WO2006066355A1 - Chitin-binding peptides - Google Patents

Chitin-binding peptides Download PDF

Info

Publication number
WO2006066355A1
WO2006066355A1 PCT/AU2005/001967 AU2005001967W WO2006066355A1 WO 2006066355 A1 WO2006066355 A1 WO 2006066355A1 AU 2005001967 W AU2005001967 W AU 2005001967W WO 2006066355 A1 WO2006066355 A1 WO 2006066355A1
Authority
WO
WIPO (PCT)
Prior art keywords
peptide
cys
asn
ala
peptides
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/AU2005/001967
Other languages
French (fr)
Inventor
Kenneth Clifford Goulter
Rachel Baltz
Manuel Dubald
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
CHARLES DARWIN UNIVERSITY
NORTHERN TERRITORY OF AUSTRALIA ACTING THROUGH ITS DEPARTMENT OF PRIMARY INDUSTRY FISHERIES AND MINES
University of Queensland UQ
Australian National University
Commonwealth Scientific and Industrial Research Organization CSIRO
BSES Ltd
Northern Territory of Australia
Department of Agriculture, Fisheries and Forestry
Queensland Department of Primary Industries and Fisheries
Biogemma SAS
Original Assignee
CHARLES DARWIN UNIVERSITY
NORTHERN TERRITORY OF AUSTRALIA ACTING THROUGH ITS DEPARTMENT OF PRIMARY INDUSTRY FISHERIES AND MINES
University of Queensland UQ
Australian National University
Commonwealth Scientific and Industrial Research Organization CSIRO
BSES Ltd
Northern Territory of Australia
Department of Agriculture and Fisheries
Department of Agriculture, Fisheries and Forestry
Biogemma SAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from AU2004907323A external-priority patent/AU2004907323A0/en
Application filed by CHARLES DARWIN UNIVERSITY, NORTHERN TERRITORY OF AUSTRALIA ACTING THROUGH ITS DEPARTMENT OF PRIMARY INDUSTRY FISHERIES AND MINES, University of Queensland UQ, Australian National University, Commonwealth Scientific and Industrial Research Organization CSIRO, BSES Ltd, Northern Territory of Australia, Department of Agriculture and Fisheries, Department of Agriculture, Fisheries and Forestry, Biogemma SAS filed Critical CHARLES DARWIN UNIVERSITY
Publication of WO2006066355A1 publication Critical patent/WO2006066355A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8279Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
    • C12N15/8282Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for fungal resistance
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04Antibacterial agents
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • C07K14/42Lectins, e.g. concanavalin, phytohaemagglutinin
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides

Definitions

  • the invention relates to peptides capable of inhibiting the growth of fungi, Oomycetes and bacteria, inhibiting infection by plant viruses, and inhibiting the activity of certain metabolic enzymes.
  • the invention relates to newly identified representatives of the plant chitin-binding class of antimicrobial peptides, which representatives can be isolated from seeds of Australian endemic gymnosperms such as Araucaria bidwillii, Agathis robusta and Podocarpus elatus.
  • the invention further relates to the purification and/or synthesis of the peptides, compositions comprising the peptides, and DNA encoding the peptides.
  • the invention still further relates to the use of the peptides and/or DNA encoding the peptides in the prophylaxis or treatment of microbial or viral infestation of a plant.
  • the invention also relates to the use of the peptides in the prophylaxis or treatment of microbial infection of an animal subject, particularly a human subject.
  • Plant pathogens are those agents capable of causing diseases of plants. These may include fungi belonging to genera such as Sclerotinia, Verticillium, Botrytis, Fusarium, Diaporthe, Macrophomina, Leptosphaeria, Mycosphaerella, Septoria and others; Oomycetes belonging to genera such as Phytophthora, Pythium, Albugo, and the various downy mildew pathogens, bacteria belonging to genera such as Pseudomonas, Xanthomonas, Erwinia,
  • the symptoms produced on plants infected with such agents include damping-off, rotting of roots and shoots, malformation of plant organs, leaf and stem spots and others.
  • Such infection of plants especially crop plants by plant pathogens such as these may cause lowering of yield both in quantity and quality. It is important therefore that plant pathogens be controlled.
  • microorganisms cause diseases in animals such as warm and cold blooded vertebrates.
  • Fungal infection of animals are called mycoses and can be caused by fungi belonging to genera such as Candida, Aspergillus, Fusarium, Xylohypha, Trichophyton, Scopulariopsis, Sporothrix, Histoplasma, Coccidioides, Cryptococcus and others. These fungi can cause cutaneous, pulmonary, and systemic infections.
  • fungal infection of food stuffs can cause toxicosis as toxins (mycotoxins) produced by the fungus are ingested by the feeding animal. Examples are the aflatoxins, trichothecenes, zearalenone, patulin and others described in Matossian, M.K. [1989] 'Poisons of the past: molds, epidemics, and history', Yale University Press, New Haven.
  • Control of many pathogens in plants can be obtained through manipulation of natural resistance genes, direct application of chemicals which inhibit germination of propagules and/or growth and reproduction, or use of other biological agents which either produce antibiotic molecules or compete for ecological niches used by plant pathogens.
  • effective or economic control measures are not available as natural genes conferring resistance have not been found or rapid changes in the virulence of the pathogen has rendered natural resistance ineffective or application of pesticides is too expensive or environmentally unacceptable.
  • plants are constantly exposed to many microorganisms capable of causing diseases on many plant species they are resistant to many other pathogen species.
  • Another option for the control of pathogens in any one plant species is to introduce genes from other species that confer resistance to those pathogens in those other species.
  • Plant chemicals may have a direct role in the defense of plants against plant pathogenic microrganisms.
  • These proteins have been catergorised into several classes according to either their presumed mode of action and/or their amino acid sequence homologies. These classes include the following: chitinases (Roberts, W.K. et al. [1986] Biochim. Biophys. Acta 880: 161-170); chitin-binding proteins (De Bolle, M.F.C. et al [1992] Plant MoI. Biol.
  • Plants produce a number of proteins that have binding affinity for certain carbohydrates. These so-called lectins include some with affinity to poly (iV-acetyl-D- glucosamine) commonly known as chitin.
  • the chitin binding proteins in plants have been reviewed by Raikhel and Broekaert (1993) [pp 407-423 in Control of Plant Gene Expression, DPS Verma (ed.) CRC Press] and Raikhel et al. (1993) ⁇ Ann. Rev. Plant Phys. Plant MoI. Biol. 44:591-615]. All include a cysteine/glycine-rich region thought to represent the chitin binding domain.
  • Some of the proteins have multiple domains and are capable of agglutinating cells while others such as chitinases combine the chitin binding domain with a catalytic domain capable of hydrolysing chitin.
  • Small non-enzymatic lectins have also been isolated from many plant species including cereals such as wheat, barley or rice (Rice and Etzler [1974] Biochem Biophys Res Comm. 59:414-419; Peumanns et al [1982] Biochem J. 203: 139-143; Tsuda [1979] J Biochem. 86:1451-1461) and stinging nettle (Peumanns et al.[1983] FEBS Lett. 177:99-103).
  • chitin-binding peptides have been shown by in vitro bioassay to be anti-fungal. These include a peptide, called hevein, from the latex of the rubber tree (Van Parijis et al. [1991] Planta 183: 258-264) and peptides from the leaves of Ginkgo (Huang et al. [2000] FEBS Lett. 478:123-126), bark of the spindle tree (Van den Bergh et al. [2002] FEBS Lett. 530:181-185), leaf intercellular washing fluids (Nielsen et al [1997] Plant Physiol.
  • the chitin-binding class of anti-microbial proteins are herein defined as monomeric proteins about 30-45 amino acids lacking enzymatic activity with cysteine backbone of 6-10 cysteine residues forming disulphide bridges, basic pi, small size around 3-5000Da.
  • Structural studies performed on hevein (Andersen et al. [1993] Biochemistry 32:1407-1422) and Ac- AMP2 from Amaranthus caudatus (Martins et al. (1996) JMoI Biol. 258: 322-333) show that these peptides, although different in length, consist of 3 antiparallel ⁇ sheets with varying loops and helical turns all stabilised by disulphide bridges.
  • chitin-binding peptides The conserved presence of one serine and three aromatic amino acid residues are necessary for chitin binding. Mutagenesis of these residues reduces or removes chitin affinity (Muraki et al. [2000] Protein Engineering 13: 385- 389).
  • the recognised biology activity of chitin-binding peptides includes being anti-fungal, anti-Gram-positive bacteria (Van den Bergh et al [2002] FEBS Lett. 530:181-185) and possibly anti-insect.
  • the amino acid sequence of an antimicrobial peptide can be determined using a method such as Edman degradation N-terminal sequencing.
  • the amino acid sequence provides information that can be used in the subsequent production of the peptide.
  • the genes encoding the peptides in their natural substrates can be identified by methods such as RT-PCR, 3' and 5' RACE.
  • the gene can be used to produce the peptide by manipulating the genetics of a cell system such that with expression of the gene the cell system produces the desired peptide.
  • the cell system could be a whole plant such that expression of the antimicrobial peptide confers some protection from infection and subsequent ingress by pathological agents.
  • Agricultural and horticultural plants might be used to express the peptides including sunflower, maize, sorghum, canola, wheat, cotton, grape, rice and all others.
  • the cell system could consist of cells maintained in culture such that expression of the gene would require purification of the peptide either from the cell or the medium in which the cells are growing.
  • purified peptide could be used ectopically to protect plants, for example as a spray, or animals including humans from infection by infectious agents particularly where those agents are fungi.
  • the peptide could be incorporated in some diluent and applied or encapsulated to provide timed release.
  • Peptides can also be manufactured by chemically synthesising the amino acid sequence.
  • the invention described herein relates to previously unidentified peptides with antimicrobial activity.
  • These peptides can be isolated from Araucaria bidwillii (Ab), Agathis robusta (Ar) or Podocarpus elatus (Pe) plants especially from the seed of these plants.
  • Araucaria bidwillii and Agathis robusta are members of the Araucariacae family.
  • the former produces an edible kernel known commonly as the bunya nut.
  • the latter is known as the South Queensland Kauri Pine.
  • Podocarpus elatus is a member of the Podocarpaceae family and is known as the Brown pine.
  • An object of the invention is to provide new plant chitin-binding peptides having activities not hitherto found in known chitin-binding peptides.
  • an isolated or synthetic peptide comprising the sequence: X 1 PX 2 CSPAGX 3 X 4 YCNX 5 GRCCSX 6 X 7 NWCGX 8 TAAYCX 9 X 1 OX 1 1NCIAX12CWZ
  • each X is independently any amino acid residue other than C, and Z is a carboxy group or the dipeptide PG.
  • an isolated or synthetic DNA which encodes a peptide according to the first embodiment.
  • a DNA construct which includes at least one DNA according to the second embodiment operatively linked to elements for the expression of peptide encoded by said DNA.
  • a host cell transformed with a DNA construct according to the third embodiment.
  • a transgenic plant transformed with a DNA construct according to the third embodiment.
  • reproductive material of a transgenic plant according to the fifth embodiment there is provided reproductive material of a transgenic plant according to the fifth embodiment.
  • a composition comprising at least one peptide according to the first embodiment together with an agriculturally acceptable carrier, diluent or excipient.
  • a composition comprising at least one peptide according to the first embodiment together with a pharmaceutically acceptable carrier, diluent or excipient.
  • a method of controlling insect, microbial or viral infestation of a plant comprising: i) introducing a DNA construct according to the third embodiment into said plant; or ii) treating said plant with a peptide according to the first embodiment or a composition according to the seventh embodiment.
  • a method of controlling microbial infestation of a mammalian subject comprising treating the subject with a peptide according to the first embodiment or a composition according to the eighth embodiment.
