WO2006066355A1 - Chitin-binding peptides - Google Patents
Chitin-binding peptides Download PDFInfo
- Publication number
- WO2006066355A1 WO2006066355A1 PCT/AU2005/001967 AU2005001967W WO2006066355A1 WO 2006066355 A1 WO2006066355 A1 WO 2006066355A1 AU 2005001967 W AU2005001967 W AU 2005001967W WO 2006066355 A1 WO2006066355 A1 WO 2006066355A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- peptide
- cys
- asn
- ala
- peptides
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
- C12N15/8282—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for fungal resistance
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/04—Antibacterial agents
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
- C07K14/42—Lectins, e.g. concanavalin, phytohaemagglutinin
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- the invention relates to peptides capable of inhibiting the growth of fungi, Oomycetes and bacteria, inhibiting infection by plant viruses, and inhibiting the activity of certain metabolic enzymes.
- the invention relates to newly identified representatives of the plant chitin-binding class of antimicrobial peptides, which representatives can be isolated from seeds of Australian endemic gymnosperms such as Araucaria bidwillii, Agathis robusta and Podocarpus elatus.
- the invention further relates to the purification and/or synthesis of the peptides, compositions comprising the peptides, and DNA encoding the peptides.
- the invention still further relates to the use of the peptides and/or DNA encoding the peptides in the prophylaxis or treatment of microbial or viral infestation of a plant.
- the invention also relates to the use of the peptides in the prophylaxis or treatment of microbial infection of an animal subject, particularly a human subject.
- Plant pathogens are those agents capable of causing diseases of plants. These may include fungi belonging to genera such as Sclerotinia, Verticillium, Botrytis, Fusarium, Diaporthe, Macrophomina, Leptosphaeria, Mycosphaerella, Septoria and others; Oomycetes belonging to genera such as Phytophthora, Pythium, Albugo, and the various downy mildew pathogens, bacteria belonging to genera such as Pseudomonas, Xanthomonas, Erwinia,
- the symptoms produced on plants infected with such agents include damping-off, rotting of roots and shoots, malformation of plant organs, leaf and stem spots and others.
- Such infection of plants especially crop plants by plant pathogens such as these may cause lowering of yield both in quantity and quality. It is important therefore that plant pathogens be controlled.
- microorganisms cause diseases in animals such as warm and cold blooded vertebrates.
- Fungal infection of animals are called mycoses and can be caused by fungi belonging to genera such as Candida, Aspergillus, Fusarium, Xylohypha, Trichophyton, Scopulariopsis, Sporothrix, Histoplasma, Coccidioides, Cryptococcus and others. These fungi can cause cutaneous, pulmonary, and systemic infections.
- fungal infection of food stuffs can cause toxicosis as toxins (mycotoxins) produced by the fungus are ingested by the feeding animal. Examples are the aflatoxins, trichothecenes, zearalenone, patulin and others described in Matossian, M.K. [1989] 'Poisons of the past: molds, epidemics, and history', Yale University Press, New Haven.
- Control of many pathogens in plants can be obtained through manipulation of natural resistance genes, direct application of chemicals which inhibit germination of propagules and/or growth and reproduction, or use of other biological agents which either produce antibiotic molecules or compete for ecological niches used by plant pathogens.
- effective or economic control measures are not available as natural genes conferring resistance have not been found or rapid changes in the virulence of the pathogen has rendered natural resistance ineffective or application of pesticides is too expensive or environmentally unacceptable.
- plants are constantly exposed to many microorganisms capable of causing diseases on many plant species they are resistant to many other pathogen species.
- Another option for the control of pathogens in any one plant species is to introduce genes from other species that confer resistance to those pathogens in those other species.
- Plant chemicals may have a direct role in the defense of plants against plant pathogenic microrganisms.
- These proteins have been catergorised into several classes according to either their presumed mode of action and/or their amino acid sequence homologies. These classes include the following: chitinases (Roberts, W.K. et al. [1986] Biochim. Biophys. Acta 880: 161-170); chitin-binding proteins (De Bolle, M.F.C. et al [1992] Plant MoI. Biol.
- Plants produce a number of proteins that have binding affinity for certain carbohydrates. These so-called lectins include some with affinity to poly (iV-acetyl-D- glucosamine) commonly known as chitin.
- the chitin binding proteins in plants have been reviewed by Raikhel and Broekaert (1993) [pp 407-423 in Control of Plant Gene Expression, DPS Verma (ed.) CRC Press] and Raikhel et al. (1993) ⁇ Ann. Rev. Plant Phys. Plant MoI. Biol. 44:591-615]. All include a cysteine/glycine-rich region thought to represent the chitin binding domain.
- Some of the proteins have multiple domains and are capable of agglutinating cells while others such as chitinases combine the chitin binding domain with a catalytic domain capable of hydrolysing chitin.
- Small non-enzymatic lectins have also been isolated from many plant species including cereals such as wheat, barley or rice (Rice and Etzler [1974] Biochem Biophys Res Comm. 59:414-419; Peumanns et al [1982] Biochem J. 203: 139-143; Tsuda [1979] J Biochem. 86:1451-1461) and stinging nettle (Peumanns et al.[1983] FEBS Lett. 177:99-103).
- chitin-binding peptides have been shown by in vitro bioassay to be anti-fungal. These include a peptide, called hevein, from the latex of the rubber tree (Van Parijis et al. [1991] Planta 183: 258-264) and peptides from the leaves of Ginkgo (Huang et al. [2000] FEBS Lett. 478:123-126), bark of the spindle tree (Van den Bergh et al. [2002] FEBS Lett. 530:181-185), leaf intercellular washing fluids (Nielsen et al [1997] Plant Physiol.
