a genomic DNA encoding the nociceptive receptor or ion channel. In one embodiment the nucleic acid is a complementary DNA (cDNA) encoding the nociceptive receptor or ion channel. In either of these embodiments the encoding DNA can be operatively linked to an endogenous or exogenous (heterologous) promoter that is responsive to binding by Runxl . In one embodiment the nucleic acid encoding a nociceptive receptor or ion channel is a gene, including at least a portion of its native or endogenous promoter, that encodes a nociceptive receptor or ion channel.
In one embodiment the nucleic acid encoding a nociceptive receptor or ion channel is naturally expressed by a cell used in a method of the invention. In such embodiment the nucleic acid encoding a nociceptive receptor or ion channel is a gene, including its native or endogenous promoter, that encodes a nociceptive receptor or ion channel. In one embodiment the endogenous promoter is a Runxl -sensitive promoter.
In one embodiment the nucleic acid encoding a nociceptive receptor or ion channel is not naturally expressed by a cell used in a method of the invention. In such embodiment the nucleic acid encoding a nociceptive receptor or ion channel is a nucleic acid that is artificially introduced into the cell, for example by transfection with a suitable expression vector for the receptor or ion channel. The nucleic acid encoding a nociceptive receptor or ion channel in one embodiment is operatively linked to an endogenous or exogenous
(heterologous) promoter. In one embodiment the endogenous promoter is a Runxl - sensitive promoter. In one embodiment the exogenous (heterologous) promoter is a Runxl -sensitive promoter.
As used herein, the term "Runxl -sensitive promoter" refers to a nucleic acid including a promoter of gene transcription, wherein the promoter includes a sequence specifically bound by a Runt domain of Runxl transcription factor. Promoters generally include 5' untranscribed, untranslated DNA sequence found upstream of (5' to) the coding sequence (open reading frame) of a gene. A promoter typically spans hundreds of nucleotides but can be longer or shorter. Promoters can include one or more transcription factor response elements, which are DNA sequences recognized and bound by transcription factors. The sequence bound by the Runt domain typically will include a DNA sequence 5'-YGYGGT-3' or 5'-PYGPYGGT-3', where G=guanine, P= purine, T=thymine, and Y=pyrimidine.
In certain embodiments the Runxl -sensitive promoter is a promoter for a gene encoding a nociceptive receptor or ion channel. Nociceptive receptors and ion channels include those disclosed above, and they can include those from human and other mammalian species. Nucleotide sequences for genes encoding such proteins are available from public databases such as GenBank. For example, human and murine cDNA sequences for TRPC3 are available as GenBank accession numbers NM_003305 and NM_019510, respectively. Human and murine cDNA sequences for TRPM8 are available as GenBank accession numbers NM_024080 and NM_134252, respectively. Human and murine cDNA sequences for TRPVl are available as GenBank accession numbers NM_080706 and NM_001001445, respectively, and a genomic sequence for murine TRPVl is available as GenBank accession number AL663116. Human and murine cDNA sequences for TRP V2 are available as GenBank accession numbers NM_016113 and NM_011706, respectively, and a genomic sequence for human TRP V2 is available as GenBank accession number A94121. Human and murine cDNA sequences for P2X3 are available as GenBank accession numbers NM_002559 and NM_145526, respectively. Human and murine cDNA sequences for Mrgprd are available as GenBank accession numbers NM_198923 and NM_203490, respectively, and genomic sequences for murine Mrgprd are available as GenBank accession numbers AB 154412 and AY042209.
Genomic and cDNA sequences for human Navl.9 are available as GenBank accession numbers AF 126739 and NM_014139, respectively.
Where promoters or promoter sequences are not previously known, they can be obtained or determined using standard molecular biology techniques, beginning with knowledge of a complete or partial cDNA sequence of a nociceptive receptor or ion channel. It is noted in this regard that essentially complete genomic sequences are already available for a number of mammalian species, including humans and mice.
As used herein the term "test cell that expresses Runxl" refers to any cell that expresses a Runxl protein. In a preferred embodiment the Runxl protein includes a Runt domain that is capable of binding to DNA. In one embodiment the test cell that expresses Runxl is a neuronal cell, i.e., a neuron, that naturally expresses Runxl. In one embodiment the test cell is a neuron in or derived from a dorsal root ganglion or trigeminal ganglion. The test cell can be isolated, i.e., removed from its usual environment as it is found in nature. In one embodiment the test cell is an immortalized cell, e.g., a cell from a cell line. In one embodiment the test cell that expresses Runxl is a cell that has been altered to overexpress Runxl; such a cell can be a neuron or it can be a cell other than a neuron. A cell can be altered to overexpress Runxl by introduction into the cell of a nucleic acid that includes a coding sequence for Runxl, e.g., a Runxl expression vector. The nucleic acid that includes a coding sequence for Runxl can be incorporated into the genome of the cell or it can be present in the cell as a plasmid or other form of nucleic acid that is separate from the genomic DNA of the cell. In one embodiment the test cell that has been altered to overexpress Runxl is a cell that is transiently transfected with a nucleic acid that includes a coding sequence for Runxl . In one embodiment the test cell that has been altered to overexpress Runxl is a cell that is stably transfected with a nucleic acid that includes a coding sequence for Runxl . In one embodiment the test cell that has been altered to overexpress Runxl is a cell that normally does not express Runxl . The overexpression of Runxl can be constitutive or it can be conditional, e.g., dependent on the presence or absence of an agent that regulates its expression by interaction with a control element associated with the nucleic acid coding for Runxl.
As used herein, the term "Runxl expression vector" refers to any nucleic acid construct that includes a nucleic acid that includes a coding sequence for Runxl,
operatively linked to a gene expression sequence which is capable of directing the expression of the Runxl nucleic acid within a eukaryotic cell. The gene expression sequence is any regulatory nucleotide sequence, such as a promoter sequence or promoter-enhancer combination, which facilitates the efficient transcription and translation of the Runxl nucleic acid to which it is operatively linked. The gene expression sequence may be, for example, a mammalian or viral promoter, such as a constitutive or inducible promoter. Constitutive mammalian promoters include, but are not limited to, the promoters for the following genes: hypoxanthine phosphoribosyl transferase (HPRT), adenosine deaminase, pyruvate kinase, β-actin, and other constitutive promoters. Exemplary viral promoters which function constitutively in eukaryotic cells include, for example, promoters from the cytomegalovirus (CMV), simian virus (e.g., SV40), papilloma virus, adenovirus, human immunodeficiency virus (HIV), Rous sarcoma virus, the long terminal repeats (LTR) of Moloney leukemia virus and other retroviruses, and the thymidine kinase promoter of herpes simplex virus. Other constitutive promoters are known to those of ordinary skill in the art. The promoters useful as gene expression sequences of the invention also include inducible promoters. Inducible promoters are expressed in the presence of an inducing agent. For example, the metallothionein promoter is induced to promote transcription and translation in the presence of certain metal ions. Other inducible promoters are known to those of ordinary skill in the art. In general, the gene expression sequence shall include, as necessary, 5' non-transcribing and 5' non-translating sequences involved with the initiation of transcription and translation, respectively, such as a TATA box, capping sequence, CAAT sequence, and the like. Especially, such 5' non-transcribing sequences will include a promoter region which includes a promoter sequence for transcriptional control of the operably joined Runxl nucleic acid. The gene expression sequences optionally include enhancer sequences or upstream activator sequences as desired.
The Runxl nucleic acid is operatively linked to the gene expression sequence. As used herein, a nucleic acid coding sequence and a gene expression sequence are said to be operatively linked when they are covalently linked in such a way as to place the expression or transcription and/or translation of the coding sequence under the influence or control of the gene expression sequence. As used herein, the Runxl nucleic acid sequence and the gene expression sequence are said to be operatively linked when they are
covalently linked in such a way as to place the expression or transcription and/or translation of the Runxl coding sequence under the influence or control of the gene expression sequence. Two DNA sequences are said to be operatively linked if induction of a promoter in the 5' gene expression sequence results in the transcription of the Runxl sequence and if the nature of the linkage between the two DNA sequences does not (1) result in the introduction of a frame-shift mutation, (2) interfere with the ability of the promoter region to direct the transcription of the Runxl sequence, or (3) interfere with the ability of the corresponding RNA transcript to be translated into a protein. Thus, a gene expression sequence would be operatively linked to a Runxl nucleic acid sequence if the gene expression sequence were capable of effecting transcription of that Runxl nucleic acid sequence such that the resulting transcript is translated into the desired protein or polypeptide.