  • X I is a polar hydrophilic negatively charged amino acid residue (D or E); and/or X 2 is a polar, hydrophilic, neutral amino acid residue, preferably T or S; and/or
  • X 3 is a polar, hydrophilic, positively charged or neutral amino acid residue, preferably R or Q; and/or
  • X 4 is selected from F, I or Q;
  • X 5 is a polar hydrophilic amino acid residue, preferably D, N or K; and/or X 6 is a polar hydrophilic, positively charged amino acid residue, preferably R or
  • X 7 is a neutral amino acid residue, preferably S or F;
  • X 8 is a polar, hydrophilic, neutral amino acid residue, preferably N or S, and/or
  • X 9 is selected from K, A or Q; and/or X 10 is a polar hydrophilic, positively charged amino acid residue, preferably R or K; and/or
  • X II is a neutral amino acid residue, preferably P or G; and/or
  • X 12 is a polar, hydrophilic, neutral amino acid residue, preferably N or Q.
  • Particularly preferred peptides comprise the following sequences: Asp-Pro-Thr-Cys-Ser-Pro-Ala-Gly-Arg-Phe-Tyr-Cys-Asn-Asp-Gly-Arg-Cys-
  • inventions include methods for obtaining or producing the subject peptide, and use of the peptide in the preparation of a medicament for controlling microbial infestation of a mammalian animal. Still further embodiments of the invention relate to the purification and/or synthesis of nascent (pre-translationally processed) protein comprising the subject peptide, compositions comprising the nascent protein, DNA encoding the nascent protein, and, inter alia, uses thereof as described in respect of the subject peptide. Still further embodiments of the invention will become apparent from a reading of the following detailed description and the examples of the invention. The examples include reference to the accompanying drawings briefly described in the following section of the specification.
  • Figures 1 shows a cation exchange chromatogram for the purification of AbAFPl and the associated graph of antifungal activity.
  • Figure 2 A shows a cation exchange HPLC profile of purified AbAFPl
  • Figure 2B shows the results of mass spectrometric analysis of the native AbAFPl SCX- HPLC peak.
  • Figure 3 shows the complete amino acid sequences of AbAFPl and the nucleotide sequences of the cDNA encoding AbAFPl.
  • the putative translation initiation codon is underlined, the mature sequence as determined from N-terminal sequencing is boxed and the asterisk denotes a translation stop codon.
  • Figure 4 shows the cation exchange chromatogram for the purification of ArAFPl and the associated graph of antifungal activity.
  • Figure 5A shows the SCX-HPLC profile of purified ArAFPl.
  • Figure 5B shows the results of mass spectrometric analysis of the native ArAFPl SCX-
  • Figure 6 shows the complete amino acid sequences of ArAFPl and the nucleotide sequences of the putative partial cDNA encoding ArAFPl.
  • the mature sequence as determined from N-terminal sequencing is boxed and the asterisk denotes a translation stop codon.
  • Figure 7 shows the cation exchange chromatogram for the purification of PeAFPl and the associated graph of antifungal activity.
  • Figure 8 A shows the SCX-HPLC profile of purified PeAFP 1.
  • Figure 8B shows the results of mass spectrometric analysis of the native PeAFPl SCX- HPLC peak.
  • Figure 9 shows the complete amino acid sequences of PeAFPl and the nucleotide sequences of the putative partial cDNA encoding PeAFPl.
  • the mature sequence as determined from N-terminal sequencing is boxed and the asterisk denotes a translation stop codon.
  • Figure 10 shows the amino acid sequences of AbAFPl, ArAFPl and PeAFPl aligned with those of a number of other chitin-binding peptides.
  • An asterisk denotes the presence of amino acid homology at that position in the three peptides while bold type indicates residues homologous for the whole group.
  • Figures 11 and 12 are bar graph summaries of control and test results of the effect of PeAFPl on the growth of insect larvae.
  • the Figure 11 results are for weight while the Figure 12 results relate to larval size.
  • Figure 13 comprises photographs of larvae in control and test experiments. BEST MODE AND OTHER MODES FOR CARRYING OUT THE INVENTION
  • the present inventors have identified three new peptides (also referred to herein as proteins) obtainable from the seed of Australian native conifers which have antimicrobial and anti-insect activity.
  • the invention provides peptides per se as well as DNA sequences encoding each of the peptides.
  • the invention further provides the amino acid sequences of the peptides (Example 3). From these sequences, the sequence of DNA encoding each peptide can be derived by reverse translating the amino-acid sequence. DNA sequences coding for these peptides can be deduced using standard codon tables.
  • DNA having a nucleotide sequence encoding the peptides can be synthesised biochemically or isolated from plant tissue of the conifers using standard cloning methods as described in laboratory manuals such as Current Protocols in Molecular Biology (copyright 1987-1995 edited by Ausabel, F.M. et al. and published by John Wiley & Sons, Inc. printed in the U.S.A.).
  • the deduced DNA sequence can be used to design oligonucleotide probes or primers that can be used to isolate the encoding gene/s and control sequences.
  • the gene/s under control of a tissue specific constitutive or inducible promoter, can be cloned into a biological system which allows expression of the peptides. Transformation methods allowing for the peptides to be expressed in a variety of systems are known. The peptides can then be expressed in any suitable system for the purpose of producing peptide for further use. Suitable hosts for the expression of peptides include E. coli, fungal cells, insect cells, mammalian cells, plant cells and plants. Such methods for expressing peptides in such hosts are described in a variety of texts including Current Protocols in Molecular Biology (supra). As indicated above, a new peptide isolated from the seed of Araucaria bidwillii has been identified. This peptide has potent antimicrobial and anti-insect activity and has the following sequence:
  • Example 2 Asn-Cys-Ile-Ala-Asn-Cys-Trp (PeAFPl; SEQ ID NO: 4) Isolation of the foregoing peptides is detailed below in Example 1.
  • the peptides are highly basic with predicted pi values for ⁇ 46AFPl of 8.5, for ⁇ 7'AFPl of 8.2 and for PeAFPl of 10.1.
  • Each peptide has 8 cysteine residues which are presumed to be involved in four disulphide linkages for stabilisation of the three-dimensional structures of the peptides (Example 2).
  • the relative molecular mass of the peptides has been determined by mass spectrometry to be ⁇ AFPl 4,726 ⁇ 2 Da, ⁇ rAFPl 4,640+2 Da and for PeAFPl 4,458+2 Da.
  • the amino acid sequences share varying degrees of similarity with previously described peptides/proteins in sequence databases (Swiss Prot and non-redundant databases) searched using the Blast algorithm (Altschul, S.F. et al. [1990] J MoI. Biol. 215: 403). Identity was found with many peptides for which only cDNA or genomic DNA sequences are known.
  • the proteins with which the subject peptides have identity include the antimicrobial chitin-binding peptides, chitinases and certain plant agglutinins.
  • the peptides described herein show a wide range of anti-fungal activity (Examples 5 and 6) including many fungi that cause serious and economically damaging plant diseases. These peptides may therefore have application in the control of such diseases either by being expressed in the host or through topological application to plant parts. Similarly, the peptides can be used for the control of animal pathogens through topological application or intravenous injection.
  • the peptides also have potent activity against insects, particularly insect pests of plants. While the efficacy of the peptides in this regard has been demonstrated against lepidopteran species, the peptides are likely to have activity against all insects by virtue of their ability to bind to chitin and hence interfere with chitin-synthesising enzymes. European corn borer (Ostrinia nubilalis) and corn root worm (Diabrotica virgifera) are examples of insects against which the present peptides have activity.
  • the peptides according to the invention can be isolated by any of the methods known to those of skill in the art including the method exemplified herein.
  • the peptides can be alternatively synthesised either chemically or enzymatically. These methods will again be known to those of skill in the art.
  • DNA according to the second embodiment of the invention can be isolated using any of the techniques known to those of skill in the art.
  • An advantageous method is to amplify the relevant gene sequence from genomic DNA after identifying that gene using probes designed from the amino acid sequence of the peptide.
  • DNA sequences encoding the peptides can also be chemically synthesized using methods that will be known to the skilled person.
  • construct includes vectors such as plasmids, cosmids, viruses, and the like as well as naked DNA per se.
  • Control elements which can be included in constructs will be known to those of skill in the art. Examples of such elements are promoters, enhancers, polyadenylation signals and transcription terminators.
  • Constructs according to the invention include chimeric genes which are defined herein as genes that do not exist in nature.
  • a chimeric gene typically comprises the following elements in 5' to 3' orientation: a promoter functional in a host cell, as defined above operably linked to a DNA encoding a peptide according to the invention in a sense or antisense orientation and a termination and/or polyadenylation signal functional in said cell.
  • Other elements for example an enhancer or an intron, or other regulatory sequences, may also be present.
  • These chimeric genes may be incorporated into recombinant replicable constructs.
  • Operably linked refers to the association of DNA sequences on a single nucleic acid fragment so that the function of one sequence is affected by the other.
  • regulatory sequences include transcription activators (enhancers) such as, for example, the translation activator of the tobacco mosaic virus (TMV) which is described in International Application No. WO 87/07644, the tobacco etch virus (TEV) described by Carrington and Freed (see J Virol. 64(4),1590-1597 [1990]), or the figwort mosaic virus described in US Patent No. 5,994,521.
  • introns for inclusion in chimeric genes are those which promote gene expression in monocotyledonous plants such as intron 1 of the actin gene described in International Application No. PCT/FR98/02820 (Publication No. WO 99/34005).
  • the chimeric gene may also comprise a sequence encoding a signal peptide or a transit peptide.
  • sequences allow the encoded polypeptide to be directed to a specific subcellular compartment or aid its secretion.
  • the role of such sequences has been in Plant Molecular Biology, Vol., 38 (1998) — see the articles by the following authors: Neuhaus, J.-M. and Rogers, J.C., ppl27-144; Heese-Peck, A. and Raikhel, N.V., pp 145-162; Soil, J. and Tien, R., pp 191-207; Robinson, C. et al, pp 209-221; and, Glaser, E. et al., pp 311-338.
  • These transit peptides can be single or double as described in Patent Application No. EP 0 508 909.
  • polyadenylation or terminator regulatory sequences may be any suitable sequence of bacterial origin, such as for example the Agrobacterium nos terminator, or alternatively of plant origin, such as for example a histone terminator as described in Patent Application No. EP 0 633 317.
  • the host cells of the fourth embodiment of the invention include plant and animal cells.
  • Plant cells can be transformed with DNA constructs of the invention according to a variety of known methods such as Agrobacterium-modi&tQd, electroporation, micro-injections, sonication, micro-projectile, and the like.
  • the DNA sequences encoding a protein would be used in conjunction with a DNA sequence encoding the native or a heterologous signal peptide sequence which would target the protein to a cellular compartment such as the vacuole or extracellularly to the apoplast.
  • These coding sequences can be ligated to a plant promoter sequence that would ensure strong expression in plant cells.
  • the promoter sequence might ensure strong constitutive expression of the protein in most or all plant cells, it may be a promoter which ensures expression in specific tissues or cells or it may also be a promoter which ensures strong induction of expression during the infection process.
  • the expression cassette will also include a transcription termination codon and polyadenylation signal sequence to allow efficient production and stabilisation of the transcribed mRNA. Efficient expression of a peptide can also be facilitated by inclusion of its DNA sequence into a sequence encoding a much larger protein which is processed inplanta to release the antimicrobial or anti-insect peptide.
  • Gene cassettes can be ligated into binary vectors carrying: i) left and right border sequences that flank the T-DNA of the Agrobacterium tumefaciens Ti plasmid; ii) a suitable selectable marker gene for the selection of transformed cells or plants; iii) origins of replication that function in A. tumefaciens or Escherichia coli; and, iv) antibiotic resistance genes that allow selection of plasmid transformed cells of E. coli and A. tumefaciens.
  • Such binary vectors can be introduced either by electroporation or tri-parental mating into A.
  • tumefaciens strains carrying disarmed Ti plasmids such as strains LBA4404, GV3101 and AGLl or into A. rhizogenes strains such as R4 and NCCPl 885.
  • Agrobacterium strains can be co- cultivated with suitable plant explants or intact plant tissue and the transformed plant cells and/or regenerant shoots selected using an agent that allows the presence of the selectable marker gene to be determined.
