WO2006077012A2 - Utilisation de ligands lxr pour la modulation de cellules denditriques - Google Patents

Utilisation de ligands lxr pour la modulation de cellules denditriques Download PDF

Info

Publication number
WO2006077012A2
WO2006077012A2 PCT/EP2006/000043 EP2006000043W WO2006077012A2 WO 2006077012 A2 WO2006077012 A2 WO 2006077012A2 EP 2006000043 W EP2006000043 W EP 2006000043W WO 2006077012 A2 WO2006077012 A2 WO 2006077012A2
Authority
WO
WIPO (PCT)
Prior art keywords
cells
lxr
dendritic cell
dendritic
cell
Prior art date
Application number
PCT/EP2006/000043
Other languages
English (en)
Other versions
WO2006077012A3 (fr
Inventor
Carole Belanger
Raphaël Darteil
Dean Hum
Original Assignee
Genfit S.A.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Genfit S.A. filed Critical Genfit S.A.
Publication of WO2006077012A2 publication Critical patent/WO2006077012A2/fr
Publication of WO2006077012A3 publication Critical patent/WO2006077012A3/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K49/00—Preparations for testing in vivo
    • A61K49/0004—Screening or testing of compounds for diagnosis of disorders, assessment of conditions, e.g. renal clearance, gastric emptying, testing for diabetes, allergy, rheuma, pancreas functions
    • A61K49/0008—Screening agents using (non-human) animal models or transgenic animal models or chimeric hosts, e.g. Alzheimer disease animal model, transgenic model for heart failure
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00—Drugs for disorders of the respiratory system
    • A61P11/06—Antiasthmatics
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5044—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics involving specific cell types
    • G01N33/5047—Cells of the immune system