- the chitin-binding class of anti-microbial proteins are herein defined as monomeric proteins about 30-45 amino acids lacking enzymatic activity with cysteine backbone of 6-10 cysteine residues forming disulphide bridges, basic pi, small size around 3-5000Da.
- Structural studies performed on hevein (Andersen et al. [1993] Biochemistry 32:1407-1422) and Ac- AMP2 from Amaranthus caudatus (Martins et al. (1996) JMoI Biol. 258: 322-333) show that these peptides, although different in length, consist of 3 antiparallel ⁇ sheets with varying loops and helical turns all stabilised by disulphide bridges.
- chitin-binding peptides The conserved presence of one serine and three aromatic amino acid residues are necessary for chitin binding. Mutagenesis of these residues reduces or removes chitin affinity (Muraki et al. [2000] Protein Engineering 13: 385- 389).
- the recognised biology activity of chitin-binding peptides includes being anti-fungal, anti-Gram-positive bacteria (Van den Bergh et al [2002] FEBS Lett. 530:181-185) and possibly anti-insect.
- the amino acid sequence of an antimicrobial peptide can be determined using a method such as Edman degradation N-terminal sequencing.
- the amino acid sequence provides information that can be used in the subsequent production of the peptide.
- the genes encoding the peptides in their natural substrates can be identified by methods such as RT-PCR, 3' and 5' RACE.
- the gene can be used to produce the peptide by manipulating the genetics of a cell system such that with expression of the gene the cell system produces the desired peptide.
- the cell system could be a whole plant such that expression of the antimicrobial peptide confers some protection from infection and subsequent ingress by pathological agents.
- Agricultural and horticultural plants might be used to express the peptides including sunflower, maize, sorghum, canola, wheat, cotton, grape, rice and all others.
- the cell system could consist of cells maintained in culture such that expression of the gene would require purification of the peptide either from the cell or the medium in which the cells are growing.
- purified peptide could be used ectopically to protect plants, for example as a spray, or animals including humans from infection by infectious agents particularly where those agents are fungi.
- the peptide could be incorporated in some diluent and applied or encapsulated to provide timed release.
- Peptides can also be manufactured by chemically synthesising the amino acid sequence.
- the invention described herein relates to previously unidentified peptides with antimicrobial activity.
- These peptides can be isolated from Araucaria bidwillii (Ab), Agathis robusta (Ar) or Podocarpus elatus (Pe) plants especially from the seed of these plants.
- Araucaria bidwillii and Agathis robusta are members of the Araucariacae family.
- the former produces an edible kernel known commonly as the bunya nut.
- the latter is known as the South Queensland Kauri Pine.
- Podocarpus elatus is a member of the Podocarpaceae family and is known as the Brown pine.
- An object of the invention is to provide new plant chitin-binding peptides having activities not hitherto found in known chitin-binding peptides.
- an isolated or synthetic peptide comprising the sequence: X 1 PX 2 CSPAGX 3 X 4 YCNX 5 GRCCSX 6 X 7 NWCGX 8 TAAYCX 9 X 1 OX 1 1NCIAX12CWZ
- each X is independently any amino acid residue other than C, and Z is a carboxy group or the dipeptide PG.
- an isolated or synthetic DNA which encodes a peptide according to the first embodiment.
- a DNA construct which includes at least one DNA according to the second embodiment operatively linked to elements for the expression of peptide encoded by said DNA.
- a host cell transformed with a DNA construct according to the third embodiment.
- a transgenic plant transformed with a DNA construct according to the third embodiment.
- reproductive material of a transgenic plant according to the fifth embodiment there is provided reproductive material of a transgenic plant according to the fifth embodiment.
- a composition comprising at least one peptide according to the first embodiment together with an agriculturally acceptable carrier, diluent or excipient.
- a composition comprising at least one peptide according to the first embodiment together with a pharmaceutically acceptable carrier, diluent or excipient.
- a method of controlling insect, microbial or viral infestation of a plant comprising: i) introducing a DNA construct according to the third embodiment into said plant; or ii) treating said plant with a peptide according to the first embodiment or a composition according to the seventh embodiment.
- a method of controlling microbial infestation of a mammalian subject comprising treating the subject with a peptide according to the first embodiment or a composition according to the eighth embodiment.
- X I is a polar hydrophilic negatively charged amino acid residue (D or E); and/or X 2 is a polar, hydrophilic, neutral amino acid residue, preferably T or S; and/or
- X 3 is a polar, hydrophilic, positively charged or neutral amino acid residue, preferably R or Q; and/or
- X 4 is selected from F, I or Q;
- X 5 is a polar hydrophilic amino acid residue, preferably D, N or K; and/or X 6 is a polar hydrophilic, positively charged amino acid residue, preferably R or
- X 7 is a neutral amino acid residue, preferably S or F;
- X 8 is a polar, hydrophilic, neutral amino acid residue, preferably N or S, and/or
- X 9 is selected from K, A or Q; and/or X 10 is a polar hydrophilic, positively charged amino acid residue, preferably R or K; and/or
- X II is a neutral amino acid residue, preferably P or G; and/or
- X 12 is a polar, hydrophilic, neutral amino acid residue, preferably N or Q.
- Particularly preferred peptides comprise the following sequences: Asp-Pro-Thr-Cys-Ser-Pro-Ala-Gly-Arg-Phe-Tyr-Cys-Asn-Asp-Gly-Arg-Cys-
- inventions include methods for obtaining or producing the subject peptide, and use of the peptide in the preparation of a medicament for controlling microbial infestation of a mammalian animal. Still further embodiments of the invention relate to the purification and/or synthesis of nascent (pre-translationally processed) protein comprising the subject peptide, compositions comprising the nascent protein, DNA encoding the nascent protein, and, inter alia, uses thereof as described in respect of the subject peptide. Still further embodiments of the invention will become apparent from a reading of the following detailed description and the examples of the invention. The examples include reference to the accompanying drawings briefly described in the following section of the specification.