  • Suitable selectable marker genes can be used to confer resistance to antibiotics or herbicides or to produce a molecule that can be assayed fluorometrically or chemically.
  • the expression of the subject peptides in transgenic plants can be detected using antibodies raised against the peptide or by using antimicrobial assays.
  • the encoding gene cassette can be micro-injected into isolated plant cells which are then selected for introgression of the gene into the genome.
  • the gene cassette can be co-precipitated onto gold or tungsten particles along with a plasmid encoding a chimeric selectable marker gene. The encoated particles or projectiles are accelerated into plant cells or tissues.
  • the transformed cells and plants according to the invention can comprise, in addition to the sequence encoding a subject peptide, other heterologous sequences encoding proteins of interest such as additional peptides which are capable of conferring on the plant resistance to diseases of bacterial or fungal origin.
  • the heterologous sequences can furthermore encode proteins for tolerance to herbicides and/or resistance to insects, such as the Bt proteins in particular (WO 98/40490).
  • Sequences encoding disease resistance polypeptides such as the polynucleotide encoding oxalate oxidase (described in US 5,866,778, US 6,229,065, US
  • 6,235,530 or EP 0 531 498) can be included in plant cells, as well as polynucleotides encoding fungicidal or bactericidal peptides.
  • Such peptides are described in the international applications having the publication numbers WO 97/30082, WO 99/24594, WO 99/02717, WO 99/53053 and WO 99/09189.
  • polynucleotides encoding agronomic traits can also be inserted, such as a polynucleotide encoding a delta-6 desaturase (US 5,552,306; US 5,614,313, WO 98/46763 and WO 98/46764), a polynucleotide encoding a serine acetyltransferase (SAT) (see WO 00/01833), or a polynucleotide encoding acyltransferase (see WO 94/13814).
  • SAT serine acetyltransferase
  • the vector can comprise a chimeric gene which comprises a first sequence encoding a peptide according to the invention and at least one other sequence encoding another peptide or protein of interest.
  • Transgenic plants according to the invention may also be obtained by crossing parental strains.
  • one parental strain carrying a gene encoding a peptide according to the invention can be crossed with another strain carrying a gene encoding at least one other peptide or protein of interest.
  • Mammalian cells that can be transformed with constructs according to the invention will be known to those of skill in the art. Like plant cell transformation, mammalian cells can be transformed using any of the techniques known to those of skill in the art.
  • both monocotyledonous and dicotyledonous plants can be transformed and regenerated.
  • Plants which can be genetically modified include grains, forage crops, fruits, vegetables, oil seed crops, palms, forestry, and vines. Specific examples of plants which can be modified follow: maize, banana, peanut, field peas, sunflower, tomato, canola, tobacco, wheat, barley, oats, potato, soybeans, cotton, carnations, sorghum, lupin, rice, and oilseed rape.
  • These, as well as other agricultural plants can be transformed with genes encoding the peptides such that they exhibit a greater degree of resistance to pathogen attack.
  • the peptides can be used for the control of microbial or insect infestation of a plant by topological application to the subject plant or to tissue thereof.
  • reproductive material of a transgenic plant includes seeds, pollen, ovules, progeny plants and clonal material.
  • control is used to denote the prophylaxis or treatment of a microbial disease or infestation of a plant or mammalian subject, or insect infestation of a plant.
  • compositions according to the seventh and eighth embodiments can comprise any one of the subject peptides or any combination thereof.
  • Compositions for administration to mammals can furthermore comprise other antimicrobial agents known to those of skill in the art, while compositions for application to plants can include other insect control agents.
  • Non-limiting examples of the invention follow.
  • Antifungal bioassays were conducted using microspectrophotometry essentially as described by Cammue et ⁇ /.[1992] J. Biol Chem. 276: 2228-2233 in a defined fungal growth medium (FGM) consisting OfK 2 HPO 4 (2.5 niM), MgSO 4 (50 mM), CaCl 2 (50 niM), FeSO 4 (5mM), CoCl 2 (0.1 mM), CuSO 4 (0.1 niM), Na 2 MoO 4 (2 mM), H 3 BO 4 (0.5 niM), KI (0.1 mM), ZnSO 4 (0.5 mM), MnSO 4 (0.1 mM), sucrose (10 g/L), asparagine (1 g/L), methionine (20 mg/L), myo-inositol (2 mg/L), biotin (0.2 mg/L), thiamine-HCl (1 mg/L) and pyridoxine-HCl (0.2 mg/L).
  • FGM
  • Some fungi which did not grow satisfactorily in the defined growth medium were bioassayed in half strength potato dextrose broth (1/2 PDB). Yeasts were assayed in quarter strength yeast peptone broth (1/4 YPD). Bioassays were performed in 96 well microtitre plates where 50 ⁇ L of filter-sterilised protein test samples dissolved in water were added to 50 ⁇ L of fungal inoculum. In control wells 50 ⁇ L of sterile water was added to 50 ⁇ L of fungal inoculum.
  • Fungal inoculum consisted of spores (50,000 spores/mL), yeast cells (50,000 cells/mL) or mycelial fragments (produced by blending a mycelial mass grown in broth and passing the macerate through a fine screen to remove larger hyphal fragments).
  • Microtitre plates were incubated at 25 0 C. Filamentous fungi were incubated stationery while yeasts were gently shaken on a microtitre plate shaker. Fungal growth in the microtitre plate wells was assessed by measuring the change in absorbance at 600 nm (A 6 oo) over time. The A 600 at each assessment time was corrected by deducting the absorbance at time zero.
  • Inhibition of growth was calculated as corrected absorbance of the test wells as a percentage of the control wells. Results are expressed as either IC 5O or MIC values which are the concentrations of protein required to give corrected absorbances 50% and less than 10% of control absorbances, respectively, at the first assessment when the corrected A 600 of the control wells exceeded 0.4. This point was reached anywhere from 48 to 144 hours incubation depending on the growth rate of the different fungi.
  • Microtiter biotests were performed in vitro to evaluate the antifungal spectrum and efficacy of the peptides studied.
  • One microtiter plate per fungus was prepared.
  • the peptide solution (5, 10, 20 ppm) was added to 10 ⁇ l of fungi in potato dextrose broth (PDB).
  • PDB potato dextrose broth
  • the microtiter plates were then incubated in the dark at room temperature (21-22°C) except for Michrodochium nivale for which the microtiter plates were incubated in the dark at 4-10°C.
  • the absorbance at 620 nm was measured 5 days after inoculation.
  • the fungal growth was expressed as the difference between the optical density at 620 nm at a given time (OD( 620 ) t ) and at the beginning of the experiment (OD (62 o ) i).
  • the inhibition efficacy of a peptide was calculated as follows:
  • Efficacy% 100(OD( 620 ) t -OD (62 o)i)(UTC) - (OD (62 o) t -OD (620) i)(peptide)/
  • OD( (620)t -OD (62 o ) i)(UTC) where (OD (620)t -OD (620) i)(peptide) is the growth of the fungus in presence of peptide and (OD (620)t -OD( 620) i)(UTC) is the growth of the same fungus without peptide (untreated control).
  • Seeds were flaked in a domestic food processor (Big Oscar, Sunbeam Appliances). Since the seed of A. robusta contains appreciable amounts of lipids the resulting meal was extracted for 1 hr with 2.5 L petroleum ether (30-40 0 C BP) at room temperature. Petroleum ether was added periodically to replace that lost through evaporation. The dissolved lipids were removed in the solvent by drawing through a sintered glass funnel under vacuum. The seed meal of A. bidwillii and P. elatus was not defatted.
  • the seed meals were extracted twice with excess 0.05 M H 2 SO 4 for lhr at room temperature with occasional stirring. After each extraction the liquid phase was decanted off and centrifuged for 10 min at 10,000g. The two supernatants for each seed meal were pooled, adjusted to 20 mM MES at pH 6 with NaOH. After standing at 4 0 C overnight the supernatants were centrifuged for 60 min at 4 0 C at 10,00Og. This fraction was further purified as described in the following section. Cation-exchange chromatography of acid extracts of seeds of native Australian conifers Protein samples were passed through 0.45 ⁇ m filters to remove any particulate matter before cation exchange chromatography.
  • Cation exchange chromatography of the extracts was performed on Source 15S media in a HRl 6/10 column (Pharmacia) equilibrated with 20 mM MES pH6. Aliquots of 250 mL of clarified extract were loaded. Following loading of the sample the column was washed with 20 mM MES pH 6 until A 28 O measurements reached >0.05 AUFS. Bound proteins were eluted by passing a linear gradient of 0 to 2 M NaCl in 20 mM MES pH 6 over 90 min at 5 mL/min. The eluate was monitored by online measurement of the absorbance at 280 nm and eluted proteins were collected in either 10 or 20 mL fractions.
  • Fractions from the cation-exchange chromatography procedures outlined above were bioassayed against the fungus Sclerotinia sclerotiorum. Protein concentrations were measured using the BCA assay (Pierce) against a standard curve generated using BSA and proteins solutions were diluted wherever possible to 50 ⁇ g/mL with sterile MilliQTM water (Millipore Corporation).
  • Anti-fungal activity was found in several early eluting fractions in the cation-exchange profile of A. bidwillii ( Figure 1). Desalted fractions eluting between 50-100 mM NaCl completely inhibited growth of Sclerotinia sclerotiorum from ascospore inoculum, that is, MIC values were equal to or less than 25 ⁇ g/mL. Active fractions were subjected to high resolution cation-exchange HPLC to further purify anti-fungal activity.
  • the cation-exchange fractions of A. bidwillii that exhibited strong activity against S. sclerotiorum when subjected to cation-exchange HPLC provided simple chromatograms where in each case complete inhibition of fungal growth was provided by fractions eluting between 55-62 min (32-35 mS/cm) ( Figure 2).
  • the active factor in this peak was called AbAFPl (Araucaria bidwillii antifungal protein 1).
  • Protein fractions from cation-exchange purification of the extract from Podocarpus elatus were subjected to high resolution cation-exchange HPLC as described for the fractions from A. bidwillii.
  • the fractions corresponding to this peak completely inhibited growth of S. sclerotiorum and Botrytis cinerea at 25 ⁇ g/mL.
  • the active factor in this peak was called PeAFPl (Podocarpus elatus antifungal protein 1).
  • the peptides were also subjected to reduction of possible disulphide bonds with dithiothreitol and alkylation of free thiol groups of cysteines with 4-vinylpyridine.
  • Approximately 50 ⁇ g of peptide were dissolved in 800 ⁇ L reduction/alkylation buffer (6 M guanidinium-Cl in 100 mM Tris buffer pH 8, 0.01% EDTA) to which was added 4 mg DTT.
  • the reduction reaction was conducted under argon at 37 0 C for 2 hr.
  • Four microlitres of 4- vinylpyridine was added and the alkylation reaction was conducted overnight under argon, at room temperature and in darkness.
  • the reduced and alkylated peptides were separated from reactants by reversed-phase HPLC on a Jupiter C 18 TM (Phenomenex) column (30 x 4.6 mm) and analysed by mass spectroscopy.
  • the reduced and alkylated AbAFPl sample gave a mass of 5575+ 2Da.
  • the mass of ArAFPl increased to 5492 ⁇ 2Da and that of PeAFPl increased to 5306+ 2Da.
  • the mass increases over the native peptides were each 848- 850 mass units. This gain in mass was interpreted as the reaction of eight 4-vinylpyridine groups (mass 106 Da) with 8 cysteine residues in each of the peptides. This conclusion has been confirmed by amino acid sequencing (Example 3) and nucleotide sequence of putative encoding genes (Example 7).
  • amino acid and cDNA sequences were subjected to comparison against published databases to evaluate whether the peptides described herein had been previously identified.
  • Amino acid sequences were analysed using the BLASTP algorithm [Basic Logic Alignment Search Tool, Altscul et at. (1997) Nucleic Acids Research 25: 3389- 3402] against the SwissProt database and non-redundant databases at NCBI.
