WO2006083051A1 - G6pd enzyme inhibitor and method for treating obesity using the same - Google Patents

G6pd enzyme inhibitor and method for treating obesity using the same Download PDF

Info

Publication number
WO2006083051A1
WO2006083051A1 PCT/KR2005/000376 KR2005000376W WO2006083051A1 WO 2006083051 A1 WO2006083051 A1 WO 2006083051A1 KR 2005000376 W KR2005000376 W KR 2005000376W WO 2006083051 A1 WO2006083051 A1 WO 2006083051A1
Authority
WO
WIPO (PCT)
Prior art keywords
gβpd
g6pd
expression
obesity
adipocytes
Prior art date
Application number
PCT/KR2005/000376
Other languages
French (fr)
Inventor
Jae Bum Kim
Jiyoung Park
Original Assignee
Seoul National University Industry Foundation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Seoul National University Industry Foundation filed Critical Seoul National University Industry Foundation
Priority to PCT/KR2005/000376 priority Critical patent/WO2006083051A1/en
Publication of WO2006083051A1 publication Critical patent/WO2006083051A1/en

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/005—Enzyme inhibitors
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/04—Anorexiants; Antiobesity agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
    • C12Y101/01—Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
    • C12Y101/01049—Glucose-6-phosphate dehydrogenase (1.1.1.49)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C12N2310/111—Antisense spanning the whole gene, or a large part of it
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.