- Figures 1 shows a cation exchange chromatogram for the purification of AbAFPl and the associated graph of antifungal activity.
- Figure 2 A shows a cation exchange HPLC profile of purified AbAFPl
- Figure 2B shows the results of mass spectrometric analysis of the native AbAFPl SCX- HPLC peak.
- Figure 3 shows the complete amino acid sequences of AbAFPl and the nucleotide sequences of the cDNA encoding AbAFPl.
- the putative translation initiation codon is underlined, the mature sequence as determined from N-terminal sequencing is boxed and the asterisk denotes a translation stop codon.
- Figure 4 shows the cation exchange chromatogram for the purification of ArAFPl and the associated graph of antifungal activity.
- Figure 5A shows the SCX-HPLC profile of purified ArAFPl.
- Figure 5B shows the results of mass spectrometric analysis of the native ArAFPl SCX-
- Figure 6 shows the complete amino acid sequences of ArAFPl and the nucleotide sequences of the putative partial cDNA encoding ArAFPl.
- the mature sequence as determined from N-terminal sequencing is boxed and the asterisk denotes a translation stop codon.
- Figure 7 shows the cation exchange chromatogram for the purification of PeAFPl and the associated graph of antifungal activity.
- Figure 8 A shows the SCX-HPLC profile of purified PeAFP 1.
- Figure 8B shows the results of mass spectrometric analysis of the native PeAFPl SCX- HPLC peak.
- Figure 9 shows the complete amino acid sequences of PeAFPl and the nucleotide sequences of the putative partial cDNA encoding PeAFPl.
- the mature sequence as determined from N-terminal sequencing is boxed and the asterisk denotes a translation stop codon.
- Figure 10 shows the amino acid sequences of AbAFPl, ArAFPl and PeAFPl aligned with those of a number of other chitin-binding peptides.
- An asterisk denotes the presence of amino acid homology at that position in the three peptides while bold type indicates residues homologous for the whole group.
- Figures 11 and 12 are bar graph summaries of control and test results of the effect of PeAFPl on the growth of insect larvae.
- the Figure 11 results are for weight while the Figure 12 results relate to larval size.
- Figure 13 comprises photographs of larvae in control and test experiments. BEST MODE AND OTHER MODES FOR CARRYING OUT THE INVENTION
- the present inventors have identified three new peptides (also referred to herein as proteins) obtainable from the seed of Australian native conifers which have antimicrobial and anti-insect activity.
- the invention provides peptides per se as well as DNA sequences encoding each of the peptides.
- the invention further provides the amino acid sequences of the peptides (Example 3). From these sequences, the sequence of DNA encoding each peptide can be derived by reverse translating the amino-acid sequence. DNA sequences coding for these peptides can be deduced using standard codon tables.
- DNA having a nucleotide sequence encoding the peptides can be synthesised biochemically or isolated from plant tissue of the conifers using standard cloning methods as described in laboratory manuals such as Current Protocols in Molecular Biology (copyright 1987-1995 edited by Ausabel, F.M. et al. and published by John Wiley & Sons, Inc. printed in the U.S.A.).
- the deduced DNA sequence can be used to design oligonucleotide probes or primers that can be used to isolate the encoding gene/s and control sequences.
- the gene/s under control of a tissue specific constitutive or inducible promoter, can be cloned into a biological system which allows expression of the peptides. Transformation methods allowing for the peptides to be expressed in a variety of systems are known. The peptides can then be expressed in any suitable system for the purpose of producing peptide for further use. Suitable hosts for the expression of peptides include E. coli, fungal cells, insect cells, mammalian cells, plant cells and plants. Such methods for expressing peptides in such hosts are described in a variety of texts including Current Protocols in Molecular Biology (supra). As indicated above, a new peptide isolated from the seed of Araucaria bidwillii has been identified. This peptide has potent antimicrobial and anti-insect activity and has the following sequence:
- Example 2 Asn-Cys-Ile-Ala-Asn-Cys-Trp (PeAFPl; SEQ ID NO: 4) Isolation of the foregoing peptides is detailed below in Example 1.
- the peptides are highly basic with predicted pi values for ⁇ 46AFPl of 8.5, for ⁇ 7'AFPl of 8.2 and for PeAFPl of 10.1.
- Each peptide has 8 cysteine residues which are presumed to be involved in four disulphide linkages for stabilisation of the three-dimensional structures of the peptides (Example 2).
- the relative molecular mass of the peptides has been determined by mass spectrometry to be ⁇ AFPl 4,726 ⁇ 2 Da, ⁇ rAFPl 4,640+2 Da and for PeAFPl 4,458+2 Da.
- the amino acid sequences share varying degrees of similarity with previously described peptides/proteins in sequence databases (Swiss Prot and non-redundant databases) searched using the Blast algorithm (Altschul, S.F. et al. [1990] J MoI. Biol. 215: 403). Identity was found with many peptides for which only cDNA or genomic DNA sequences are known.
- the proteins with which the subject peptides have identity include the antimicrobial chitin-binding peptides, chitinases and certain plant agglutinins.
- the peptides described herein show a wide range of anti-fungal activity (Examples 5 and 6) including many fungi that cause serious and economically damaging plant diseases. These peptides may therefore have application in the control of such diseases either by being expressed in the host or through topological application to plant parts. Similarly, the peptides can be used for the control of animal pathogens through topological application or intravenous injection.