  • the BLAST searches identified a number of similarities of the peptides described herein and chitin-binding lectins of various sizes, including other chitin-binding peptides.
  • the in vitro antifungal activity of A b AFPl was evaluated on seven fungal strains responsible for major field damage to crops using the second procedure described above in General Methods.
  • the seven strains were: Michrodochium nivale, Fusarium culmorum, Fusarium graminearum, Fusarium moniliforme subglutinans, Fusarium moniliforme profilferatum, Sclerotinia sclerotiorum, Septoria tritici.
  • the results of the evaluations are presented in the following table in which the data are for inhibition efficacy (%) at 5, 10 and 20 ppm.
  • RNAlaterTM RNA stabilisation solution
  • Total RNA was extracted from 4-5g of frozen tissue by using the Hot Borate method of Wilkins and Smart (1996) [p 21-41 Laboratory Guide to RNA: Isolation, Analysis and Synthesis, PA Krieg (ed.), Wiley-Liss].
  • Poly (A)+ mRNA was purified by affinity separation using the OligotexTM system (QIAGEN Pty Ltd). Double stranded cDNA was prepared from the mRNA using the SMARTTM PCR cDNA synthesis kit (Clontech).
  • the software package Mac Vector 6.0TM was used to predict degenerate probes from the degenerate reverse translations from the amino acid sequences. The same software was then used to predict the suitability of the probes as PCR primers.
  • Degenerate primers were synthesised for use in 3' RACE. The following degenerate oligonucleotide primer was designed from amino acids 9-15 present in the known sequence of AbAFPl.
  • AbAFPl Degenerate 5 1 GNT TYT AYT GYA AYG AYG G 3 1 (SEQ ID NO: 18)
  • This primer and the oligonucleotide primer specific to the cDNA prepared with the SMARTTM system— ie, TS-PCR: 5' AAGCAGTGGTATCAACGCAGAGT 3' (SEQ ID NO: 19)— were used to amplify DNA fragments from the cDNA template.
  • Control PCR reactions were also performed using only AbAFPl Degenerate or TS-PCR primers with the cDNA template.
  • thermocycling program included an initial step of 94 0 C for 5min, followed by 30 cycles of 92 0 C for 45sec, 5O 0 C for 30sec and 72 0 C for 1 min before a final step of 72 0 C for 7min.
  • Amplification products were separated by electrophoresis on 1.5% (w/v) agarose gel. Bands present in the amplifications using AbAFPl Degenerate and TS-PCR primers together but absent when only or other primer was used in the PCR were excised from the gel, purified using a ConcertTM DNA clean-up kit and cloned into the vector pGemT EasyTM (Promega) and transformed into E. coli (Top 10TM, Invitrogen) using the procedures recommended by the various manufacturers.
  • Inserts were sequenced using the fluorescent dideoxy terminator reaction procedure (PRISMTM, ABI).
  • PRISMTM fluorescent dideoxy terminator reaction procedure
  • the following degenerate oligonucleotide primer designed from amino acids 8 — 15 present in the known sequence of ArAFPl was used for performing 3' RACE of ArAFPl :
  • ArAFPl Degenerate 5' GNC ARC ART AYT GYA AYA AYG G 3' (SEQ ID NO: 20) PCR was performed as described for the AbAFPl 3' RACE.
  • PCR was performed as described for AbAFPl 3' RACE except that the annealing temperature used was 55 0 C.
  • Sequencing of amplification products provided sequences that when translated conformed to the known amino acid sequences of the C-terminal ends of the peptides. From these sequences the software package MacVector 6.0TM was used to predict suitable anti-sense primers for 5' RACE. The respective primers were: AbAFPl Anti-sense: 5' AGA CTT GCT CGA TCT ACA CG 3' (SEQ ID NO: 22)
  • ArAFPl Anti-sense 5' GTG AGG GCA GTA ACA CCG 3' (SEQ ID NO: 23)
  • PeAFPl Anti-sense 5' AAG CCA TTG GAT TGG AGG 3' (SEQ ID NO: 24)
  • the AbAFPl and PeAFPl anti-sense primers were situated in the 3' UTR while the ArAFPl anti-sense primer was situated 5 1 of the stop codon. These primers were used in conjunction with the TS-PCR primer to amplify the respective cDNA pools under the amplification conditions described for the 3' RACE reactions. Strong amplifications not present in the control reactions were cloned and sequenced. In each case sequences complimentary to the respective sequences produced with 3' RACE were recovered. Contigs were created between the respective 3' and 5' RACE products.
  • the AbAFPl Contig (SEQ ID NO: 25) was approximately 600 nucleotides in length and included an ORF (open reading frame) encoding a 94 amino acid sequence (SEQ ID NO: 26) within which are the 43 amino acids corresponding exactly to AbAFPl .
  • the ORF also encodes 26 N-terminal amino acids with a predicted signal peptide structure obeying the rules of von Heijne (1985, MoI. Biol. 184: 99-105). There are also C-terminal 25 amino acids of unknown function. It is predicted therefore that AbAFPl is part of a tripartite protein that undergoes post-translational processing before release of mature AbAFPl (Figure 3).
  • the ArAFPl Contig (SEQ ID NO: 27) was approximately 550 nucleotides in length and included a coding region (SEQ ID NO: 28) that when translated included a sequence of 43 amino acids corresponding exactly to ArAFPl. There are 29 amino acids N-terminal to this sequence and 30 amino acids C-terminal. It is predicted therefore ArAFPl is part of a tripartite protein that undergoes post-translational processing before release of mature ArAFPl ( Figure 6).
  • the PeAFPl Contig (SEQ ID NO: 29) was shorter at only 420 nucleotides. It is predicted that 5' RACE did not obtain the full 5' sequence. However, the sequence obtained when translated (SEQ ID NO: 30) included a sequence of 41 amino acids corresponding exactly to the sequence of PeAFPl obtained though peptide sequencing (Example 3). There are at least 15 amino acids N-terminal and 29 amino acids C-terminal to the PeAFPl coding sequence. It is predicted therefore PeAFPl is part of a tripartite protein that undergoes post- translational processing before release of mature PeAFPl (Figure 9).
  • chitinases, agglutinins and the like presented the possibility that these peptides might also possess such activity.
  • a 1 ml column was packed with chitin (poly-N-acetylglucosamine from crab shells, Sigma C-3132) particles that passed through a 30 mesh screen.
  • the column was extensively washed with alternate cycles of 50 mM NH 4 Acetate (pH 7) and 100 mM acetic acid (pH 2.8) and the eluant monitored until no material absorbing at 280nm passed from the column.
  • the column was then equilibrated with 50 mM NH 4 Acetate and 200 ⁇ g of either AbAFPl, ArAFPl or PeAFPl dissolved in the same buffer was loaded.
  • PeAFPl The peptide PeAFPl exemplified above was tested for effects on lepidopteran larvae given that it has some similarity to a number of multivalent lectins that have been shown to possess anti-insect activity.
  • PeAFPl was incorporated into the insect diet at 5 mg/niL and dispensed in 0.5 mL aliquots in small disposable plastic receptacles. Second instar larvae of Helicoverpa armigera were weighed and placed 1 per receptacle. Control insects were provided diet without PeAFPl or with the addition of 5 mg/mL BSA as a control protein. Each day insects were checked for mortality, on days 2, 3, 4, 5, and 7 after enclosure larvae were assessed for developmental stage (instar) and on days 3 and 7 after enclosure larvae were weighed. Twenty-four replicate insects were used for each treatment.
  • Range 0.8-2 .4 2.2- 11.6- 2.0- 2.0- 2.0- 2.0- 3.0- 3.0-
  • Range 0.6-2. 1 0.8-7.2 0.9- 2.0- 2.0- 2.0- 2.0- 2.0- 2.0- 2.0- 2.0-

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Oncology (AREA)
  • Biophysics (AREA)
  • Animal Behavior & Ethology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • General Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Communicable Diseases (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Botany (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The invention provides plant chitin-binding peptides having activities not hitherto found in known chitin-binding peptides or proteins. The peptides according to the invention comprise the sequence X1PX2CSPAGX3X4YCNX5GRCCSX6X7NWCGX8TAAYCX9X10X11NCIAX12CWZ wherein, each X is independently any amino acid residue other than C, and Z is a carboxy group or the dipeptide PG. The invention also provides DNA encoding the peptides, constructs comprising the DNA, host cells transformed with the foregoing constructs, transgenic plants comprising the DNA, and reproductive material of such plants. The invention further provides compositions of the chitin-binding peptides and use of the peptides in controlling microbial infestation of a subject mammal, or insect or microbial infestation of a plant.

Description

CHITIN-BINDING PEPTIDES
TECHNICAL FIELD
The invention relates to peptides capable of inhibiting the growth of fungi, Oomycetes and bacteria, inhibiting infection by plant viruses, and inhibiting the activity of certain metabolic enzymes. In particular, the invention relates to newly identified representatives of the plant chitin-binding class of antimicrobial peptides, which representatives can be isolated from seeds of Australian endemic gymnosperms such as Araucaria bidwillii, Agathis robusta and Podocarpus elatus. The invention further relates to the purification and/or synthesis of the peptides, compositions comprising the peptides, and DNA encoding the peptides. The invention still further relates to the use of the peptides and/or DNA encoding the peptides in the prophylaxis or treatment of microbial or viral infestation of a plant. The invention also relates to the use of the peptides in the prophylaxis or treatment of microbial infection of an animal subject, particularly a human subject.
BACKGROUND OF THE INVENTION Control of Pathogenic Microorganisms
Plant pathogens are those agents capable of causing diseases of plants. These may include fungi belonging to genera such as Sclerotinia, Verticillium, Botrytis, Fusarium, Diaporthe, Macrophomina, Leptosphaeria, Mycosphaerella, Septoria and others; Oomycetes belonging to genera such as Phytophthora, Pythium, Albugo, and the various downy mildew pathogens, bacteria belonging to genera such as Pseudomonas, Xanthomonas, Erwinia,
Ralstonia, Clavibacter, and Agrobacterium and various viruses, phytoplasmas and nematodes. The symptoms produced on plants infected with such agents include damping-off, rotting of roots and shoots, malformation of plant organs, leaf and stem spots and others. Such infection of plants especially crop plants by plant pathogens such as these may cause lowering of yield both in quantity and quality. It is important therefore that plant pathogens be controlled.
Similarly microorganisms cause diseases in animals such as warm and cold blooded vertebrates. Fungal infection of animals are called mycoses and can be caused by fungi belonging to genera such as Candida, Aspergillus, Fusarium, Xylohypha, Trichophyton, Scopulariopsis, Sporothrix, Histoplasma, Coccidioides, Cryptococcus and others. These fungi can cause cutaneous, pulmonary, and systemic infections. As well fungal infection of food stuffs can cause toxicosis as toxins (mycotoxins) produced by the fungus are ingested by the feeding animal. Examples are the aflatoxins, trichothecenes, zearalenone, patulin and others described in Matossian, M.K. [1989] 'Poisons of the past: molds, epidemics, and history', Yale University Press, New Haven.