The Runxl nucleic acid of the invention may be delivered to the cell alone or in association with a vector. In its broadest sense, a vector is any vehicle capable of facilitating the transfer of the Runxl nucleic acid to a cell so that Runxl can be expressed by the cell. The vector generally transports the nucleic acid to the cell with reduced degradation relative to the extent of degradation that would result in the absence of the vector. The vector optionally includes the above-described gene expression sequence to enhance expression of the Runxl nucleic acid in cells. In general, the vectors useful in the invention include, but are not limited to, plasmids, phagemids, viruses, and other vehicles derived from viral or bacterial sources that have been manipulated by the insertion or incorporation of the Runxl nucleic acid sequences. Viral vectors include, but are not limited to, nucleic acid sequences from the following viruses: retrovirus, such as Moloney murine leukemia virus, Harvey murine sarcoma virus, murine mammary tumor virus, and Rous sarcoma virus; adenovirus, adeno-associated virus; SV40-type viruses; polyoma viruses; Epstein-Barr viruses; papilloma viruses; herpes virus; vaccinia virus; polio virus; and RNA virus such as a retrovirus. One can readily employ other vectors not named but known in the art.
Preferred viral vectors are based on non-cytopathic eukaryotic viruses in which non-essential genes have been replaced with the gene of interest. Non-cytopathic viruses include retroviruses, the life cycle of which involves reverse transcription of genomic viral RNA into DNA with subsequent proviral integration into host cellular DNA. Retroviruses
have been approved for human gene therapy trials. Most useful are those retroviruses that are replication-deficient (i.e., capable of directing synthesis of the desired proteins, but incapable of manufacturing an infectious particle). Such genetically altered retroviral expression vectors have general utility for the high-efficiency transduction of genes in vivo. Standard protocols for producing replication-deficient retroviruses (including the steps of incorporation of exogenous genetic material into a plasmid, transfection of a packaging cell line with plasmid, production of recombinant retroviruses by the packaging cell line, collection of viral particles from tissue culture media, and infection of the target cells with viral particles) are provided in Kriegler, M., Gene Transfer and Expression: A Laboratory Manual, W.H. Freeman and Co., New York (1991) and Murray, E. J., Methods in Molecular Biology, vol. 7, Humana Press, Inc., Cliffton, New Jersey (1991). A preferred virus for certain applications is the adeno-associated virus, a double-stranded DNA virus. The adeno-associated virus can be engineered to be replication-deficient and is capable of infecting a wide range of cell types and species. It further has advantages, such as heat and lipid solvent stability; high transduction frequencies in cells of diverse lineages, including hematopoietic cells; and lack of superinfection inhibition, thus allowing multiple series of transductions. Reportedly, the adeno-associated virus can integrate into human cellular DNA in a site-specific manner, thereby minimizing the possibility of insertional mutagenesis and variability of inserted gene expression characteristic of retroviral infection. In addition, wild-type adeno-associated virus infections have been followed in tissue culture for greater than 100 passages in the absence of selective pressure, implying that the adeno-associated virus genomic integration is a relatively stable event. The adeno-associated virus can also function in an extrachromosomal fashion. Other vectors include plasmid vectors. Plasmid vectors have been extensively described in the art and are well-known to those of skill in the art. See, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, 1989. In the last few years, plasmid vectors have been found to be particularly advantageous for delivering genes to cells in vivo because of their inability to replicate within and integrate into a host genome. These plasmids, however, having a promoter compatible with the host cell, can express a peptide from a gene operatively encoded within the plasmid. Some commonly used plasmids include pBR322, pUC18,
pUC19, pRc/CMV, SV40, and pBlueScript. Other plasmids are well-known to those of ordinary skill in the art. Additionally, plasmids may be custom designed using restriction enzymes and ligation reactions to remove and add specific fragments of DNA.
As used herein, the term "test agent" refers to any suitable chemical compound or mixture of chemical compounds selected for assessment in a screening method of the invention. Test agents specifically include but are not limited to small molecules, nucleic acids, polysaccharides, peptides, polypeptides, proteins, lipids, and conjugates of any combination thereof.
In one embodiment a test agents is a small molecule, i.e., a natural, synthetic, or semi-synthetic organic molecule with molecular weight less than 1.5 kDa. Many drugs are small molecules, and the test agent in one embodiment is a drug.
In one embodiment the test agent is nucleic acid. The nucleic acid can be DNA, RNA, or a synthetic homolog thereof, e.g., a peptide nucleic acid or a phosphorothioate nucleic acid. The nucleic acid in one embodiment can be a competitor for a nucleic acid that is bound by the Runt domain of Runxl, e.g., a nucleic acid having a sequence 5'-
YGYGGT-3' or 5'-PYGPYGGT-3'. In various specific embodiments 5'-YGYGGT-3' can be 5'-CGCGGT-3', 5'-CGTGGT-3', 5'-TGCGGT-3', or 5'-TGTGGT-3'. In various specific embodiments 5'-PYGPYGGT-3' can be 5'-GTGGTGGT-3', 5'-GCGGTGGT-3', 5'-ATGGTGGT-3', 5'-ACGGTGGT-3', 5'-GTGGCGGT-3', 5'-GCGGCGGT-3', 5'- ATGGCGGT-3', 5'-ACGGCGGT-S', 5'-GTGATGGT-3', 5'-GCGATGGT-3', 5'- ATGATGGT-3', 5'-ACGATGGT-S', 5'-GTGACGGT-3', 5'-GCGACGGT-3', 5'- ATGACGGT-3', or 5'-ACGACGGT-3'.
In one embodiment the test agent nucleic acid can be an antisense nucleic acid targeted to a DNA or RNA sequence encoding or regulating the expression of: Runxl; a Runxl cofactor (e.g., CBFβ); or a Runxl -dependent nociceptive receptor or ion channel. In one embodiment the test agent nucleic acid can be a short interfering RNA (siRNA) targeted to a DNA or RNA sequence encoding Runxl, a Runxl cofactor (e.g., CBFβ), or a nociceptive receptor or ion channel.
In one embodiment the test agent nucleic acid encodes a protein for expression within a cell upon its introduction into the cell. The protein encoded by such a nucleic acid in one embodiment can be a protein that modulates the interaction between Runxl
and a Runxl cofactor or other protein (such as CBFβ) that interacts with Runxl. In one embodiment the protein encoded by such a nucleic acid is a dominant negative CBFβ.
A test agent can belong to a library of small molecules or a library of test agents, where the library may include tens, hundreds, thousands, tens of thousands, or even hundreds of thousands of compounds. In one embodiment the library is or includes a number of compounds generated through combinatorial chemistry techniques. A library can be presented in the form of a physical array and may in one embodiment be accessed or otherwise manipulated using a robotic device, particularly for high throughput screening. Certain methods according to the invention involve comparison between a test cell and a control cell. As used herein, the term "control cell" refers to any cell suitable for use in the methods of the invention for comparison with a test cell. In preferred embodiments the test cell and the control cell are derived from the same or homologous source of cells. For example, in one embodiment a test cell that expresses Runxl is compared to a control cell that does not express Runxl , where the test cell and the control cell differ insofar as the test cell includes a Runxl expression vector but the control does not include the Runxl expression vector. As a further example, in one embodiment a test cell that is contacted with a test agent is compared to a control cell that is not contacted with the test agent. In certain embodiments measurements comparing the test cell to the control cell are performed under conditions (e.g., test conditions) that are identical. The test conditions can include such parameters as temperature, culture medium, concentration of test agent, cell density, duration, and the like. Those skilled in the art will recognize how to design and perform properly controlled comparisons.
In one embodiment a candidate inhibitor of Runxl -mediated expression of a nociceptive receptor or ion channel identified according to a method of the invention is tested in a further assay designed to establish whether the inhibitory effect of the candidate agent is specifically attributable to inhibition of Runxl expression or function. Such an assay can compare, for example, the expression of the nociceptive receptor or ion channel in a cell that expresses Runxl versus the expression of the nociceptive receptor or ion channel in a cell that does not expresses Runxl .
Similarly, in one embodiment a candidate agent for use in inhibiting neuropathic pain identified according to a method of the invention is tested in a further assay designed
to establish whether the inhibitory effect of the candidate agent is specifically attributable to inhibition of Runxl expression or function. Such an assay can compare, for example, the expression of the nociceptive receptor or ion channel in a cell that expresses Runxl versus the expression of the nociceptive receptor or ion channel in a cell that does not expresses Runxl.