Definitions

  • the present invention relates to a glucose-6- phosphate dehydrogenase (hereinafter, referred to as
  • G6PD G6PD
  • a therapeutic use o.f G ⁇ PD enzyme inhibitor for obesity a therapeutic use o.f G ⁇ PD enzyme inhibitor for obesity and a method for treating and/or preventing obesity by using the same.
  • Obesity is a major risk factor for metabolic diseases including hyperlipidemia, hypercholesterolemia, cardiovascular disease and type II diabetes (Kopelman, P. G. , Obesity as a medical problem,
  • G6PD Glucose-6-phosphate dehydrogenase
  • PPP pentose phosphate pathway
  • G6PD plays a key role in the maintenance of redox potential and cell survival via production of NADPH and pentose phosphates . Also, G6PD participates in reductive biosynthesis of fatty acids and cholesterol .
  • G ⁇ PD hepatic G ⁇ PD is regulated by nutritional signals including high-carbohydrate diet, polyunsaturated fatty acids, and hormonal signals such as insulin, glucagon, thyroid and glucocorticoids (Salati, L. M. and B. Amir-Ahmady, Annu. Rev. Nutr. 21 : 121-140, 2001) . Furthermore, it is reported that G ⁇ PD deficient patients show a decrease in lipogenic rate and serum lipoprotein concentrations, implying the importance of G ⁇ PD in fatty acid synthesis (15, 16) .
  • the present inventors have identified that both G ⁇ PD mRNA and protein be highly expressed in adipocytes and their levels be significantly elevated in fat tissues of several obese mouse models .
  • G ⁇ PD over-expression stimulated the expression of adipocyte marker genes as well as the elevation of cellular free fatty acids (FFAs) , triglyceride (TG) and FFA release into the medium.
  • FFAs free fatty acids
  • TG triglyceride
  • siRNAs small interfering RNAs
  • DHEA DHEA
  • the present invention has been developed novel therapeutic substances for obesity treatment and a method for treating obesity by using the G ⁇ PD enzyme inhibitor successfully.
  • FIG. 1 depicts the expression of G ⁇ PD mRNA in mouse tissue and adipocyte by Northern blot analysis .
  • B. 3T3-F442A cell and 3T3-L1 cell are analyzed by using cDNA probe G ⁇ PD, PPARY and aP2 and normalized with 36B4.
  • FIG. 2 depicts the expression of G ⁇ PD mRNA in fat tissues of obese mice by Northern blot analysis .
  • Subcutaneous and epididymal fat pads are dissected from l ⁇ -week-old db/+, db/db mice and analyzed by using cDNA probe G ⁇ PD, IDH, ME, FAS, ADDl, PPARy and aP2.
  • B Relative amount of each ⁇ iRNA is quantified from mRNAs of db/db versus db/+ mice with phosphoimager .
  • C Epididymal fat pads are dissected from 16-week- old C57bl/6J (B ⁇ ) , ob/ob, db/db and diet induced obesity (DIO) mice and analyzed by using cDNA probe G ⁇ PD and aP2.
  • FIG. 3 depicts the protein level and enzymatic activity of G ⁇ PD in obese mice tissue by Immunoblot analysis .
  • PIG. 4 depicts the stimulation of adipogenesis in adipocyte through G6PD over-expression.
  • PIG. 5 depicts the suppression of lipogenic and adipogenic activity by knockdown of G ⁇ PD.
  • Each retroviral siRNA infected 3T3-L1 adipocytes (mock, G6PD-2i, -5i and -Hi) are examined by Immunoblot analysis to indicates the protein levels of endogenous G ⁇ PD.
  • Each retroviral siRNA infected cells are examined by Northern blot analysis to evaluate mRNA levels of lipogenic (G ⁇ PD, ⁇ PGD, ME, ADDl/SREBPlc and FAS) and adipogenic ( PPARY, C/EBP ⁇ and aP2 ) genes and normalized with
  • FIG. 6 depicts the effect of G ⁇ PD over-expression on adipocytokine including adiponectin, TNF ⁇ , IL6, resistin and FFAs .
  • AdG ⁇ PD infected 3T3-L1 adipocyte is extracted and analyzed by SDS-PAGE and Immunoblot analysis with adiponectin, G ⁇ PD and flag detecting only AdG ⁇ PD antibodies .
  • Mock or AdG ⁇ PD infected adipocytes is examined for mRNA levels of indicated genes (G6PD, TNF ⁇ , IL ⁇ , resistin and adiponectin) are by Real-time RT-PCRs.
  • FIG. 7 depicts the effect of G6PD over-expression on the insulin sensitivity.
  • A. Mock or AdG ⁇ PD infected 3T3-L1 adipocyte are treated with or without insulin (100 nM) and analyzed by Immunoblot analysis with IR, IRS-I and Akt antibodies.
  • FIG. 8 depicts the functional role of G6PD in adipocyte and the impacts on obesity schematically.
  • FIG. 9 depicts the changes of body weight in experimental mice db/db and db/+ after treating chemical G6PD inhibitor of the present invention.
  • the object of the present invention is to provide G ⁇ PD (glucose-6-phosphate dehydrogenase) enzyme inhibitor and a method for treating and/or preventing obesity, diabetes and the like by using a G ⁇ PD enzyme inhibitor.
  • G ⁇ PD glycose-6-phosphate dehydrogenase
  • the present invention provides a G ⁇ PD enzyme inhibitor that can suppress the expression of G ⁇ PD enzyme and be useful for treatment of obesity, diabetes and the like .
  • the G6PD enzyme inhibitor of the present invention can be small interfering RNAs (siRNAs) , preferably selected from small interfering RNAs containing SEQ ID NO.
  • siRNAs small interfering RNAs
  • the present invention provides a recombinant retrovirus vector containing small interfering RNA (siRNA) sequences that can be used for obesity treatment and a recombinant adenovirus vector containing the small interfering RNA (siRNA) sequence.
  • siRNA small interfering RNA
  • the G6PD enzyme inhibitor of the present invention can be chemical substances that affect the function of G6PD enzyme directly and/or indirectly and preferably, can be selected from the group consisting of DHEA (dehydroepiandrosterone) , epiandrosterone, isoflurane, sevoflurane and diazepam and more preferably, can be DHEA (dehydroepiandrosterone) .
  • the present invention provides a method for treating and/or preventing obesity and diabetes by using the G ⁇ PD enzyme inhibitor.
  • the present invention provides the oligonucleotides that are designed from Oligoengine tools and used to create the recombinant retrovirus vector.
  • mouse G ⁇ PD siRNA oligonucleotides are positioned at 279 ⁇ 297, 546 ⁇ 564 and 1149 ⁇ 1167 nucleotides downstream from the transcription start site of mouse G6PD cDNA.
  • Three constructs of the present invention are named as pSUPER-retro-siRNA-G6PD-2i
  • the present invention provides chemical G6PD inhibitor that can affect the function of G6PD enzyme directly and/or indirectly.
  • the chemical G6PD enzyme inhibitor can be selected from selected from the group consisting of DHEA (dehydroepiandrosterone) , epiandrosterone, isoflurane, sevoflurane and diazepam and more preferably, can be DHEA (dehydroepiandrosterone) . It is natural that any kind of substance that can suppress the expression of G6PD enzyme and the G6PD enzymatic activity can be adopted for the G6PD inhibitor in the present invention.
  • the present invention provides a method for treating and/or preventing lipid metabolic disorders targeting to G ⁇ PD enzyme, including obesity, diabetes and the like, by using the G ⁇ PD enzyme inhibitor .
  • the G ⁇ PD enzyme inhibitor can be small interfering RNAs and the recombinant viral vectors containing any sequence of above-mentioned siRNA.
  • the G ⁇ PD inhibitor can be selected from the group consisting of DHEA (dehydroepiandrosterone) , epiandrosterone, isoflurane, sevoflurane and diazepam and more preferably, can be DHEA (dehydroepiandrosterone) .
  • the present invention provides a process for screening a G ⁇ PD enzyme inhibitor for obesity treatment, which comprises (1) an expression vector containing G ⁇ PD gene; (2 ) a gene expression system; (3) various reagents and the like .
  • one or more commonly used components such as vehicle can be added through a conventional procedure .
  • the substance of the present invention can be provided as the main pharmacologically active components in an oral dosage form including, but not limited to, tablets , capsules, caplets, gelcaps, liquid solutions, suspensions or elixirs, powders, lozenges, micronized particles and osmotic delivery systems; or in a parenteral dosage form including unit administration or several times administration.
  • the dosage of the substance of the invention will vary, depending on factors such as severity of obesity or diabetes, age, sex, physical condition, administration period, administration method, discharge ratio and body weight of the patient, diet, etc.
  • oligonucleotides used to create pSUPER-Retro-siRNAG ⁇ PD were designed from Oligoengine tools (http: //www. oligoengine . com) .
  • Three sets of mouse G ⁇ PD siRNA oligonucleotides are positioned at 279 ⁇ 297, 546 ⁇ 564 and 1149 ⁇ 1167 nucleotides downstream from the transcription start site of mouse G6PD cDNA.
  • pSUPER-retro-siRNA-G6PD-2i (279 ⁇ 297 )
  • pSUPER- retro-siRNA-G6PD-5i (546 ⁇ 564)
  • pSUPER-retro-siRNA-G6PD- Hi (1149 ⁇ 1167)
  • siRNA sequences were as follows (See Sequence list) :
  • SEQ ID NO. 1 G6PD-2i-sense
  • SEQ ID NO. 3 G6PD-5i-sense, 5' -GATCCCCCTGTCGAACCACATCTCCTTTCAAGAGAAGGAGATGTG
  • SEQ ID NO. 5 G6PD-lli-antisense, 5' -GATCCCCCAGTGCAAGCGTAATGAGCTTCAAGAGAGCTCATTACG
  • SEQ ID NO. 6 G ⁇ PD-lli-antisense, 5' -AGCTTTTCCAAAAACAGTGCAAGCGTAATGAGCTCTTGAAGCT
  • oligonucleotides were annealed and then cloned into pSUPER-Retro vector (OligoEngine) .
  • the DNA constructs were used to produce G ⁇ PD siRNA retrovirus .
  • siRNA experiments were performed as described by the manufacturer' s protocols (OligoEngine) .