Definitions

  • DCs Dendritic Cells
  • LXR-ligands in particular LXR agonists, may be used to modulate in vitro and in vivo Dendritic Cell (DC) differentiation and/or maturation, and/or, asthmatic responses. Said responses may include the recruitment of inflammatory cells to the BAL (Broncho Alveolar Lavage) fluid, Th2-cytokine secretion, and/or, peribronchial and/or perivascular infiltration of inflammatory cells.
  • BAL Broncho Alveolar Lavage
  • the present invention relates to the use of LXR in methods for identifying compounds, in particular LXR agonists, which interfere (inhibit or prevent) with DC differentiation and/or maturation.
  • the present invention also relates to methods to identify LXR-mediated, DC-specific anti-inflammatory genes.
  • non-human mammalian animals may be used as in vivo model systems for identifying LXR binding compounds (in particular LXR agonists) inhibiting or preventing Th2-cytokine secretion, recruitment of inflammatory cells to the BAL fluid, and/or, peribronchial and/or perivascular infiltration of inflammatory cells.
  • LXR binding compounds in particular LXR agonists
  • the present invention also relates to the use of a non-human mammalian animals as an in vivo model for identifying compounds inhibiting T cell proliferation and/or Th2-cytokine release through the analysis of primary immune response or for identifying compounds inhibiting the recruitment of inflammatory cells to the BAL fluid, Th2-cytokine secretion, and/or, peribronchial and/or perivascular infiltration of inflammatory cells through the analysis of secondary immune response.
  • the present invention discloses the use of an LXR agonist to prepare a medicament for the treatment of diseases or disorders wherein the inhibition or the prevention of DC differentiation and/or maturation is aimed at or for the treatment of diseases associated with the recruitment of inflammatory cells to the BAL fluid, with Th2-cytokine secretion, and/or, with peribronchial and/or perivascular infiltration of inflammatory cells.
  • Said medicament may preferably be used to treat asthma, in particular allergy-induced asthma.
  • the present invention also relates to Dendritic Cell compositions or DC precursor compositions and to uses of these compositions to study the recruitment of inflammatory cells to the BAL fluid, Th2-cytokine secretion, and/or, peribronchial and/or perivascular infiltration of inflammatory cells in a model organism.
  • said model organism may be used to study asthma.
  • a major aim of the present invention is to find new agents to treat airway inflammation and/or asthma, in particular, allergy-induced asthma.
  • allergic asthma are infiltration of eosinophils into the bronchial wall and lumen, elevated serum IgE levels, mucus production in the airway and airway hyperresponsiveness.
  • inflammatory cells such as eosinophils, mast cells, T cells, CD4+ T cells, macrophages, and Dendritic Cells
  • inflammatory mediators and enzymes such as cysteinyl-leukotrienes, histamine, prostaglandins, kinins, IL-4, IL-5, IL-13, adenosine A1 receptor, mast cell tryptase and phosphodiesterase.
  • Corticosteroids are commonly used as anti-inflammatory agents in asthma. However, the long-term use of corticosteroids can produce serious side effects such as glaucoma, cataracts, osteoporosis, growth retardation in children and adolescents and decreased functioning of the adrenal gland.
  • New asthma targets include leukotriene antagonists (however, not as effective as corticosteroids), monoclonal antibodies that specifically recognize IgE, cytokine or cytokine receptor modulators such as soluble IL- 4 receptor, chemokine or chemokine receptor modulators, inhibitors of PDE4, adenosine receptors, adhesion molecules, Th2-specific transcription factors and genes involved in airway remodeling.
  • LXRs also named Liver X Receptors
  • LXRs were first identified as orphan receptors of the nuclear receptor superfamily.
  • Two LXR proteins ( ⁇ and ⁇ ) are known to exist in mammals.
  • the expression of LXR ⁇ is restricted, with highest levels in the liver (hence, the name Liver X Receptor) and lower but significant levels in kidney, intestine, spleen and adrenals.
  • LXR ⁇ expression is ubiquitous and has been found in nearly every tissue examined. Later on, LXR was shown to be activated by a specific class of naturally occurring, oxidized derivatives of cholesterol, including 22(R)- hydroxylcholesterol, 24(S)-hydroxycholesterol and 24(S),25(S)-epoxycholesterol. These oxysterols are concentrated in tissues where cholesterol metabolism and LXR expression are high, such as liver, brain and placenta.
  • the compounds T0901317 (Schultz et al. (2000) Genes&Dev. Nov 15; 14(22): 2831-8) and GW3965 (Collins et al. (2002) J.Med.Chem. May 9; 45(10):1963- 6) were shown to be LXR selective agonists.
  • LXR function is an essential regulatory component of cholesterol homeostasis. It was suggested that LXR agonists may be used as protective agents against atherosclerosis due to their coordinated effects on cholesterol synthesis, dietary cholesterol absorption, reverse cholesterol transport and bile acid synthesis and excretion.
  • WO 03/059884 relates to heterocyclic compounds, compositions and methods for modulating the activity of nuclear receptors, including LXR.
  • LXR binding compounds for instance on p.16, 1.7-21.
  • One of said uses is the treatment of inflammation.
  • said application only provides a hypothetical example of an in vivo study to test the effect of said compounds on plasma cholesterol and triglycerides levels (example 74, p.345- 346).
  • WO 03/106435 relates to new compounds modulating LXR function suggesting their role as anti-sclerotic and anti-inflammatory agent. Also in this application no focus is set on a specific use of said compounds.
  • diseases which may be treated using the compounds of the invention such as aterosclerosis (and atherosclerosis), lipid-related diseases, inflammatory diseases, cardiovascular diseases, renal diseases, diabetes, cancer and Alhzheimer's disease (for instance on p.8, 1.24 to p.9, 1.1).
  • the term "inflammatory diseases” is broadly defined as “diseases mediated by inflammatory cytokines" (I.32-33 of said paragraph).
  • LXR activators were found to stimulate epidermal differentiation and development, improve permeability barrier homeostasis and inhibit epidermal proliferation. Keratinocytes generate the primary cytokines TNF- ⁇ and IL-1 in response to a variety of forms of cutaneous injury.
  • LXR agonists reduce inflammation in a model of contact dermatitis and inhibit inflammatory gene expression in aortas of atherosclerotic mice. They identified LXR as lipid dependent regulators of inflammatory gene expression that may serve to link lipid metabolism and immune function in macrophages.
  • MMPs Matrix MetalloProteinases
  • LXR agonists GW3965 or T0901317 specifically inhibit MMP-9 expression in macrophages at least in part through antagonism of the NFKB signalling pathway. They suggested the impact of both LXRs, LXR ⁇ and LXR ⁇ , on macrophage inflammatory responses.
  • the present invention relies on the unexpected finding that LXRs are present on Dendritic Cells (DCs) and exert an unexpected function in said cells.
  • said receptors and the DCs carrying said receptors may be used to develop methods, assays and kits to screen compounds, in particular LXR binding compounds, which interfere with (inhibit or prevents) Dendritic Cell differentiation and/or maturation.
  • the present invention also points to the importance of the identification of LXR- mediated, DC specific anti-inflammatory target genes. Methods for said modulation and identification are described below.
  • One of the aims of the present invention is to find new compounds which may be used to prepare medicaments for the treatment of diseases or disorders wherein a decrease of DCs activity/functionality, and/or, a decrease of recruitment of inflammatory cells to the BAL fluid, Th2-cytokine secretion, and/or, peribronchial and/or perivascular infiltration of inflammatory cells is aspired.
  • the decrease in DC activity or functionality may be the result from a decrease of the differentiation and/or maturation of DC-precursors into fully mature and functional DCs.
  • the disease which is in particular aimed at to be treated, is airway inflammation and/or asthma, i.e. allergy-induced asthma.
  • non-human mammalian animals may be used as in vivo model systems for identifying LXR binding compounds (in particular LXR agonists) inhibiting or preventing Th2-cytokine secretion, recruitment of inflammatory cells to the BAL fluid, and/or, peribronchial and/or perivascular infiltration of inflammatory cells.
  • LXR binding compounds in particular LXR agonists
  • the present invention also relates to the use of a non-human mammalian animals as an in vivo model for identifying compounds inhibiting T cell proliferation and/or Th2-cytokine release through the analysis of primary immune response or for identifying compounds inhibiting the recruitment of inflammatory cells to the BAL fluid, Th2-cytokine secretion, and/or, peribronchial and/or perivascular infiltration of inflammatory cells through the analysis of secondary immune response.
  • the present invention discloses the use of an LXR agonist to prepare a medicament for the treatment of diseases or disorders wherein the inhibition or the prevention of DC differentiation and/or maturation is aimed at and for the treatment of diseases associated with the recruitment of inflammatory cells to the BAL fluid, with
  • Th2-cytokine secretion and/or with peribronchial and/or perivascular infiltration of inflammatory cells may be used preferably to treat asthma, in particular allergy-induced asthma.
  • the present invention also relates to Dendritic Cell compositions or DC precursor compositions wherein said DCs or precursors thereof have been treated in vitro with an LXR ligand and to uses of these compositions to study the recruitment of inflammatory cells to the BAL fluid, Th2-cytokine secretion, and/or, peribronchial and/or perivascular infiltration of inflammatory cells, preferably to study asthma.
  • the present invention also relates to methods to modulate DCs in vitro.
  • Dendritic Cells are highly specialized antigen-presenting cells of the immune system. In particular, Dendritic Cells are the only antigen-presenting cells that can activate na ⁇ ve T cell and are therefore critical for the initiation of primary immune responses. Moreover, several studies have reported increased numbers of Dendritic Cells in the airways of allergic asthmatic subjects, suggesting that Dendritic Cells play a key role in asthma pathogenesis. With the term "Th2-cytokine” is meant a cytokine produced typical for the Th2 response; examples of Th2-type cytokines are IL-4, IL-5, IL-6, IL-9, IL10 and IL-13.
  • Predominant cytokines produced in a Th1-type response are IFN- ⁇ , TNF- ⁇ , IL-2 or lymphotoxin (LT).
  • LT lymphotoxin
  • the present inventors found that cell-surface expression of CD 1a, which is not expressed in macrophages but is specific to Dendritic Cells, is highly reduced by LXR ligand. Moreover, the present invention shows that the genes CCR7 and ELC are regulated by LXR ligands. Such finding was not reported in studies with macrophages. The regulation of CCR7 and ELC in DCs indicates that LXR ligand can interfere with DC migration to lymphoid organs (see below). Therefore, based on the prior art a skilled person would not derive that LXR is present on DCs and would be able to interfere with DC functions.
  • the present invention relates to a method for identifying a compound which interferes with (inhibits or prevents) Dendritic Cell (DC) differentiation and/or maturation comprising the steps of: . a) stimulating in vitro differentiation of Dendritic Cell precursors to Dendritic Cells and/or Dendritic Cell maturation, b) adding during, before or after step a), to said Dendritic Cells or Dendritic Cell precursors an LXR agonist stimulating said receptor, c) measuring the influence of said LXR agonist on the differentiation and/or maturation of said Dendritic Cell precursors or Dendritic Cells, d) optionally, repeating step a) to c) wherein, instead of LXR agonist, a reference compound known to inhibit said differentiation and/or maturation is added during, before or after step a), and measuring the influence of said reference compound on the differentiation and/or maturation of said Dendritic Cell precursors or Dendritic Cells and comparing these
  • LXR also named “Liver X Receptor” or “Lipid X Receptor”
  • LXR the receptor as represented by the GenBank Accession No. NM_005693 (human LXR ⁇ ) or by GenBank Accession No. NM_007121 (human LXR ⁇ ) .
  • said LXR may have an origin other than human such as the receptors represented by NM_013839 (murine LXR ⁇ ), NM_009473 (murine LXR ⁇ ), NM_031627 (rat LXR ⁇ ), NM_031626 (rat LXR ⁇ ) and NM_204542 (chicken LXR ⁇ ).
  • said receptor may be a variant thereof, carrying similar binding and/or signaling properties compared to the wild type receptor.
  • the cells used in the method of the present invention carrying said receptors may thus be of different origin such as human, monkey, mouse, rat, hamster, etc.
  • Dendritic Cell precursors such as monocytes, CD34+ hematopoietic progenitor cells or IL-3R plasmacytoid cells - see below
  • inflammatory mediators the type of inflammatory agents that can be used will be further discussed in details. It is known that each of said stages in which said cells may reside is complex and comprises of different sub-stages. For Dendritic Cells, all of these sub-stages have not been identified yet.
  • Dendritic Cells express high levels of CD 1a (key marker of Dendritic Cells) and have a high capacity to capture and process antigens while mature Dendritic Cells show a reduced expression of CD1a, have a reduced phagocytic activity, but express high levels of co- stimulatory molecules such as CD80 and CD86 and have a high capacity to stimulate T cells.
  • CD 1a key marker of Dendritic Cells
  • CD80 and CD86 express high levels of co- stimulatory molecules
  • co- stimulatory molecules such as CD80 and CD86 and have a high capacity to stimulate T cells.
  • the compound which may interfere with the Dendritic Cell differentiation and/or maturation through the LXR, may be of any origin.
  • said compound may be a small organic molecule from libraries of chemical compounds or collections of such molecules.
  • said compound may be present in samples or extracts from natural sources, e.g., plant, fungal or bacterial extracts or even in human tissue samples.
  • all LXR agonists may interfere with DC differentiation and maturation; however the degree of interference (0% to 100%) depends on the property of the agonist.
  • the activity of the LXR agonist may be divided in two major activities: a transactivation and a transrepression activity. Both activities may be full, partial or negligible.
  • Transactivation activity means the possibility to activate promoters bearing LXR response elements (LXREs), via the binding of liganded-LXR and coactivators at said elements.
  • LXREs LXR response elements
  • Transrepression activity means the possibility to inhibit or interfere with the transactivation function of certain transcription factors (known examples are interference with NF- ⁇ B or AP-1 transcription factors).
  • LXR agonists of the present invention carry a dominant transrepression activity over their transactivation activity.
  • an agonist with a higher transrepression activity compared to its transactivation activity will probably result in a better interference of DC differentiation and/or maturation.
  • an LXR ligand with weaker transactivation capacity will not lead to the undesirable effect linked to transactivation of SREBP-Ic which promotes hypertriglyceridemia [Repa (2000) Genes&Dev. 14:2819-2830; Yoshikawa (2001) MoI. Cell. Biol. 21:2991-3000].