Certain methods according to the invention involve the use of a reporter. As used herein, the term "reporter" refers to any nucleic acid or proteinaceous molecule, including a protein, that is produced in or by a cell and that can be measured, preferably by objective, quantitative measurement. In one embodiment the reporter is a protein that is normally not expressed by the cell. The reporter can be encoded by a nucleic acid sequence the expression of which is placed under the control of a promoter that is sensitive to a selected condition or compound, e.g., Runxl . Examples of such reporters are well known in the art. In one embodiment the reporter is a protein, such as green fluorescent protein, that emits light. The emitted light can be measured in a quantitative manner using a luminometer or other suitable device. The intensity of emitted light will be directly proportional to the amount of reporter protein that is expressed. In one embodiment the reporter is an enzyme that is capable of converting a suitable enzyme substrate into a product. The product can be measured using any suitable quantitative method, examples of which are well known in the art. The amount of product in the presence of nonlimiting substrate will be directly proportional to the amount of reporter enzyme that is expressed.
Certain methods of the invention in some embodiments involve measuring expression of a particular protein or transcript. General methods and techniques for making such measurements are well known in the art and can include, without limitation, immunostaining, in situ hybridization, fluorescence microscopy, enzyme-linked immunosorbent assay (ELISA), immunoblotting (e.g., Western or dot blotting), Northern blotting, reverse transcriptase/polymerase chain reaction (RT/PCR), etc. Those skilled in the art will recognize that suitable target-specific binding agents and probes can be obtained commercially or prepared using standard techniques. For example, nucleic acid probes can be prepared using publicly available sequences of target sequences and a suitable tagging agent. Antigen-specific polyclonal and monoclonal antibodies can be prepared and, optionally, labeled using suitable sources of antigen and standard techniques in molecular biology.
The invention in certain aspects provides a method for identifying a candidate agent for use in inhibiting neuropathic pain and/or cancer pain. As used herein, the term "neuropathic pain" refers to heightened pain sensitivity associated with peripheral nerve injury. The nerve injury may arise as a result of mechanical injury or disease affecting the nerve. In an important clinical setting, neuropathic pain is associated with cancer.
Neuropathic pain can be associated with mechanical allodynia, i.e., pain stimulated by a normally innocuous tactile stimulus. Neuropathic pain typically has an unusual burning, tingling, or electric shock-like quality and can be triggered by very light touch. Damaged primary afferents, including nociceptors, become highly sensitive to mechanical stimulation and generate impulses even in the absence of stimulation.
The invention in one aspect involves measuring an amount of binding between Runxl and a Runxl -sensitive promoter. The measuring can be performed using any suitable method, including but not limited to chromatin immunoprecipitation (ChiP) and surface plasmon resonance (SPR). In ChiP samples containing Runxl promoter protein and putative promoter-containing DNA are chemically fixed using paraformaldehyde or other suitable agent, thereby crosslinking promoter to DNA. Following crosslinking, samples are sonicated to produce DNA fragments on the order of 1 kb long, some of which will be crosslinked to promoter. Upon addition of anti-Runxl antibody, Runxl and associated DNA can be precipitated or otherwise isolated from material not containing Runxl, and then bound DNA can be extracted from the Runxl, for example by heating. Quantitative PCR performed using extracted DNA as template and primers selected for specific nociceptive receptors and ion channels can then be performed to assess the amount of binding between Runxl and a Runxl -sensitive promoter.
Based on discoveries underlying the invention, it is now appreciated that Runxl coordinately controls expression of a number of nociceptive receptors and ion channels. The methods of the invention can be used to assess the effect of a test agent on a number of nociceptive receptors and ion channels in parallel, thereby powerfully facilitating methods for discovery of candidate agents for use in inhibiting Runxl -mediated expression of nociceptive receptors and ion channels, as well as neuropathic pain.
The present invention is further illustrated by the following Examples, which in no way should be construed as further limiting.
EXAMPLES
Example 1 Generation and Characterization ofRunxl~'~ Mice
Two Runt class transcription factors, Runxl/PEBP2αB/AMLl (Runxl) and Runx3/PEBP2βC/AML2 (Runx3 ; de Bruijn MF et al. (2004) Oncogene 23 :4238-8), are expressed by cutaneous and proprioceptive sensory neurons, respectively, in the dorsal root ganglia (DRG), and Runx3 is implicated in the differentiation of proprioceptive sensory neurons. Inoue K et al. (2002) Nat Neurosci 5:946-54; Levanon D et al. (2002) EMBO J 21:3454-63; Theriault FM et al. (2004) Proc Natl Acad Sci USA 101 :10343-8. To examine the influence of Runxl on the differentiation of nociceptive sensory neurons, the phenotype of Runxl -deficient mice were analyzed. Mice carrying a /oxP-based conditional Runxl allele (referred here to as Runxl ) were crossed with a Wntl-Cre mouse strain that directs Cre expression in neural crest progenitors of DRG neurons.
Wntl-Cre transgenic mice have been described previously. Jiang X et al. (2000) Development 127:1607-16. The morning that vaginal plugs were observed was considered as EO.5. PCR-based genotyping was performed with the following primers: for Wntl-Cre allele, 5' TATCTCACGTACTGACGGTG 3' (SEQ ID NO:1) and 5' CTAGTCTAGACT- AATCGCCATCTTCCAGC 3' (SEQ ID NO:2); for Runxl wild-type and floxed alleles, 5' GAGTCCCAGCTGTCAATTCC 3' (SEQ ID NO: 3) and 5' GGTGATGGTCAGAGTGA- AGC 3 ' (SEQ ID NO:4), with floxed allele showing a larger size of DNA band after gel electrophoresis.
In Situ Hybridization and Immunostaining. Mouse in situ probes for TRPAl (0.9 kb), TRPM8 (0.71 kb), TRPVl (0.72 kb), TrIcA (0.7 kb), TRPV2 (0.8 kb), DRASIC (1.0 kb), P2X3 (1.1 kb), TRPC3 (0.8 kb), and Navl.9 were amplified with gene-specific sets of PCR primers and cDNA templates prepared from PO mouse DRG. The probes of
Mrgpral-8, Mrgprd, Mrgprc, Mrgprb4-5 were gifts from X. Zhong and DJ. Anderson. The in situ signals were photographed under trans-luminescent light and converted into pseudo red fluorescent color.
For immunostaining on frozen sections, embryos were collected in ice-cold PBS, fixed in 4% paraformaldehyde in PBS, and saturated with 20% sucrose in PBS overnight at 40C. For adult mice, after they were perfused with 4% paraformaldehyde in PBS, dorsal root ganglia were dissected and collected in 4% paraformaldehyde for 1 hour, and
saturated with 20% sucrose in PBS overnight at 40C. Adjacent sections of 14 μm thickness were blocked with 1% BSA plus 0.1% Triton in PBS for 1 hour, and incubated at 40C overnight with rabbit or guinea pig anti-Runxl (T. Jessell, Columbia University). The primary antibodies were detected using species-specific fluorescence-conjugated secondary antibodies.
Cell Counting. To count total DRG neurons, fifth lumbar (L5) DRG were dissected from three pairs of Rural' ~ and control RunxlF F mice, fixed, and embedded, sectioned with 10 μm thickness, hybridized with a digoxigenin-labeled non-radioactive RNA probe of SCGl 0, which is a pan-neural marker. The in situ hybridization signal was detected by anti-digoxigenin antibody conjugated with alkaline phosphatase that can produce a purple color enzymatic reaction product. Numbers OfSCGlO+ neurons were counted. Only cells containing nuclei were counted. To determine the percentages of neurons expressing molecular markers, four adjacent sets of sections were prepared from lumbar DRG and probed separately with four different probes, one of which was the pan- neural marker SCGlO to determine the total number of neurons so that percentages can be calculated. Three independent lumbar DRG were used for each counting. Instead of relying on morphology to identify neurons, the total neuron number was determined by counting cells expressing SCGlO. This method made it possible to identify some very small sensory neurons. The in situ hybridization methods also made it possible to identify Ret+ neurons that expressed at medium/low levels.