- the peptides also have potent activity against insects, particularly insect pests of plants. While the efficacy of the peptides in this regard has been demonstrated against lepidopteran species, the peptides are likely to have activity against all insects by virtue of their ability to bind to chitin and hence interfere with chitin-synthesising enzymes. European corn borer (Ostrinia nubilalis) and corn root worm (Diabrotica virgifera) are examples of insects against which the present peptides have activity.
- the peptides according to the invention can be isolated by any of the methods known to those of skill in the art including the method exemplified herein.
- the peptides can be alternatively synthesised either chemically or enzymatically. These methods will again be known to those of skill in the art.
- DNA according to the second embodiment of the invention can be isolated using any of the techniques known to those of skill in the art.
- An advantageous method is to amplify the relevant gene sequence from genomic DNA after identifying that gene using probes designed from the amino acid sequence of the peptide.
- DNA sequences encoding the peptides can also be chemically synthesized using methods that will be known to the skilled person.
- construct includes vectors such as plasmids, cosmids, viruses, and the like as well as naked DNA per se.
- Control elements which can be included in constructs will be known to those of skill in the art. Examples of such elements are promoters, enhancers, polyadenylation signals and transcription terminators.
- Constructs according to the invention include chimeric genes which are defined herein as genes that do not exist in nature.
- a chimeric gene typically comprises the following elements in 5' to 3' orientation: a promoter functional in a host cell, as defined above operably linked to a DNA encoding a peptide according to the invention in a sense or antisense orientation and a termination and/or polyadenylation signal functional in said cell.
- Other elements for example an enhancer or an intron, or other regulatory sequences, may also be present.
- These chimeric genes may be incorporated into recombinant replicable constructs.
- Operably linked refers to the association of DNA sequences on a single nucleic acid fragment so that the function of one sequence is affected by the other.
- regulatory sequences include transcription activators (enhancers) such as, for example, the translation activator of the tobacco mosaic virus (TMV) which is described in International Application No. WO 87/07644, the tobacco etch virus (TEV) described by Carrington and Freed (see J Virol. 64(4),1590-1597 [1990]), or the figwort mosaic virus described in US Patent No. 5,994,521.
- introns for inclusion in chimeric genes are those which promote gene expression in monocotyledonous plants such as intron 1 of the actin gene described in International Application No. PCT/FR98/02820 (Publication No. WO 99/34005).
- the chimeric gene may also comprise a sequence encoding a signal peptide or a transit peptide.
- sequences allow the encoded polypeptide to be directed to a specific subcellular compartment or aid its secretion.
- the role of such sequences has been in Plant Molecular Biology, Vol., 38 (1998) — see the articles by the following authors: Neuhaus, J.-M. and Rogers, J.C., ppl27-144; Heese-Peck, A. and Raikhel, N.V., pp 145-162; Soil, J. and Tien, R., pp 191-207; Robinson, C. et al, pp 209-221; and, Glaser, E. et al., pp 311-338.
- These transit peptides can be single or double as described in Patent Application No. EP 0 508 909.
- polyadenylation or terminator regulatory sequences may be any suitable sequence of bacterial origin, such as for example the Agrobacterium nos terminator, or alternatively of plant origin, such as for example a histone terminator as described in Patent Application No. EP 0 633 317.
- the host cells of the fourth embodiment of the invention include plant and animal cells.
- Plant cells can be transformed with DNA constructs of the invention according to a variety of known methods such as Agrobacterium-modi&tQd, electroporation, micro-injections, sonication, micro-projectile, and the like.
- the DNA sequences encoding a protein would be used in conjunction with a DNA sequence encoding the native or a heterologous signal peptide sequence which would target the protein to a cellular compartment such as the vacuole or extracellularly to the apoplast.
- These coding sequences can be ligated to a plant promoter sequence that would ensure strong expression in plant cells.
- the promoter sequence might ensure strong constitutive expression of the protein in most or all plant cells, it may be a promoter which ensures expression in specific tissues or cells or it may also be a promoter which ensures strong induction of expression during the infection process.
- the expression cassette will also include a transcription termination codon and polyadenylation signal sequence to allow efficient production and stabilisation of the transcribed mRNA. Efficient expression of a peptide can also be facilitated by inclusion of its DNA sequence into a sequence encoding a much larger protein which is processed inplanta to release the antimicrobial or anti-insect peptide.
- Gene cassettes can be ligated into binary vectors carrying: i) left and right border sequences that flank the T-DNA of the Agrobacterium tumefaciens Ti plasmid; ii) a suitable selectable marker gene for the selection of transformed cells or plants; iii) origins of replication that function in A. tumefaciens or Escherichia coli; and, iv) antibiotic resistance genes that allow selection of plasmid transformed cells of E. coli and A. tumefaciens.
- Such binary vectors can be introduced either by electroporation or tri-parental mating into A.
- tumefaciens strains carrying disarmed Ti plasmids such as strains LBA4404, GV3101 and AGLl or into A. rhizogenes strains such as R4 and NCCPl 885.
- Agrobacterium strains can be co- cultivated with suitable plant explants or intact plant tissue and the transformed plant cells and/or regenerant shoots selected using an agent that allows the presence of the selectable marker gene to be determined.
- Suitable selectable marker genes can be used to confer resistance to antibiotics or herbicides or to produce a molecule that can be assayed fluorometrically or chemically.
- the expression of the subject peptides in transgenic plants can be detected using antibodies raised against the peptide or by using antimicrobial assays.
- the encoding gene cassette can be micro-injected into isolated plant cells which are then selected for introgression of the gene into the genome.