  • 3T3-L1 cells were grown to confluence in Dulbecco' s modifided Eagle' s medium (DMEM) supplemented with 10% bovine calf serum (BCS, Gibco BRL) . Differentiation of 3T3-L1 cells was induced as described previously. Briefly, after two days of post-confluence, 3T3-L1 cells were incubated with DMEM containing 10% fetal bovine serum (FBS, Gibco BRL) , 3- isobutyl-1-methylxanthine (500 ⁇ M) , dexamethasone (1 ⁇ M) and insulin (5 ⁇ g/ml) for 48 h.
  • DMEM Dulbecco' s modifided Eagle' s medium
  • BCS bovine calf serum
  • Culture medium was changed every other day with DMEM containing 10% FBS and insulin (5 ⁇ g/ml) .
  • 3T3-F442A cells were maintained in DMEM containing 10% BCS and were differentiated into adipocytes by addition of the medium with 10% FBS and insulin (5 ⁇ g/ml) when the cells were confluent .
  • cDNAs used as probes were G ⁇ PD, 6PGD,
  • G ⁇ PD mRNA was highly expressed in adipose tissues .
  • kidney, lung and spleen expressed moderate levels of G ⁇ PD mRNA (FIG. IA) .
  • mRNAs of 6PGD, ME and IDH, other NADPH producing enzymes were abundantly expressed in adipose tissues, although their tissue distributions were not the same.
  • pre- adipocytes such as 3T3-F442A and 3T3-L1
  • differentiated adipocytes prominently expressed G6PD mRNA, which was increased during adipogenesis (FIG. IB) . Therefore, it is confirmed that G ⁇ PD play important roles in lipogenesis or adipogenesis in fat cells .
  • TGN buffer 50 mM Tris pH 7.5, 150 mM NaCl, 1% Tween 20, 0.2% NP-40, 1 mM PMSF, 100 mM NaF, 1 mM Na3VO4, 10 ⁇ g/ml Aprotinin, 2 ⁇ g/ml Pepstatin A and 10 ⁇ g/ml Leupeptin.
  • Total cell lysates were centrifugated at 12, 000 rpm at 4 °C for 15 min for the removal of fat debris .
  • the protein concentration was determined by BCA assay kit (Pierce) .
  • Western blot analyses were conducted as Amersham Life Science' s protocol.
  • the proteins were separated by electrophoresis on SDS-polyacrylamide gel and transferred to polyvinylidene difluoride (PVDF) membranes
  • GSK3 ⁇ were purchased from Transduction Laboratory.
  • IR, IRS-I, Akt, phospho-Akt and 4G10 antibodies were purchased from Cell Signaling Technology.
  • mouse adiponectin antibodies were provided by KOMED (Seoul, Korea) . Results were visualized with horseradish peroxidase-conjugated secondary antibodies (Sigma Aldrich) and were enhanced chemiluminescence.
  • G6PD enzyme activities were determined by measuring the rate of NADPH production. Since 6PGD, the second enzyme of PPP, also produces NADPH, both 6PGD and total dehydrogenase activity (G6PD + 6PGD) were measured separately as previously described (53) . G6PD activity was calculated by subtracting the activity of 6PGD from the total enzyme activity. Glucose-6-phosphate, 6- phosphogluconate, and NADP + were obtained from Sigma Aldrich. Protein levels were determined for each sample using BCA assay kit (Pierce) , and each enzyme activity was normalized by protein concentration.
  • FIG. 3A As expected from the mRNA and protein levels of
  • G ⁇ PD the enzymatic activity of G ⁇ PD was enhanced in various fat depots of db/db mice (FIG. 3B) .
  • G ⁇ PD enzymatic activities of the liver and muscle from db/db mice were insignificantly different from those of lean mice (FIG. 3B) .
  • the enzymatic activities of G ⁇ PD in fat tissues were at least five to twenty folds higher than that of liver in both normal and obese mice .
  • Example 4 Stimulation of adipogenesis and lipogenesis by over-expression of G6PD enzyme.
  • Retroviruses were constructed in pBabe vectors using puromycin selectable markers .
  • Viral constructs were transfected into BOSC cells using calcium-phosphate transfection method. Cells were incubated in DMEM containing 10% FBS for 48 hour. The cell culture medium was filtered through a 0.45 um-pore-size filter, and the viral supernatant was used for the infection of 3T3-L1 pre- adipocytes with polybrene (4 ⁇ g/ml) . The cells were infected for at least 12 hour and allowed to recover for 24 hour with fresh medium. The infected cells were selected with puromycin (1 to 5 ⁇ g/ml) .
  • 3T3-L1 cells showed enhanced adipocyte morphology with larger and more lipid droplet accumulation (FIG. 4B) .
  • G ⁇ PD G ⁇ PD
  • FAS ADDl/SREBPlc
  • PPARy PPARy
  • aP2 PPARy
  • the level of G ⁇ PD expression is closely associated with the levels of fatty acid metabolites including TG and FFAs in adipocytes . Also, it is proved that aberrant increase of G ⁇ PD in obese subjects promote circulating plasma FFAs level, which is a key cause of metabolic diseases including insulin resistance and hyperlipidemia and lipotoxicity.
  • G ⁇ PD knockdown was investigated by using siRNAs .
  • siRNAs As described above, three different G ⁇ PD siRNA constructs into pSUPER retrovector (G6PD-2i, -5i, and
  • G ⁇ PD-lli most effectively suppressed the expression of endogenous G ⁇ PD protein (almost 90% reduction of G ⁇ PD protein) whereas G ⁇ PD-21 and G ⁇ PD-5i partially decreased G ⁇ PD protein in 3T3-L1 cells (FIG. 5A) .
  • G ⁇ PD- Hi effectively blunted G ⁇ PD enzyme activity (data not shown) .
  • G6PD adenovirus was produced by Neurogenex (Seoul, Korea) .
  • G6PD cDNA was inframe fused with Flag epitope tag in its N-terminus.
  • 3T3-L1 adipocytes (at day 6 after differentiations) were incubated with serum free DMEM and various titers of adenovirus for 16 h at 37 0 C. Then, culture medium was replaced with fresh medium. Each experiment was performed at 72 hour after viral infection.
  • cDNAs were synthesized with Superscript First-Strand Synthesis System for RT-PCR kit (Invitrogen) . It was analyzed in a model iCyclerTM Realtime PCR Detection System (Bio-Rad) with following primers sets
  • SEQ ID NO. 10 TNF ⁇ antisense, 5' -CTGATGGTGTGGGTGAGGAG-S' ;
  • SEQ ID NO. 12 IL ⁇ antisense, 5' -ACTCCAGAAGACCAGAGGAAAT-S' ;
  • SEQ ID NO. 14 resistin antisense, 5' -GACCGGAGGACATCAGACAT-S' ;
  • SEQ ID NO. 15 adiponectin sense, 5' - GGCAGGAAAGGAGAACCTGG-S' ;
  • SEQ ID NO . 18 GAPDH antisense, 5 ' - GGATGCAGGGATGATGTTC-S ' ;
  • G6PD adenovirus AdG ⁇ PD
  • G6PD adenovirus was adopted to infect differentiated adipocytes .
  • G6PD adenovirus was produced by Neurogenex (Seoul, Korea) .
  • G6PD cDNA was fused with Flag epitope tag at the N- terminus .
  • 3T3-L1 adipocytes (at day 6 after differentiations) were incubated with serum free DMEM and various titers of adenovirus for 16 hour at 37 0 C. Then, culture medium was replaced with fresh medium. Each experiment was performed at 72 hour after viral infection.
  • adenoviral G6PD infected adipocytes (50 pfu/cell infection) expressed 1.5 folds more of G ⁇ PD protein than mock infected cells (FIG. 6A) . Accordingly, the enzyme activity of G6PD was increased by adenoviral G6PD expression (data not shown) . Furthermore, adenoviral G6PD expression in adipocytes increased the release of FFAs into culture medium (FIG. 6B) .
  • adipocytokines TNF ⁇ , IL6 and resistin are well known to induce insulin resistance in obese or diabetic animal models, whereas adiponectin enhances insulin sensitivity (32, 33) . Therefore, it is strongly suggested that increase of G ⁇ PD levels in adipocytes would alter insulin sensitivity not only by changing lipid metabolites but also by modulating adipocytokine expression.
  • Insulin stimulated glucose uptake in 3T3-L1 adipocytes was determined by measuring [C 14 ] 2-deoxy-glucose uptake as previously described.
  • adenovirus infected 3T3-L1 adipocytes were incubated in low glucose- DMEM containing 0.1% BSA for 16 hour at 37 0 C. Cells were stimulated with or without 100 nM insulin for 1 hour at 37 0 C.
  • Glucose uptake was initiated by the addition of [C 14 ] 2- deoxy-D-glucose at final concentration of 3 ⁇ mol/L for 10 min in HEPES buffer saline (140 mM NaCl, 5 mM KCl, 2.5 mM MgCl 2 , 1 mM CaCl 2 and 20 mM HEPES pH 7.4) .
  • the reaction was terminated by separating cells from HEPES buffer saline and [C 14 ] 2-deoxy-D-glucose. After washing 3 times in ice-cold PBS, the cells were extracted by 0.1% SDS, and subjected to scintillation counting for C 14 radioactivity. Protein concentration was determined with the BCA assay kit (Pierce) , and radioactivities were normalized by each protein concentration.
  • AdG ⁇ PD infected 3T3-L1 adipocytes uptake [C 14 ] 2-deoxy-D-glucose in response to insulin was determined. As shown in FIG. 7B, the folds of insulin stimulated glucose uptake were reduced in G6PD over- expressed adipocytes . It is elucidated that abnormal increase of G ⁇ PD expression in adipocytes interfere with insulin signaling and thereby induce insulin resistances in obese subjects .
  • G ⁇ PD enzyme inhibitor In order to examine the therapeutic use of G ⁇ PD enzyme inhibitor, several substances including DHEA (dehydroepiandrosterone) were administered into experimental obese mice, db/db and db/+. As shown in FIG. 9, it is verified that mice treated with G6PD enzyme inhibitor of the present invention lose their body weight remarkably. Consequently, the G ⁇ PD enzyme inhibitors are confirmed to be effective and nontoxic as a therapeutic agent for obesity treatment in the present invention. INDUSTRIAL APPLICABILITY
  • the glucose-6- phosphate dehydrogenase (G ⁇ PD) inhibitor of the present invention can be developed industrially and administered efficiently to facilitate or promote weight loss and the method for treating and/or preventing obesity by using the G ⁇ PD enzyme inhibitor can be applied widely in the future.
  • G ⁇ PD glucose-6- phosphate dehydrogenase