Results are shown in FIG. 2, which illustrates conditional knockout of Rural in the DRG and comparison of neurogenesis between wild-type and Rural -deficient mice. FIG. 2 A presents schematics of the conditional allele. Numbered vertical bars represent exons. Exon 4, encoding part of the DNA-binding Runt domain, is flanked with two loxP sequences (white triangles). Deletion of this exon is known to generate a null allele, de Bruijn MF et al. (2004) Oncogene 23:4238-8. The neo cassette in the intron region was also flanked with loxP sequences. FIG. 2A illustrates how, after crossing with Wntl-Cre mice, the neo cassette and exon 4 were removed by Cre-mediated DNA recombination, thereby yielding RunxF^ mice. FIG. 2B illustrates immunostaining of Runxl on sections through wild-type RunxlF/F (left) and Rural"^ (right) adult DRG. A complete loss of Runxl protein was noted in mutants. FIG. 2C illustrates that expression of the pan- neuronal marker SCGlO, detected by in situ hybridization, was comparable in wild-type
RunxlF/F (left) and RuiuV1' (right) adult DRG. FIG. 2D illustrates that no difference was detected in numbers OfSCGlO+ neurons in the fifth lumbar (L5) DRG between wild-type RumlF/F and Runxl~f~ mice.
In Runxl~'~ mice there was no detectable expression of Runxl in DRG neurons, suggesting complete penetrance of Cre-mediated recombination. RunxF^ mice were viable and fertile with no overt abnormalities. Moreover, DRG neuronal numbers were similar in Runxl~ ~ and control RunxlFF mice, indicating that Runxl is not required for the genesis or survival of DRG neurons.
Example 2
Runxl Promotes Transition from TrM+ to Ret+ Phenotype
In Runxl~ ~ mice, the transition from TrkA to Ret expression is markedly impaired, resulting in a dramatic change in the proportional representation of TrM+ and Ret+ neurons (FIG. 3). Experiments in this example examined the role of Runxl in the transition of neurons from a TrM+ phenotype to a Ret+ phenotype.
For in situ hybridization and immunostaining on frozen sections, transverse sections through DRGs or the dorsal horn of the spinal cords of adult mice were collected and prepared for in situ hybridization with digoxigenin-labeled TrIcA and Ret riboprobes. The in situ hybridization signal was detected by anti-digoxigenin antibody conjugated with alkaline phosphatase that can produce a purple color enzymatic reaction product (which was converted into pseudo red fluorescent color using Photoshop®). After detection of in situ hybridization signals, the tissue sections were incubated with fluorescein-conjugated IB4 lectin. Representative results are shown in FIG. 3.
As shown in FIG. 3, Runxl regulates neurotrophin receptor expression. FIG. 3A- D show results of in situ hybridization with TrM (FIG. 3 A and FIG. 3B) or Ret (FIG. 3C and FIG. 3D) probes of adult DRGs in wild-type (FIG. 3A and FIG. 3C) and Runxl"'' (FIG. 3B and FIG. 3D) mice. FIG. 3E-H show results from double labeling for TrkA or Ret and IB4 binding in adult DRG in wild-type (FIG. 3E and FIG. 3G) and Riinxl"'" (FIG. 3F and FIG. 3H) mice. In wild-type DRG, IB4+ cells coexpress Ret (FIG. 3E, arrow), but do not coexpress TrkA (FIG. 3G, arrow). In contrast, in adult Runxl"1" DRG, IB4+ neurons lose Ret expression (FIG. 3F, arrow), and many of them express TrM instead (FIG. 3H, arrow). FIG. 31 shows percentages of DRG neurons expressing the
molecular markers in wild-type and RunxFf~ mice. FIG. 3 J shows a schematic of the transformation of prospective Ret+ into TrIcA+ nociceptors in mutants (in comparison with the situation occurring in wild-type DRG, FIG. IG). In RunxFf~ mice all nociceptors retain TrIcA. expression, although the "transformed" cells retain IB4 staining. In P60 DRG, the proportion of Ret+ neurons decreased from 69% in control
(RunxlF/F) mice to 30% in RunxFf~ mice (FIG. 3C3 FIG. 3D and FIG. 31; Table 1). Conversely, the proportion of TrkA+ neurons increased from 28% in control mice to 69% in Runxl"'" mice (FIG. 3A, FIG. 3B, and FIG. 31; Table 1). The degree of loss of Ret+ and gain in TrkA+ neurons in RunxF^ mice agreed well with the proportion of adult DRG neurons that express Runxl in wild-type mice (-40%, Table 1). In wild-type DRG, carbohydrate epitopes recognized by the lectin IB4 labeled ~70% of mature Runxl+ neurons, while IB4 label was not detected in TrIcA+ nociceptors (FIG. 3G). IB4 labeling persisted in RunxF ~ mice (FIG. 3F, 3H), but most labeled neurons no longer expressed Ret and many now expressed TrIcA instead (FIG. 3H). Together, these findings provide evidence that Runxl activity is normally involved in promoting the transition from a TrkA+ to a Ref phenotype, by suppressing TrkA and activating or maintaining Ret expression (FIG. 3J).
Table 1. Percentages of Neurons Expressing Molecular Markers in RunxlF/F and Runxl+ DRG
SCGlO Runxl TrkA Ret IB4 TrkC Mrgpral Mrgpra2 Mrgpra3 Mrgpraό RunxlF/F 100 40±2 28±3 69±6 30±4 12±1 37±7 52±6 6±2 43±6
Runxl+ 101±5 O±O* 69±6* 30±2* 31±5 12±1 4±2* 20±4* l±0.2* 4±2*
Values presented as mean ± s.d. *P < 0.001 (by Student's test)
Example 3 Runxl Is Involved in Coordinate Expression of Multiple Nociceptors
Experiments in this example were performed to compare expression of multiple, diverse nociceptive sensory channels and receptors in DRG taken from adult wild-type and RunxF ~ mice.
For in situ hybridization and immunostaining on frozen sections, transverse sections through DRGs of adult mice were collected and prepared for in situ hybridization with probes for TRPAl (0.9 kb), TRPM8 (0.71 kb), TRPC3 (0.8 kb), TRPVl (0.72 kb), TRPV2 (0.8 kb), P2X3 (1.1 kb), Mrgprb4, Mrgprb5, Mrgprd, Mrgpral-8, Mrgprc, Navl.9, and DRASIC (1.0 kb). Mouse in situ probes for TRPAl, TRPM8, TRPC3, TRPVl, TRPV2, P2X3, Navl.9, and DRASIC were amplified with gene-specific sets of PCR primers and cDNA templates prepared from PO mouse DRG. The probes of Mrgpral-8, Mrgprd, Mrgprc, Mrgprb4-5, which contain the coding region, were gifts from X. Zhong and DJ. Anderson at California Institute of Technology. In one set of experiments sections were double labeled using anti-Runxl antibody and a probe for TRPM8, Mrgprd, P2X3, Navl.9, TRPC3, or DRASIC, essentially as described in Example 1.
For in situ hybridization combined with fluorescent immunostaining for Runxl, in situ hybridization was performed without proteinase K treatment, followed by immunostaining with Runxl antibody (gift from T. Jessell, Columbia University, New York; 1 :4000 in blocking solution) that was against the peptide sequence
GRASGMTSLSAELSSRL (SEQ ID NO:5). The specificity of Runxl antibody was confirmed by the matching of its expression in wild-type DRG and the elimination of its staining in Runxl~ ~ DRG. The in situ signals were photographed under trans-luminescent light and converted into pseudo red fluorescent color, while Runxl protein was detected with Alexa 488-conjugated secondary antibodies (Jackson Laboratories). Representative results are shown in FIG. 4.
As shown in FIG. 4A-D, there was marked reduction of diverse ion channels and receptors in DRG ofRunxl^" mice as compared to wild-type (RunxlF/F) mice. In particular there was a selective reduction of high-level expression (arrows), but not of intermediate level expression (arrowheads), of TRPVl, TRPV2, and Navl.9 in Runxl"1' mice. Only very few Runxl^" cells still exhibited high-level expression of TRPV2 or Navl.9.
As shown in FIG. 4E, double labeling of Runxl protein (bright, originally green) and indicated probes (less bright, originally red) for TRPC3, Mrgprd, P2X3, or Navl.9/SNS on adult P30 wild-type DRG sections demonstrated that Runxl was expressed in the majority of neurons expressing TRPC3, Mrgprd, P2X3, or Navl.9/SNS. Runxl was also expressed in the majority of neurons expressing TRPM8.