  • said LXR agonist carry preferably dominant (i.e. equal or more than 70%) transrepression activity (99, 95, 90, 85, 80, 75 or 70%), more preferably full (100%) transrepression activity, and no or negligible/minor (i.e. equal or less than 30%) transactivation activity (0, 1 , 5, 10, 20, 25 or 30%).
  • the LXR agonist may also carry 70% to 30% of trans-repression activity (70, 65, 60, 55, 50, 45, 40, 35 or 30%) and 30% to 70% of transactivation activity (30, 35, 40, 45, 50, 55, 60, 65 or 70%).
  • the present invention also points to the fact that the choice of an LXR agonist, to achieve transactivation or transrepression, may not only be defined by the property of the ligand itself, but it may also be influenced by the environment created in the cell.
  • T0901317, GW3965 or a functional equivalent i.e. a molecule that can bind specifically to the Ligand Binding Domain (LBD) of LXR and transactivates or transrepresses specific target genes
  • LBD Ligand Binding Domain
  • a combination thereof may be used as reference compound used in step d) of the above-described method.
  • LXR agonists T0901317 and GW3965 share similar properties in terms of interfering with DC function in vitro and in trans-activating promoters containing LXR response elements.
  • T0901317 or GW3965 may also be the LXR agonist of step b) of the above mentioned method.
  • the LXR agonist of step b) or the reference compound of step d) according to the present invention is T0901317 or GW3965 or a functional equivalent or a combination thereof.
  • Dendritic Cells or Dendritic Cell precursors of which the differentiation and/or maturation is studied may be of myeloid, lymphoid or plasmacytoid origin.
  • lymphoid stem cell differentiates along one or two pathways, giving rise to either a lymphoid stem cell or a myeloid stem cell.
  • the types and amounts of growth factors present in the microenvironment in which a particular stem cell resides control its differentiation. Both types of lymphoid and myeloid progenitor cells may generate Dendritric Cells (respectively of lymphoid or myeloid origin).
  • the lymphoid progenitor or precursor which is the terminology used for mice, is referred to as a plasmacytoid progenitor or precursor in human.
  • differentiated DCs can be directly isolated from blood using BDCA-1 or BDCA-3 (myeloid specific) or BDCA-2 and BDCA-4 (plasmacytoid specific) antibodies [Dzionek (2000) J.Immunol. 165:6037-6046]. Therefore, Dendritic Cells used in the method of the present invention may be directly isolated from (peripheral or cord) blood. Human DCs can differentiate in vitro from CD34+ hematopoietic progenitor cells of the cord blood, the bone marrow, peripheral blood [Caux (1992) Nature 360:258-61; Szabolcs (1995) J. Immunol.
  • the Dendritic Cell precursor used in the method of the present invention may be isolated from peripheral blood, cord blood, bone marrow, thymus or lymphoid tissues.
  • the Dendritic Cell precursor used in the method of the present invention may be a monocyte, a CD34+ hematopoietic progenitor cell or an IL-3 plasmacytoid cell.
  • said DCs differentiate from monocytes.
  • Murine myeloid DCs may commonly be obtained from bone marrow progenitor cells. Methods to isolate Dendritic Cells or Dendritic Cell precursors are known by a skilled person in the art. Differentiated murine bone marrow-derived DCs may be further treated with ovalbumine (OVA) before intratracheal injection in mice (see below). When using human DCs, said OVA treatment is not essential.
  • OVA ovalbumine
  • Monocyte-derived DCs are most commonly used to assess DC phenotype and function.
  • a general protocol includes a first isolation of Peripheral Blood Mononuclear Cells (PBMCs) on Ficoll Gradient followed by a purification of monocytes by adherence [Bender (1996) J.lmmunol.Meth. 196:121-35] or by using CD14-antibody coated beads (Miltenyi Biotec) [Pickl (1996) J.Immunol. 157:3850-3859].
  • the purified monocytes are then cultured in presence of GM-CSF and IL-4 for a period of 5 to 7 days to generate immature Dendritic Cells.
  • the stimulation of immature Dendritic Cells and the stimulation of the differentiation of Dendritic Cell precursors to Dendritic Cells in step a) may be achieved by treating with allergens (ex. der p 1 , der p 2, bet Via, ovalbumine, etc.), inflammatory cytokines (ex. TNF ⁇ , IL-1 ⁇ , etc.), CD40L (also called CD154, is a co-stimulatory membrane protein belonging to the TNF superfamily), bacterial products (ex. LPS or LipoPolySaccharide), pathogens such as Escherichia coli, Candida, viruses (ex. Influenza, measles and dengue viruses, HIV, etc.) or other agents known in the art.
  • allergens ex. der p 1 , der p 2, bet Via, ovalbumine, etc.
  • inflammatory cytokines ex. TNF ⁇ , IL-1 ⁇ , etc.
  • CD40L also called CD154, is a co-stimulatory membrane protein belonging to the
  • Dendritic Cell precursor differentiation to Dendritic Cells may be measured through the analysis of cell surface expression of CD1a, CD11c, CD40, HLA-DR, transcription of CD40 and/or MMP9 and/or other differentiation markers known in the art.
  • Maturation of Dendritic Cells may be measured through the analysis of LPS- inducible (or other maturation agents described above) expression of cell surface markers CD83, CD86, CD80, HLA-DR and/or through the analysis of the transcription of chemokines IP-10, ELC (EBV-induced molecule 1 Ligand Chemokine), TARC (Thymus and Activation Regulated Chemokine), MCP-1 (Monocyte Chemoattractant Protein-1 ), RANTES (Regulated upon Activation, Normally T-Expressed and presumably Secreted), chemokine receptor CCR7 and/or other maturation markers known in the art.
  • the expression of said specific marker genes for DC maturation or DC precursor differentiation may be analyzed via quantitative RT-PCR analysis or by FACS (Fluorescence-Activated Cell Sorting) analysis.
  • the expression of internal control genes may also be studied in parallel to correct for experimental deviations. Changes of at least 10 %, including 15%, 20% and more, preferably 30%, in expression of said gene(s) in the presence of said agent compared to the expression level in said DCs in the absence of said agent, or compared to said expression level in said DCs in the presence of a reference compound are interpreted as an indication for the interference of said agent on DC precursor differentiation and/or DC maturation.
  • DC precursor differentiation or DC maturation may be measured through any method known in the art for the analysis of T cell immune response triggered by Dendritic cells.
  • the present invention particularly suggests to measure said T cell immune response in a heterologous MLR (Mixed Leukocyte Reaction) assay thereby incubating Dendritic Cells from one donor with allogeneic na ⁇ ve CD4+ T cells isolated from a second donor and measuring T cell proliferation, preferably by BrdU (Bromodeoxyuridine) incorporation and alternatively by tritiated thymidine incorporation [Messele (2000) Clin.Diagn.Lab.lmmunol. 7: 687-692].
  • the T cell immune response is measured, this is preferentially performed in a heterologous MLR assay thereby incubating Dendritic Cells with allogeneic T cells and measuring T cell proliferation.
  • the screening methods provided by the present invention may be amenable to high throughput assays.
  • a microarray system may be used.
  • An agent that modulates the function of LXR is a molecule or a compound that increases or decreases LXR activity, including compounds that change the binding of reference compounds and compounds that change LXR downstream signaling activities, i.e through the modulation of the interaction of LXR with secondary molecules.
  • the ability to reconstitute LXR/LXR-ligand binding either in vitro, on cultured cells or in vivo provides a tool for the identification of agents that disrupt said binding.
  • Assays based on disruption of said binding can identify agents, such as small organic molecules, from libraries or collections of such molecules.
  • such assays can identify agents in samples or extracts from natural sources, e.g., plant, fungal or bacterial extracts or even in human tissue samples.
  • the extracts can be made from a library of chemical compounds, including, for example, T0901317 or GW3965, variants thereof, or other LXR ligands known in the prior art and derivatives or a combination thereof.
  • Standard physiological, pharmacological and biochemical procedures are available for testing and identifying compounds that can modulate the activity of nuclear receptors, including LXR.
  • assays include, for example, biochemical assays such as binding assays, fluorescence polarization assays, FRET-based coactivator recruitment assays (for a general description see Glickman et al. (2002) J. Biomol. Screen.
  • LXR expression plasmids with or without LXR coactivators
  • LXREs luciferase reporter plasmids bearing LXR response elements
  • one-hybrid GAL4 assay to identify compounds that can activate a reporter plasmid containing GAL4 response element through binding of a GAL4-LXR (LBD or Ligand Binding Domain) chimera
  • protein-protein interaction assays such as the mammalian two-hybrid assay (Lehmann et al. (1997) J. Biol.Chem. 272:3137-3140).
  • High Throughput Screening systems are commercially available (see, e.g. Zymark Corp., Hopkinton, MA; Air Technical Industries, Mentor, OH; Beckman Instruments Inc., Fullerton, CA; Precision Systems Inc., Natick, MA) which enable these assays to be run in a high throughput mode. These systems automate the entire procedure, including all sample and reagent pipetting, liquid dispensing timed incubations and final readings of the microplate in detector(s) appropriate for the assay. These configurable systems provide high throughput and rapid start up as well as a high degree of flexibility and customization. The manufacturers of such systems provide detailed protocols for various high throughput systems. Thus, for example, Zymark Corp.
  • Such assays are generally performed using either the full length receptor or isolated Ligand Binding Domain (LBD) (to facilitate the purification procedure and the proteins can be tagged for example with histidine residues or GST (Glutathione-S-transferase)).
  • LXR Ligand Binding Domain
  • said Ligand Binding Domains may comprise amino acids 264 to 447 (LXRq) or 278 to 461 (LXR ⁇ ) of the full length sequence.
  • fluorescence polarization assays provide a way of detecting binding of compounds to the nuclear receptor of interest by measuring changes in fluorescence polarization that occurs as a result of the displacement of a trace amount of the label ligand by the compound. Additionally this approach can also be used to monitor the ligand dependent association of a fluorescently labeled coactivator peptide to the nuclear receptor of interest to detect ligand binding to the nuclear receptor of interest.
  • LXR functions as a heterodimer with the Retinoid X Receptor (RXR) to regulate gene expression [Willy (1997) Genes&Dev. 11:289-298; Lehmann (1997) J. Biol.Chem. 272:3137-3140].
  • RXR Retinoid X Receptor
  • the LXR/RXR heterodimer can be activated by ligands of both RXR and LXR, either separately or in synergy [Janowski (1996) Nature 383:728-31].
  • LXR ⁇ was also shown to function as a monomer on cAMP-responsive transcriptional regulation of a number of genes, including renin and c-myc [Tamura (2000) PNAS 97:8513-8518; Anderson (2003) J.Biol.Chem. 278: 15252-15260].
  • a number of screening assays to identify compounds that interact with LXR ⁇ , LXR ⁇ , or the heterodimeric forms have been described in the literature and some of these assays will be discussed below.
  • the binding of a potential ligand to the LBD domain of LXR can be measured in a Scintillation Proximity Assay (SPA) by assessing the degree to which a compound can compete off a radiolabeled ligand with known affinity for the receptor.
  • SPA Scintillation Proximity Assay
  • Such assay was used to determine that naturally occuring oxysterols can bind directly to LXR at concentrations that occur in vivo [Janowski (1999) PNAS 96:266-271].
  • the radioactivity emitted by a radiolabeled compound generates an optical signal when it is brought into close proximity to a scintillant such as a Ysi-copper containing bead, to which the nuclear receptor is bound.
  • the radiolabeled compound is displaced from the nuclear receptor, the amount of light emitted from the nuclear receptor bound scintillant decreases and this can be readily detected using standard microplate liquid scintillation plate readers such as, for example, a Wallac MicroBeta reader.
  • LXR ⁇ or LXR ⁇ can also be measured by Fluorescence Resonance Energy Transfer (FRET) or time resolved FRET [Zhou (1998) MoI. Endocrinol. 12:1594-604].
  • FRET Fluorescence Resonance Energy Transfer
  • time resolved FRET time resolved FRET
  • LXR coactivators have more affinity with LXR ligands with good transrepression activity (ex. GW3965).
  • LXR coactivators have been described such as SRC-1 , RIP140, TRAP220, SRC-3/ACTR [Kaneko (2003) J.Biol.Chem. 278:36091-36098], Asc-2 [Kim (2003) Mol.Cell.Biol. 23:3583-92], PGC-1 [Oberkofler (2004) Biochem.J. 381:357-63], GRIP-1 [Svensson (2003) EMBO J.
  • LXR was also shown to interact with the co-repressors N-COR and SMRT [Hu (2003) Mol.Endocrinol. 17:1019-1026; Wagner (2003) Mol.Cell.Biol. 23:5780-5789]. Moreover, the LXR-corepressor interaction is isoform-specific, wherein LXR ⁇ has a very strong interaction while LXR ⁇ only shows weak interaction [Hu (2003) MoI. Endocrinol. 17:1019-1026].
  • This assay can be exploited to measure the ligand dependent interaction of a secondary molecule with LXR in order to characterize the agonist or antagonist activity of compounds.
  • the assay in this case involves the use a recombinant Glutathione-S-transferase (GST)-nuclear receptor Ligand Binding Domain (LBD) fusion protein and a synthetic biotinylated peptide sequenced derived from the receptor interacting domain of a secondary molecule.
  • GST-LBD is labeled with a europium chelate (donor) via a europium-tagged anti-GST antibody
  • the secondary molecule is labeled with allophycocyanin via a streptavidin-biotin linkage.
  • the fluorescently labeled GST-LXR (LBD) and fluorescently labeled coactivator are mixed together and allowed to equilibrate for at least 1 hour prior to addition to either variable or constant concentrations of the sample for which the affinity is to be determined. After equilibration, the time-resolved fluorescent signal is quantitated using a fluorescent plate reader. The affinity of the compound can then be estimated from a plot of fluorescence versus concentration of compound added. In the presence of an agonist for LXR, the peptide is recruited to the GST-LBD bringing europium and allophycocyanin into close proximity to enable energy transfer from the europium chelate to the allophycocyanin.
  • excitation energy absorbed by the europium chelate is transmitted to the allophycocyanin moiety resulting in emission at 665 nm. If the europium chelate is not brought in to close proximity to the allophycocyanin moiety, there is little or no energy transfer and excitation of the europium chelate results in emission at 615 nm. Thus the intensity of light emitted at 665 nm gives an indication of the strength of the protein-protein interaction.
  • the activity of a nuclear receptor antagonist can be measured by determining the ability of a compound to competitively inhibit (ie., IC50) the activity of an agonist for the nuclear receptor.
  • cell-based assay methodologies may be successfully used in screening assays to identify and profile the specificity of compounds of the present invention. These approaches include the co-transfection assay, translocation assays, complementation assays and the use of gene activation technologies to overexpress endogenous LXR.