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Diabetes (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicinal Chemistry (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Molecular Biology (AREA)
  • Hematology (AREA)
  • Biochemistry (AREA)
  • Obesity (AREA)
  • Biotechnology (AREA)
  • Epidemiology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Virology (AREA)
  • Emergency Medicine (AREA)
  • Endocrinology (AREA)
  • Immunology (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Child & Adolescent Psychology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The present invention relates to a glucose-6-phosphate dehydrogenase (hereinafter, referred to as ¡°G6PD¡±) inhibitor, a therapeutic use of G6PD enzyme inhibitor for obesity and diabetes and a method for treating and/or preventing obesity and diabetes by using the same, which can be developed industrially to facilitate or promote weight loss and the like.

Description

G6ED ENZYME INHIBITOR AND METHOD FOR TREATING OBESITY
USING THE SAME
TECHNICAL FIELD
The present invention relates to a glucose-6- phosphate dehydrogenase (hereinafter, referred to as
"G6PD") inhibitor, a therapeutic use o.f GβPD enzyme inhibitor for obesity and a method for treating and/or preventing obesity by using the same.
BACKGROUND
In the past several decades, obesity has become a common health issue. Obesity is a major risk factor for metabolic diseases including hyperlipidemia, hypercholesterolemia, cardiovascular disease and type II diabetes (Kopelman, P. G. , Obesity as a medical problem,
Nature 404 : 635-643, 2000) and as the second leading cause of preventable death, contributes to >300, 000 deaths per year. The estimated direct annual health cost associated with obesity is $70 billion, while the overall cost to the
U. S . economy has been estimated to be over $140 billion.
Furthermore, the prevalence of obesity has increased by about 50% in the past 10 years . While the vast majority of obesity occurs in the industrialized world, the prevalence of obesity is also increasing in Korea and Japan and 10% ~ 25% of adults in most countries of Western Europe. The rise in the incidence of obesity has promoted the WHO to recognize obesity as a significant disease .
In many cases, metabolic diseases are closely associated with a failure of lipid homeostasis . A balance between fat synthesis (lipogenesis) and fat breakdown
(lipolysis/fatty acid oxidation) is critical for the maintenance of lipid homeostasis that prevents lipotoxicity in the organs of over-nourished individuals by confining excess lipid into adipocytes . Thus, defects in liporegulation lead to hyperlipidemia or lipid toxicity found in obesity and type II diabetes (Unger, R. H. , Endocrinology 144 : 5159-5165, 2003) . Consequently, tremendous research is currently being devoted to the identification of molecular targets that behave as a "switch" that controls lipid metabolism and to the development of drugs that specifically regulate lipid metabolism.
Glucose-6-phosphate dehydrogenase (G6PD) is the rate- limiting enzyme of pentose phosphate pathway (PPP) and it is highly conserved in most mammalian species (Kletzien, R. F. et al. , Faseb J. 8 : 174-181, 1994) . G6PD plays a key role in the maintenance of redox potential and cell survival via production of NADPH and pentose phosphates . Also, G6PD participates in reductive biosynthesis of fatty acids and cholesterol . Regarding the lipogenic activity of GβPD, it has been demonstrated that hepatic GβPD is regulated by nutritional signals including high-carbohydrate diet, polyunsaturated fatty acids, and hormonal signals such as insulin, glucagon, thyroid and glucocorticoids (Salati, L. M. and B. Amir-Ahmady, Annu. Rev. Nutr. 21 : 121-140, 2001) . Furthermore, it is reported that GβPD deficient patients show a decrease in lipogenic rate and serum lipoprotein concentrations, implying the importance of GβPD in fatty acid synthesis (15, 16) .
The present inventors have identified that both GβPD mRNA and protein be highly expressed in adipocytes and their levels be significantly elevated in fat tissues of several obese mouse models . In adipocytes, GβPD over-expression stimulated the expression of adipocyte marker genes as well as the elevation of cellular free fatty acids (FFAs) , triglyceride (TG) and FFA release into the medium.
In order to settle above-mentioned obesity problems, the present inventors have tried to exploit the physiological roles of GβPD enzyme and screened GβPD enzyme inhibitors that can be used for obesity treatment .
Precisely, small interfering RNAs (hereinafter, referred to as "siRNAs") that can suppress the GβPD expression have been designed and identified to impair normal function of adipocytes . Then, chemical GβPD inhibitor that can suppress both lipogenesis and adipogenesis, especially DHEA has been screened and confirmed to treat and/or prevent obesity and diabetes effectively. Therefore, the present invention has been developed novel therapeutic substances for obesity treatment and a method for treating obesity by using the GβPD enzyme inhibitor successfully.
BRIEF DESCRIPTION OF THE DRRWINGS
The above and other objects, features and other advantages of the present invention will be more clearly understood from the following detailed description taken in conjunction with the accompanying drawings, in which;
FIG. 1 depicts the expression of GβPD mRNA in mouse tissue and adipocyte by Northern blot analysis .
A. Each tissue is dissected from 10-week-old C57BL/6J mice and analyzed by using cDNA probe including GβPD, 6PGD, ME, IDH, ADDl, PPARy and aP2. B. 3T3-F442A cell and 3T3-L1 cell are analyzed by using cDNA probe GβPD, PPARY and aP2 and normalized with 36B4.
FIG. 2 depicts the expression of GβPD mRNA in fat tissues of obese mice by Northern blot analysis .
A. Subcutaneous and epididymal fat pads are dissected from lβ-week-old db/+, db/db mice and analyzed by using cDNA probe GβPD, IDH, ME, FAS, ADDl, PPARy and aP2.
B . Relative amount of each πiRNA is quantified from mRNAs of db/db versus db/+ mice with phosphoimager . C . Epididymal fat pads are dissected from 16-week- old C57bl/6J (Bβ) , ob/ob, db/db and diet induced obesity (DIO) mice and analyzed by using cDNA probe GβPD and aP2.
FIG. 3 depicts the protein level and enzymatic activity of GβPD in obese mice tissue by Immunoblot analysis .
A. Epididymal fat (WAT; white adipose tissue) pad are dissected from db/+ and db/db mice and analyzed by using GβPD, GSK3β and PPARy antibodies . B . Subcutaneous (Sub) , mesenteric (Mes) and epididymal (Epi) fat pads, liver and muscle tissues are examined.
PIG. 4 depicts the stimulation of adipogenesis in adipocyte through G6PD over-expression.
A. 3T3-L1 cells transduced with mock (pBabe) or G6PD retrovirus (pBabe-GβPD) are extracted to measure GβPD and 6PGD enzymatic activities .
B. Microscopy with or without Oil-Red 0 staining C. GβPD, FAS, ADDl/SREBPlc, PPARy, aP2 and HSL are evaluated for mRNA levels by Northern blot analysis .
D ~ F. 3T3-L1 adipocytes transduced above are analyzed to estimate cellular FFAs, TG and FFAs released into culture medium.
PIG. 5 depicts the suppression of lipogenic and adipogenic activity by knockdown of GβPD.
A. Each retroviral siRNA infected 3T3-L1 adipocytes (mock, G6PD-2i, -5i and -Hi) are examined by Immunoblot analysis to indicates the protein levels of endogenous GβPD.
B. Mock or G6PD-lli siRNA infected 3T3-L1 cells are induced and stained with Oil-Red 0.
C ~ E. Mock or G6PD-lli siRNA infected 3T3-L1 adipocytes are analyzed to measure cellular TG, FFAs and cholesterol levels .
F. Each retroviral siRNA infected cells are examined by Northern blot analysis to evaluate mRNA levels of lipogenic (GβPD, βPGD, ME, ADDl/SREBPlc and FAS) and adipogenic ( PPARY, C/EBPα and aP2 ) genes and normalized with
28S rRNA.
FIG. 6 depicts the effect of GβPD over-expression on adipocytokine including adiponectin, TNF α , IL6, resistin and FFAs .
A. AdGβPD infected 3T3-L1 adipocyte is extracted and analyzed by SDS-PAGE and Immunoblot analysis with adiponectin, GβPD and flag detecting only AdGβPD antibodies .
B. Released FFA is measured with NEFA assay kit .
C. Mock or AdGβPD infected adipocytes is examined for mRNA levels of indicated genes (G6PD, TNFα, ILβ, resistin and adiponectin) are by Real-time RT-PCRs.
FIG. 7 depicts the effect of G6PD over-expression on the insulin sensitivity.
A. Mock or AdGβPD infected 3T3-L1 adipocyte are treated with or without insulin (100 nM) and analyzed by Immunoblot analysis with IR, IRS-I and Akt antibodies.