Control of many pathogens in plants can be obtained through manipulation of natural resistance genes, direct application of chemicals which inhibit germination of propagules and/or growth and reproduction, or use of other biological agents which either produce antibiotic molecules or compete for ecological niches used by plant pathogens. However, for many diseases effective or economic control measures are not available as natural genes conferring resistance have not been found or rapid changes in the virulence of the pathogen has rendered natural resistance ineffective or application of pesticides is too expensive or environmentally unacceptable. Although plants are constantly exposed to many microorganisms capable of causing diseases on many plant species they are resistant to many other pathogen species. Another option for the control of pathogens in any one plant species is to introduce genes from other species that confer resistance to those pathogens in those other species. Plant chemicals may have a direct role in the defense of plants against plant pathogenic microrganisms. The earliest studied were the phytoalexins which low molecular weight secondary metabolites produced in response to pathogen challenge. More recently it has been shown that plants produce a large number of proteins and peptides which when isolated demonstrate antibiotic activity. These proteins have been catergorised into several classes according to either their presumed mode of action and/or their amino acid sequence homologies. These classes include the following: chitinases (Roberts, W.K. et al. [1986] Biochim. Biophys. Acta 880: 161-170); chitin-binding proteins (De Bolle, M.F.C. et al [1992] Plant MoI. Biol. 22: 1187-1190 and Van Parijis, J. et al. [1991] Planta 183: 258-264); β-1,3- glucanases(Manners, J.D. et al. [1973] Phytochemistry 12: 547-553); ribosome-inactivating proteins (Leah, R. et al. [1991] J. Biol. Chem. 266: 1564-1573); α and β thionins (Fernandez de Caleya, R. et al. [1972] Appl Microbiol. 23: 998-1000 and Bohlmann, H. et al. [1988] EMBO J. 7:1559-1565); permatins, thaumatin-like and osmotin-like proteins (Woloshuk, CP. et al. [1991] Plant Cell 3: 619-628 and Hejgaard, J. [1991] FEBS Letts. 291: 127-131 and Vigers, AJ. et al. [1991] MoI. Plant-Microbe Interact. 4:315-323); non-specific lipid transfer proteins (Molina, A. et al. [1993] FEBS Letts. 3166: 119-122); 2s Albumins (Terras, F.R.G. et «/.[1992] J. Biol. Chem 267: 15301-15309) and plant defensins (Terras, F.R.G. et al. [1995] Plant Cell 7:5723-588). Other antimicrobial proteins from plants that have yet to be classified into broad groups include the peptide Mz-AMPl (Macadamia integrifolia- Antimicrobial Protein 1) ( Marcus, J.P. et α/.[1997] Eur. J. Biochem 244:743-749), the neurotoxin-like antimicrobial knottin-type peptides from Mirabilis jalapa (Cammue, B.P.A. et al.[l992] J. Biol. Chem. 67:2228-2233), the peptides of Impatiens balsamina (Tailor, R.H et al. [1997] J. Biol. Chem. 272:24480-24487) and snakin-1 from potato tubers (Segura et al. [1999] MoI. Plant Micr. /wf. 12:16-23) Chitin-Binding Peptides
Plants produce a number of proteins that have binding affinity for certain carbohydrates. These so-called lectins include some with affinity to poly (iV-acetyl-D- glucosamine) commonly known as chitin. The chitin binding proteins in plants have been reviewed by Raikhel and Broekaert (1993) [pp 407-423 in Control of Plant Gene Expression, DPS Verma (ed.) CRC Press] and Raikhel et al. (1993) {Ann. Rev. Plant Phys. Plant MoI. Biol. 44:591-615]. All include a cysteine/glycine-rich region thought to represent the chitin binding domain. Some of the proteins have multiple domains and are capable of agglutinating cells while others such as chitinases combine the chitin binding domain with a catalytic domain capable of hydrolysing chitin. Small non-enzymatic lectins have also been isolated from many plant species including cereals such as wheat, barley or rice (Rice and Etzler [1974] Biochem Biophys Res Comm. 59:414-419; Peumanns et al [1982] Biochem J. 203: 139-143; Tsuda [1979] J Biochem. 86:1451-1461) and stinging nettle (Peumanns et al.[1983] FEBS Lett. 177:99-103). Many of these small chitin-binding peptides have been shown by in vitro bioassay to be anti-fungal. These include a peptide, called hevein, from the latex of the rubber tree (Van Parijis et al. [1991] Planta 183: 258-264) and peptides from the leaves of Ginkgo (Huang et al. [2000] FEBS Lett. 478:123-126), bark of the spindle tree (Van den Bergh et al. [2002] FEBS Lett. 530:181-185), leaf intercellular washing fluids (Nielsen et al [1997] Plant Physiol. 113: 83-91), seeds of Amaranthus caudatus (De Bolle et al. [1993] Plant MoI. Biol 22: 1187-1190), Atriplex nummularia (Last and Llewellyn [1997] New Zealand Journal of Botany 35: 385-394), Pharitis nil (Koo et al [1998] Biochim Biophys Acta 1382: 80-90) and Capsicum and Briza (International Patent Application Publication Number WO94/11511). The chitin-binding class of anti-microbial proteins are herein defined as monomeric proteins about 30-45 amino acids lacking enzymatic activity with cysteine backbone of 6-10 cysteine residues forming disulphide bridges, basic pi, small size around 3-5000Da. Structural studies performed on hevein (Andersen et al. [1993] Biochemistry 32:1407-1422) and Ac- AMP2 from Amaranthus caudatus (Martins et al. (1996) JMoI Biol. 258: 322-333) show that these peptides, although different in length, consist of 3 antiparallel β sheets with varying loops and helical turns all stabilised by disulphide bridges. The conserved presence of one serine and three aromatic amino acid residues are necessary for chitin binding. Mutagenesis of these residues reduces or removes chitin affinity (Muraki et al. [2000] Protein Engineering 13: 385- 389). The recognised biology activity of chitin-binding peptides includes being anti-fungal, anti-Gram-positive bacteria (Van den Bergh et al [2002] FEBS Lett. 530:181-185) and possibly anti-insect. Many of these activities are thought to be due to interaction with of chitin within the cell walls of many fungi and in the exoskeletons of insects and iV-acetylglucosamine as a component of peptidoglycan of bacterial cell walls. This, however, does not explain activity against Oomycetes which lack chitin. It may be the basic iso-electric points of these peptides or that the peptides also have affinity for other carbohydrates that are present that contribute to the inhibitory activity against these organisms (Van den Bergh et al. [2004] Planta 219: 221-232). The peptides have been found non-toxic to in vitro cultures of human cells (Broekart et al. [1992] Biochemistry 31 : 4308-4314). Use of Antimicrobial Peptides to Control Pathogenic Microorganisms
Once purified, the amino acid sequence of an antimicrobial peptide can be determined using a method such as Edman degradation N-terminal sequencing. The amino acid sequence provides information that can be used in the subsequent production of the peptide. The genes encoding the peptides in their natural substrates can be identified by methods such as RT-PCR, 3' and 5' RACE. The gene can be used to produce the peptide by manipulating the genetics of a cell system such that with expression of the gene the cell system produces the desired peptide. The cell system could be a whole plant such that expression of the antimicrobial peptide confers some protection from infection and subsequent ingress by pathological agents. Agricultural and horticultural plants might be used to express the peptides including sunflower, maize, sorghum, canola, wheat, cotton, grape, rice and all others.
Published information describing the effect of incorporating antimicrobial proteins and peptides into plants include reports of the expression of a plant chitinase (Broglie, K. et al. [1991] Science 254:1194-1197), a plant chitinase in combination with a plant glucanase (Zhu, Q. et al. [1994] Bio/technology 12: 807-812), a fungal chitinase (Terakawa, T. et al. [1997] Plant Cell Reports 16: 439-443), a ribosome-inactivating protein (Logemann, J. et al. [1992] Bio/Technology 10:305-308), a human lysozyme (Nakajima, H. et al.[1997] Plant Cell Reports 16: 674-679), a peptide derived from a moth (Huang, Y. et al. [1997] Phytopathology 87: 494- 499), a plant lipid transfer protein (Molina, A. and Garcia-Olmedo, F. [1997] Plant Journal 12: 669-675), a peptide derived from horseshoe crabs (Allefs, S.H.J.M. et al. [1996] Molecular Breeding !: 97-105), a plant α-thionin (Carmona, MJ. et al. [1993] Plant Journal 3: 457-462) and a chitin-binding peptide (Lee, O.S. et α/.[2003] Phytochemistry 62: 1073-1079).
Alternatively, the cell system could consist of cells maintained in culture such that expression of the gene would require purification of the peptide either from the cell or the medium in which the cells are growing. Such purified peptide could be used ectopically to protect plants, for example as a spray, or animals including humans from infection by infectious agents particularly where those agents are fungi. The peptide could be incorporated in some diluent and applied or encapsulated to provide timed release. Peptides can also be manufactured by chemically synthesising the amino acid sequence.
The above techniques allow the amino sequence of the peptides to be manipulated either through changing the nucleotide sequence of the encoding gene, that is, through site-directed or random mutagenesis or by controlling the incorporation of different amino acids during chemical synthesis. Such altered peptides may have enhanced efficacy against microorganisms (Cuervo, et al [1988] Peptide Research 1: 81-86).
The Desirability of Having Available Further Chitin-Binding Peptides
Although a large number of individual chitin-binding peptides are known, it would be desirable to have available further chitin-binding peptides so that an antimicrobial peptide can be chosen having an activity that is appropriate for the particular circumstance. Specifically, it would be desirable to have available new chitin-binding peptides which, inter alia:
• have selective activity against a particular pathogen of a particular plant or animal;
• have enhanced activity against a particular pathogen compared with other members of the class; and
• have activities not hitherto found in chitin-binding peptides such as antiviral activity and inhibitory activity against metabolic enzymes.
A number of plant chitin-binding peptides have been described in the patent literature. For example, in International Patent Application No. PCT/GB93/02179 (Publication No. WO 94/11511) by Zeneca Limited, the applicant describes two "biocidal chitin binding proteins". None of the disclosures referred to in the previous paragraph relate to chitin-binding peptides having the desirable properties set out above.
The invention described herein relates to previously unidentified peptides with antimicrobial activity. These peptides can be isolated from Araucaria bidwillii (Ab), Agathis robusta (Ar) or Podocarpus elatus (Pe) plants especially from the seed of these plants. Araucaria bidwillii and Agathis robusta are members of the Araucariacae family. The former produces an edible kernel known commonly as the bunya nut. The latter is known as the South Queensland Kauri Pine. Podocarpus elatus is a member of the Podocarpaceae family and is known as the Brown pine. SUMMARY OF THE INVENTION
An object of the invention is to provide new plant chitin-binding peptides having activities not hitherto found in known chitin-binding peptides.
It is also an object of the present invention to provide peptides that can inhibit the activity of some or all of the following: α-amylase enzymes of different origins; proteinase enzymes especially of the serine proteinase class; and, protein synthesis in cell free systems.
It is a still further object of the invention to provide DNA capable of expressing the aforementioned peptides in cell systems especially plant cells.
According to a first embodiment of the invention, there is provided an isolated or synthetic peptide comprising the sequence: X1PX2CSPAGX3X4YCNX5GRCCSX6X7NWCGX8TAAYCX9X1OX11NCIAX12CWZ
(SEQ ID NO: 1) wherein, each X is independently any amino acid residue other than C, and Z is a carboxy group or the dipeptide PG.
According to a second embodiment of the invention, there is provided an isolated or synthetic DNA which encodes a peptide according to the first embodiment.
According to a third embodiment of the invention, there is provided a DNA construct which includes at least one DNA according to the second embodiment operatively linked to elements for the expression of peptide encoded by said DNA.
According to a fourth embodiment of the invention, there is provided a host cell transformed with a DNA construct according to the third embodiment.
According to a fifth embodiment of the invention, there is provided a transgenic plant transformed with a DNA construct according to the third embodiment.
According to a sixth embodiment of the invention, there is provided reproductive material of a transgenic plant according to the fifth embodiment. According to a seventh embodiment of the invention, there is provided a composition comprising at least one peptide according to the first embodiment together with an agriculturally acceptable carrier, diluent or excipient. According to an eighth embodiment of the invention, there is provided a composition comprising at least one peptide according to the first embodiment together with a pharmaceutically acceptable carrier, diluent or excipient.
According to a ninth embodiment of the invention, there is provided a method of controlling insect, microbial or viral infestation of a plant, the method comprising: i) introducing a DNA construct according to the third embodiment into said plant; or ii) treating said plant with a peptide according to the first embodiment or a composition according to the seventh embodiment.
According to a tenth embodiment of the invention, there is provided a method of controlling microbial infestation of a mammalian subject, the method comprising treating the subject with a peptide according to the first embodiment or a composition according to the eighth embodiment.