  • co-transfection assays using full-length LXR co-transfection assays using chimeric LXR comprising the Ligand Binding Domain (LBD) of the nuclear receptor of interest fused to a heterologous DNA Binding Domain (DBD), assays based around the use of the mammalian two hybrid assay system and assays based around the use of the mammalian one hybrid assay system.
  • LBD Ligand Binding Domain
  • DBD heterologous DNA Binding Domain
  • LXR/RXR heterodimer binds to response elements termed LXREs, that are characterized by two direct hexameric repeats separated by four nucleotides (DR4 element) [Willy (1995) Genes&Dev. 9:1033-1045].
  • LXR functions as a heterodimer with RXR 1
  • the co-transfection assay can include the use of expression plasmids for both LXR and RXR, or functional binding domains thereof.
  • Co-transfection assays require access to the full length LXR and suitable response elements that provide sufficient screening sensitivity and specificity to LXR.
  • Genes encoding the following full-length proteins, which are suitable for use in the co- transfection studies and profiling the compounds described herein, include human RXR ⁇ (GenBank Accession No.
  • Reporter plasmids may be constructed using standard molecular biological techniques by placing nucleic acids (cDNA) encoding for the reporter gene downstream from a suitable minimal promoter.
  • luciferase reporter plasmids may be constructed by placing cDNA encoding firefly luciferase immediately down stream from the herpes virus thymidine kinase promoter (located at nucleotides residues-105 to +51 of the thymidine kinase nucleotide sequence) which is linked in turn to the LXR response elements.
  • thymidine kinase promoter located at nucleotides residues-105 to +51 of the thymidine kinase nucleotide sequence
  • Numerous methods of co-transfecting the expression and reporter plasmids are known to those of skill in the art and may be used for the co-transfection assay to introduce the plasmids into a suitable cell type.
  • the selected cell type will not endogenously express nuclear receptors that interact with the response elements used in the reporter plasmid.
  • LXR ⁇ which is ubiquitously expressed in all cell types.
  • LXR ⁇ is expressed in a more restricted manner.
  • LXR coactivators which play a key role in transactivation processes, is also taken into account for the selection of a cell line.
  • Numerous reporter gene systems are known in the art and include, for example, alkaline phosphatase (see Berger J. et al. (1988) Gene 66:1-10; Kain, S. R. (1997) Methods. MoI. Biol 63:49-60), ⁇ -galactosidase (See, U. S. Patent No. 5,070, 012, issued Dec, 3,1991 to Nolan et al., and Bronstein I.
  • chimeras comprising the Ligand Binding Domain (LBD) of LXR to a heterologous DNA Binding Domain (DBD) expands the versatility of cell-based assays by directing activation of LXR to defined DNA binding elements recognized by defined DNA Binding Domain (see WO 95/18380).
  • This assay expands the utility of cell-based co-transfection assays in cases where the biological response or screening window using the native DNA Binding Domain is not satisfactory.
  • the methodology is similar to that used with the basic co-transfection assay, except that a chimeric construct is used in place of the full length LXR.
  • LXR DNA Binding Domains from defined nuclear receptors, or from yeast or bacterially derived transcriptional regulators such as members of the GAL 4 and Lex A /Umud super families are used.
  • a third cell-based assay of utility for screening LXR agonists is a mammalian two-hybrid assay that measures the ability of the LXR to interact with a cofactor in the presence of a ligand.
  • the basic approach is to create three plasmid constructs that enable the interaction of the nuclear receptor with the interacting protein to be coupled to a transcriptional readout within a living cell.
  • the first construct is an expression plasmid encoding a fusion protein comprising the interacting protein, or a portion of that protein containing the interacting domain, fused to a GAL4 DNA Binding Domain.
  • the second expression plasmid comprises DNA encoding the LXR fused to a strong transcription activation domain such as VP16
  • the third construct comprises the reporter plasmid comprising a reporter gene with a minimal promoter and GAL4 upstream activating sequences.
  • the GAL4 DNA Dinding Domain encoded in the first construct allows for specific binding of the fusion protein to GAL4 sites upstream of a minimal promoter.
  • the GAL4 DNA Binding Domain typically has no strong transcriptional activation properties in isolation, expression of the reporter gene occurs only at a low level.
  • the LXR-VP16 fusion protein can bind to the GAL4-interacting protein fusion protein bringing the strong transcriptional activator VP16 in close proximity to the GAL4 binding sites and minimal promoter region of the reporter gene. This interaction significantly enhances the transcription of the reporter gene, which can be measured for various reporter genes as described above. Transcription of the reporter gene is thus driven by the interaction of the interacting protein and nuclear receptor of interest in a ligand dependent fashion.
  • a fourth, and preferred, cell-based assay for screening LXR agonists is the mammalian one hybrid assay that measures the activity of LXR.
  • This assay can be used to screen for agonists or antagonists.
  • an expression vector containing LBD (Ligand Binding Domain) of LXR fused to the DBD (DNA Binding Domain) of GAL4 may be generated.
  • LBD Ligand Binding Domain
  • DBD DNA Binding Domain
  • GAL4 DNA Binding Domain
  • a reporter plasmid multiple copies of the GAL4 response element are inserted upstream of a minimal TK promoter linked to a reporter gene.
  • These two constructs are transfected together in a relevant cell line expressing (known) LXR secondary molecules (co-activators or co-repressors described above).
  • the measure of the luciferase activity is correlated with the amount of ligand added.
  • Any compound which is a candidate for activation of LXR may be tested by these methods. Generally, compounds are tested at several different concentrations to optimize the chances that activation of the receptor will be detected and recognized if present. As well, dose-response curves can be made to measure and compare the relative affinity of a given ligand and the maximal effect produced by each ligand. Typically assays are performed in triplicate and vary within experimental error by less than 15%. Each experiment can be repeated three or more times with similar results.
  • Activity of the reporter gene can be conveniently normalized to the internal control and the data plotted as fold activation relative to untreated cells.
  • a positive control compound (agonist) can be included alone with any aqueous or organic solvent
  • antagonist activity can be measured by determining the ability of a compound to competitively inhibit the activity of an agonist.
  • said LXR agonist can be identified using a binding assay and/or a signal transduction assay specific for said receptor.
  • a preferable example of a binding assay used in the method of the present invention is a one-hybrid GAL4 assay.
  • a signal transduction assay specific for said receptor can be set up in order to identify the LXR agonist or to confirm if an LXR binding compound is an LXR agonist.
  • said signal transduction assay is preferentially secondary, following the above-proposed binding assay.
  • An example of such a signal transduction assay may be a FRET assay.
  • the LXR agonist, or compositions thereof can be evaluated for their ability to increase or decrease the expression of target genes modulated by LXR in vivo (see below). This can be studied using Northern-blot, RT-PCR or oligonucleotide microarray analysis to measure RNA levels. Western-blot analysis can be used to measure expression of proteins encoded by LXR target genes. Genes that are known to be activated by LXR include ABCA1 [Costet (2000) J.Biol.Chem. 275:28240-28245], ABCG1 , ABCG5, ABCG-8 [Repa (2002) J.Biol.Chem. 277:18793- 18800], FAS [Joseph (2002) J.Biol.Chem.
  • LXR ligands were shown to inhibit the expression of inflammatory mediators such as inducible Nitric Oxide Synthases (NOS), CycloOXygenase 2 (COX-2), IL-6, and MMP9 in response to LPS (Lipo Poly Saccharide) stimulation [Joseph (2003) Nat.Med. 9:213-9 ; Castrillo (2003) J.Biol. Chem. 278:10443-10449].
  • NOS Nitric Oxide Synthases
  • COX-2 CycloOXygenase 2
  • IL-6 interleukin-6
  • MMP9 Lipo Poly Saccharide
  • the inventors of the present invention show that LXR ligands inhibit expression of CCR7, ELC, IP-10, CD83 and CD86.
  • ECL and CCR7 have a crucial role in the migration of DCs to lymphoid organs, said genes are considered as important marker genes to measure the maturation of DCs.
  • a glucocorticoid receptor (GR) ligand with good trans-repressing activity has been recently reported [Coghlan (2003) Mol.Endocinol. 17:860-869].
  • This compound (AL-438) confers a full anti-inflammatory activity comparable to other steroids but has a reduced transactivation effect on genes involved on bone and glucose metabolism. Therefore, this compound may serve as a prototype to treat inflammatory diseases without having the detrimental side effects often associated with transactivation processes. Such compound with a dissociated transrepressing activity has not been described yet for LXR.
  • Changes of at least 15% or more, preferably 30%, in DC precursor differentiation and/or DCs maturation through the presence of said agent compared to the DC precursor differentiation and/or DCs maturation in the absence of said agent or compared to said DC precursor differentiation and/or DC maturation in the presence of a reference compound may identify an LXR agonist interfering with the DC precursor differentiation and/or DCs maturation through LXR.
  • changes in said differentiation and/or maturation may also go from 30% to 40, 50, 60, 70, 80, 90, up to 100%.
  • the reference condition can be set as 100.
  • the present invention elaborates on a method to identify LXR mediated, Dendritic Cell specific, anti-inflammatory target genes.
  • said method may comprise the steps of: a) stimulating in vitro the differentiation of Dendritic Cell precursor to Dendritic Cells and/or the Dendritic Cell maturation, b) adding during, before or after step a) to said Dendritic Cells or Dendritic Cell precursors an LXR agonist stimulating said receptor, c) analyzing the influence (positive or negative) of said LXR agonist on the expression of secondary genes (target genes), by comparing the expression of the same genes in Dendritic Cell precursors or Dendritic Cells which were not treated by the LXR agonist, d) optionally repeating steps a) to c) wherein, instead of LXR agonist, a reference compound known to induce said differentiation and/or maturation is added during, before or after step a), e) optionally, comparing the results of steps c) and d), f) identifying an LXR mediated target gene, wherein the expression of said target gene is down- or up-regulated
  • LXR ligands The effect of LXR ligands on cholesterol and fatty acid metabolism occurs via a transactivation mechanism on promoters bearing LXR response elements (LXREs).
  • LXREs LXR response elements
  • the present invention suggests that the mechanism by which LXR ligand conferring anti-inflammatory activity occurs through a transrepression mechanism.
  • the present invention suggests that, for the treatment of diseases or disorders influenced by Dendritic Cell (DC) differentiation and/or maturation, the recruitment of inflammatory cells to the BAL fluid, Th2-cytokine secretion, and/or, peribronchial and/or perivascular infiltration of inflammatory cells, LXR ligands may be used preferably, that show better trans-repression than trans-activation capacities.
  • DC Dendritic Cell
  • the present invention also relates to the treatment of airway inflammation and/or asthma.
  • the ligands T0901317 and GW3965 are good trans-activators, however, a higher dose is needed for the trans-repression.
  • a specific trans- repression screening assay needs to be developed to find molecules with a high trans- repressive activity.
  • genes which are down-regulated by LXR include CD1a, CDHc 1 HLA-DR, ELC, CCR7, MMP-9, CD40 and CD80.
  • cell surface markers CD83, CD86, CD80, HLA-DR, chemokines ELC, IP-10, TARC, MCP-1, RANTES, chemokine receptor CCR7 can be considered as possible primary marker genes to measure the maturation of DCs. Emphasis may be given to genes that have a key role on DC migration and antigen presentation function.
  • Dendritic Cell or Dendritic Cell precursor studied can be of myeloid, lymphoid or plasmacytoid origin.
  • differentiated DCs can be directly isolated from blood, using BDCA-1 or BDCA-3 (myeloid specific) or BDCA-2 and BDCA-4 (plasmacytoid specific) antibodies [Dzionek (2000) J.Immunol. 165:6037-6046]. Therefore, Dendritic
  • Cells used in the methods of the present invention may be directly isolated from (peripheral or cord) blood.
  • Dendritic Cell precursors used can be a monocyte, a CD34+ hematopoietic progenitor cells of the cord blood, the adult bone marrow, peripheral blood or the thymus or an IL-3R plasmacytoid cells from blood or lymphoid tissues. Therefore, Dendritic Cell precursor used in the method of the present invention may be a monocyte, a CD34+ hematopoietic progenitor or an IL-3R plasmacytoid cell and may be isolated from peripheral blood, cord blood, bone marrow, thymus or lymphoid tissues. Preferably, said Denditic Cell differentiates from a monocyte. In addition, the stimulation of DC precursors differentiation to Dendritic Cells or
  • DC maturation in step a) can be achieved by treating with an agent chosen from the group consisting of allergens (ex. der p 1 , der p 2, bet Via, ovalbumine, etc.), inflammatory cytokines (ex. TNF ⁇ , IL-1 ⁇ , etc.), CD40L (also called CD154, is a co- stimulatory membrane protein belonging to the TNF superfamily), bacterial products (ex. LPS or Lipo Poly Saccharide), pathogens such as Escherichia coli, Candida, viruses (ex. Influenza, measles and dengue viruses, HIV, etc.) and other agents known in the art. Said different agents may be purified or not.
  • allergens ex. der p 1 , der p 2, bet Via, ovalbumine, etc.
  • inflammatory cytokines ex. TNF ⁇ , IL-1 ⁇ , etc.
  • CD40L also called CD154, is a co- stimulatory membrane protein belonging to the TNF superfamily
  • bacterial products ex. LPS or
  • the Dendritic Cell precursor differentiation to Dendritic Cells may be measured through the analysis of cell surface expression of CD1a, CD11c, CD40, HLA-DR, transcription of CD40 and/or MMP9 and/or other differentiation marker.
  • Maturation of Dendritic Cells may be measured through the analysis of the LPS (or other maturation agents) inducible expression of cell surface markers CD83, CD86, CD80, HLA-DR and/or through the analysis of the transcription of chemokines IP-10, ELC, MCP-1 , RANTES, TARC, chemokine receptor CCR7 and/or other maturation agent. Both expressions may be analyzed via quantitative RT-PCR analysis or by FACS analysis.
  • the function of Dendritic Cells may be measured though their capacity to trigger a T cell immune response.
  • the Dendritic Cell precursor differentiation or DCs maturation can be measured though the analysis of T cell immune response triggered by Dendritic Cells.
  • Said T cell immune response triggered by Dendritic Cells may be measured in a heterologous MLR assay thereby incubating Dendritic Cells with allogeneic T cells and measuring T cell proliferation.
  • said LXR agonist can be identified using a binding assay and/or a signal transduction assay specific for said receptor, said LXR agonist of step b) or said reference compound of step d) can be T0901317 or GW3965, or a functional equivalent, or a combination thereof and said influence of step c) can be analysed through the analysis of the expression of a large battery of genes via quantitative RT-PCR analysis.