B. Insulin stimulated [C14] 2-deoxy-glucose uptake is decreased according to G6PD over-expression.
FIG. 8 depicts the functional role of G6PD in adipocyte and the impacts on obesity schematically.
FIG. 9 depicts the changes of body weight in experimental mice db/db and db/+ after treating chemical G6PD inhibitor of the present invention.
DISCLOSURE OF THE INVENTION
The object of the present invention is to provide GβPD (glucose-6-phosphate dehydrogenase) enzyme inhibitor and a method for treating and/or preventing obesity, diabetes and the like by using a GβPD enzyme inhibitor.
Precisely, the present invention provides a GβPD enzyme inhibitor that can suppress the expression of GβPD enzyme and be useful for treatment of obesity, diabetes and the like .
The G6PD enzyme inhibitor of the present invention can be small interfering RNAs (siRNAs) , preferably selected from small interfering RNAs containing SEQ ID NO.
1 - 6 (See Sequence list) and more preferably a small interfering RNA containing SEQ ID NO. 5 or SEQ ID NO. 6.
In addition, the present invention provides a recombinant retrovirus vector containing small interfering RNA (siRNA) sequences that can be used for obesity treatment and a recombinant adenovirus vector containing the small interfering RNA (siRNA) sequence.
The G6PD enzyme inhibitor of the present invention can be chemical substances that affect the function of G6PD enzyme directly and/or indirectly and preferably, can be selected from the group consisting of DHEA (dehydroepiandrosterone) , epiandrosterone, isoflurane, sevoflurane and diazepam and more preferably, can be DHEA (dehydroepiandrosterone) .
In addition, the present invention provides a method for treating and/or preventing obesity and diabetes by using the GβPD enzyme inhibitor.
Hereinafter, the present invention will be described more clearly as follows .
The present invention provides the oligonucleotides that are designed from Oligoengine tools and used to create the recombinant retrovirus vector.
In detail, three sets of mouse GβPD siRNA oligonucleotides are positioned at 279 ~ 297, 546 ~ 564 and 1149 ~ 1167 nucleotides downstream from the transcription start site of mouse G6PD cDNA. Three constructs of the present invention are named as pSUPER-retro-siRNA-G6PD-2i
(279 ~ 297) , pSUPER-retro-siRNA-G6PD-5i (546 ~ 564) and pSUPER-retro-siRNA-G6PD-lli (1149 ~ 1167) respectively. It is natural that other kinds of recombinant vectors using above-mentioned oligonucleotides to regulate the expression of G6PD and to treat and/or prevent obesity, diabetes and the like, including the recombinant adenovirus vector, can be within the scope of the present invention.
In addition, the present invention provides chemical G6PD inhibitor that can affect the function of G6PD enzyme directly and/or indirectly. Preferably, the chemical G6PD enzyme inhibitor can be selected from selected from the group consisting of DHEA (dehydroepiandrosterone) , epiandrosterone, isoflurane, sevoflurane and diazepam and more preferably, can be DHEA (dehydroepiandrosterone) . It is natural that any kind of substance that can suppress the expression of G6PD enzyme and the G6PD enzymatic activity can be adopted for the G6PD inhibitor in the present invention.
In addition, the present invention provides a method for treating and/or preventing lipid metabolic disorders targeting to GβPD enzyme, including obesity, diabetes and the like, by using the GβPD enzyme inhibitor .
At this moment, the GβPD enzyme inhibitor can be small interfering RNAs and the recombinant viral vectors containing any sequence of above-mentioned siRNA. Besides, the GβPD inhibitor can be selected from the group consisting of DHEA (dehydroepiandrosterone) , epiandrosterone, isoflurane, sevoflurane and diazepam and more preferably, can be DHEA (dehydroepiandrosterone) .
In addition, the present invention provides a process for screening a GβPD enzyme inhibitor for obesity treatment, which comprises (1) an expression vector containing GβPD gene; (2 ) a gene expression system; (3) various reagents and the like .
Depending on the desired uses of substance according to the present invention, one or more commonly used components such as vehicle can be added through a conventional procedure .
The substance of the present invention can be provided as the main pharmacologically active components in an oral dosage form including, but not limited to, tablets , capsules, caplets, gelcaps, liquid solutions, suspensions or elixirs, powders, lozenges, micronized particles and osmotic delivery systems; or in a parenteral dosage form including unit administration or several times administration. The dosage of the substance of the invention will vary, depending on factors such as severity of obesity or diabetes, age, sex, physical condition, administration period, administration method, discharge ratio and body weight of the patient, diet, etc.
Further features and advantages of the present invention will appear hereinafter.
EXAMPLES
Practical and presently preferred embodiments of the present invention are illustrated as shown in the following Examples .
However, it will be appreciated that those skilled in the art, on consideration of this disclosure, may make modifications and improvements within the spirit and scope of the present invention.
<Example 1> Preparation of siRNAs of G6PD
The sequences of oligonucleotides used to create pSUPER-Retro-siRNAGβPD were designed from Oligoengine tools (http: //www. oligoengine . com) . Three sets of mouse GβPD siRNA oligonucleotides are positioned at 279 ~ 297, 546 ~ 564 and 1149 ~ 1167 nucleotides downstream from the transcription start site of mouse G6PD cDNA. Three constructs were referred as pSUPER-retro-siRNA-G6PD-2i (279 ~ 297 ) , pSUPER- retro-siRNA-G6PD-5i (546 ~ 564) and pSUPER-retro-siRNA-G6PD- Hi (1149 ~ 1167) , respectively.
The siRNA sequences were as follows (See Sequence list) :
(1) SEQ ID NO. 1 : G6PD-2i-sense,
5' -GATCCCCGAAAGACCTAAGCTGGAGGTTCAAGAGACCTCCAGCTT
AGGTCTTTCTTTTTGGAAA-3' ;
(2) SEQ ID NO. 2 : G6PD-2i-antisense,
5'-AGCTTTTCCAΆΆΆAGAAΆGACCTAΆGCTGGAGGTCTCTTGAΆCCT CCAGCTTAGGTCTTTCGGG-3 ' ;
(3) SEQ ID NO. 3: G6PD-5i-sense, 5' -GATCCCCCTGTCGAACCACATCTCCTTTCAAGAGAAGGAGATGTG
GTTCGACAGTTTTTGGAAA-3' ;
(4) SEQ ID NO. 4 : G6PD-5i-antisense,
5'-AGCTTTTCCAΆAΆACTGTCGAACCACATCTCCTTCTCTTGAΆΆGG AGATGTGGTTCGACAGGGG-3' ;
(5) SEQ ID NO. 5: G6PD-lli-antisense, 5' -GATCCCCCAGTGCAAGCGTAATGAGCTTCAAGAGAGCTCATTACG
CTTGCACTGTTTTTGGAAA-3' ;
(6) SEQ ID NO. 6 : GβPD-lli-antisense, 5' -AGCTTTTCCAAAAACAGTGCAAGCGTAATGAGCTCTCTTGAAGCT
CATTACGCTTGCACTGGGG-3' .
These oligonucleotides were annealed and then cloned into pSUPER-Retro vector (OligoEngine) . The DNA constructs were used to produce GβPD siRNA retrovirus . siRNA experiments were performed as described by the manufacturer' s protocols (OligoEngine) .
<Example 2> Expression of G6PD iriRNA in mouse tissue and adipocyte
(1) Cell culture.
3T3-L1 cells were grown to confluence in Dulbecco' s modifided Eagle' s medium (DMEM) supplemented with 10% bovine calf serum (BCS, Gibco BRL) . Differentiation of 3T3-L1 cells was induced as described previously. Briefly, after two days of post-confluence, 3T3-L1 cells were incubated with DMEM containing 10% fetal bovine serum (FBS, Gibco BRL) , 3- isobutyl-1-methylxanthine (500 μM) , dexamethasone (1 μM) and insulin (5 μg/ml) for 48 h. Culture medium was changed every other day with DMEM containing 10% FBS and insulin (5 μg/ml) . 3T3-F442A cells were maintained in DMEM containing 10% BCS and were differentiated into adipocytes by addition of the medium with 10% FBS and insulin (5 μg/ml) when the cells were confluent .
(2) Northern blot analysis
Total RNA was isolated with TRIzol reagent (Invitrogen Life Technologies) according to the manufacturer' s protocol . Then, each RNA was denatured in formamide and formaldehyde, and separated by electrophoresis on formaldehyde-containing agarose gels . After electrophoresis, RNA was transferred to nylon membrane (Schleicher and Schuell, Germany) , which was cross-linked with UV and hybridized with DNA probes . DNA probes were labeled by random priming method using the Klenow fragment of DNA polymerase I (Takara, Japan) and [α-32P] dCTP
(Amersham-Pharmacia) . cDNAs used as probes were GβPD, 6PGD,
ME, IDH, ADDl/SREBPlc, FAS, PPARy, C/EBPα, aP2, HSL and 36B4. To normalize RNA loading, blots were hybridized with a cDNA probe for human acidic ribosomal protein, 36B4.