TRP class ion channels transduce a wide range of thermal stimuli, including noxious cold or heat. Jordt SE et al. (2003) Curr Opin Neurobiol 13:487-92; Bandell M et al. (2004) Neuron 41 : 849-57. In Rural'1' mice, there was a virtually complete elimination of two putative cold receptors TRPAl and TRPM8 (Jordt SE et al. (2003) Curr Opin 5 Neurobiol 13 :487-92; Bandell M et al. (2004) Neuron 41 :849-57) as well as of TRPC3 (FIG. 4A). High level expression of two heat receptors TRPVl and TRPV2 (Jordt SE et al. (2003) Curr Opin Neurobiol 13:487-92) was also largely eliminated (FIG. 4A). The Mrgpr genes (Mrgpr/SNSR) encode a large family of G-protein coupled receptors (GPCRs) expressed preferentially in Ret+ nociceptors (Dong X et al. (2001) Cell 10 106:619-32; Lembo PM et al. (2002) Nat Neurosci 5:201-9), and activation of Mrgprc in rats causes hypersensitivity to heat and mechanical stimuli (Grazzini E et al. (2004) Proc Natl Acad Sci U S A 101 :7175-80). In RunxVμ mice, expression of all twelve Mrgpr genes was either markedly reduced or absent (FIG. 4B, Table 1).
ATP, released from damaged tissue, evokes painful response by activating ATP- 15 gated channels (P2Xs). Wood JN (2004) Gut 53 Suppl 2, U9-12. Expression of nociceptor-specific P2X3 (Chen CC et al. (1995) Nature 377:428-31) was markedly reduced in Runxl~μ mutants (FIG. 4C).
The tetrodotoxin-resistant Na+ channel gene Navl.9/SNS2 determines nociceptor membrane excitability (Dib-Hajj SD et al. (1998) Proc Natl Acad Sci USA 95:8963-8), 20 and again in Runxl~f~ mice, Navl.9/SNS2 expression was markedly reduced (FIG. 4D, Table 1).
Double labeling showed that Runxl is detected in a majority of neurons expressing TRPM8, TRPC3, Mrgprd, Navl.9 or P2X3 (FIG. 4E). These findings suggest that Runxl is involved in the expression of a large cohort of nociceptive ion channels and receptors. '25
Example 4 Runxl Suppresses Expression of Certain Neuropeptides and Ion Channels
FIG. 5 illustrates that Runxl is able to suppress the expression of markers normally expressed in TrIcA+ nociceptors. Most adult TrkA+ neurons are peptidergic and 30 express the genes encoding the precursors for the neuropeptides Substance P (SP) and Calcitonin Gene Related Peptide (CGRP). Snider WD et al. (1998) Neuron 20:629-32. From E16.5 to P30 in wild-type DRG, CGRP+ neurons either do not express, or express
only a low level of, Runxl (FIG. 5A). In RunxV'" adult mice, however, there is a marked increase in the percentages of DRG neurons expressing CGRP, from 32 ± 2% to 64 ± 2% (P < 0.001) (FIG. 5C, E). 5!P+ neurons also showed a significant, albeit more modest, increase in the percentages of DRG neurons expressing CGRP, from 32 ± 4% to 43 ± 2% (P < 0.0001) (FIG. 5C, E). The expansion of CGRP in Runxl''" mice was also apparent by the detection of CGRP expression in IB4+ neurons (FIG. 5C), which is only very rarely observed in wild-type DRG (FIG. 5C). Together, these findings suggest that in absence of Rural, prospective non-peptidergic nociceptors develop into CGRP+ peptidergic neurons. The DRG acid-sensing channel DRASIC and the mu-class opioid receptor (MOR) are associated preferentially in peptidergic neurons. Consistently, in adult wild-type DRG Runxl+ neurons do not express DRASIC (FIG. 5A). In RunxFf~ adult mice, however, there was a marked increase in the percentages of DRG neurons expressing MOR (from 33 ± 2% to 63 ± 3%; P < 0.001) or DRASIC (from 22 ± 2% to 71 ± 5%; P < 0.001) (FIG. 5D, E). Thus, within presumptive Ret+ neurons, Runxl is required to suppress the expression of a subset of receptors and ion channels normally associated with a TrkA identity (summarized in FIG. 5F).
Example 5 Expression of Certain Nociceptor Receptors or Channels Is Independent ø/Runxl
FIG. 5D and 5E (Example 4) also show that not all nociceptor receptors or channels are affected in Runxl+" mice. There was no increase or reduction in expression of the acid-sensing channel ASIC in RumF^ mice as compared to wild-type mice. The expression of ion channel Navl .8/SNS was also unaffected in RunxFf~ mice as compared to wild-type mice. Thus, Runxl deficiency results in a selective loss in expression of a subset of nociceptor transduction proteins.
Example 6
Runxl Initiates Expression of Some Ion Channels and Receptors Independent of TrkA and Ret
Analysis of Rural phenotypes at prenatal stages further suggested that Runxl initiates expression of some ion channels/receptors before it suppresses TrkA and
maintains Ret expression postnatally (FIG. 6). These findings suggested that the loss of at least some ion channels/receptors in RunxF ~ mice is independent of the loss of Ret or the gain of TrIcA.
In situ hybridization showed that expression of TRPM8 and Mrgprd is first detected at El 6.5 in wild-type DRG (FIG. 6A, C), and this expression is eliminated in RunxV^ DRG at El 6.5 (FIG. 6B, D). However, at every embryonic or neonatal stage examined (E14.5, E17, and PO) nearly all Runxl+ neurons in wild-type DRG expressed TrIcA (FIG. 6E). This suggests that Runxl is required to activate channel/receptor expression at prenatal/neonatal stages before it acts to switch off TrkA expression at postnatal stages. By E17, Ret expression becomes apparent in a subpopulation of Runxl+ neurons (FIG. 6F). At this stage, however, TRPM8+ neurons do not co-express Ret (FIG. 6G-I), suggesting that initiation of TRPM8 expression is independent of Ret-mediated signaling. Thus, the loss of many nociceptive ion channels in Runxl"f~ DRG neurons is unlikely be explained solely by the loss of Ret or the gain of TrkA expression, which in turn implies a more direct function for Runxl in controlling the expression of these channels and receptors.
Example 7 Runxl Controls Central Targeting of Nociceptive Afferents The precision in processing sensory information demands coordination between the specification of sensory modality and afferent central target selection. FIG. 7 shows that Runxl coordinates these two developmental processes. In wild-type mice, IB4+ (Ret+) afferents project predominantly to inner lamina II (Hi) (FIG. 7A (arrow) and FIG. 7K), whereas CGRP+ and SP+ peptidergic afferents (TrIcA+) project predominantly to lamina I and outer layer II (Ho) (FIG. 7C, arrowhead), and to a lesser extent to lamina Hi (FIG. 7C, arrow). Snider WD et al. (1998) Neuron 20:629-32. In Runxl+ mice, IB4+, CGRP+, and SP+ afferents all reach the dorsal horn (FIG. 7B, D, H), suggesting that initial axon pathfϊnding from the DRG to the spinal cord is independent of Runxl. However, double labeling of IB4 and CGRP or SP clearly showed a shift in IB4+ afferent innervation from the more ventral lamina to the most dorsal lamina of the dorsal horn, whereas
CGRP+ afferents (FIG. 7D versus 7C) and SP+ afferents (FIG. 7H versus 7G) still project predominantly to the most superficial lamina. The dorsal shift in IB4+ afferent innervation
is also supported by the double labeling of IB4 and PKC-gamma (FIG. 71). In wild-type mice, IB4+ afferents terminate in the lamina exactly abutting the territory enriched with PKC-gamma-positive neuronal cell bodies and processes (FIG. 71), but in RunxF1" mice the density of IB4+ afferents in this area is greatly reduced (FIG. 7J versus FIG. 71, arrows).
In the dorsal horn of RunxV1" mice, a subset of IB4+ afferents co-stained with CGRP and to a lesser extent with SP, something rarely seen in wild-type mice. This difference in co-labeling with CGRP and SP is consistent with their dramatic (CGRP) and modest (SP) derepression in Runxl~μ IB4+ neurons (FIG. 5). However, within the superficial dorsal lamina of Rural -deficient mice, some afferents express only CGRP or SP and do not label with IB4. This suggests that endogenous peptidergic afferents project normally in RunxF^ mice. Thus a loss of Rural appears to specifically perturb the laminar target selection of IB4+ afferents (summarized in FIG. 7K, L).