- the gene cassette can be co-precipitated onto gold or tungsten particles along with a plasmid encoding a chimeric selectable marker gene. The encoated particles or projectiles are accelerated into plant cells or tissues.
- the transformed cells and plants according to the invention can comprise, in addition to the sequence encoding a subject peptide, other heterologous sequences encoding proteins of interest such as additional peptides which are capable of conferring on the plant resistance to diseases of bacterial or fungal origin.
- the heterologous sequences can furthermore encode proteins for tolerance to herbicides and/or resistance to insects, such as the Bt proteins in particular (WO 98/40490).
- Sequences encoding disease resistance polypeptides such as the polynucleotide encoding oxalate oxidase (described in US 5,866,778, US 6,229,065, US
- 6,235,530 or EP 0 531 498) can be included in plant cells, as well as polynucleotides encoding fungicidal or bactericidal peptides.
- Such peptides are described in the international applications having the publication numbers WO 97/30082, WO 99/24594, WO 99/02717, WO 99/53053 and WO 99/09189.
- polynucleotides encoding agronomic traits can also be inserted, such as a polynucleotide encoding a delta-6 desaturase (US 5,552,306; US 5,614,313, WO 98/46763 and WO 98/46764), a polynucleotide encoding a serine acetyltransferase (SAT) (see WO 00/01833), or a polynucleotide encoding acyltransferase (see WO 94/13814).
- SAT serine acetyltransferase
- the vector can comprise a chimeric gene which comprises a first sequence encoding a peptide according to the invention and at least one other sequence encoding another peptide or protein of interest.
- Transgenic plants according to the invention may also be obtained by crossing parental strains.
- one parental strain carrying a gene encoding a peptide according to the invention can be crossed with another strain carrying a gene encoding at least one other peptide or protein of interest.
- Mammalian cells that can be transformed with constructs according to the invention will be known to those of skill in the art. Like plant cell transformation, mammalian cells can be transformed using any of the techniques known to those of skill in the art.
- both monocotyledonous and dicotyledonous plants can be transformed and regenerated.
- Plants which can be genetically modified include grains, forage crops, fruits, vegetables, oil seed crops, palms, forestry, and vines. Specific examples of plants which can be modified follow: maize, banana, peanut, field peas, sunflower, tomato, canola, tobacco, wheat, barley, oats, potato, soybeans, cotton, carnations, sorghum, lupin, rice, and oilseed rape.
- These, as well as other agricultural plants can be transformed with genes encoding the peptides such that they exhibit a greater degree of resistance to pathogen attack.
- the peptides can be used for the control of microbial or insect infestation of a plant by topological application to the subject plant or to tissue thereof.
- reproductive material of a transgenic plant includes seeds, pollen, ovules, progeny plants and clonal material.
- control is used to denote the prophylaxis or treatment of a microbial disease or infestation of a plant or mammalian subject, or insect infestation of a plant.
- compositions according to the seventh and eighth embodiments can comprise any one of the subject peptides or any combination thereof.
- Compositions for administration to mammals can furthermore comprise other antimicrobial agents known to those of skill in the art, while compositions for application to plants can include other insect control agents.
- Non-limiting examples of the invention follow.
- Antifungal bioassays were conducted using microspectrophotometry essentially as described by Cammue et ⁇ /.[1992] J. Biol Chem. 276: 2228-2233 in a defined fungal growth medium (FGM) consisting OfK 2 HPO 4 (2.5 niM), MgSO 4 (50 mM), CaCl 2 (50 niM), FeSO 4 (5mM), CoCl 2 (0.1 mM), CuSO 4 (0.1 niM), Na 2 MoO 4 (2 mM), H 3 BO 4 (0.5 niM), KI (0.1 mM), ZnSO 4 (0.5 mM), MnSO 4 (0.1 mM), sucrose (10 g/L), asparagine (1 g/L), methionine (20 mg/L), myo-inositol (2 mg/L), biotin (0.2 mg/L), thiamine-HCl (1 mg/L) and pyridoxine-HCl (0.2 mg/L).
- FGM
- Some fungi which did not grow satisfactorily in the defined growth medium were bioassayed in half strength potato dextrose broth (1/2 PDB). Yeasts were assayed in quarter strength yeast peptone broth (1/4 YPD). Bioassays were performed in 96 well microtitre plates where 50 ⁇ L of filter-sterilised protein test samples dissolved in water were added to 50 ⁇ L of fungal inoculum. In control wells 50 ⁇ L of sterile water was added to 50 ⁇ L of fungal inoculum.
- Fungal inoculum consisted of spores (50,000 spores/mL), yeast cells (50,000 cells/mL) or mycelial fragments (produced by blending a mycelial mass grown in broth and passing the macerate through a fine screen to remove larger hyphal fragments).
- Microtitre plates were incubated at 25 0 C. Filamentous fungi were incubated stationery while yeasts were gently shaken on a microtitre plate shaker. Fungal growth in the microtitre plate wells was assessed by measuring the change in absorbance at 600 nm (A 6 oo) over time. The A 600 at each assessment time was corrected by deducting the absorbance at time zero.
- Inhibition of growth was calculated as corrected absorbance of the test wells as a percentage of the control wells. Results are expressed as either IC 5O or MIC values which are the concentrations of protein required to give corrected absorbances 50% and less than 10% of control absorbances, respectively, at the first assessment when the corrected A 600 of the control wells exceeded 0.4. This point was reached anywhere from 48 to 144 hours incubation depending on the growth rate of the different fungi.
- Microtiter biotests were performed in vitro to evaluate the antifungal spectrum and efficacy of the peptides studied.
- One microtiter plate per fungus was prepared.
- the peptide solution (5, 10, 20 ppm) was added to 10 ⁇ l of fungi in potato dextrose broth (PDB).