Above all, in order to examine the tissue distribution of GβPD mRNA, Northern blot analysis was preformed. As shown in FIG. IA, GβPD mRNA was highly expressed in adipose tissues . Also, kidney, lung and spleen expressed moderate levels of GβPD mRNA (FIG. IA) . mRNAs of 6PGD, ME and IDH, other NADPH producing enzymes, were abundantly expressed in adipose tissues, although their tissue distributions were not the same. Compared to pre- adipocytes such as 3T3-F442A and 3T3-L1, differentiated adipocytes prominently expressed G6PD mRNA, which was increased during adipogenesis (FIG. IB) . Therefore, it is confirmed that GβPD play important roles in lipogenesis or adipogenesis in fat cells .
<Example 3> Expression profile of G6PD in fat tissue of obese mice model
(1) Western blot analysis
White adipose tissues and adipocytes were lysed with TGN buffer (50 mM Tris pH 7.5, 150 mM NaCl, 1% Tween 20, 0.2% NP-40, 1 mM PMSF, 100 mM NaF, 1 mM Na3VO4, 10 μg/ml Aprotinin, 2 μg/ml Pepstatin A and 10 μg/ml Leupeptin) . Total cell lysates were centrifugated at 12, 000 rpm at 4 °C for 15 min for the removal of fat debris .
The protein concentration was determined by BCA assay kit (Pierce) . Western blot analyses were conducted as Amersham Life Science' s protocol. The proteins were separated by electrophoresis on SDS-polyacrylamide gel and transferred to polyvinylidene difluoride (PVDF) membranes
(Millipore) . Following the transfer, the membranes were blocked with milk containing PBST and were probed with primary antibodies against GβPD, PPARγ, GSK3β, Flag, Adiponectin, IR, IRS-I, Akt, phospho-Akt and phospho- tyrosine (4G10) . GβPD antibodies were purchased from Sigma Aldrich. PPARγ and Flag antibodies were acquired from Santa Cruz Biotechnology.
GSK3β were purchased from Transduction Laboratory. IR, IRS-I, Akt, phospho-Akt and 4G10 antibodies were purchased from Cell Signaling Technology. Lastly, mouse adiponectin antibodies were provided by KOMED (Seoul, Korea) . Results were visualized with horseradish peroxidase-conjugated secondary antibodies (Sigma Aldrich) and were enhanced chemiluminescence.
(2) G6PD enzyme assay
G6PD enzyme activities were determined by measuring the rate of NADPH production. Since 6PGD, the second enzyme of PPP, also produces NADPH, both 6PGD and total dehydrogenase activity (G6PD + 6PGD) were measured separately as previously described (53) . G6PD activity was calculated by subtracting the activity of 6PGD from the total enzyme activity. Glucose-6-phosphate, 6- phosphogluconate, and NADP+ were obtained from Sigma Aldrich. Protein levels were determined for each sample using BCA assay kit (Pierce) , and each enzyme activity was normalized by protein concentration. In order to examine whether the level of GβPD expression is changed in the fat tissues of obese animals, Northern blot analysis on subcutaneous and epididymal fat tissue of db/db mice was performed. Surprisingly, the mRNA expression levels of GβPD were remarkably increased in both subcutaneous (2.9 folds) and epididymal fat pads ( 6.3 folds) of db/db mice compared to those of db/+ lean littermates (FIG. 2A and B) . On the contrary, the mRNA levels of other NADPH producing enzymes such as IDH and ME were either slightly changed or even decreased in db/db mice . The mRNA levels of FAS and ADDl/SREBPlc were reduced in fat tissues of db/db mice (FIG. 2A and B) . Also, GβPD mRNA levels in other obese mice models such as ob/ob and DIO mice were investigated. Compared to lean mice, the mRNA levels of GβPD were clearly increased in both obese models (FIG. 2C) . These results demonstrated that the level of GβPD mRNA be explicitly elevated in fat tissues of various obese mice models, implying that the stimulation of GβPD expression appears to be associated with abnormal lipogenic activity in obese animals, leading to hyperlipidemia. Therefore, it is elucidated that the expression level of GβPD mRNA in human fat tissues tends to increase with the degree of obesity
In order to decide whether the protein levels and enzyme activity of GβPD are also elevated in the fat tissues of obese mice, Western blot analysis and GβPD enzyme activity assays were performed. The protein levels of GβPD were also increased (about 3.3 folds) compared to lean mice
(FIG. 3A) . As expected from the mRNA and protein levels of
GβPD, the enzymatic activity of GβPD was enhanced in various fat depots of db/db mice (FIG. 3B) . However, GβPD enzymatic activities of the liver and muscle from db/db mice were insignificantly different from those of lean mice (FIG. 3B) .
Furthermore, the enzymatic activities of GβPD in fat tissues were at least five to twenty folds higher than that of liver in both normal and obese mice .
Therefore, it is identified that both the expressional level and enzymatic activity of GβPD are remarkably elevated in several fat pads of obese animals, which may link to lipid dysregulation.
<Example 4> Stimulation of adipogenesis and lipogenesis by over-expression of G6PD enzyme.
(1) Retrovirus infection
Retroviruses were constructed in pBabe vectors using puromycin selectable markers . Viral constructs were transfected into BOSC cells using calcium-phosphate transfection method. Cells were incubated in DMEM containing 10% FBS for 48 hour. The cell culture medium was filtered through a 0.45 um-pore-size filter, and the viral supernatant was used for the infection of 3T3-L1 pre- adipocytes with polybrene (4 μg/ml) . The cells were infected for at least 12 hour and allowed to recover for 24 hour with fresh medium. The infected cells were selected with puromycin (1 to 5 μg/ml) .
(2) Measurement of cellular lipid metabolites
Cellular contents of triglycerides and cholesterol in the 3T3-L1 cells were measured by using TG and Cholesterol assay kit (Sigma Aldrich) . The amount of free fatty acids was determined with NEFA assay kit (Roche) . Each analysis was performed as recommended by the manufacturer' s protocol
Next, in order to examine functional roles of G6PD in adipocytes, the effects of GβPD over-expression were investigated on the lipogenic and/or adipogenic potential .
Retroviral over-expression of GβPD in 3T3-L1 cells enhanced
— 1.4 folds of its enzyme activity in comparison to mock retrovirus infected adipocytes (FIG. 4A) . On day 6 after the induction of adipocyte differentiation, GβPD over-expressed
3T3-L1 cells showed enhanced adipocyte morphology with larger and more lipid droplet accumulation (FIG. 4B) .
Northern blot analyses were performed to investigate the change in lipogenic and adipogenic gene expression profiles . As shown in FIG. 4C, GβPD over-expression markedly promoted the expression of most adipocyte marker genes, including
GβPD, FAS, ADDl/SREBPlc, PPARy and aP2. Therefore, it is verified that GβPD over-expression can stimulate adipogenesis with lipogenesis by increasing both adipogenic and lipogenic gene expression.
Next, in order to determine the levels of lipid metabolites such as TG, cholesterol, and FFAs in the absence or presence of GβPD over-expression, we determined levels of lipid metabolite in adipocytes . In GβPD over-expressed adipocytes, cellular FFAs and TG levels were elevated at about 2 folds and 1.7 folds, respectively (FIG. 4D and E) . Interestingly, the level of FFAs released into the cultured medium was also increased by ~ 1.4 folds (FIG. 4F) . In contrast, cellular cholesterol levels were not significantly changed (data not shown) . As a result, it is elucidated that the level of GβPD expression is closely associated with the levels of fatty acid metabolites including TG and FFAs in adipocytes . Also, it is proved that aberrant increase of GβPD in obese subjects promote circulating plasma FFAs level, which is a key cause of metabolic diseases including insulin resistance and hyperlipidemia and lipotoxicity.
<Example 5> Effect of 66PD knockdown on adipogenesis
In order to verify whether GβPD is associated with in adipocyte differentiation, GβPD knockdown was investigated by using siRNAs . As described above, three different GβPD siRNA constructs into pSUPER retrovector (G6PD-2i, -5i, and
-Hi) were designed. Then, 3T3-L1 cells were infected with these siRNA retroviruses and examined their abilities to suppress GβPD protein levels (FIG. 5A) . Among these siRNAs, GβPD-lli most effectively suppressed the expression of endogenous GβPD protein (almost 90% reduction of GβPD protein) whereas GβPD-21 and GβPD-5i partially decreased GβPD protein in 3T3-L1 cells (FIG. 5A) . Consistently, GβPD- Hi effectively blunted GβPD enzyme activity (data not shown) .