Example 8
Rural -Deficient Mice Exhibit Markedly Diminished Response to Noxious Thermal Stimuli
To examine if the molecular and anatomical defects in Rural'1' mice are accompanied by alterations in behavioral responses to noxious stimuli, acute responses to noxious thermal and mechanical stimuli were assayed. All animals were acclimatized to the behavioral testing apparatus on at least three
'habituation' sessions. Following habituation, at least two baseline measures were obtained for each of the behavioral tests on two separate occasions the week before experimental measurements. The tester was blinded to the genotype of each animal.
To measure cold pain, animals were placed on an elevated wire grid. A drop of acetone was applied to the plantar hindpaw using a feeding tube attached to a syringe. The duration of time that the animal elevated or licked the paw over a 90 s period immediately following application of the acetone drop was measured.
To measure heat pain, mice were placed on a hot plate (Ugo Basile, Italy) and the latency to hindpaw flicking, licking, or jumping measured. The hot plate was set to three different temperatures, 50, 52, and 55°C, and all animals were tested sequentially at each temperature with at least 5 min between tests. A cutoff time of 60 s was used for testing at
50°C.
To measure mechanical pain, animals were placed on an elevated wire grid and the lateral plantar surface of the hindpaw stimulated using von Frey monofilaments (0.0174 - 4.57 g) or pin prick. The withdrawal threshold for the von Frey assay was determined as the filament at which the animal withdrew its paw at least twice in 10 applications. The pin prick was measured as duration of time that the animal elevated or licked the paw over a 20 s period immediately following the pin prick.
Statistical analyses of pain behaviors. Baseline data (and all non-procedural testing data) was taken as the mean of two tests performed. Except as noted otherwise, behavioral data were analyzed by Student's T-test when comparing two groups (Graphpad Prism, Graphpad, San Diego, CA) and 2-way repeated measures ANOVA followed by
Bonferroni's post-test for time courses of two or more groups (R, v. 1.7.0, R Development Core Team, Vienna, Austria). Log data was used for statistical analysis of von Frey results. P<0.05 was accepted as statistical significance.
Representative results are presented in FIG. 8. As shown in FIG. 8A - FIG. 8H, Runxl -deficient mice exhibited pain behavioral deficits. Behavioral sensitivity of control RunxlFF mice (open bars) and Runxl~ ~ mice (hatched bars) in tests of heat (hotplate, FIG. 8A - FIG. 8B), cold (acetone evaporation, FIG. 8C), chemical pain (capsaicin-induced pain, FIG. 8D), and mechanical pain (von Frey, FIG. 8E, or pin prick stimuli, FIG. 8F) are shown. n=19 for control RunxlF/F and n=16 for RunxFf~ groups, *P<0.05, **P<0.01 and ***P<0.001.
Runxl -deficient mice exhibited a markedly diminished response to a noxious cold (acetone evaporation) stimulus (FIG. 8C). In addition, Runxl -deficient mice exhibited a significantly delayed reaction time to a noxious heat stimulus (5O0C and 52°C hot plate) that was most evident at the lowest stimulus temperature (FIG. 8A - FIG. 8B). These findings could reflect loss of expression of those TRP channels implicated in noxious cold and heat pain sensitivity (Jordt SE et al. (2003) Curr Opin Neurobiol 13:487-92). Alternatively, the defects in responsiveness to thermal noxious stimuli could result from alterations in connectivity (FIG. 7). Regardless, the findings establish a requirement for Runxl activity in sensory neurons for the detection of acute thermal noxious stimuli. Mechanical pain, however, was not markedly changed by the loss of Runxl function. Thus, the sensitivity of Runxl"^ mice to noxious mechanical stimuli was not significantly altered in this set of experiments (FIG. 8E and FIG. 8F), implying that
Runxl -independent channels/receptors are able to detect noxious mechanical stimuli. The absence of TRPAl expression in RunxV1' mice (FIG. 4A) also suggests that TRPAl may not act as an exclusive mechanotransducer in nociceptors (Jordt SE et al. (2003) Curr Opin Neurobiol 13:487-92; Bandell M et al. (2004) Neuron 41 :849-57) even though it has been reported to have a mechanotransduction role in the vestibular apparatus and cochlea. Corey DP et al. (2004) Nature 432:723-30.
Example 9 Rural -Deficient Mice Exhibit Markedly Diminished Neuropathic Pain Neuropathic pain represents a heightened pain sensitivity induced by peripheral nerve injury, and normally innocuous tactile stimuli can evoke pain or pain-like withdrawal response, a phenomenon termed mechanical allodynia. Woolf C (2004) Life Sci 74:2605-10. Abnormal activation of Ret+ class nociceptors may possibly underlie peripheral neuropathic pain. In order to assess if neuropathic pain is affected in RunxF^ mice, experiments were performed in mice using the spared nerve injury (SNI) model.
The spared nerve injury (SNI) model was performed on RunxF^ and control RunxlF/F mice as described for rats. Decosterd I et al. (2000) Pain 87:149-58. Briefly, animals were anesthetized using isoflurane (3% induction, 2% maintenance). An incision was made on the lateral thigh and the underlying muscle separated to expose the sciatic nerve. The three terminal branches of the sciatic nerve (tibial, common peroneal, and sural nerves) were carefully separated while minimizing any contact with or stretching of the sural nerve. The tibial and common peroneal nerves were then individually ligated with 6.0 silk and cut distally. 2-3 mm of each nerve distal to the ligation was removed. The muscle incision was closed using silk sutures and the skin with surgical staples. Animals were placed on an elevated wire grid and the lateral plantar surface of the hindpaw stimulated using von Frey monofilaments (0.0174 - 4.57 g). The withdrawal threshold for the von Frey assay was determined as the filament at which the animal withdrew its paw at least twice in 10 applications.
All animals were acclimatized to the behavioral testing apparatus on at least three 'habituation' sessions. Following habituation, at least two baseline measures were obtained on two separate occasions the week before surgery. Following the surgical
procedures (day 0), the behavioral tests were performed at defined intervals. The tester was blinded to the genotype of each animal.
Baseline data (and all non-procedural testing data) was taken as the mean of two tests performed. Post-surgery behavioral data were analyzed by Student's T-test when comparing two groups (Graphpad Prism, Graphpad, San Diego, CA) and 2-way repeated measures ANOVA followed by Bonferroni's post-test for time courses of two or more groups (R, v. 1.7.0, R Development Core Team, Vienna, Austria). P<0.05 was accepted as statistical significance.
Representative results are shown in FIG. 8G, where n=6 for each group. As shown in FIG. 8G, in control RunxlF/F mice, nerve injury induced mechanical allodynia, indicated by a substantial lowering of the paw withdrawal threshold (ANOVA interaction: F(8,80)=3.14, PO.01). After SNI in RunxV'' mice, no change in paw withdrawal threshold was detected (P>0.05), indicating an absence of mechanical allodynia. These results demonstrate that Rural function is necessary for the manifestation of neuropathic pain responses.
Example 10 Runxl -Deficient Mice Exhibit Diminished Response to Inflammatory Pain
Inflammatory pain occurs in response to peripheral tissue inflammation. Snider WD et al. (1998) Neuron 20:629-32. In order to assess if Runxl function is involved in establishment of inflammatory pain responses, mechanical allodynia was monitored after intraplantar injection of complete Freund's adjuvant (CFA).
For CFA-mediated inflammation, mice were briefly anesthetized with isoflurane (2-3 min) and 15 ml of CFA injected into the plantar surface of the left hindpaw. Animals were placed on an elevated wire grid and the lateral plantar surface of the hindpaw stimulated using von Frey monofilaments (0.0174 - 4.57 g). The withdrawal threshold for the von Frey assay was determined as the filament at which the animal withdrew its paw at least twice in 10 applications.
All animals were acclimatized to the behavioral testing apparatus on at least three 'habituation' sessions. Following habituation, at least two baseline measures were obtained on two separate occasions. Following the CFA injection, the von Frey tests were performed as described above. The tester was blinded to the genotype of each animal.
n=13 control RunxlF/F mice and n=10 Runxl^" mice. Log data was used for statistical analysis of von Frey results. P<0.05 was accepted as statistical significance. Representative results are depicted in FIG. 8H.