- PDB potato dextrose broth
- the microtiter plates were then incubated in the dark at room temperature (21-22°C) except for Michrodochium nivale for which the microtiter plates were incubated in the dark at 4-10°C.
- the absorbance at 620 nm was measured 5 days after inoculation.
- the fungal growth was expressed as the difference between the optical density at 620 nm at a given time (OD( 620 ) t ) and at the beginning of the experiment (OD (62 o ) i).
- the inhibition efficacy of a peptide was calculated as follows:
- Efficacy% 100(OD( 620 ) t -OD (62 o)i)(UTC) - (OD (62 o) t -OD (620) i)(peptide)/
- OD( (620)t -OD (62 o ) i)(UTC) where (OD (620)t -OD (620) i)(peptide) is the growth of the fungus in presence of peptide and (OD (620)t -OD( 620) i)(UTC) is the growth of the same fungus without peptide (untreated control).
- Seeds were flaked in a domestic food processor (Big Oscar, Sunbeam Appliances). Since the seed of A. robusta contains appreciable amounts of lipids the resulting meal was extracted for 1 hr with 2.5 L petroleum ether (30-40 0 C BP) at room temperature. Petroleum ether was added periodically to replace that lost through evaporation. The dissolved lipids were removed in the solvent by drawing through a sintered glass funnel under vacuum. The seed meal of A. bidwillii and P. elatus was not defatted.
- the seed meals were extracted twice with excess 0.05 M H 2 SO 4 for lhr at room temperature with occasional stirring. After each extraction the liquid phase was decanted off and centrifuged for 10 min at 10,000g. The two supernatants for each seed meal were pooled, adjusted to 20 mM MES at pH 6 with NaOH. After standing at 4 0 C overnight the supernatants were centrifuged for 60 min at 4 0 C at 10,00Og. This fraction was further purified as described in the following section. Cation-exchange chromatography of acid extracts of seeds of native Australian conifers Protein samples were passed through 0.45 ⁇ m filters to remove any particulate matter before cation exchange chromatography.
- Cation exchange chromatography of the extracts was performed on Source 15S media in a HRl 6/10 column (Pharmacia) equilibrated with 20 mM MES pH6. Aliquots of 250 mL of clarified extract were loaded. Following loading of the sample the column was washed with 20 mM MES pH 6 until A 28 O measurements reached >0.05 AUFS. Bound proteins were eluted by passing a linear gradient of 0 to 2 M NaCl in 20 mM MES pH 6 over 90 min at 5 mL/min. The eluate was monitored by online measurement of the absorbance at 280 nm and eluted proteins were collected in either 10 or 20 mL fractions.
- Fractions from the cation-exchange chromatography procedures outlined above were bioassayed against the fungus Sclerotinia sclerotiorum. Protein concentrations were measured using the BCA assay (Pierce) against a standard curve generated using BSA and proteins solutions were diluted wherever possible to 50 ⁇ g/mL with sterile MilliQTM water (Millipore Corporation).
- Anti-fungal activity was found in several early eluting fractions in the cation-exchange profile of A. bidwillii ( Figure 1). Desalted fractions eluting between 50-100 mM NaCl completely inhibited growth of Sclerotinia sclerotiorum from ascospore inoculum, that is, MIC values were equal to or less than 25 ⁇ g/mL. Active fractions were subjected to high resolution cation-exchange HPLC to further purify anti-fungal activity.
- the cation-exchange fractions of A. bidwillii that exhibited strong activity against S. sclerotiorum when subjected to cation-exchange HPLC provided simple chromatograms where in each case complete inhibition of fungal growth was provided by fractions eluting between 55-62 min (32-35 mS/cm) ( Figure 2).
- the active factor in this peak was called AbAFPl (Araucaria bidwillii antifungal protein 1).
- Protein fractions from cation-exchange purification of the extract from Podocarpus elatus were subjected to high resolution cation-exchange HPLC as described for the fractions from A. bidwillii.
- the fractions corresponding to this peak completely inhibited growth of S. sclerotiorum and Botrytis cinerea at 25 ⁇ g/mL.
- the active factor in this peak was called PeAFPl (Podocarpus elatus antifungal protein 1).
- the peptides were also subjected to reduction of possible disulphide bonds with dithiothreitol and alkylation of free thiol groups of cysteines with 4-vinylpyridine.
- Approximately 50 ⁇ g of peptide were dissolved in 800 ⁇ L reduction/alkylation buffer (6 M guanidinium-Cl in 100 mM Tris buffer pH 8, 0.01% EDTA) to which was added 4 mg DTT.
- the reduction reaction was conducted under argon at 37 0 C for 2 hr.
- Four microlitres of 4- vinylpyridine was added and the alkylation reaction was conducted overnight under argon, at room temperature and in darkness.
- the reduced and alkylated peptides were separated from reactants by reversed-phase HPLC on a Jupiter C 18 TM (Phenomenex) column (30 x 4.6 mm) and analysed by mass spectroscopy.
- the reduced and alkylated AbAFPl sample gave a mass of 5575+ 2Da.
- the mass of ArAFPl increased to 5492 ⁇ 2Da and that of PeAFPl increased to 5306+ 2Da.
- the mass increases over the native peptides were each 848- 850 mass units. This gain in mass was interpreted as the reaction of eight 4-vinylpyridine groups (mass 106 Da) with 8 cysteine residues in each of the peptides. This conclusion has been confirmed by amino acid sequencing (Example 3) and nucleotide sequence of putative encoding genes (Example 7).
- amino acid and cDNA sequences were subjected to comparison against published databases to evaluate whether the peptides described herein had been previously identified.