With regard to the first embodiment defined above, it is preferred that:
XI is a polar hydrophilic negatively charged amino acid residue (D or E); and/or X2 is a polar, hydrophilic, neutral amino acid residue, preferably T or S; and/or
X3 is a polar, hydrophilic, positively charged or neutral amino acid residue, preferably R or Q; and/or
X4 is selected from F, I or Q; and/or
X5 is a polar hydrophilic amino acid residue, preferably D, N or K; and/or X6 is a polar hydrophilic, positively charged amino acid residue, preferably R or
K; and/or
X7 is a neutral amino acid residue, preferably S or F; and/or
X8 is a polar, hydrophilic, neutral amino acid residue, preferably N or S, and/or
X9 is selected from K, A or Q; and/or X10 is a polar hydrophilic, positively charged amino acid residue, preferably R or K; and/or
XII is a neutral amino acid residue, preferably P or G; and/or
X12 is a polar, hydrophilic, neutral amino acid residue, preferably N or Q. Particularly preferred peptides comprise the following sequences: Asp-Pro-Thr-Cys-Ser-Pro-Ala-Gly-Arg-Phe-Tyr-Cys-Asn-Asp-Gly-Arg-Cys-
Cys-Ser-Arg-Ser-Asn-Trp-Cys-Gly-Asn-Thr-Ala-Ala-Tyr-Cys-Lys-Arg-Pro- Asn-Cys-Ile-Ala-Gln-Cys-Trp-Pro-Gly (SEQ ID NO: 2); or Asp-Pro-Ser-Cys-Ser-Pro-Ala-Gly-Gln-Gln-Tyr-Cys-Asn-Asn-Gly-Arg-Cys- Cys-Ser- Lys-Phe-Asn-Trp-Cys-Gly-Ser-Thr-Ala-Ala-Tyr-Cys-Gln-Lys-Pro- Asn-Cys-Ile-Ala-Gln-Cys-Trp-Pro-Gly (SEQ ID NO: 3); or Glu-Pro-Thr-Cys-Ser-Pro-Ala-Gly-Arg-Ile-Tyr-Cys-Asn-Lys-Gly-Arg-Cys- Cys-Ser-Lys-Phe-Asn-Trp-Cys-Gly-Asn-Thr-Ala-Ala-Tyr-Cys-Ala-Lys-Gly-
Asn-Cys-Ile-Ala-Asn-Cys-Trp (SEQ ID NO: 4).
Other embodiments of the invention include methods for obtaining or producing the subject peptide, and use of the peptide in the preparation of a medicament for controlling microbial infestation of a mammalian animal. Still further embodiments of the invention relate to the purification and/or synthesis of nascent (pre-translationally processed) protein comprising the subject peptide, compositions comprising the nascent protein, DNA encoding the nascent protein, and, inter alia, uses thereof as described in respect of the subject peptide. Still further embodiments of the invention will become apparent from a reading of the following detailed description and the examples of the invention. The examples include reference to the accompanying drawings briefly described in the following section of the specification.
BRIEF DESCRIPTION OF THE DRAWINGS
Figures 1 shows a cation exchange chromatogram for the purification of AbAFPl and the associated graph of antifungal activity. Figure 2 A shows a cation exchange HPLC profile of purified AbAFPl
Figure 2B shows the results of mass spectrometric analysis of the native AbAFPl SCX- HPLC peak.
Figure 3 shows the complete amino acid sequences of AbAFPl and the nucleotide sequences of the cDNA encoding AbAFPl. In this figure, the putative translation initiation codon is underlined, the mature sequence as determined from N-terminal sequencing is boxed and the asterisk denotes a translation stop codon.
Figure 4 shows the cation exchange chromatogram for the purification of ArAFPl and the associated graph of antifungal activity.
Figure 5A shows the SCX-HPLC profile of purified ArAFPl. Figure 5B shows the results of mass spectrometric analysis of the native ArAFPl SCX-
HPLC peak.
Figure 6 shows the complete amino acid sequences of ArAFPl and the nucleotide sequences of the putative partial cDNA encoding ArAFPl. In this figure, the mature sequence as determined from N-terminal sequencing is boxed and the asterisk denotes a translation stop codon.
Figure 7 shows the cation exchange chromatogram for the purification of PeAFPl and the associated graph of antifungal activity. Figure 8 A shows the SCX-HPLC profile of purified PeAFP 1.
Figure 8B shows the results of mass spectrometric analysis of the native PeAFPl SCX- HPLC peak.
Figure 9 shows the complete amino acid sequences of PeAFPl and the nucleotide sequences of the putative partial cDNA encoding PeAFPl. In this figure, the mature sequence as determined from N-terminal sequencing is boxed and the asterisk denotes a translation stop codon.
Figure 10 shows the amino acid sequences of AbAFPl, ArAFPl and PeAFPl aligned with those of a number of other chitin-binding peptides. An asterisk denotes the presence of amino acid homology at that position in the three peptides while bold type indicates residues homologous for the whole group.
Figures 11 and 12 are bar graph summaries of control and test results of the effect of PeAFPl on the growth of insect larvae. The Figure 11 results are for weight while the Figure 12 results relate to larval size.
Figure 13 comprises photographs of larvae in control and test experiments. BEST MODE AND OTHER MODES FOR CARRYING OUT THE INVENTION
The following abbreviations are used hereafter: Ab Araucaria bidwillii
Ar Agathis robusta
EDTA ethylenediaminetetra acetic acid MALDI-TOF Matrix-assisted laser desorption ionisation- Time of flight mass spectrometer
MeCN methyl cyanide (acetonitrile)
MES 2-(N-morpholino) ethanesulphonic acid
Mr molecularmass relative to 1/12 of the atomic mass 12C PCR polymerase chain reaction
Pe Podocarpus elatus ppm Parts per million equivalent to μg/mL concentration
RACE rapid amplification of cDNA ends RP HPLC reversed phase high pressure liquid chromatography RT PCR reverse transcriptase PCR SCX strong cation exchange
SDS-PAGE sodium dodecyl sulphate polyacrylamide gel electrophoresis SE standard error as estimate of standard distribution of sample mean based on population mean SPE solid phase extraction
T-DNA transfer DNA
TFA trifluoroacetic acid Tris Tris[hydroxymethyl]-aminomethane hydrochloride
The present inventors have identified three new peptides (also referred to herein as proteins) obtainable from the seed of Australian native conifers which have antimicrobial and anti-insect activity. The invention provides peptides per se as well as DNA sequences encoding each of the peptides. The invention further provides the amino acid sequences of the peptides (Example 3). From these sequences, the sequence of DNA encoding each peptide can be derived by reverse translating the amino-acid sequence. DNA sequences coding for these peptides can be deduced using standard codon tables. DNA having a nucleotide sequence encoding the peptides can be synthesised biochemically or isolated from plant tissue of the conifers using standard cloning methods as described in laboratory manuals such as Current Protocols in Molecular Biology (copyright 1987-1995 edited by Ausabel, F.M. et al. and published by John Wiley & Sons, Inc. printed in the U.S.A.). The deduced DNA sequence can be used to design oligonucleotide probes or primers that can be used to isolate the encoding gene/s and control sequences.
The gene/s, under control of a tissue specific constitutive or inducible promoter, can be cloned into a biological system which allows expression of the peptides. Transformation methods allowing for the peptides to be expressed in a variety of systems are known. The peptides can then be expressed in any suitable system for the purpose of producing peptide for further use. Suitable hosts for the expression of peptides include E. coli, fungal cells, insect cells, mammalian cells, plant cells and plants. Such methods for expressing peptides in such hosts are described in a variety of texts including Current Protocols in Molecular Biology (supra). As indicated above, a new peptide isolated from the seed of Araucaria bidwillii has been identified. This peptide has potent antimicrobial and anti-insect activity and has the following sequence:
Asp-Pro-Thr-Cys-Ser-Pro-Ala-Gly-Arg-Phe-Tyr-Cys-Asn-Asp-Gly-Arg-Cys- Cys-Ser-Arg-Ser-Asn-Trp-Cys-Gly-Asn-Thr-Ala-Ala-Tyr-Cys-Lys-Arg-Pro-
Asn-Cys-Ile-Ala-Gln-Cys-Trp-Pro-Gly (AbAFPl; SEQ ID NO: 2) An additional antimicrobial and anti-insect peptide has been isolated from the seed of Agathis robusta, the sequence of this peptide being as follows:
Asp-Pro-Ser-Cys-Ser-Pro-Ala-Gly-Gln-Gln-Tyr-Cys-Asn-Asn-Gly-Arg-Cys- Cys-Ser-Lys-Phe-Asn-Trp-Cys-Gly-Ser-Thr-Ala-Ala-Tyr-Cys-Gln-Lys-Pro-
Asn-Cys-Ile-Ala-Gln-Cys-Trp-Pro-Gly (ArAFPl; SEQ ID NO: 3) A still further antimicrobial and anti-insect peptide has been isolated from the seed of Podocarpus elatus, the sequence this peptide being as follows:
Glu-Pro-Thr-Cys-Ser-Pro-Ala-Gly-Arg-Iso-Tyr-Cys-Asn-Lys-Gly-Arg-Cys- Cys-Ser- Lys-Phe-Asn-Trp-Cys-Gly-Asn-Thr-Ala-Ala-Tyr-Cys-Ala-Lys-Gly-
Asn-Cys-Ile-Ala-Asn-Cys-Trp (PeAFPl; SEQ ID NO: 4) Isolation of the foregoing peptides is detailed below in Example 1. The peptides are highly basic with predicted pi values for ^46AFPl of 8.5, for ^7'AFPl of 8.2 and for PeAFPl of 10.1. Each peptide has 8 cysteine residues which are presumed to be involved in four disulphide linkages for stabilisation of the three-dimensional structures of the peptides (Example 2). The relative molecular mass of the peptides has been determined by mass spectrometry to be ^δAFPl 4,726±2 Da, ^rAFPl 4,640+2 Da and for PeAFPl 4,458+2 Da.
The amino acid sequences share varying degrees of similarity with previously described peptides/proteins in sequence databases (Swiss Prot and non-redundant databases) searched using the Blast algorithm (Altschul, S.F. et al. [1990] J MoI. Biol. 215: 403). Identity was found with many peptides for which only cDNA or genomic DNA sequences are known. The proteins with which the subject peptides have identity include the antimicrobial chitin-binding peptides, chitinases and certain plant agglutinins. The peptides described herein show a wide range of anti-fungal activity (Examples 5 and 6) including many fungi that cause serious and economically damaging plant diseases. These peptides may therefore have application in the control of such diseases either by being expressed in the host or through topological application to plant parts. Similarly, the peptides can be used for the control of animal pathogens through topological application or intravenous injection.
The peptides also have potent activity against insects, particularly insect pests of plants. While the efficacy of the peptides in this regard has been demonstrated against lepidopteran species, the peptides are likely to have activity against all insects by virtue of their ability to bind to chitin and hence interfere with chitin-synthesising enzymes. European corn borer (Ostrinia nubilalis) and corn root worm (Diabrotica virgifera) are examples of insects against which the present peptides have activity.
With specific reference to the embodiments of the invention defined above, the peptides according to the invention can be isolated by any of the methods known to those of skill in the art including the method exemplified herein. The peptides can be alternatively synthesised either chemically or enzymatically. These methods will again be known to those of skill in the art.
DNA according to the second embodiment of the invention can be isolated using any of the techniques known to those of skill in the art. An advantageous method is to amplify the relevant gene sequence from genomic DNA after identifying that gene using probes designed from the amino acid sequence of the peptide. DNA sequences encoding the peptides can also be chemically synthesized using methods that will be known to the skilled person.
With reference to the third embodiment of the invention, the term "construct" includes vectors such as plasmids, cosmids, viruses, and the like as well as naked DNA per se. Control elements which can be included in constructs will be known to those of skill in the art. Examples of such elements are promoters, enhancers, polyadenylation signals and transcription terminators.