Next, the effect of GβPD knockdown on adipogenesis and lipogenesis was examined. Consistently, it is elucidated that GβPD is involved in adipogenesis and lipogenesis (FIG. 4) and 3T3-L1 cells infected with G6PD-lli-siRNA retrovirus may attenuate adipocyte differentiation with a little lipid droplet accumulation (FIG. 5B) . Furthermore, the cellular levels of TG and FFAs were significantly decreased in GβPD-lli infected 3T3-L1 cells
(FIG. 5C and D) . Nonetheless, cellular cholesterol levels was not significantly changed (FIG. 5E) , which is also consistent with the results from GβPD over-expressing cells . In order to determine if the reduction of GβPD expression might affect adipogenic gene expression in 3T3-L1 cells, Northern blot analysis was performed. As shown in FIG. 5F, the mRNA expression levels of most lipogenic genes including GβPD, 6PGD, ME, ADDl/SREBPlc and FAS and those of adipogenic genes including PPARγ, C/EBPα and aP2 were greatly decreased in GβPD-lli infected 3T3-L1 cells . Therefore, it is approved that a certain amount of GβPD appears to be required for the execution of both adipogenesis and lipogenesis in adipocytes.
<Example 6> Effect of 66PD over-expression on expression of adipocytokines.
(1) Adenovirus infection.
G6PD adenovirus was produced by Neurogenex (Seoul, Korea) . G6PD cDNA was inframe fused with Flag epitope tag in its N-terminus. For adenoviral infection, 3T3-L1 adipocytes (at day 6 after differentiations) were incubated with serum free DMEM and various titers of adenovirus for 16 h at 37 0C. Then, culture medium was replaced with fresh medium. Each experiment was performed at 72 hour after viral infection.
(2) Real-time RT-PCR.
For real-time RT PCR analysis, cDNAs were synthesized with Superscript First-Strand Synthesis System for RT-PCR kit (Invitrogen) . It was analyzed in a model iCyclerTM Realtime PCR Detection System (Bio-Rad) with following primers sets
(a) SEQ ID NO. 7 : G6PD sense,
5' -CGATGGCAGAGCAGGT-3' ; (b) SEQ ID NO. 8 : G6PD antisense, 5' -GATCTGGTCCTCACG-S' ;
(c) SEQ ID NO. 9: TNFα sense, 5' -GCCACCACGCTCTTCTGCCT-3' ;
(d) SEQ ID NO. 10: TNFα antisense, 5' -CTGATGGTGTGGGTGAGGAG-S' ;
(e) SEQ ID NO. 11: ILβ sense,
5' -CCAGAGATACAAAGAAATGATGG-S' ;
(f) SEQ ID NO. 12 : ILβ antisense, 5' -ACTCCAGAAGACCAGAGGAAAT-S' ;
(g) SEQ ID NO. 13: resistin sense, 5' -CAGAAGGCACAGCAGTCTTG -3' ;
(h) SEQ ID NO. 14 : resistin antisense, 5' -GACCGGAGGACATCAGACAT-S' ;
(i) SEQ ID NO. 15: adiponectin sense, 5' - GGCAGGAAAGGAGAACCTGG-S' ;
(j ) SEQ ID NO. 16: adiponectin antisense,
5' -GCCTTGTCCTTCTTGAAGAG-S' ; (k) SEQ ID NO . 17 : GAPDH sense,
5' -TGCACCACCAACTGCTTAG-3' ;
(1) SEQ ID NO . 18 : GAPDH antisense, 5 ' - GGATGCAGGGATGATGTTC-S ' ;
(3 )
It has been demonstrated that abnormal increase of cellular FFAs, TG and FFA releases leads to the change of adipocytokine production and insulin sensitivity in adipocytes . In order to examine the effect of G6PD over- expression on the expression or secretion of adipocytokines, G6PD adenovirus (AdGβPD) was adopted to infect differentiated adipocytes . G6PD adenovirus was produced by Neurogenex (Seoul, Korea) . G6PD cDNA was fused with Flag epitope tag at the N- terminus . For adenoviral infection, 3T3-L1 adipocytes (at day 6 after differentiations) were incubated with serum free DMEM and various titers of adenovirus for 16 hour at 37 0C. Then, culture medium was replaced with fresh medium. Each experiment was performed at 72 hour after viral infection.
Compared to mock infected adipocytes, adenoviral G6PD infected adipocytes (50 pfu/cell infection) expressed 1.5 folds more of GβPD protein than mock infected cells (FIG. 6A) . Accordingly, the enzyme activity of G6PD was increased by adenoviral G6PD expression (data not shown) . Furthermore, adenoviral G6PD expression in adipocytes increased the release of FFAs into culture medium (FIG. 6B) .
In order to determine the level of adipocytokine expression, Real-time RT-PCR and Western blot analyses in the absence or presence of ectopic G6PD expression were conducted. Interestingly, infection with AdGβPD dramatically suppressed the protein and mRNA expression of adiponectin (FIG. 6A and C) . Normal expression of adiponectin is crucial to maintain insulin sensitivity and to prevent athrosclerosis . Also, reduction of adiponectin level is found in obese or diabetic subjects . Furthermore, Real-time RT-PCR analyses showed that mRNA levels of TNFα, IL6 and resistin were greatly elevated in GβPD over-expressed adipocytes (FIG. 6C) . Among these adipocytokines, TNFα, IL6 and resistin are well known to induce insulin resistance in obese or diabetic animal models, whereas adiponectin enhances insulin sensitivity (32, 33) . Therefore, it is strongly suggested that increase of GβPD levels in adipocytes would alter insulin sensitivity not only by changing lipid metabolites but also by modulating adipocytokine expression.
<Example 7> Attenuation of insulin signaling by over- expression of G6PD
Since over-expression of G6PD in adipocytes enhanced the levels of FFAs, TNFα, IL6 and resistin, which are key players in insulin resistance (FIG. β) , it is hypothesized that G6PD over-expression induce insulin resistance . In order to examine the insulin signaling cascade with or without AdGβPD infection, mock infected adipocytes exhibited increased tyrosine phosphorylation of insulin receptor (IR) and insulin receptor substrate (IRS) -I when treated with insulin (FIG. 7A, lane 2) . On the contrary, the induction of phosphorylation at the tyrosine residues of IR and IRS-I was significantly diminished in AdGβPD infected adipocytes (FIG. 7A, lanes 4 and 6) . Furthermore, Akt phosphorylation, a downstream event of insulin signaling, was also reduced by G6PD over-expression. It is confirmed that insulin signaling in GβPD over-expressed adipocyte is decreased, probably linked to changes of adipocytokine expression (FIG. 7A) . Also, insulin stimulated glucose uptake assay because it is a good measure of insulin sensitivity in adipocytes .
Insulin stimulated glucose uptake in 3T3-L1 adipocytes was determined by measuring [C14] 2-deoxy-glucose uptake as previously described. In short, adenovirus infected 3T3-L1 adipocytes were incubated in low glucose- DMEM containing 0.1% BSA for 16 hour at 370C. Cells were stimulated with or without 100 nM insulin for 1 hour at 370C. Glucose uptake was initiated by the addition of [C14] 2- deoxy-D-glucose at final concentration of 3 μmol/L for 10 min in HEPES buffer saline (140 mM NaCl, 5 mM KCl, 2.5 mM MgCl2, 1 mM CaCl2 and 20 mM HEPES pH 7.4) . The reaction was terminated by separating cells from HEPES buffer saline and [C14] 2-deoxy-D-glucose. After washing 3 times in ice-cold PBS, the cells were extracted by 0.1% SDS, and subjected to scintillation counting for C14 radioactivity. Protein concentration was determined with the BCA assay kit (Pierce) , and radioactivities were normalized by each protein concentration.
The ability of AdGβPD infected 3T3-L1 adipocytes to uptake [C14] 2-deoxy-D-glucose in response to insulin was determined. As shown in FIG. 7B, the folds of insulin stimulated glucose uptake were reduced in G6PD over- expressed adipocytes . It is elucidated that abnormal increase of GβPD expression in adipocytes interfere with insulin signaling and thereby induce insulin resistances in obese subjects .
<Example 8> Application of G6PD enzyme inhibitor for obesity treatment in animal model
In order to examine the therapeutic use of GβPD enzyme inhibitor, several substances including DHEA (dehydroepiandrosterone) were administered into experimental obese mice, db/db and db/+. As shown in FIG. 9, it is verified that mice treated with G6PD enzyme inhibitor of the present invention lose their body weight remarkably. Consequently, the GβPD enzyme inhibitors are confirmed to be effective and nontoxic as a therapeutic agent for obesity treatment in the present invention. INDUSTRIAL APPLICABILITY
As illustrated and confirmed above, the glucose-6- phosphate dehydrogenase (GβPD) inhibitor of the present invention can be developed industrially and administered efficiently to facilitate or promote weight loss and the method for treating and/or preventing obesity by using the GβPD enzyme inhibitor can be applied widely in the future.
Those skilled in the art will appreciate that the conceptions and specific embodiments disclosed in the foregoing description may be readily utilized as a basis for modifying or designing other embodiments for carrying out the same purposes of the present invention.
Those skilled in the art will also appreciate that such equivalent embodiments do not depart from the spirit and scope of the invention as set forth in the appended claims .