  • said method may be a High Throughput Screening method.
  • Said High Throughput Screening method can be set up using a microarray system.
  • the present invention elaborates on the use of a non- human mammalian animal as an in vivo model for identifying compounds inhibiting Th2-cytokine secretion, recruitment of inflammatory cells such as macrophages, lymphocytes, neutrophils and/or eosinophils to the BAL fluid, and/or, peribronchial and/or perivascular infiltration of inflammatory cells comprising the steps of: a) sensitizing said animal by injecting OVA (Ovalbumine) emulsified in alum thereby generating OVA-specific T cells in a non-human mammalian animal, b) incubating said animal for several days, c) challenging said animal with OVA aerosols, d) injecting an LXR agonist (intranasally or other route of administration) before each aerosol challenge in said animal, e) analyzing the inflammatory cell (macrophage, lymphocyte, neutrophil, eosinophil, etc.) content of the BAL fluid of
  • OVA is emulsified in alum with 10 to 100 ⁇ g of OVA and a 2% alum suspension.
  • the emulsion is given intraperitoneally and one or several sensitizations can be performed : for example, a first sensitization at day 0 and a second sensitization between day 4 and day 7.
  • the OVA aerosol challenge may be performed two weeks after the final OVA-Alum injection.
  • mice are exposed daily for 30 min for three consecutive days to nebulized
  • mice may be sacrificed by intraperitoneal injection of pentobarbital sodium (60 mg/kg body weight) followed by exsanguination from the iliac vessels. The trachea is then surgically exposed and cannulated, and the bronchoalveolar lavage is performed as known by a skilled person in the art. The cells of the BAL fluid are then centrifuged, washed and counted on cytospin preparations.
  • PBS Phosphate Buffered Saline
  • the cellular composition of BAL fluid is an indicator of airway inflammation.
  • OVA- sensitized/OVA-exposed positive control group there should be a significantly higher number of neutrophils, eosinophils, monocytes/macrophages and T lymphocytes compared to the negative control group OVA-sensitized/PBS aerosol.
  • eosinophilic and neutrophilic cells Some types of said diseases or disorders are more influenced by eosinophil infiltration; others are more influenced by neutrophil infiltration, and others by a combination thereof.
  • eosinophilic and neutrophilic cells Some types of said diseases or disorders are more influenced by eosinophil infiltration; others are more influenced by neutrophil infiltration, and others by a combination thereof.
  • Several studies involving the analysis of BAL fluid from adult asthmatic subjects revealed an increased total cell number and an increased eosinophils and lymphocytes number, CD4+ T lymphocytes being the predominant T cell subtype.
  • other studies with infants or children with asthma showed a predominant increased of neutrophils in the BAL fluid [Le Bourgeois (2002) Chest 122:791-797].
  • CD8+ T lymphocytes predominate in subjects with Chronic Obstructive Pulmonary Disease (COPD) [Ho (2002) Chest 121:1421-1426].
  • COPD Chronic Obstructive Pulmonary Disease
  • the presence of macrophages in the BAL fluid constitutes another marker of inflammation but is less characteristic for asthma.
  • Th2-cytokines which can be studied in the method of the present invention, are IL4, IL-5, IL-6, IL-9, 11-10 and IL-13.
  • the secretion of IL-4 and IL-5 is studied by a skilled person in the art to analyze the activation of the Th2 response.
  • the secretion of IFN- ⁇ , TNF-a, IL-2 or lymphotoxin can be studied as marker to analyze the Th 1 -response.
  • T cell response is often studied by the analysis of cytokines produced by lymph node T cell restimulated in vitro with specific antigens such as OVA. These studies are usually performed with draining lymph nodes such as mediastinal lymph node cell suspensions, which contains na ⁇ ve and effector T cell of CD4 and CD8 subtype.
  • peribronchial and/or perivascular inflammatory cell infiltration in lung biopsies can be performed as mentioned: at 24 hours after the last aerosol, lung biopsies are fixed, paraffin embedded, cut into four-micrometer sections and stained with hematoxylin and eosin for histological analysis.
  • a skilled person in the art can identify peribronchial and/or perivascular eosinophil-rich infiltrates and airway mucosal changes typical of goblet cell hyperplasia.
  • the LXR agonist used according to the present invention may be any compound which stimulates LXR activity. As mentioned above, said agonist may be
  • said LXR agonist applied according to the present invention, may be a single compound or may be present in a composition.
  • Said composition may be a pharmacological composition to be tested for DCs differentiation/maturation, for recruitment of inflammatory cells to the BAL fluid, for Th2-cytokine secretion, and/or, for peribronchial and/or perivascular infiltration of inflammatory cells.
  • said composition can be tested to analyze its effect on airway inflammation and/or asthmatic responses.
  • the above-described use of the present invention may be considered as secondary and/or tertiary screenings assays to evaluate LXR ligands for their efficiency to have an effect on the above-mentioned physiological processes.
  • Said compound or composition may have the same properties as the compound or composition to be used in human or animal patients.
  • LXR agonists to be tested for their DC differentiation/maturation modulating activity, for their modulating activity of recruitment of inflammatory cells to the BAL fluid, for their Th2-cytokine secretion modulating activity, and/or, for their modulating activity of peribronchial and/or perivascular infiltration of inflammatory cells, may be formulated and administered orally, or parentally through intravenous, subcutaneous, intramuscular, percutaneous, intranasal or intrarectal route or the like, or by inhalation.
  • said agonists are administered by nebulization or intranasally.
  • Dosage forms for oral administration include tablets, pills, powders, granules, liquids, suspensions, syrups, capsules, etc.
  • the tablets may be formulated according to a conventional process by using additives consisting of an excipient such as lactose, starch, calcium carbonate, crystalline cellulose or silicic acid; a binder such as carboxymethylcellulose, methylcellulose, calcium phosphate or polyvinylpyrrolidone; a disintegrator such as sodium alginate, sodium bicarbonate, sodium laurylsulfate or stearic acid monoglyceride; a humectant such as glycerin; an absorbent such as kaolin or colloidal silica; a lubricant such as talc or granular boric acid, etc.
  • an excipient such as lactose, starch, calcium carbonate, crystalline cellulose or silicic acid
  • a binder such as carboxymethylcellulose, methylcellulose, calcium phosphate or poly
  • the pills, powders and granules may be prepared by conventional processes also using additives similar to those mentioned above.
  • Liquid preparations such as the liquids, suspensions and syrups can be formulated also according to conventional processes.
  • a carrier for example, a glycerol ester such as tricaprylin, triacetin or an iodized poppy oil fatty acid ester; water; an alcohol such as ethanol; or an oily base such as liquid paraffin, coconut oil, soybean oil, sesame oil or corn oil is used.
  • the capsules are formulated by filling a powdery, granular or liquid pharmaceutical composition, or the like, in gelatin capsules, or the like.
  • Dosage forms for intravenous, subcutaneous and intramuscular administration include injections in the forms of sterilized aqueous solutions, non-aqueous solutions, etc.
  • aqueous solution for example, a physiological saline solution or the like is used as a solvent.
  • non-aqueous solution for example, propylene glycol, polyethylene glycol, a vegetable oil such as olive oil, an organic ester which is acceptable for injection such as ethyl oleate or an iodized poppy oil fatty acid ester, or the like is used as a solvent.
  • an isotonizing agent e.g., a preservative, a humectant agent, an emulsifier, a dispersant, a stabilizer, etc.
  • the preparation may be sterilized by applying an adequate treatment such as filtration through a bacterium-retaining filter, blending of a germicide or irradiation.
  • the preparation may be prepared as an aseptic solid preparation which is used by dissolving in sterilized water or a sterilized solvent for injection just prior to use.
  • the LXR agonist may be used in the form of a clathrate compound prepared by using ⁇ , ⁇ or ⁇ -cyclodextrin, a methylated cyclodextrin, or the like.
  • the compound may be used also as an injection of lipoid form.
  • Dosage forms for percutaneous administration preparations include ointments, creams, lotions, solutions, etc.
  • Examples of the base of an ointment include a fatty acid such as castor oil, olive oil, sesame oil or safflower oil; lanolin; white, yellow or hydrophilic vaseline; wax; a higher alcohol such as oleyl alcohol, isostearyl alcohol, octyldodecanol or hexyldecanol; a glycol such as glycerin, diglycerin, ethylene glycol, propylene glycol, sorbitol or 1 ,3-butanediol; etc.
  • ethanol, dimethyl sulfoxide polyethylene glycol, etc. may be compounded.
  • a preservative such as a paraoxybenzoic acid ester, sodium benzoate, salicylic acid, sorbic acid or boric acid; an antioxidant such as butylhydroxyanisole or dibutylhydroxytoluene; etc. may be added.
  • an absorption promoter such as diisopropyl adipate, diethyl sebacate, ethyl caproate or ethyl laurate may be compounded.
  • the LXR agonist may be used in the form of a clathrate compound prepared by using ⁇ , ⁇ or ⁇ -cyclodextrin, a methylated cyclodextrin, etc.
  • An ointment can be prepared by a conventional process.
  • dosage forms of oil-in-water type are preferable with the aim of stabilizing the LXR agonist.
  • the above-mentioned fatty oil, higher alcohol, glycol, or the like may be used as the base of a cream, and diethylene glycol, propylene glycol, sorbitan mono fatty acid ester, polysorbate 80, sodium laurylsulfate, or the like may be used as the emulsifier of a cream.
  • the above-mentioned preservative, antioxidant, or the like may be added, as necessary.
  • the LXR agonist can be used in the form of a clathrate compound prepared by using a cyclodextrin or a methylcyclodextrin.
  • a cream can be prepared according to a conventional process.
  • Examples of the lotions include a suspension-type lotion, an emulsion-type lotion and a solution-type lotion.
  • the suspension-type lotion may be prepared by using a suspending agent such as sodium alginate, traganth or sodium carboxymethylcellulose, and optionally by adding an antioxidant, a preservative, etc.
  • the emulsion-type lotion may be prepared according to a conventional process by using an emulsifier such as sorbitan mono fatty acid ester, polysorbate 80 or sodium laurylsulfate.
  • the LXR agonist can be dissolved in an alcohol such as ethanol, and optionally an antioxidant, a preservative, or the like is added.
  • Pharmaceutical LXR agonist preparations for intranasal administration are supplied in the form of a liquid or powdery composition.
  • a liquid or powdery composition As the base of the liquid preparation, water, saline, a phosphate buffer solution, an acetate buffer solution, or the like is used, and the liquid preparation may contain further a surfactant, an antioxidant, a stabilizer, a preservative and/or a thickener.
  • a base for the powdery preparation a water-absorbent base is preferable.
  • water-absorbent base examples include polyacrylate salts such as sodium polyacrylate, potassium polyacrylate and ammonium polyacrylate; cellulose lower-alkyl ethers such as methylcellulose, hydroxyethylcellulose, hydroxypropyl-cellulose and sodium carboxymethylcellulose; and polyethylene glycol, polyvinyl pyrrolidone, amylose, pullulan, etc., which are easily soluble in water.
  • polyacrylate salts such as sodium polyacrylate, potassium polyacrylate and ammonium polyacrylate
  • cellulose lower-alkyl ethers such as methylcellulose, hydroxyethylcellulose, hydroxypropyl-cellulose and sodium carboxymethylcellulose
  • polyethylene glycol, polyvinyl pyrrolidone, amylose, pullulan, etc. which are easily soluble in water.
  • cellulose compounds such as crystalline cellulose, [alpha]-cellulose and cross-linked sodium carboxymethylcellulose
  • starch compounds such as hydroxypropyl starch, carboxymethyl starch, cross-linked starches, amylose, amylopectin and pectin
  • proteins such as gelatin, casein and sodium caseinate
  • gums such as gum arabic, tragacanth gum and glucomannan
  • polyvinylpolypyrrolidone cross-linked polyacrylic acid and salts thereof, cross-linked polyvinyl alcohols, etc., which are scarcely soluble in water.
  • These compounds may be used alone or in mixtures of two or more thereof.
  • the powdery preparation may be further compounded with an antioxidant, a coloring agent, a preservative, a disinfectant, an antiseptic, etc.
  • an antioxidant for example, a coloring agent, a preservative, a disinfectant, an antiseptic, etc.
  • a coloring agent for example, a coloring agent, a preservative, a disinfectant, an antiseptic, etc.
  • a preservative for example, a disinfectant, an antiseptic, etc.
  • a disinfectant for example, by using a spraying device, etc.
  • ordinary suppositories such as gelatin soft capsule are used.
  • an adequate biocompatible vehicle can be administered to disease sites using an applicator such as a spraying device, a nebulizer or an atomizer.
  • an active ingredient comprising an LXR agonist may be administered by using a pMDI (volumetric sprayer) in which a suspension or solution prepared by suspending or dissolving the active ingredient in a spraying agent for aerosol such as alternative flon is filled.
  • the LXR agonist may be dissolved in an ethanol aqueous solution, the solution is filled in an adequate sprayer.
  • a pharmaceutically effective dose of the active LXR agonist tested depends on administration route, age and sex of the patient and the conditions of the disease, but it is ordinarily about 0.001-100 ⁇ g per day, preferably about 0.01-50 ⁇ g per day, and administration frequency is ordinarily 1-3 time per day.
  • the LXR agonist is preferably prepared, so as to meet these conditions.
  • LXR agonists When the LXR agonists are administered as a composition, and not as a simple one-agent solution, as normally would be administered to a patient, a skilled person may also evaluate possible side-effects of said agents on the metabolic conditions in said model animals.
  • the effect of an LXR agonist on the modulation of physiological processes such as airway eosinophilic inflammation and asthma is evaluated through the comparison of the in vivo changes related to recruitment of inflammatory cells such as macrophages, lymphocytes, neutrophils and/or eosinophils to the BAL fluid, related to Th2-cytokine secretion, and/or, related to peribronchial and/or perivascularinfiltration of inflammatory cells.
  • inflammatory cells content, Th2-cytokine secretion, and/or, peribronchial and/or perivascular infiltration of inflammatory cells in a model wherein an LXR agonist is used are compared with inflammatory cells content, Th2-cytokine secretion, and/or, peribronchial and/or perivascular infiltration of inflammatory cells of model wherein the animal is treated identically with a reference compound or wherein the animal is untreated or wherein an animal received a carrier molecule or a vehicle.
  • the secretion of IL-4, IL-5, IL-6, IL-9, IL-10 and IL-13 is studied.
  • IFN- ⁇ , TNF- ⁇ , IL-2 or lymphotoxi ⁇ secretion is mostly studied to test in parallel the effect of the LXR agonists on the Th1- response.