Constructs according to the invention include chimeric genes which are defined herein as genes that do not exist in nature. A chimeric gene typically comprises the following elements in 5' to 3' orientation: a promoter functional in a host cell, as defined above operably linked to a DNA encoding a peptide according to the invention in a sense or antisense orientation and a termination and/or polyadenylation signal functional in said cell. Other elements, for example an enhancer or an intron, or other regulatory sequences, may also be present. These chimeric genes may be incorporated into recombinant replicable constructs.
Operably linked refers to the association of DNA sequences on a single nucleic acid fragment so that the function of one sequence is affected by the other. According to the invention and as indicated above, it is also possible to use, in combination with the promoter regulatory sequence of constructs, other regulatory sequences which are situated between the promoter and the coding sequence. These regulatory sequences include transcription activators (enhancers) such as, for example, the translation activator of the tobacco mosaic virus (TMV) which is described in International Application No. WO 87/07644, the tobacco etch virus (TEV) described by Carrington and Freed (see J Virol. 64(4),1590-1597 [1990]), or the figwort mosaic virus described in US Patent No. 5,994,521. Particularly preferred introns for inclusion in chimeric genes are those which promote gene expression in monocotyledonous plants such as intron 1 of the actin gene described in International Application No. PCT/FR98/02820 (Publication No. WO 99/34005).
The chimeric gene may also comprise a sequence encoding a signal peptide or a transit peptide. Such sequences allow the encoded polypeptide to be directed to a specific subcellular compartment or aid its secretion. The role of such sequences has been in Plant Molecular Biology, Vol., 38 (1998) — see the articles by the following authors: Neuhaus, J.-M. and Rogers, J.C., ppl27-144; Heese-Peck, A. and Raikhel, N.V., pp 145-162; Soil, J. and Tien, R., pp 191-207; Robinson, C. et al, pp 209-221; and, Glaser, E. et al., pp 311-338. These transit peptides can be single or double as described in Patent Application No. EP 0 508 909.
With regard to polyadenylation or terminator regulatory sequences, these may be any suitable sequence of bacterial origin, such as for example the Agrobacterium nos terminator, or alternatively of plant origin, such as for example a histone terminator as described in Patent Application No. EP 0 633 317.
The host cells of the fourth embodiment of the invention include plant and animal cells. Plant cells can be transformed with DNA constructs of the invention according to a variety of known methods such as Agrobacterium-modi&tQd, electroporation, micro-injections, sonication, micro-projectile, and the like. For expression in plants, the DNA sequences encoding a protein would be used in conjunction with a DNA sequence encoding the native or a heterologous signal peptide sequence which would target the protein to a cellular compartment such as the vacuole or extracellularly to the apoplast. These coding sequences can be ligated to a plant promoter sequence that would ensure strong expression in plant cells. The promoter sequence might ensure strong constitutive expression of the protein in most or all plant cells, it may be a promoter which ensures expression in specific tissues or cells or it may also be a promoter which ensures strong induction of expression during the infection process. The expression cassette will also include a transcription termination codon and polyadenylation signal sequence to allow efficient production and stabilisation of the transcribed mRNA. Efficient expression of a peptide can also be facilitated by inclusion of its DNA sequence into a sequence encoding a much larger protein which is processed inplanta to release the antimicrobial or anti-insect peptide. Gene cassettes can be ligated into binary vectors carrying: i) left and right border sequences that flank the T-DNA of the Agrobacterium tumefaciens Ti plasmid; ii) a suitable selectable marker gene for the selection of transformed cells or plants; iii) origins of replication that function in A. tumefaciens or Escherichia coli; and, iv) antibiotic resistance genes that allow selection of plasmid transformed cells of E. coli and A. tumefaciens. Such binary vectors can be introduced either by electroporation or tri-parental mating into A. tumefaciens strains carrying disarmed Ti plasmids such as strains LBA4404, GV3101 and AGLl or into A. rhizogenes strains such as R4 and NCCPl 885. These Agrobacterium strains can be co- cultivated with suitable plant explants or intact plant tissue and the transformed plant cells and/or regenerant shoots selected using an agent that allows the presence of the selectable marker gene to be determined. Suitable selectable marker genes can be used to confer resistance to antibiotics or herbicides or to produce a molecule that can be assayed fluorometrically or chemically. The expression of the subject peptides in transgenic plants can be detected using antibodies raised against the peptide or by using antimicrobial assays.
Other methods of gene transfer in plants use direct insertion of the gene into plant cells. The encoding gene cassette can be micro-injected into isolated plant cells which are then selected for introgression of the gene into the genome. Alternatively, the gene cassette can be co-precipitated onto gold or tungsten particles along with a plasmid encoding a chimeric selectable marker gene. The encoated particles or projectiles are accelerated into plant cells or tissues. With regard to methods of transforming plant cells and of regenerating plants, there may be mentioned in particular the following patents and patent applications: US 4,459,355; US 4,536,475; US 5,464,763; US 5,177,010; US 5,187,073; EP 267,159; EP 0 604 662; EP 0 672 752; US 4,945,050; US 5,036,006; US 5,100,792; US 5,371,014; US 5,478,744; US 5,179,022; US 5,565,346; US 5,484,956; US 5,508,468; US 5,538,877; US 5,554,798; US 5,489,520; US 5,510,318; US 5,204,253; US 5,405,765; EP 0 442 174; EP 0 486 233; EP 0 486 234; EP 0 539 563; EP 0 674 725; EP 1 171 621; and the international applications having the publication numbers WO 91/02701, WO 95/06128 and WO 00/22148. Regenerant plants can be selected for presence of the marker gene and expression of the peptide can be detected using antibodies raised against the peptide or by using anti-microbial assays.
The transformed cells and plants according to the invention can comprise, in addition to the sequence encoding a subject peptide, other heterologous sequences encoding proteins of interest such as additional peptides which are capable of conferring on the plant resistance to diseases of bacterial or fungal origin. The heterologous sequences can furthermore encode proteins for tolerance to herbicides and/or resistance to insects, such as the Bt proteins in particular (WO 98/40490). Sequences encoding disease resistance polypeptides such as the polynucleotide encoding oxalate oxidase (described in US 5,866,778, US 6,229,065, US
6,235,530 or EP 0 531 498) can be included in plant cells, as well as polynucleotides encoding fungicidal or bactericidal peptides. Such peptides are described in the international applications having the publication numbers WO 97/30082, WO 99/24594, WO 99/02717, WO 99/53053 and WO 99/09189. Other polynucleotides encoding agronomic traits can also be inserted, such as a polynucleotide encoding a delta-6 desaturase (US 5,552,306; US 5,614,313, WO 98/46763 and WO 98/46764), a polynucleotide encoding a serine acetyltransferase (SAT) (see WO 00/01833), or a polynucleotide encoding acyltransferase (see WO 94/13814).
Genes for tolerance to herbicides are well known to persons skilled in the art and are in particular are described in the following patent applications: EP 0 115 673; WO 87/04181; EP 0 337 899; WO 96/38567; and, WO 97/04103.
The other sequences referred to above may be integrated into a plant or cells thereof by means of any suitable vector. For example, the vector can comprise a chimeric gene which comprises a first sequence encoding a peptide according to the invention and at least one other sequence encoding another peptide or protein of interest.
Further information on the expression of heterologous genes in plants is given in Plant Molecular Biology (copyright 1994, 2nd ed., edited by Gelvin, S.B. and Schilperoort, R.A., published by Kluwer Academic Publishers, Dordrecht, The Netherlands).
Transgenic plants according to the invention may also be obtained by crossing parental strains. For example, one parental strain carrying a gene encoding a peptide according to the invention can be crossed with another strain carrying a gene encoding at least one other peptide or protein of interest. Mammalian cells that can be transformed with constructs according to the invention will be known to those of skill in the art. Like plant cell transformation, mammalian cells can be transformed using any of the techniques known to those of skill in the art.
With regard to the fifth embodiment of the invention, both monocotyledonous and dicotyledonous plants can be transformed and regenerated. Plants which can be genetically modified include grains, forage crops, fruits, vegetables, oil seed crops, palms, forestry, and vines. Specific examples of plants which can be modified follow: maize, banana, peanut, field peas, sunflower, tomato, canola, tobacco, wheat, barley, oats, potato, soybeans, cotton, carnations, sorghum, lupin, rice, and oilseed rape. These, as well as other agricultural plants, can be transformed with genes encoding the peptides such that they exhibit a greater degree of resistance to pathogen attack. Alternatively, the peptides can be used for the control of microbial or insect infestation of a plant by topological application to the subject plant or to tissue thereof.
With reference to the sixth embodiment of the invention, reproductive material of a transgenic plant includes seeds, pollen, ovules, progeny plants and clonal material.
With reference to the seventh and eighth embodiments of the invention, those with skill in the art will know the nature of carriers, diluents or excipients which can be included in compositions for administration to plants and animals. Similarly, those with skill in the art will know the best way of applying the composition or peptide per se to achieve disease control. In the present context, the term "control" is used to denote the prophylaxis or treatment of a microbial disease or infestation of a plant or mammalian subject, or insect infestation of a plant.
Compositions according to the seventh and eighth embodiments can comprise any one of the subject peptides or any combination thereof. Compositions for administration to mammals can furthermore comprise other antimicrobial agents known to those of skill in the art, while compositions for application to plants can include other insect control agents. Non-limiting examples of the invention follow.
GENERAL METHODS Antifungal activity assays Method A
Antifungal bioassays were conducted using microspectrophotometry essentially as described by Cammue et α/.[1992] J. Biol Chem. 276: 2228-2233 in a defined fungal growth medium (FGM) consisting OfK2HPO4 (2.5 niM), MgSO4 (50 mM), CaCl2 (50 niM), FeSO4 (5mM), CoCl2 (0.1 mM), CuSO4 (0.1 niM), Na2MoO4 (2 mM), H3BO4 (0.5 niM), KI (0.1 mM), ZnSO4 (0.5 mM), MnSO4 (0.1 mM), sucrose (10 g/L), asparagine (1 g/L), methionine (20 mg/L), myo-inositol (2 mg/L), biotin (0.2 mg/L), thiamine-HCl (1 mg/L) and pyridoxine-HCl (0.2 mg/L). Some fungi which did not grow satisfactorily in the defined growth medium were bioassayed in half strength potato dextrose broth (1/2 PDB). Yeasts were assayed in quarter strength yeast peptone broth (1/4 YPD). Bioassays were performed in 96 well microtitre plates where 50 μL of filter-sterilised protein test samples dissolved in water were added to 50 μL of fungal inoculum. In control wells 50 μL of sterile water was added to 50 μL of fungal inoculum. Fungal inoculum consisted of spores (50,000 spores/mL), yeast cells (50,000 cells/mL) or mycelial fragments (produced by blending a mycelial mass grown in broth and passing the macerate through a fine screen to remove larger hyphal fragments).
Microtitre plates were incubated at 250C. Filamentous fungi were incubated stationery while yeasts were gently shaken on a microtitre plate shaker. Fungal growth in the microtitre plate wells was assessed by measuring the change in absorbance at 600 nm (A6oo) over time. The A600 at each assessment time was corrected by deducting the absorbance at time zero.
Inhibition of growth was calculated as corrected absorbance of the test wells as a percentage of the control wells. Results are expressed as either IC5O or MIC values which are the concentrations of protein required to give corrected absorbances 50% and less than 10% of control absorbances, respectively, at the first assessment when the corrected A600 of the control wells exceeded 0.4. This point was reached anywhere from 48 to 144 hours incubation depending on the growth rate of the different fungi.
Method B
Microtiter biotests were performed in vitro to evaluate the antifungal spectrum and efficacy of the peptides studied. One microtiter plate per fungus was prepared. The peptide solution (5, 10, 20 ppm) was added to 10 μl of fungi in potato dextrose broth (PDB). The microtiter plates were then incubated in the dark at room temperature (21-22°C) except for Michrodochium nivale for which the microtiter plates were incubated in the dark at 4-10°C.