As shown in FIG. 8H, although both wild-type and Runxrf~ mice developed mechanical allodynia in the inflamed hindpaw (FIG. 8H), the degree of allodynia was less in Runxrf- than in control Runx 1 lF/F mice (ANOVA interaction: F(l,21)=23.556, PO.001). These results indicate Runxl also has a role in the development of inflammatory pain.
EQUIVALENTS The foregoing written specification is considered to be sufficient to enable one skilled in the art to practice the invention. The present invention is not to be limited in scope by examples provided, since the examples are intended as a single illustration of one aspect of the invention and other functionally equivalent embodiments are within the scope of the invention. Various modifications of the invention in addition to those shown and described herein will become apparent to those skilled in the art from the foregoing description and fall within the scope of the appended claims. The advantages of the invention are not necessarily encompassed by each embodiment of the invention.
AU references, patents and patent publications that are recited in this application are incorporated in their entirety herein by reference.
What is claimed is:
Claims
1. A method for identifying a candidate inhibitor of Runxl -mediated expression of a nociceptive receptor or ion channel, the method comprising contacting a test cell that expresses Runxl and comprises a nucleic acid encoding a nociceptive receptor or ion channel operatively linked to a Runxl -sensitive promoter, with a test agent; measuring a test amount of expression of the nociceptive receptor or ion channel; comparing the test amount of expression of the nociceptive receptor or ion channel to a control amount of expression of the nociceptive receptor or ion channel measured in a control cell that expresses Runxl and comprises the nucleic acid encoding the nociceptive receptor or ion channel operatively linked to the Runxl -sensitive promoter, wherein the control cell is not contacted with the test agent; and identifying the test agent as a candidate inhibitor of Runxl -mediated expression of a nociceptive receptor or ion channel when the control amount of expression is greater than the test amount of expression.
2. The method of claim 1 , wherein the nucleic acid encoding the nociceptive receptor or ion channel operatively linked to the Runxl -sensitive promoter encodes a nociceptive receptor or ion channel chosen from TRPC3, TRPM8, TRPAl, Mrgprd, P2X3, Navl .9/SNS2, and any combination thereof.
3. The method of claim 1 , wherein the test cell comprises a Runxl expression vector.
4. The method of claim 1, wherein the control cell comprises a Runxl expression vector.
5. The method of claim 1 , wherein the test amount of expression and the control amount of expression are corresponding amounts of transcript for the nociceptive receptor or ion channel.
6. The method of claim 1 , wherein the test amount of expression and the control amount of expression are corresponding amounts of protein for the nociceptive receptor or ion channel.
J 7. The method of claim 1 , wherein the nucleic acid encoding the nociceptive receptor or ion channel operatively linked to the Runxl -sensitive promoter is part of an expression vector.
8. The method of claim I3 wherein the control cell is a dorsal root ganglion cell 0 derived from a RunxlF/F; Wntl-Cre mouse.
9. The method of claim 1 , wherein the test compound is selected from the group consisting of small molecules, peptides, nucleic acids, and any combination thereof.
5 10. The method of claim 1, wherein the test compound is a small molecule.
11. The method of claim 1 , wherein the test compound is a nucleic acid.
12. The method of claim I3 wherein the test compound inhibits expression of Runxl. 0
13. A method for identifying a candidate inhibitor of Runxl -mediated expression of a nociceptive receptor or ion channel, the method comprising contacting a test cell that expresses Runxl and comprises a nucleic acid encoding a reporter operatively linked to a Runxl -sensitive promoter, with a test agent; 5 measuring a test amount of expression of the reporter; comparing the test amount of expression of the reporter to a control amount of expression of the reporter measured in a control cell that expresses Runxl and comprises the nucleic acid encoding the reporter operatively linked to the Runxl -sensitive promoter; and 0 identifying the test agent as a candidate inhibitor of Runxl -mediated expression of a nociceptive receptor or ion channel when the control amount of expression is greater than the test amount of expression.
14. The method of claim 13, wherein the reporter is green fluorescent protein.
15. The method of claim 13, wherein the Runxl -sensitive promoter is a promoter for a 5 nociceptive receptor or ion channel chosen from TRPC3, TRPM8, TRPAl, Mrgprd,
P2X3, Navl.9/SNS2, and any combination thereof.
16. The method of claim 13, wherein the test cell comprises a Runxl expression vector.
10
17. The method of claim 13, wherein the control cell comprises a Runxl expression vector.
18. The method of claim 13 , wherein the test amount of expression and the control /5 amount of expression are corresponding amounts of transcript for the reporter.
19. The method of claim 13, wherein the test amount of expression and the control amount of expression are corresponding amounts of protein for the reporter.
20 20. The method of claim 19, wherein the reporter expression is measured as fluorescence emitted by the reporter.
21. The method of claim 13, wherein the control cell is a dorsal root ganglion cell derived from a RunxlF/F ;Wntl-Cre mouse.
25
22. The method of claim 13, wherein the test compound is selected from the group consisting of small molecules, peptides, nucleic acids, and any combination thereof.
23. The method of claim 13, wherein the test compound is a small molecule. 30
24. The method of claim 13, wherein the test compound is a nucleic acid.
25. The method of claim 13 , wherein the test compound inhibits expression of Runxl .
26. A method for identifying a candidate agent for use in inhibiting neuropathic pain, the method comprising contacting a test cell that expresses Runxl and comprises a nucleic acid encoding a nociceptive receptor or ion channel operatively linked to a Runxl -sensitive promoter, with a test agent; measuring a test amount of expression of the nociceptive receptor or ion channel; comparing the test amount of expression of the nociceptive receptor or ion channel to a control amount of expression of the nociceptive receptor or ion channel measured in a control cell that expresses Runxl and comprises the nucleic acid encoding the nociceptive receptor or ion channel operatively linked to the Runxl -sensitive promoter, wherein the control cell is not contacted with the test agent; and identifying the test agent as a candidate agent for use in inhibiting neuropathic pain when the control amount of expression is greater than the test amount of expression.
27. The method of claim 26, wherein the nucleic acid encoding the nociceptive receptor or ion channel operatively linked to the Runxl -sensitive promoter encodes a nociceptive receptor or ion channel chosen from TRPC3, TRPM8, TRPAl, Mrgprd, P2X3, Navl .9/SNS2, and any combination thereof.
28. The method of claim 26, wherein the test cell comprises a Runxl expression vector.
29. The method of claim 26, wherein the control cell comprises a Runxl expression vector.
30. The method of claim 26, wherein the test amount of expression and the control amount of expression are corresponding amounts of transcript for the nociceptive receptor or ion channel.
31. The method of claim 26, wherein the test amount of expression and the control amount of expression are corresponding amounts of protein for the nociceptive receptor or ion channel.
32. The method of claim 26, wherein the nucleic acid encoding the nociceptive receptor or ion channel operatively linked to the Runxl -sensitive promoter is part of an expression vector.
33. The method of claim 26, wherein the control cell is a dorsal root ganglion cell derived from a RunxlF/F; Wntl-Cre mouse.
34. The method of claim 26, wherein the test compound is selected from the group consisting of small molecules, peptides, nucleic acids, and any combination thereof.
35. The method of claim 26, wherein the test compound is a small molecule.
36. The method of claim 26, wherein the test compound is a nucleic acid.
37. The method of claim 26, wherein the test compound inhibits expression of Runxl .
38. A method for identifying a candidate agent for use in inhibiting neuropathic pain, the method comprising: measuring a test amount of binding between Runxl and a Runxl -sensitive promoter for a nociceptive receptor or ion channel in presence of a test compound; comparing the test amount of binding to a control amount of binding between
Runxl and the promoter for the nociceptive receptor or ion channel in absence of the test compound; and identifying the test compound as a candidate agent for use in inhibiting neuropathic pain when the test amount of binding is less than the control amount of binding.
39. The method of claim 38, wherein the nociceptive receptor or ion channel is chosen from TRPC3, TRPM8, TRPAl, Mrgprd, P2X3, Navl.9/SNS2, and any combination thereof.
40. The method of claim 38, wherein the nociceptive receptor or ion channel is TRPC3.
41. The method of claim 38, wherein the test compound is selected from the group consisting of small molecules, peptides, nucleic acids, and any combination thereof.