  • the above-mentioned method describes the possibility to study the inhibition of recruitment of inflammatory cells such as macrophages, lymphocytes, neutrophils and/or eosinophils to the BAL fluid, the inhibition of Th2-cytokine secretion, and/or, the inhibition of peribronchial and/or perivascular infiltration of inflammatory cells.
  • said model animals may also be used to study the prevention of said recruitment of inflammatory cells to the BAL fluid, the prevention of Th2-cytokine secretion, and/or, the prevention of peribronchial and/or perivascular infiltration of inflammatory cells.
  • the present invention suggests the use of a non-human mammalian animal as an in vivo model for identifying compounds preventing Th2- cytokine secretion, recruitment of inflammatory cells such as macrophages, lymphocytes, neutrophils and/or eosinophils to the BAL fluid, and/or, peribronchial and/or perivascular infiltration of inflammatory cells, comprising the steps of: a) injecting an LXR agonist (intranasally or other route of administration) in a non human mammalian animal, b) sensitizing said animal by injecting ovalbumine (OVA) emulsified in alum thereby generating OVA-specific T cells in said animal, c) incubating said animal for several days, d) challenging said animal with OVA aerosols, e) optionally, injecting an LXR agonist (intranasally or other route of administration) before each aerosol challenge in said animal, f) analyzing the inflammatory cell (macrophage,
  • a non-human mammalian animal may be used as an in vivo model for identifying compounds inhibiting T cell proliferation and/or Th2-cytokine release through the analysis of the primary immune response.
  • Th2-cytokines may for instance be released from lymph node cells. Said use may comprise the steps of: a) isolating OVA-specific T cells from the TCR (T Cell Receptor) transgenic mouse
  • OVA-specific T cells of step a) are isolated from spleen and lymph nodes of a TCR transgenic mouse (DO11.10) [Murphy (1990) Science 250:1720-1723] and are labeled with CFSE (for Carboxy Fluorescein diacetate Succinimidyl Ester) which passively diffuses into cells and becomes fluorescent after being cleaved by intracellular esterases.
  • CFSE serves as a tracer for measuring T cell proliferation, as cell divisions correspond to sequential halving of CFSE fluorescence.
  • Dendritic Cells are treated in vitro with an LXR agonist.
  • said Dendritic Cells may be of myeloid, lymphoid, or plasmacytoid origin, preferably myeloid origin, and may be obtained as mentioned before.
  • the conditions at which said agonist is applied may be easily derived for the skilled person in the art.
  • the DCs will be treated in vitro with different doses of the LXR agonist (generally from 10-8M to 10-5M) and the non-toxic dose at which an effect is observed on DC precursor differentiation and on DC maturation will be selected for the in vivo studies.
  • Dendritic Cells pulsed with OVA are used according to the present invention to induce an asthmatic response in an in vivo asthma model.
  • Said pulsed DCs are preferably injected intratracheally in said animal.
  • said animal is incubated preferably 10 days to allow induction of immunological responses.
  • said Dendritic Cells of step c) are pulsed with ovalbumine (OVA), preferably at a concentration of 10 ug of OVA as a 2% alum suspension.
  • OVA ovalbumine
  • Th2-cytokine production by ex vivo OVA-restimulated lymph node T cells may be studied as mentioned before.
  • the proliferation of T cells is measured by using CFSE as a cell tracer (as described above).
  • a non-human mammalian animal may also be used as an in vivo model for identifying compounds inhibiting the recruitment of inflammatory cells such as macrophages, lymphocytes, neutrophils and/or eosinophils to the BAL fluid, Th2-cytokine secretion, and/or, peribronchial and/or perivascular infiltration of inflammatory cells through the analysis of the secondary immune response.
  • inflammatory cells such as macrophages, lymphocytes, neutrophils and/or eosinophils
  • Said use may comprise the steps of: a) treating Dendritic Cells with an LXR agonist, b) pulsing the Dendritic Cells of step a) with ovalbumine (OVA), c) injecting the LXR-treated Dendritic Cells pulsed with OVA obtained in step b) in said non human mammalian animal, d) incubating said animal for several days, e) challenging said animal with OVA aerosols, f) analyzing inflammatory cell (macrophage, lymphocyte, neutrophil, eosinophil, etc.) content of the BAL fluid of said animal, g) optionally, extracting draining lymph nodes from said animal, h) optionally, restimulating lymph nodes of step g) with OVA, i) optionally, analyzing Th2-cytokine secretion produced by the cells of step h), j) optionally, measuring Th2-cytokine secretion in the BAL fluid, k) optionally, analyzing peribron
  • step f comparing the cellular content of step f), the Th2-cytokine secretion optionally measured in step i) or j) and/or peribronchial and/or perivascular inflammatory cell infiltration optionally measured in step k) with the cellular content, the Th2-cytokine secretion and/or peribronchial and/or perivascular inflammatory cell infiltration obtained from an animal treated as described in the previous steps but wherein the Dendritic Cells were not stimulated with the LXR agonist, m) optionally, comparing the cellular content of step f), Th2-cytokine secretion optionally measured in step i) or j) and/or peribronchial and/or perivascular inflammatory cell infiltration optionally measured in step k) with the cellular content, Th2-cytokine secretion, and/or, peribronchial and/or perivascular inflammatory cell infiltration obtained from an animal treated as described in the previous steps but wherein the Dendritic Cells were stimulated with
  • Dendritic Cells pulsed with OVA are used according to the present invention to induce an asthmatic response in an in vivo asthma model.
  • the present application shows that if DCs are previously treated with an LXR ligand, this asthmatic response could be reduced.
  • the murine model with adoptive transfer of pulsed-DCs may thus be used to evaluate LXR ligands in secondary or tertiary screening assays.
  • Said pulsed DCs are preferably injected intratracheally in said animal. Furthermore, after said injection said animal is incubated preferably 10 days to allow induction of immunological responses. Draining lymph nodes, such as mediastinal lymph nodes are removed, homogenized and resuspended in culture media using standard methods of the art. The ex vivo production of cytokines by the collected T cells is measured after restimulation with 10 ⁇ g/ml of OVA for 4 days as described in [Hammad (2004) Am.JPathol. 164:263-271]. The cytokine production studied relates to the Th2-cytokines IL-4, IL-5, IL-6, IL-
  • IFN- ⁇ , TNF- ⁇ , IL-2 or lymphotoxin concentrations may be studied as reference for the Th 1 -response.
  • said non-human mammalian animal may, for instance, be a mouse or a rat.
  • said Dendritic Cell may be of myeloid, lymphoid or plasmacytoid origin.
  • said Dendritic Cell may be directly isolated from (peripheral or cord) blood.
  • said LXR agonist or said reference compound may be T0901317 or GW3965, or a functional equivalent, or a combination thereof.
  • said animal may be used as a model for identifying compounds interfering with (inhibiting or preventing) asthma, more particularly allergy-induced asthma.
  • the present invention elaborates on the in vitro use of an LXR agonist to interfere with (inhibit or prevent) Dendritic Cell precursor differentiation and/or DC maturation.
  • LXR agonists may be candidates to exert said effect. Consequently, LXR agonist may be used for the preparation of a medicament for the treatment of a disease associated with DC differentiation and/or maturation.
  • LXR agonists identified according to a method of the present invention or identified by means of the use of a non-human mammalian animal according to the present invention, may be used to prepare a medicament for the treatment of a disease associated with recruitment of inflammatory cells to the BAL fluid.
  • said agonist may be used to prepare a medicament for the treatment of a disease associated with increased Th2-cytokine release.
  • said agonist may be used to prepare a medicament for the treatment of a disease associated with peribronchial and/or perivascular infiltration of inflammatory cells.
  • LXR agonists can be administered alone or in combination with conventional medicines.
  • An LXR agonist may be combined with other agents also carrying activity on airway inflammation, or carrying activity on other cellular processes.
  • said cellular processes may be linked to the dysregulation of other inflammatory responses or may be related to non-inflammatory responses.
  • non-inflammatory responses may be the treatment of cholesterol mediated processes (diabetes, cholestasis, atherosclerosis, or related diseases).
  • cholesterol mediated processes diabetes, cholestasis, atherosclerosis, or related diseases.
  • vitamin D3 and DEX interfere strongly with DC function and produce a distinct DC phenotype [Xing (2002) Biochem.Biophys.Res.Commun. 297:645-52]. Therefore, LXR ligands, glucocorticoids (i.e.
  • dexamethasone and analogues thereof anti-histamines
  • Platelet Activating Factor (PAF) antagonists anti-histamines
  • PAF Platelet Activating Factor
  • leukotriene antagonists leukotriene antagonists
  • 5-lipoxygenase inhibitors 5-lipoxygenase inhibitors
  • COX(2) inhibitors anticholinergic agents
  • methyl xanthines or ⁇ -adrenergic agents may be combined in a preparation to treat the diseases according to the present invention.
  • the present invention suggests that some LXR agonists will have dominant activity in DC modulation (i.e. in DC precursors differentiation and/or in DCs maturation), and other may have dominant activity in modulating cholesterol metabolism. Therefore, the present inventors suggest that it is possible to perform a combined treatment of DC-related and cholesterol-related diseases through the use of specific LXR-agonists. Dosage information for these agents is well known.
  • a sixth embodiment of the present invention relates to an isolated Dendritic Cell composition or an isolated Dendritic Cell precursor composition comprising DCs or DC precursors thereof which have been treated in vitro with an LXR agonist.
  • Said agonist may interfere with , (inhibiting or preventing) DC precursor differentiation and/or with DCs maturation.
  • Said cells may subsequently be sensitized in vitro with the maturation agents described above.
  • the stimulation of the differentiation of Dendritic Cell precursors to Dendritic Cells or Dendritic Cell maturation may be achieved by treating with allergens (ex. der p 1, der p 2, bet Via, ovalbumine, etc.), inflammatory cytokines (ex.
  • CD40L also called CD154, is a co-stimulatory membrane protein belonging to the TNF superfamily
  • bacterial products ex. LPS or LipoPolySaccharide
  • pathogens such as Escherichia coli, Candida, viruses (ex. Influenza, measles and dengue viruses, HIV, etc.) or other agents known in the art. Said different agents may be purified or not.
  • said Dendritic Cell or Dendritic Cell precursor may be of myeloid, lymphoid or plasmacytoid origin.
  • differentiated DCs can be directly isolated from blood, using BDCA-1 or BDCA-3 (myeloid specific) or BDCA-2 and BDCA-4 (plasmacytoid specific) antibodies. Therefore, Dendritic Cells used in the method of the present invention may be directly isolated from (peripheral or cord) blood.
  • Said Dendritic Cell precursor may be a monocyte, a CD34+ hematopoietic progenitor cell of the cord blood, the adult bone marrow, the peripheral blood or the thymus or an IL-3R plasmacytoid cell from the blood or lymphoid tissues.
  • the Dendritic Cell precursor may thus be isolated from peripheral blood, cord blood, bone marrow, thymus or other lymphoid tissues and may be a monocyte, a CD34+ hematopoietic progenitor or an IL-3R plasmacytoid cell.
  • Preferably said Dendritic Cell differentiates from a monocyte.
  • the LXR agonist used to treat the Dendritic Cell composition or the Dendritic Cell precursor composition according to the present invention may be T0901317 or GW3965 or a functional equivalent or a combination thereof.
  • the present invention further elaborates on the use of a Dendritic Cell composition or a Dendritic Cell precursor composition according to the present invention -to. study the_recruitment of inflammatory cells to the BAL fluid in a model organism.
  • the present invention also elaborates on the use of a Dendritic Cell composition or a Dendritic Cell precursor composition according to the present invention to study the release of Th2-cytokine in the BAL fluid and by lymph node cells in a model organism.
  • the present invention also elaborates on the use of a Dendritic Cell composition or a Dendritic Cell precursor composition according to the present invention to study the peribronchial and/or perivascular infiltration of inflammatory cells in a model organism.
  • the LXR agonist identified according to a method of the present invention or identified by means of the use of a non-human mammalian animal according to the present invention may be used to prepare a medicament for the treatment of asthma, preferably allergy-induced asthma.
  • the present invention also relates to the use of a Dendritic Cell composition or a Dendritic Cell precursor composition according to the present invention to study asthma, preferably allergy-induced asthma.
  • allergen-triggered asthma is the most influenced by eosinophylic migration.
  • LXR ligands was found in the present invention to inhibit said eosinophilic migration, it becomes obvious that especially allergen-induced asthma may be treated using said LXR agonists. That LXR agonists are efficient in allergy induced asthma models is confirmed by the experimental findings described in the present application.
  • diseases from the group consisting of Eosinophilic Intrinsic Asthma, Eosinophilic Bronchitis, Occupational Asthma, COPD, Bronchiectasis may also be treated using LXR ligands as the LXR ligand can also repress the effect of a Th1 stimuli such as LPS.
  • the present invention also suggests that the disease chosen from the group consisting of Viral Wheeze/PV Cough, Neutrophilic Asthma and Bronchitis may be treated.
  • the LXR agonist T0901317 or GW3965 or a functional equivalent or a combination thereof may be used to interfere in vitro with (inhibit or prevent) DC differentiation and/or maturation or to study a disease associated with the recruitment of inflammatory cells to the BAL fluid, with the release of Th2-cytokine in the BAL fluid and/or by lymph node cells, and/or, with peribronchial and/or perivascular infiltration of inflammatory cells.
  • the LXR agonist, T0901317 or GW3965 or a functional equivalent or a combination thereof may be also used according to any uses or methods of the present invention.
  • AHR Airway HyperResponsiveness - an asthma-like phenotype with wheeze and bronchodilator-responsive shortness of breath
  • asthma-like or asthma describes variable airflow obstruction and AHR, it is believed these are the most specific hallmarks of the disease, it should be remembered that patients with asthma usually also have symptoms of bronchitis. Mwt, molecular weight; Eos. Branch., eosinophilic bronchitis; Occ. Asthma, occupational asthma; PV, post viral; BHR, bronchial hyper-responsiveness; COPD , chronic obstructive pulmonary disease.
  • FIG. 2 Expression of LXR ⁇ and LXR ⁇ in myeloid and plasmacytoid DCs.
  • mRNA expression of LXR ⁇ and LXR ⁇ was analyzed by RT-PCR.
  • Monocyte-derived DCs were stimulated with 100 ng/ml of LPS for 24 hours and plasmacytoid DCs were stimulated with 3 ⁇ M of CpG ODN 2006 ( ⁇ '-TGCTGCTTTTGTGCTTTTGTGCTT) and IL-3 (10ng/ml) for 24 hours.