- Amino acid sequences were analysed using the BLASTP algorithm [Basic Logic Alignment Search Tool, Altscul et at. (1997) Nucleic Acids Research 25: 3389- 3402] against the SwissProt database and non-redundant databases at NCBI.
- the BLAST searches identified a number of similarities of the peptides described herein and chitin-binding lectins of various sizes, including other chitin-binding peptides.
- the in vitro antifungal activity of A b AFPl was evaluated on seven fungal strains responsible for major field damage to crops using the second procedure described above in General Methods.
- the seven strains were: Michrodochium nivale, Fusarium culmorum, Fusarium graminearum, Fusarium moniliforme subglutinans, Fusarium moniliforme profilferatum, Sclerotinia sclerotiorum, Septoria tritici.
- the results of the evaluations are presented in the following table in which the data are for inhibition efficacy (%) at 5, 10 and 20 ppm.
- RNAlaterTM RNA stabilisation solution
- Total RNA was extracted from 4-5g of frozen tissue by using the Hot Borate method of Wilkins and Smart (1996) [p 21-41 Laboratory Guide to RNA: Isolation, Analysis and Synthesis, PA Krieg (ed.), Wiley-Liss].
- Poly (A)+ mRNA was purified by affinity separation using the OligotexTM system (QIAGEN Pty Ltd). Double stranded cDNA was prepared from the mRNA using the SMARTTM PCR cDNA synthesis kit (Clontech).
- the software package Mac Vector 6.0TM was used to predict degenerate probes from the degenerate reverse translations from the amino acid sequences. The same software was then used to predict the suitability of the probes as PCR primers.
- Degenerate primers were synthesised for use in 3' RACE. The following degenerate oligonucleotide primer was designed from amino acids 9-15 present in the known sequence of AbAFPl.
- AbAFPl Degenerate 5 1 GNT TYT AYT GYA AYG AYG G 3 1 (SEQ ID NO: 18)
- This primer and the oligonucleotide primer specific to the cDNA prepared with the SMARTTM system— ie, TS-PCR: 5' AAGCAGTGGTATCAACGCAGAGT 3' (SEQ ID NO: 19)— were used to amplify DNA fragments from the cDNA template.
- Control PCR reactions were also performed using only AbAFPl Degenerate or TS-PCR primers with the cDNA template.
- thermocycling program included an initial step of 94 0 C for 5min, followed by 30 cycles of 92 0 C for 45sec, 5O 0 C for 30sec and 72 0 C for 1 min before a final step of 72 0 C for 7min.
- Amplification products were separated by electrophoresis on 1.5% (w/v) agarose gel. Bands present in the amplifications using AbAFPl Degenerate and TS-PCR primers together but absent when only or other primer was used in the PCR were excised from the gel, purified using a ConcertTM DNA clean-up kit and cloned into the vector pGemT EasyTM (Promega) and transformed into E. coli (Top 10TM, Invitrogen) using the procedures recommended by the various manufacturers.
- Inserts were sequenced using the fluorescent dideoxy terminator reaction procedure (PRISMTM, ABI).
- PRISMTM fluorescent dideoxy terminator reaction procedure
- the following degenerate oligonucleotide primer designed from amino acids 8 — 15 present in the known sequence of ArAFPl was used for performing 3' RACE of ArAFPl :
- ArAFPl Degenerate 5' GNC ARC ART AYT GYA AYA AYG G 3' (SEQ ID NO: 20) PCR was performed as described for the AbAFPl 3' RACE.
- PCR was performed as described for AbAFPl 3' RACE except that the annealing temperature used was 55 0 C.
- Sequencing of amplification products provided sequences that when translated conformed to the known amino acid sequences of the C-terminal ends of the peptides. From these sequences the software package MacVector 6.0TM was used to predict suitable anti-sense primers for 5' RACE. The respective primers were: AbAFPl Anti-sense: 5' AGA CTT GCT CGA TCT ACA CG 3' (SEQ ID NO: 22)
- ArAFPl Anti-sense 5' GTG AGG GCA GTA ACA CCG 3' (SEQ ID NO: 23)
- PeAFPl Anti-sense 5' AAG CCA TTG GAT TGG AGG 3' (SEQ ID NO: 24)
- the AbAFPl and PeAFPl anti-sense primers were situated in the 3' UTR while the ArAFPl anti-sense primer was situated 5 1 of the stop codon. These primers were used in conjunction with the TS-PCR primer to amplify the respective cDNA pools under the amplification conditions described for the 3' RACE reactions. Strong amplifications not present in the control reactions were cloned and sequenced. In each case sequences complimentary to the respective sequences produced with 3' RACE were recovered. Contigs were created between the respective 3' and 5' RACE products.
- the AbAFPl Contig (SEQ ID NO: 25) was approximately 600 nucleotides in length and included an ORF (open reading frame) encoding a 94 amino acid sequence (SEQ ID NO: 26) within which are the 43 amino acids corresponding exactly to AbAFPl .
- the ORF also encodes 26 N-terminal amino acids with a predicted signal peptide structure obeying the rules of von Heijne (1985, MoI. Biol. 184: 99-105). There are also C-terminal 25 amino acids of unknown function. It is predicted therefore that AbAFPl is part of a tripartite protein that undergoes post-translational processing before release of mature AbAFPl (Figure 3).
- the ArAFPl Contig (SEQ ID NO: 27) was approximately 550 nucleotides in length and included a coding region (SEQ ID NO: 28) that when translated included a sequence of 43 amino acids corresponding exactly to ArAFPl. There are 29 amino acids N-terminal to this sequence and 30 amino acids C-terminal. It is predicted therefore ArAFPl is part of a tripartite protein that undergoes post-translational processing before release of mature ArAFPl ( Figure 6).