42. The method of claim 38, wherein the test compound is a small molecule.
43. The method of claim 38, wherein the test compound is a nucleic acid.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US11/884,800 US8268572B2 (en) | 2005-03-04 | 2006-03-03 | Methods to identify inhibitors of Runx1-mediated expression of nociceptive receptors and ion channels |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US65882405P | 2005-03-04 | 2005-03-04 | |
US60/658,824 | 2005-03-04 |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2006096498A2 true WO2006096498A2 (en) | 2006-09-14 |
WO2006096498A3 WO2006096498A3 (en) | 2006-12-07 |
Family
ID=36953875
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US2006/007578 WO2006096498A2 (en) | 2005-03-04 | 2006-03-03 | Regulation of runx1 for treatment of pain |
Country Status (2)
Country | Link |
---|---|
US (1) | US8268572B2 (en) |
WO (1) | WO2006096498A2 (en) |
Cited By (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP2158316A2 (en) * | 2007-05-11 | 2010-03-03 | Adynxx, Inc. | Gene expression and pain |
AU2014201462B2 (en) * | 2007-05-11 | 2016-09-29 | Adynxx, Inc. | Gene expression and pain |
EP3007686A4 (en) * | 2013-06-10 | 2017-03-15 | Yeda Research and Development Co., Ltd. | Compositions and methods for treating a hematological malignancy associated with an altered runx1 activity or expression |
US9700624B2 (en) | 2012-05-10 | 2017-07-11 | Adynxx, Inc. | Formulations for the delivery of active ingredients |
US10287583B2 (en) | 2014-08-15 | 2019-05-14 | Adynxx, Inc. | Oligonucleotide decoys for the treatment of pain |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20040146986A1 (en) * | 2001-01-29 | 2004-07-29 | Suk-Chul Bae | Runx3 gene showing anti-tumor activity and use thereof |
-
2006
- 2006-03-03 WO PCT/US2006/007578 patent/WO2006096498A2/en active Application Filing
- 2006-03-03 US US11/884,800 patent/US8268572B2/en active Active
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20040146986A1 (en) * | 2001-01-29 | 2004-07-29 | Suk-Chul Bae | Runx3 gene showing anti-tumor activity and use thereof |
Non-Patent Citations (3)
Title |
---|
ALESSANDRI A.J. ET AL.: 'ETV6 (TEL)-AML1 pre-B acute lymphoblastic leukaemia cells are associated with a distinct antigen-presenting phenotype' BR J HAEMATOL vol. 116, no. 2, February 2002, pages 266 - 272, XP003004910 * |
BACKSTROM S. ET AL.: 'The RUNX1 Runt domain at 1.25A resolution: a structural switch and specifically bound chloride ions modulate DNA binding' J MOL BIOL vol. 322, no. 2, 13 September 2002, pages 259 - 272, XP004449744 * |
WOLF-WATZ M. ET AL.: 'Chloride binding by the AML1/Runx1 transcription factor studied by NMR' FEBS LETT. vol. 488, no. 1-2, 12 January 2001, pages 81 - 84, XP001008720 * |
Cited By (14)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US9290762B2 (en) | 2007-05-11 | 2016-03-22 | Adynxx, Inc. | Gene expression and pain |
EP2158316A2 (en) * | 2007-05-11 | 2010-03-03 | Adynxx, Inc. | Gene expression and pain |
EP2158316A4 (en) * | 2007-05-11 | 2011-11-09 | Adynxx Inc | Gene expression and pain |
AU2008251320B2 (en) * | 2007-05-11 | 2013-12-19 | Adynxx, Inc. | Gene expression and pain |
US8741864B2 (en) | 2007-05-11 | 2014-06-03 | Adynxx, Inc | Gene expression and pain |
JP2016014070A (en) * | 2007-05-11 | 2016-01-28 | アダイニクス, インコーポレイテッド | Gene expression and pain |
JP2010526541A (en) * | 2007-05-11 | 2010-08-05 | アダイニクス, インコーポレイテッド | Gene expression and pain |
AU2014201462B2 (en) * | 2007-05-11 | 2016-09-29 | Adynxx, Inc. | Gene expression and pain |
US10041069B2 (en) | 2007-05-11 | 2018-08-07 | Adynxx, Inc. | Gene expression and pain |
US9700624B2 (en) | 2012-05-10 | 2017-07-11 | Adynxx, Inc. | Formulations for the delivery of active ingredients |
US10434178B2 (en) | 2012-05-10 | 2019-10-08 | Adynxx Sub, Inc. | Formulations for the delivery of active ingredients |
EP3007686A4 (en) * | 2013-06-10 | 2017-03-15 | Yeda Research and Development Co., Ltd. | Compositions and methods for treating a hematological malignancy associated with an altered runx1 activity or expression |
US10287583B2 (en) | 2014-08-15 | 2019-05-14 | Adynxx, Inc. | Oligonucleotide decoys for the treatment of pain |
US10683502B2 (en) | 2014-08-15 | 2020-06-16 | Adynxx Sub, Inc. | Oligonucleotide decoys for the treatment of pain |
Also Published As
Publication number | Publication date |
---|---|
US20090170079A1 (en) | 2009-07-02 |
WO2006096498A3 (en) | 2006-12-07 |
US8268572B2 (en) | 2012-09-18 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US11785925B2 (en) | Disease biomarkers and treatment methods related thereto | |
Fenselau et al. | A rapidly acting glutamatergic ARC→ PVH satiety circuit postsynaptically regulated by α-MSH | |
Jiang et al. | Promoted interaction of C/EBPα with demethylated Cxcr3 gene promoter contributes to neuropathic pain in mice | |
Perry et al. | Subcellular knockout of importin β1 perturbs axonal retrograde signaling | |
Kim et al. | A core paired-type and POU homeodomain-containing transcription factor program drives retinal bipolar cell gene expression | |
Li et al. | Barhl1 regulates migration and survival of cerebellar granule cells by controlling expression of the neurotrophin-3 gene | |
Sultana et al. | Deletion of olfactomedin 2 induces changes in the AMPA receptor complex and impairs visual, olfactory, and motor functions in mice | |
Calvo et al. | Bex3 dimerization regulates NGF-dependent neuronal survival and differentiation by enhancing trkA gene transcription | |
US8268572B2 (en) | Methods to identify inhibitors of Runx1-mediated expression of nociceptive receptors and ion channels | |
Lui et al. | Lhx1/5 control dendritogenesis and spine morphogenesis of Purkinje cells via regulation of Espin | |
Sun et al. | 5‐HT6R null mutatrion induces synaptic and cognitive defects | |
Chen et al. | CPEB 2‐dependent translation of long 3′‐UTR Ucp1 mRNA promotes thermogenesis in brown adipose tissue | |
Yanpallewar et al. | Tamalin is a critical mediator of electroconvulsive shock-induced adult neuroplasticity | |
Huang et al. | Extrinsic and intrinsic signals converge on the Runx1/CBFβ transcription factor for nonpeptidergic nociceptor maturation | |
Chen et al. | mTOR–neuropeptide Y signaling sensitizes nociceptors to drive neuropathic pain | |
Lopez-Erauskin et al. | Stathmin-2 loss leads to neurofilament-dependent axonal collapse driving motor and sensory denervation | |
Neel et al. | SH2 domain-containing protein-tyrosine phosphatases | |
Syed et al. | Miles to go (mtgo) encodes FNDC3 proteins that interact with the chaperonin subunit CCT3 and are required for NMJ branching and growth in Drosophila | |
Chang et al. | Ephexin1 is required for Eph-mediated limb trajectory of spinal motor axons | |
Tsai et al. | Paxillin is required for proper spinal motor axon growth into the limb | |
González et al. | PFTK1 kinase regulates axogenesis during development via RhoA activation | |
Pfaller et al. | The glucocorticoid receptor as a master regulator of the Müller cell response to diabetic conditions in mice | |
Diao et al. | Fast inactivation of Shal (Kv4) K+ channels is regulated by the novel interactor SKIP3 in Drosophila neurons | |
Shirazyan et al. | Gli2 and Gli3 Regulate Horizontal Basal Cell-Mediated Regeneration of the Olfactory Epithelium | |
Ryu et al. | Stress-induced translation of KCNB1 contributes to the enhanced synaptic transmission of the lateral habenula |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
NENP | Non-entry into the national phase |
Ref country code: DE |
|
NENP | Non-entry into the national phase |
Ref country code: RU |
|
122 | Ep: pct application non-entry in european phase |
Ref document number: 06736835 Country of ref document: EP Kind code of ref document: A2 |
|
WWE | Wipo information: entry into national phase |
Ref document number: 11884800 Country of ref document: US |