Claims

36 What is claimed is:
1. A GβPD (glucose-β-phosphate dehydrogenase) enzyme inhibitor, which can be used for treatment and/or prevention of obesity and/or diabetes.
2. The GβPD enzyme inhibitor according to claim 1, which can be selected from small interfering RNAs (siRNAs) of SEQ ID NO. 1 - 6 and preferably, siRNAs of SEQ ID NO. 5 ~ 6.
3. A recombinant retrovirus vector containing small interfering RNAs of SEQ ID NO. 1 ~ 6 and preferably, siRNAs of SEQ ID NO. 5 - 6 for obesity treatment.
4. The G6PD enzyme inhibitor according to claim 1, which can be selected from the group consisting of DHEA
(dehydroepiandrosterone) , epiandrosterone, isoflurane, sevoflurane and diazepam and more preferably, can be DHEA (dehydroepiandrosterone) .
5. A method for treating and/or preventing obesity, in which the GβPD enzyme inhibitor of claim 1 is administered.
6. A method for screening a material for treating and/or preventing obesity, in which the GβPD enzyme is used.
PCT/KR2005/000376 2005-02-07 2005-02-07 G6pd enzyme inhibitor and method for treating obesity using the same WO2006083051A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
PCT/KR2005/000376 WO2006083051A1 (en) 2005-02-07 2005-02-07 G6pd enzyme inhibitor and method for treating obesity using the same

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/KR2005/000376 WO2006083051A1 (en) 2005-02-07 2005-02-07 G6pd enzyme inhibitor and method for treating obesity using the same

Publications (1)

Publication Number Publication Date
WO2006083051A1 true WO2006083051A1 (en) 2006-08-10

Family

ID=36777405

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2005/000376 WO2006083051A1 (en) 2005-02-07 2005-02-07 G6pd enzyme inhibitor and method for treating obesity using the same

Country Status (1)

Country Link
WO (1) WO2006083051A1 (en)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009067489A1 (en) 2007-11-20 2009-05-28 Lankenau Institute For Medical Research Disulfide chemotherapeutic agents and methods of use thereof
WO2013017656A1 (en) * 2011-08-02 2013-02-07 Medizinische Universität Wien Antagonists of ribonucleases for treating obesity
KR101481041B1 (en) 2007-11-30 2015-01-12 (주)아모레퍼시픽 Glucose-6-phosphate dehydrogenase inhibitor and a composition for inhibiting differentiation of adipocyte comprising same
WO2023083979A1 (en) * 2021-11-10 2023-05-19 Umecrine Ab 3.beta.-hydroxy, 3.alpha.-ethyl steroids for modulation of the alpha-3 subtype of the gaba-a receptor
US12014835B2 (en) 2020-02-19 2024-06-18 Vanderbilt University Methods for evaluating therapeutic benefit of combination therapies

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
BLASI: "Influence of benzodiazepine on body weight and food intake in obese and lean Zucker rats", PROG. NEURO-PSYCHOPHARMACOL. & BIOL. PSYCHIAT., vol. 24, 2000, pages 561 - 577 *
COLEMAN: "Antiobesity effects of etiocholanolones in diabetes(db). viable yellow(Avy), and normal mice", ENDOCRINOLOGY, vol. 117, no. 6, December 1985 (1985-12-01), pages 2279 - 2283 *
RICHARDS ET AL.: "Serum leptin, lipids, free fatty acids, and fat pads in long-term dehydroepiandrosterone-treated Zucker rats", PROC. SOC. EXP. BIOL. MED., vol. 223, no. 3, March 2000 (2000-03-01), pages 258 - 262 *
YEN ET AL.: "Control of obesity in Avy/a mice by 5alpha-adrostan-17-one", EXPERIENTIA, vol. 34, no. 12, December 1978 (1978-12-01), pages 1542 - 1543 *
YEN ET AL.: "Prevention of obesity in Avy/a mice by dehydroepiandrosterone", LIPIDS, vol. 12, no. 5, May 1977 (1977-05-01), pages 409 - 413 *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009067489A1 (en) 2007-11-20 2009-05-28 Lankenau Institute For Medical Research Disulfide chemotherapeutic agents and methods of use thereof
KR101481041B1 (en) 2007-11-30 2015-01-12 (주)아모레퍼시픽 Glucose-6-phosphate dehydrogenase inhibitor and a composition for inhibiting differentiation of adipocyte comprising same
WO2013017656A1 (en) * 2011-08-02 2013-02-07 Medizinische Universität Wien Antagonists of ribonucleases for treating obesity
US12014835B2 (en) 2020-02-19 2024-06-18 Vanderbilt University Methods for evaluating therapeutic benefit of combination therapies
WO2023083979A1 (en) * 2021-11-10 2023-05-19 Umecrine Ab 3.beta.-hydroxy, 3.alpha.-ethyl steroids for modulation of the alpha-3 subtype of the gaba-a receptor

Similar Documents

Publication Publication Date Title
Wu et al. Hepatic exosome-derived miR-130a-3p attenuates glucose intolerance via suppressing PHLPP2 gene in adipocyte
JP5822845B2 (en) Regulation of angiopoietin-like 3 expression
Lei et al. Hyperglycemia-induced protein kinase C β2 activation induces diastolic cardiac dysfunction in diabetic rats by impairing caveolin-3 expression and Akt/eNOS signaling
Yang et al. Relative contribution of adipose triglyceride lipase and hormone-sensitive lipase to tumor necrosis factor-α (TNF-α)-induced lipolysis in adipocytes
Moc et al. Physiological activation of Akt by PHLPP1 deletion protects against pathological hypertrophy
EP3063276B1 (en) Micrornas modulating the effect of glucocorticoid signaling
IL204796A (en) Antisense modulation of fibroblast growth factor receptor 4 expression
EP2056881A2 (en) Methods and sequences to suppress primate huntington gene expression in vivo
KR20170129263A (en) Compounds and methods for modulating TMPRSS6 expression
CA2964168A1 (en) Therapeutic inhibition of lactate dehydrogenase and agents therefor
McMurphy et al. Hepatic expression of adenovirus 36 E4ORF1 improves glycemic control and promotes glucose metabolism through AKT activation
WO2006083051A1 (en) G6pd enzyme inhibitor and method for treating obesity using the same
KR20140023344A (en) Antisense modulation of ptpib expression
Zhang et al. GRK4-mediated adiponectin receptor-1 phosphorylative desensitization as a novel mechanism of reduced renal sodium excretion in hypertension
JP6002152B2 (en) Inhibitors of branched chain aminotransferase 1 (BCAT1) for the treatment of brain tumors
Xu et al. MiR‐195 promotes pancreatic β‐cell dedifferentiation by targeting Mfn2 and impairing Pi3k/Akt signaling in type 2 diabetes
Gaddam et al. Genetic deletion of miR-204 improves glycemic control despite obesity in db/db mice
KR20110065568A (en) Treating hepatitis c virus infection with over-expression of microrna-196
KR20170122769A (en) Modulation of apolipoprotein C-III (ApoCIII) expression in lipodystrophic group
JP2008538355A (en) Compositions relating to acetyl-CoA carboxylase and their use
US10077446B2 (en) Glucan-encapsulated siRNA for treating type 2 diabetes mellitus
JP7158759B2 (en) A pharmaceutical composition for the prevention or treatment of muscle disease or cachexia, comprising as an active ingredient a miRNA located in the Dlk1-Dio3 cluster or a variant thereof
Ma et al. The hepatic ectonucleotide pyrophosphatase/phosphodiesterase 1 gene mRNA abundance is reduced by insulin and induced by dexamethasone
KR101928427B1 (en) Composition comprising microRNA-497 for preventing or treating of alcoholic liver diseases and method of screening thereof
JP5377358B2 (en) Enigma-Mdm2 interaction and its use

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 05721845

Country of ref document: EP

Kind code of ref document: A1