- the PeAFPl Contig (SEQ ID NO: 29) was shorter at only 420 nucleotides. It is predicted that 5' RACE did not obtain the full 5' sequence. However, the sequence obtained when translated (SEQ ID NO: 30) included a sequence of 41 amino acids corresponding exactly to the sequence of PeAFPl obtained though peptide sequencing (Example 3). There are at least 15 amino acids N-terminal and 29 amino acids C-terminal to the PeAFPl coding sequence. It is predicted therefore PeAFPl is part of a tripartite protein that undergoes post- translational processing before release of mature PeAFPl (Figure 9).
- chitinases, agglutinins and the like presented the possibility that these peptides might also possess such activity.
- a 1 ml column was packed with chitin (poly-N-acetylglucosamine from crab shells, Sigma C-3132) particles that passed through a 30 mesh screen.
- the column was extensively washed with alternate cycles of 50 mM NH 4 Acetate (pH 7) and 100 mM acetic acid (pH 2.8) and the eluant monitored until no material absorbing at 280nm passed from the column.
- the column was then equilibrated with 50 mM NH 4 Acetate and 200 ⁇ g of either AbAFPl, ArAFPl or PeAFPl dissolved in the same buffer was loaded.
- PeAFPl The peptide PeAFPl exemplified above was tested for effects on lepidopteran larvae given that it has some similarity to a number of multivalent lectins that have been shown to possess anti-insect activity.
- PeAFPl was incorporated into the insect diet at 5 mg/niL and dispensed in 0.5 mL aliquots in small disposable plastic receptacles. Second instar larvae of Helicoverpa armigera were weighed and placed 1 per receptacle. Control insects were provided diet without PeAFPl or with the addition of 5 mg/mL BSA as a control protein. Each day insects were checked for mortality, on days 2, 3, 4, 5, and 7 after enclosure larvae were assessed for developmental stage (instar) and on days 3 and 7 after enclosure larvae were weighed. Twenty-four replicate insects were used for each treatment.
- Range 0.8-2 .4 2.2- 11.6- 2.0- 2.0- 2.0- 2.0- 3.0- 3.0-
- Range 0.6-2. 1 0.8-7.2 0.9- 2.0- 2.0- 2.0- 2.0- 2.0- 2.0- 2.0- 2.0-
Abstract
Description
Claims
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU2004907323A AU2004907323A0 (en) | 2004-12-24 | Chitin-Binding Peptides | |
AU2004907323 | 2004-12-24 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2006066355A1 true WO2006066355A1 (en) | 2006-06-29 |
Family
ID=36601289
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/AU2005/001967 WO2006066355A1 (en) | 2004-12-24 | 2005-12-23 | Chitin-binding peptides |
Country Status (1)
Country | Link |
---|---|
WO (1) | WO2006066355A1 (en) |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2006117464A1 (en) * | 2005-04-29 | 2006-11-09 | Laboratoire Nuxe | Skin protective composition based on araucaria grain extracts |
US11883450B1 (en) | 2023-04-28 | 2024-01-30 | King Faisal University | Extract of Agathis robusta as antifungal agent |
-
2005
- 2005-12-23 WO PCT/AU2005/001967 patent/WO2006066355A1/en not_active Application Discontinuation
Non-Patent Citations (2)
Title |
---|
MURAKI M. ET AL.: "Chemically prepared hevein domains: effect of C-terminal truncation and the mutagenesis of aromatic residues on the affinity for chitin", PROTEIN ENGINEERING, vol. 13, no. 6, 2000, pages 385 - 389 * |
NIELSEN K.K. ET AL.: "Characterization of a New Antifungal Chitin-Binding Peptide from Sugar Beet Leaves", PLANT PHYSIOL., vol. 113, 1997, pages 83 - 91, XP002213469, DOI: doi:10.1104/pp.113.1.83 * |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2006117464A1 (en) * | 2005-04-29 | 2006-11-09 | Laboratoire Nuxe | Skin protective composition based on araucaria grain extracts |
US11883450B1 (en) | 2023-04-28 | 2024-01-30 | King Faisal University | Extract of Agathis robusta as antifungal agent |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
JP3375130B2 (en) | Biocidal protein | |
US6187904B1 (en) | Biocidal proteins | |
US5986176A (en) | Transgenic plants expressing biocidal proteins | |
US20020168392A1 (en) | Antimicrobial proteins | |
KR101957550B1 (en) | Antifungal plant proteins, peptides, and methods of use | |
US5750504A (en) | Antimicrobial proteins | |
US5861480A (en) | Antimicrobial proteins from aralia and impatiens | |
EP0672146B1 (en) | Biocidal chitin binding proteins | |
EP0593501B1 (en) | Biocidal proteins | |
WO2006066355A1 (en) | Chitin-binding peptides | |
CZ289646B6 (en) | Antimicrobial proteins, recombinant DNAs encoding thereof, antimicrobial preparation containing thereof and method of fighting fungi or bacteria | |
AU723474B2 (en) | Antimicrobial proteins | |
WO1997028185A1 (en) | Anti-microbial protein | |
AU1536997A (en) | Anti-microbial protein |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KM KN KP KR KZ LC LK LR LS LT LU LV LY MA MD MG MK MN MW MX MZ NA NG NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SM SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU LV MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
NENP | Non-entry into the national phase |
Ref country code: DE |
|
122 | Ep: pct application non-entry in european phase |
Ref document number: 05821482 Country of ref document: EP Kind code of ref document: A1 |
|
WWW | Wipo information: withdrawn in national office |
Ref document number: 5821482 Country of ref document: EP |