  • FIG. 3 In vitro effects of LXR agonists on DC modulation: Interference of LXR ligands T0901317 and GW3965 with the differentiation of monocytes into Dendritic Cells. LXR ligands GW3965 (A and B) and T0901317 (C and D) were added at day 3 of differentiation and monocyte-derived DCs were characterized at day 6 for cell-surface expression of CD1a by FACS (Fluorescence-Activated Cell Sorting) analysis and for CD40 transcriptional activity by RT-PCR.
  • Figure 4 In vitro effects of LXR agonists on DC modulation : Interference of LXR ligands T0901317 and GW3965 with LPS-inducible transcription of ELC and CCR7 in Dendritic Cells.
  • Monocyte-derived DCs were preincubated for 2 hours with LXR ligand GW3965 (A and B) or T0901317 (C and D) and then stimulated with LPS (Lipo Poly Saccharide) for an additional 16 hours.
  • LPS Lipo Poly Saccharide
  • the transcriptional activity of the chemokine ELC (Ebv-induced molecule 1 Ligand Chemokine) and its receptor CCR7 was analysed by quantitative RT-PCR.
  • FIG. 5 In vitro effects of LXR agonists on DC modulation : Interference of LXR ligand T0901317 with the capacity of DCs to stimulate the proliferation of allogeneic T cells.
  • a heterologous MLR (Mixed Leukocyte Reaction) assay was performed with increasing quantities of DCs (treated or not with T0901317) incubated with na ⁇ ve CD4+ T cells for 7 days.
  • T cell proliferation was measured by BrdU (Bromodeoxyuridine) incorporation.
  • FIG. 1 Representative diagram of a one-hybrid GAL4 assay using a reporter plasmid containing 5 tandem repeats of GAL4 response elements (Gal4RE(x5)) and an expression plasmid encoding a GAL4(DBD)-LXR(LBD) chimera.
  • FRET Fluorescence Resonance Energy Transfer
  • Figure 8 In vivo asthma model for identifying compounds interfering with T cell proliferation and/or Th2-cytokine release by lymph node cells through the analysis of the primary immune response.
  • the intratracheal injection of OVA-pulsed DCs treated with the LXR ligand impairs the primary immune response by interfering with cytokine secretion of lymph node T cell.
  • FIG. 9 Schematic representation of the murine model of allergic asthma with adoptive transfer of OVA-pulsed DCs.
  • Figure 10 In vivo asthma model for identifying compounds interfering with (inhibiting) recruitment of inflammatory cells to the BAL fluid, with Th2-cytokine secretion, and/or, with peribronchial and/or perivascular infiltration of inflammatory cells through the analysis of the secondary immune response.
  • Cellular composition of the BAL fluid Cellular composition of the BAL fluid.
  • Figure 11 In vivo asthma model for identifying compounds interfering with (inhibiting) recruitment of inflammatory cells to the BAL fluid, with Th2-cytokine secretion, and/or, with peribronchial and/or perivascular infiltration of inflammatory cells through the analysis of the secondary immune response. Analysis of the cytokine secretion by lymph node T cell.
  • Example 1 Expression of LXR ⁇ and LXR ⁇ in myeloid and plasmacytoid DCs.
  • mRNA expression of LXR ⁇ and LXR ⁇ was analyzed by RT-PCR using the following oligonucleotides: 5'-TTCCTCCTGACTCTGCGGTG (sense oligo) and 5'- TCCTGGCTTCCTCTCTGAGG (antisense oligo) for LXR ⁇ and 5'- AGCAGCAGCAGGAGTCACAGTC (sense oligo) and 5'-
  • CTTGAGCCGCTGTTAGCTGGAC antisense oligo
  • Monocyte-derived DCs were stimulated with 100 ng/ml of LPS for 24 hours and plasmacytoid DCs were stimulated with 3 ⁇ M of CpG ODN 2006 ( ⁇ '-TGCTGCTTTTGTGCTTTTGTGCTT) and IL-3 (10ng/ml) for 24 hours.
  • LXR ⁇ and LXR ⁇ are expressed in myeloid and plasmacytoid DCs (mDC and pDC - see Figure 2).
  • LXR ⁇ is down-regulated in plasmatocytoid DCs activated with CpG oligos.
  • LXR ⁇ is up-regulated, suggesting that these two LXRs may have different roles in DCs.
  • the selection of compounds binding to both receptor subtypes is aimed at.
  • Example 2 In vitro effect of LXR agonists on DC modulation.
  • the LXR ligands were first tested on the normal differentiation of monocytes into DCs by measuring the acquisition of the DC phenotype. For these experiments, GW3965 or T0901317 were added at day 3 of differentiation and DC differentiation markers were examined at day 6 (the cytokines GM-CSF and IL-4 were present throughout the differentiation process). It was found that LXR ligands T0901317 or GW3965 interfered with cell-surface expression of CD1a, CD11c, CD40 and HLA-DR and with the transcription of CD40 and MMP9. A dose response analysis of CD1a and CD40 is shown in Figure 3. These results showed that LXR ligands interfere with the differentiation of DCs and skewed DC toward the acquisition of an unusual phenotype.
  • LXR ligands The effect of LXR ligands on LPS-inducible maturation of DCs was then investigated.
  • monocyte-derived DCs obtained at day 6 of differentiation were pre-treated with LXR ligands GW3965 or T0901317 for 2 hours and then stimulated with LPS for 16 hours.
  • the maturation markers ELC, CCR7, IP-10 were down regulated by T091317, as well as co-stimulatory molecules CD80 and CD86 and MHC Il expression (the results for ELC and CCR7 are shown in Figure 4).
  • LXR ligands inhibit the migration of DCs to secondary lymphoid organs and therefore may interfere with the initiation of the immune response triggered by DCs.
  • MHC class Il expression and co-stimulatory molecules such as CD80 and CD86 indicate that the antigen presentation function will be altered by LXR ligands.
  • monocyte-derived DCs treated with the LXR ligand have a reduced ability to stimulate the proliferation of na ⁇ ve CD4+ T cell in a Mixed Leukocyte Reaction (MLR) assay.
  • MLR Mixed Leukocyte Reaction
  • LXR target genes such as ABCA1 , ApoE, and PLTP was also observed, suggesting that LXR ligands are fully functional in DCs and thus play a role in cholesterol and lipoprotein metabolism of DCs.
  • the effect of the LXR ligand T0901317 was tested on the expression of known differentiation and maturation markers and on the antigen presentation function of DCs.
  • the maturation markers ELC, CCR7, IP-10, CD80, CD83, CD86, MHC class Il were down regulated by T091317, suggesting that an LXR agonist could reduce the migration of DCs in the secondary lymphoid organs and reduce the potential of DCs to initiate an immune response.
  • Example 3 High Throughput Screen (HTS) for LXR agonists: one-hybrid GAL-4.
  • HTS High Throughput Screen
  • LLD Ligand Binding Domain
  • a cell-based GAL-4 screening assay The concept of said assay is depicted in Figure 6.
  • This assay also allows the development of HTS screening assays to screen for LXR ligands, in particular LXR agonists.
  • a cell-based GAL4 assay may serve as a primary screening of pharmacological compounds; followed by a secondary screening, such as a FRET assay (see example 4).
  • Another potential secondary screening may include the use of endogenous LXR target genes (see below).
  • an expression vector containing the DNA Binding Domain (DBD) of GAL4 is fused to the Ligand Binding Domain (LBD) of LXR.
  • LBD Ligand Binding Domain
  • a reporter plasmid comprising multiple copies of the GAL4 response element upstream of a minimal TK promoter is made. Both constructs are then transfected together in a relevant cell line which expresses known LXR co-activators or co-repressors. Examples of said co-activators are SRC-1, ASC2, PGC-1 , RIP140, TRAP220, SRC-3/ACTR and GRIP-1 and said co-repressors are NCOR1 and SMRT/NCOR2.
  • the nuclear ligand T091317 or the pharmacological products are added and the luciferase activity is measured 24 hours later.
  • This assay can serve to screen for T091317 analogs or other molecules that can fit the ligand binding pocket and mimick the effect of T091317.
  • High level of induction with T0901317 or GW3965 was obtained in COS-7 and HepG2 cells but other cell lines may also be tested.
  • FRET assay The concept of FRET assay is depicted in Figure 7. This assay can be used to screen for agonists or antagonists.
  • a GST (Glutathion S-Transferase) fusion construct containing the LBD domain of LXR is produced in bacteria.
  • the GST-LXR chimeric protein is incubated with a biotinilated peptide derived from a co-activator or co-repressor of LXR, a GST-APC conjugated antibody which serves as an acceptor molecule, and a RPE (R-PhycoErythrin)-conjugated streptavidin which constitutes the donor molecule.
  • RPE R-PhycoErythrin
  • Example 5 High throughput screen for LXR agonists: endogenous LXR targets.
  • LXR target genes involved in cholesterol and fatty acid metabolism have been identified so far. Examples are ABCA1 , ABCG5, ABCG8, cholesterol ester transfer protein, cyp7A1, acetyl-coenzyme A, fatty acid synthetase, fatty acid binding protein, apolipoprotein E, SREBP-Ic, P450, stearoyl-CoA desaturase 1 and insig-2.
  • the endogenous LXR target genes involved in inflammation and immunity are less known. Recently, Kim et al. (2003) (MoI. Cell. Biol. 23:3583-92) showed, by transcription profiling of LXR ligand treated mice, that IKKb is an inducible target gene of LXR.
  • assays using T0901317-treated DCs are performed.
  • Said inflammatory stimuli are chosen from the group consisting of der p1 , LPS or CD40L.
  • the identification of (a) LXR target gene(s) in DCs allows the development of assays with a DC-specific LXR target gene.
  • Microarrays of DCs treated with LXR ligand will help to identify DC-specific LXR target gene.
  • LXR ligand T0901317 some genes, such as ABCA1 , ApoE, and PLTP were found to be induced by the LXR ligand T0901317. It is believed that these genes are transactivated through the binding of LXR to response elements found in their promoter region. In contrast, the LXR ligand interfered with the LPS-inducible expression of ELC, CCR7 and MMP9. Since many genes involved in inflammatory processes are regulated by NFKb, it was suggested that LXR may interfere through antagonism of NFKB signaling pathway [Castillo (2003) J.Biol.Chem. 278:10443-10449]. Other signaling pathways such as the IL-4 inducible STAT6 pathway, the PMA-inducible GATA-3 pathway, and the TGF- ⁇ signaling pathway may be tested to determine the influence of LXR ligands.
  • GR glucocorticoid receptor
  • This transrepression assay was performed by co-transfection of a reporter plasmid containing the promoter region of E-selectin together with a GR expression plasmid. Following transfection, cells were treated with TNF ⁇ and IL-1 ⁇ in the absence or presence of compound. In parallel, a transactivation assay was performed using a reporter plasmid containing a promoter bearing GR response elements such as the tyrosine aminotransferase promoter. These assays led to the identification of a compound (AL-438) that confers a better transrepression activity than the well characterized prednisolone and a weaker transactivation capacity than prednisolone.
  • Example 6 In vivo asthma model for identifying compounds interfering or preventing Th2-cytokine secretion, recruitment of inflammatory cells to the BAL fluid, and/or, peribronchial and/or perivascular infiltration of inflammatory cells.
  • mice are sensitized by an injection of ovalbumine (OVA) emulsified in alum.
  • OVA ovalbumine
  • the effect of the LXR ligand is tested by injecting the ligand intranasally, at the time of sensitization.
  • OVA aerosol challenges are given for three consecutive days between day 10 to day 12, and LXR ligand is given intranasally at least four hours before each challenge.
  • the time at which the LXR ligand is given is not limited to said period.
  • the asthmatic response is analyzed 24 hours after the last challenge and includes the histological analysis of peribronchial and/or perivascular infiltration of inflammatory cells in lung biopsies, BAL fluid analysis (cellular content and cytokine secretion) and airway hyperactivity .
  • this model can also be used to test if LXR ligands can prevent asthma in which case the injection of the LXR ligand is performed before the sensitization with OVA.
  • Example 7 In vivo asthma model for identifying compounds interfering with T cell proliferation and/or Th2-cytokine release by lymph node cells through the analysis of the primary immune response.
  • Example 8 In vivo asthma model for identifying compounds interfering with (inhibiting) recruitment of inflammatory cells to the BAL fluid, with Th2-cytokine secretion, and/or, with peribronchial and/or perivascular infiltration of inflammatory cells through the analysis of the secondary immune response.
  • the nuclear receptor LXR has been evaluated in vitro and was shown to interfere with Dendritic Cell phenotype and function (see above).
  • the in vivo inhibitory effect of the LXR ligand on the asthmatic response using a murine model of asthma with adoptive transfer of DCs is studied.
  • the BAL fluid was analyzed for cellular content and the thoracic lymph nodes were extracted, restimulated with OVA for 4 days, and analyzed for cytokine secretion.
  • the analysis of the BAL fluid showed that the treatment of DCs with the LXR ligand had an effect on the secondary immune response which is reflected by a reduction in the number of macrophages, lymphocytes and eosinophils (Figure 10).
  • the level of the Th2-cytokines, IL-4, IL-5 produced by T cell were reduced ( Figure 11).
  • the present invention indicates that LXR-treated DC, i.e. using
  • T0901317 inhibits airway eosinophila in BAL fluid and inhibits secretion of Th2- cytokines such as IL-4, IL-5 and IL-10.
  • the present invention provides thus evidence for the role of LXR agonists in airway inflammation.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Immunology (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Urology & Nephrology (AREA)
  • Molecular Biology (AREA)
  • Hematology (AREA)
  • Toxicology (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pathology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Cell Biology (AREA)
  • Pulmonology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • General Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Organic Chemistry (AREA)
  • Microbiology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Food Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Zoology (AREA)
  • Diabetes (AREA)
  • Endocrinology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Rheumatology (AREA)
  • Epidemiology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne l'utilisation de LXR dans des méthodes d'identification de composés qui interfèrent avec la différenciation et/ou la maturation cellulaires et des méthodes d'identification de gènes anti-inflammatoires spécifiques des cellules dendritiques médiées par LXR. Les animaux mammifères non humains peuvent être utilisés en tant que systèmes modèles in vivo pour l'identification de composés de liaison LXR ( en particulier des agonistes de LXR) inhibant ou empêchant l'activation des cellules T, la sécrétion de la cytokine Th2, le recrutement de cellules inflammatoires dans le fluide de lavage broncho-alvéolaire et/ou l'infiltration périvasculaire et/ou péribronchique de cellules inflammatoires. L'invention porte également sur l'utilisation d'un agoniste LXR pour préparer un médicament pour le traitement de maladies ou de troubles dans lesquels l'inhibition ou la prévention de la différenciation et/ou de la maturation cellulaire, le recrutement de cellules inflammatoires vers le fluide de lavage broncho-alvéolaire, la sécrétion de la cytokine Th2, et/ou l'infiltration péribronchique et/ou périvasculaire de cellules inflammatoires. Elle se rapporte encore à une composition de cellules dendritiques ou à une composition de précurseur de cellules dendritiques ainsi qu'à leurs utilisations pour étudier le recrutement de cellules inflammatoires vers le fluide de lavage broncho-alvéolaire, la sécrétion de cytokine Th2, et/ou l'infiltration péribronchique et/ou périvasculaire de cellules inflammatoires dans un organisme modèle.
PCT/EP2006/000043 2005-01-18 2006-01-05 Utilisation de ligands lxr pour la modulation de cellules denditriques WO2006077012A2 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP05000888 2005-01-18
EP05000888.7 2005-01-18

Publications (2)

Publication Number Publication Date
WO2006077012A2 true WO2006077012A2 (fr) 2006-07-27
WO2006077012A3 WO2006077012A3 (fr) 2006-11-02

Family

ID=34933347

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2006/000043 WO2006077012A2 (fr) 2005-01-18 2006-01-05 Utilisation de ligands lxr pour la modulation de cellules denditriques

Country Status (1)

Country Link
WO (1) WO2006077012A2 (fr)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008110569A1 (fr) * 2007-03-12 2008-09-18 Bioneer A/S Méthode de détermination d'un effet immunomodulateur
WO2010032008A2 (fr) * 2008-09-16 2010-03-25 Natural Environment Research Council Molécule modulatrice des cellules dendritiques
WO2011117582A1 (fr) * 2010-03-23 2011-09-29 Natural Environment Research Council Protéines inhibitrices des cellules dendritiques provenant des tiques
KR20200104687A (ko) * 2019-02-27 2020-09-04 연세대학교 산학협력단 알레르기성 호흡기 질환의 동물 모델 및 이의 용도

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB2381866A (en) * 2001-11-12 2003-05-14 Karobio Ab Assays for liver X receptor (LXR) modulators
WO2003059884A1 (fr) * 2001-12-21 2003-07-24 X-Ceptor Therapeutics, Inc. Modulateurs de lxr
WO2003106435A1 (fr) * 2002-06-18 2003-12-24 Sankyo Company, Limited Derives de la pyrimidin-4(3h)-one a cycles fusionnes, spn procede de preparation et ses utilisations
WO2004058819A2 (fr) * 2002-12-24 2004-07-15 Karo Bio Ab Cristal de protéine
US20040259948A1 (en) * 2003-01-10 2004-12-23 Peter Tontonoz Reciprocal regulation of inflammation and lipid metabolism by liver X receptors

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB2381866A (en) * 2001-11-12 2003-05-14 Karobio Ab Assays for liver X receptor (LXR) modulators
WO2003059884A1 (fr) * 2001-12-21 2003-07-24 X-Ceptor Therapeutics, Inc. Modulateurs de lxr
WO2003106435A1 (fr) * 2002-06-18 2003-12-24 Sankyo Company, Limited Derives de la pyrimidin-4(3h)-one a cycles fusionnes, spn procede de preparation et ses utilisations
WO2004058819A2 (fr) * 2002-12-24 2004-07-15 Karo Bio Ab Cristal de protéine
US20040259948A1 (en) * 2003-01-10 2004-12-23 Peter Tontonoz Reciprocal regulation of inflammation and lipid metabolism by liver X receptors

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
CASTRILLO, A. ET AL: "Liver X receptor-dependent repression of matrix metalloproteinase-9 expression in macrophages." JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 278, no. 12, 21 March 2003 (2003-03-21), pages 10443-10449, XP009049818 ISSN: 0021-9258 *
COLLINS ALAN R: "Pleiotropic vascular effects of PPARgamma ligands." DRUG NEWS & PERSPECTIVES. MAY 2003, vol. 16, no. 4, May 2003 (2003-05), pages 197-204, XP001206500 ISSN: 0214-0934 *
SHIAU A K ET AL: "ORPHAN NUCLEAR RECEPTORS: FROM NEW LIGAND DISCOVERY TECHNOLOGIES TO NOVEL SIGNALING PATHWAYS" CURRENT OPINION IN DRUG DISCOVERY AND DEVELOPMENT, CURRENT DRUGS, LONDON, GB, vol. 4, no. 5, September 2001 (2001-09), pages 575-590, XP009031659 ISSN: 1367-6733 *

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008110569A1 (fr) * 2007-03-12 2008-09-18 Bioneer A/S Méthode de détermination d'un effet immunomodulateur
WO2010032008A2 (fr) * 2008-09-16 2010-03-25 Natural Environment Research Council Molécule modulatrice des cellules dendritiques
WO2010032008A3 (fr) * 2008-09-16 2010-05-20 Natural Environment Research Council Molécule modulatrice des cellules dendritiques
WO2011117582A1 (fr) * 2010-03-23 2011-09-29 Natural Environment Research Council Protéines inhibitrices des cellules dendritiques provenant des tiques
US9676832B2 (en) 2010-03-23 2017-06-13 Jon Austyn Dendritic cell inhibitory proteins from ticks
KR20200104687A (ko) * 2019-02-27 2020-09-04 연세대학교 산학협력단 알레르기성 호흡기 질환의 동물 모델 및 이의 용도
KR102275276B1 (ko) 2019-02-27 2021-07-09 연세대학교 산학협력단 알레르기성 호흡기 질환의 동물 모델 및 이의 용도

Also Published As

Publication number Publication date
WO2006077012A3 (fr) 2006-11-02

Similar Documents

Publication Publication Date Title
Cain et al. Immune regulation by glucocorticoids
JP5130591B2 (ja) 薬物および用途
Liu et al. Oxysterols direct B-cell migration through EBI2
Schimmer et al. ACTH, adrenal steroids, and pharmacology of the adrenal cortex
US8486926B2 (en) Steroid tetrol solid state forms
Gao et al. UDP-glucose acting at P2Y14 receptors is a mediator of mast cell degranulation
US8354396B2 (en) Drug identification and treatment method
US8217025B2 (en) Drug screening and treatment methods
US20080153792A1 (en) Drug Identification and Treatment Method
EP2277522A2 (fr) Methodes pour augmenter ou diminuer la densité osseuse et identifier des molécules
Chen et al. Thymus-derived glucocorticoids mediate androgen effects on thymocyte homeostasis
US20080221074A1 (en) Drug Screen and Treatment Method
EP2298316A1 (fr) Procedes de traitement therapeutique
US9115168B2 (en) Steroids having 7-oxygen and 17-heteroaryl substitution-3
CN101472579B (zh) 药物和用途
WO2006077012A2 (fr) Utilisation de ligands lxr pour la modulation de cellules denditriques
CN103857394A (zh) 四氢甲基嘧啶羧酸的治疗应用
WO2005028667A1 (fr) Recepteur couple a la proteine g pour le ciblage de medicament exprime dans des mastocytes humains et procede de criblage de ce recepteur
Han et al. Bone marrow mesenchymal stem cells derived exosomal miRNAs can modulate diabetic bone-fat imbalance
JP2004507262A (ja) 慢性炎症性気道疾病の炎症状態に明瞭な影響を与える物質の同定方法
Boehme et al. Antagonism of CRTH2 ameliorates chronic epicutaneous sensitization-induced inflammation by multiple mechanisms
Guo et al. The overexpression of neurokinin B–neurokinin 3 receptor system exerts direct effects on the ovary under PCOS‐like conditions to interfere with mitochondrial function
Tanigawa et al. Species-specific differences in the glucocorticoid receptor transactivation function upon binding with betamethasone-esters
Dondi et al. Expression and differential effects of the activation of glucocorticoid receptors in mouse gonadotropin-releasing hormone neurons
WO2010065096A1 (fr) Essai de criblage d'antidépresseurs

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase in:

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 06706164

Country of ref document: EP

Kind code of ref document: A2

WWW Wipo information: withdrawn in national office

Ref document number: 6706164

Country of ref document: EP