The absorbance at 620 nm was measured 5 days after inoculation. The fungal growth was expressed as the difference between the optical density at 620 nm at a given time (OD(620)t) and at the beginning of the experiment (OD(62o)i). The inhibition efficacy of a peptide was calculated as follows:
Efficacy% = 100(OD(620)t-OD(62o)i)(UTC) - (OD(62o)t -OD(620)i)(peptide)/
(OD((620)t -OD(62o)i)(UTC) where (OD(620)t -OD(620)i)(peptide) is the growth of the fungus in presence of peptide and (OD(620)t -OD(620)i)(UTC) is the growth of the same fungus without peptide (untreated control).
Anti-bacterial activity assays
Bacterial stocks were streaked onto tryptic soy agar (TSB, Difco) and incubated at 280C except for E. coli and Bacillus subtilus which were incubated at 370C. Single colonies were transferred to 25mL of TSB and shaken for 18 hr. Aliquots were diluted in TSB to A6O0=O.1 and shaken for another 3-4hr until A6oo=O.2-O.4. Cells were pelleted by centrifugation for 10 min at 3000g and 40C. Pellets were resuspended in double strength (2X) TSB to A60O=O.1. Aliquots of 50 μL were added to protein dilutions in microtitre plate wells. Plates were incubated with shaking at 280C except for E. coli which was incubated at 370C. A600 measurements were recorded at the start of the assay and at 6 hr intervals until the A600 of the control wells (no protein addition) reached A6oo=O.5. Calculations of inhibition were performed as described for fungal assays in Example 1.
Example 1 Isolation of Subject Peptides
In this example, we describe the extraction of the subject peptides (proteins) from seeds of A. bidwillii, A. robusta and P. elatus and the purification of the peptides from those extracts. Extraction of basic protein fraction from seeds of native Australian conifers One kilogram each of Araucaria bidwillii and Agathis robusta seeds were purchased from the Queensland DPI Forestry Tree Seed Centre, Queensland, Australia. Seed of Podocarpus elatus was collected from a tree growing on the campus of The University of Queensland, St. Lucia, Queensland, Australia. Seeds of A. bidwillii and P. elatus were dehulled before further processing while those of A. robusta was used as obtained. Seeds were flaked in a domestic food processor (Big Oscar, Sunbeam Appliances). Since the seed of A. robusta contains appreciable amounts of lipids the resulting meal was extracted for 1 hr with 2.5 L petroleum ether (30-400C BP) at room temperature. Petroleum ether was added periodically to replace that lost through evaporation. The dissolved lipids were removed in the solvent by drawing through a sintered glass funnel under vacuum. The seed meal of A. bidwillii and P. elatus was not defatted.
The seed meals were extracted twice with excess 0.05 M H2SO4 for lhr at room temperature with occasional stirring. After each extraction the liquid phase was decanted off and centrifuged for 10 min at 10,000g. The two supernatants for each seed meal were pooled, adjusted to 20 mM MES at pH 6 with NaOH. After standing at 40C overnight the supernatants were centrifuged for 60 min at 40C at 10,00Og. This fraction was further purified as described in the following section. Cation-exchange chromatography of acid extracts of seeds of native Australian conifers Protein samples were passed through 0.45 μm filters to remove any particulate matter before cation exchange chromatography.
Cation exchange chromatography of the extracts was performed on Source 15S media in a HRl 6/10 column (Pharmacia) equilibrated with 20 mM MES pH6. Aliquots of 250 mL of clarified extract were loaded. Following loading of the sample the column was washed with 20 mM MES pH 6 until A28O measurements reached >0.05 AUFS. Bound proteins were eluted by passing a linear gradient of 0 to 2 M NaCl in 20 mM MES pH 6 over 90 min at 5 mL/min. The eluate was monitored by online measurement of the absorbance at 280 nm and eluted proteins were collected in either 10 or 20 mL fractions.
Five millilitre aliquots of the fractions were desalted and concentrated by passing over Bond Elut™ (Varian) or Strata (Cl 8e)™ (Phenomenex) SPE columns that were equilibrated with 20 mM MES pH 6, the salt was removed by washing with 3 column volumes of 5% MeCN in 0.1% TFA and the bound proteins were eluted with 50% MeCN in 0.1% TFA. The eluants were dried in a rotary vacuum concentrator before being resuspended in MiIIiQ H2O and redried to remove residual TFA. Resuspension and drying was repeated 3 times. The fractions were finally resuspended in 1 mL MilliQ™ water before filter sterilisation through 0.22 μm filter into sterile tubes. Protein samples were stored at -2O0C. Purification of proteins from cation-exchange fractions from seeds of native Australian conifers
Fractions from the cation-exchange chromatography procedures outlined above were bioassayed against the fungus Sclerotinia sclerotiorum. Protein concentrations were measured using the BCA assay (Pierce) against a standard curve generated using BSA and proteins solutions were diluted wherever possible to 50 μg/mL with sterile MilliQ™ water (Millipore Corporation).
Anti-fungal activity was found in several early eluting fractions in the cation-exchange profile of A. bidwillii (Figure 1). Desalted fractions eluting between 50-100 mM NaCl completely inhibited growth of Sclerotinia sclerotiorum from ascospore inoculum, that is, MIC values were equal to or less than 25 μg/mL. Active fractions were subjected to high resolution cation-exchange HPLC to further purify anti-fungal activity. About 1 mg amounts of each of the combined fractions were loaded on a Luna SCX™ (5 μm) column (150 x 4.6 mm) (Phenomenex) equilibrated with 1OmM NH4Acetate in 20% MeCN (pH5) (=100%A). The column was eluted at 0.5 mL/min with a 35 mL linear gradient (70 min) from 100%A to IM NH4Acetate in 20% MeCN (pH5) (=100%B). Eluate was monitored for protein by online measurement of absorbance at 280 nm. Fractions of 1 mL (2 min) of the eluate were collected, vacuum dried thrice after resuspension in MilliQ™ water to remove traces of NH4 Acetate, resuspended in MilliQ™ water, filter sterilised and bioassayed against S. sclerotiorum and B. cinerea at concentrations of 50 μg/mL as described in General Methods.
The cation-exchange fractions of A. bidwillii that exhibited strong activity against S. sclerotiorum when subjected to cation-exchange HPLC provided simple chromatograms where in each case complete inhibition of fungal growth was provided by fractions eluting between 55-62 min (32-35 mS/cm) (Figure 2). The active factor in this peak was called AbAFPl (Araucaria bidwillii antifungal protein 1).
Desalted fractions eluting between 20-20OmM NaCl from the cation-exchange purification of the extract from Agathis robusta completely inhibited growth of Sclerotinia sclerotiorum (Figure 4). These were subjected to high resolution cation-exchange HPLC as described for the fractions from A. bidwillii. Among these fractions complete inhibition of growth of S. sclerotiorum and Botrytis cinerea was found in the major peak eluting between 33-37 min (16-19 mS/cm) (Figure 6). The active factor in this peak was called ArAFPl {Agathis robusta antifungal protein 1).
Protein fractions from cation-exchange purification of the extract from Podocarpus elatus were subjected to high resolution cation-exchange HPLC as described for the fractions from A. bidwillii. A single major peak eluted from the column between 46-52 min (27- 31mS/cm) (Figure 8A). The fractions corresponding to this peak completely inhibited growth of S. sclerotiorum and Botrytis cinerea at 25 μg/mL. The active factor in this peak was called PeAFPl (Podocarpus elatus antifungal protein 1).
Example 2 Molecular Characterisation of the Purified Peptides
The peaks described as AbAFPl (Example 1), ArAFPl (Example 1) and PeAFPl (Example 1) were subjected to mass spectroscopic analysis by MALDI-TOF to assess purity and mass. Approximately 50 μg of each peptide in 50% MeCN was used for testing. Analysis of AbAFPl revealed the presence of a molecule with mass of 4,726Da + 2 Da. Analysis of ArAFPl revealed a single peptide having a molecular mass of 4,640Da + 2 Da. Analysis of PeAFPl revealed a single peptide having a molecular mass of 4,458Da ± 2 Da. The actual mass spectrometric analyses described above are presented in Figures 2B, 5B and 8B.
The peptides were also subjected to reduction of possible disulphide bonds with dithiothreitol and alkylation of free thiol groups of cysteines with 4-vinylpyridine. Approximately 50 μg of peptide were dissolved in 800 μL reduction/alkylation buffer (6 M guanidinium-Cl in 100 mM Tris buffer pH 8, 0.01% EDTA) to which was added 4 mg DTT. The reduction reaction was conducted under argon at 370C for 2 hr. Four microlitres of 4- vinylpyridine was added and the alkylation reaction was conducted overnight under argon, at room temperature and in darkness. The reduced and alkylated peptides were separated from reactants by reversed-phase HPLC on a Jupiter C18™ (Phenomenex) column (30 x 4.6 mm) and analysed by mass spectroscopy. The reduced and alkylated AbAFPl sample gave a mass of 5575+ 2Da. The mass of ArAFPl increased to 5492 ± 2Da and that of PeAFPl increased to 5306+ 2Da. In all these peptides the mass increases over the native peptides were each 848- 850 mass units. This gain in mass was interpreted as the reaction of eight 4-vinylpyridine groups (mass 106 Da) with 8 cysteine residues in each of the peptides. This conclusion has been confirmed by amino acid sequencing (Example 3) and nucleotide sequence of putative encoding genes (Example 7).
Example 3 Amino Acid Sequencing of the Purified Peptides
Approximately 1 μg of each of reduced and alkylated peptides were subjected to
Automated Edman degradation N-terminal sequencing. Sequencing continued until no discernible signal could be determined. Using the amino acid sequences obtained it is possible to compare molecular weights with those obtained with mass spectroscopy. The software program Mac Vector 6.0™ was used to predict the molecular weight of the peptides consisting of the amino acid sequences obtained. AbAFPl was estimated to have a Mr of 4,734, ArAFPl to have a Mr of 4,649 and PeAFPl to have a Mr of 4,466. These predictions do not account for the presence of disulphide bonds. Given the presence of eight cysteines there is potential for the presence of 4 disulphide bonds with the loss of eight hydrogens or mass units providing masses of 4,726Da for AbAFPl, 4,641Da for ArAFPl and 4,458Da for PeAFPl. These agree very closely with the masses obtained by mass spectroscopic analysis (Example 2) and it is proposed that these sequences are therefore correct and that each peptide is stabilised by 4 disulfides.
Example 4
Similarity and Homology Searches
The amino acid and cDNA sequences (obtained in Examples 3 and 6) were subjected to comparison against published databases to evaluate whether the peptides described herein had been previously identified. Amino acid sequences were analysed using the BLASTP algorithm [Basic Logic Alignment Search Tool, Altscul et at. (1997) Nucleic Acids Research 25: 3389- 3402] against the SwissProt database and non-redundant databases at NCBI. The BLAST searches identified a number of similarities of the peptides described herein and chitin-binding lectins of various sizes, including other chitin-binding peptides. An alignment of AbAFPl, ArAFPl and PeAFPl with previously known chitin-binding peptides is presented in Figure 10. The sequence IDs of the other chitin-binding peptides presented in this figure are as follows: ^cAMPl SEQ ID NO: 5 ΛcAMP2 SEQ ID NO: 6 AnI SEQ ID NO: 7 5mAMPl SEQ ID NO: 8
£vIWF4 SEQ ID NO: 9 CaAMPl SEQ ID NO: 10 EaAFPl SΕQ ID NO: 11 EαAFP2 SΕQ ID NO: 12 EeCBPl SΕQ ID NO: 13 Hevein SΕQ ID NO: 14
PraAMPl SΕQ ID NO: 15 P/7AMP2 SΕQ ID NO: 16 UDA SΕQ ID NO: 17
Example 5 Anti-fungal Potency of the Purified Peptides
Against Fungal Pathogens of Plants
The activity of purified AbAFPl, ArAFPl and PeAFPl were tested against different plant pathogenic fungi in synthetic fungal medium (SFM) as described in General Methods using Method A. Table 1 presents the IC50 of the peptides against a number of plant pathogenic fungi, hi the table where a result is presented as '>200'5 this indicates that concentrations higher than 200 μg/mL (ie 200 ppm) were not tested.
Table 1 Anti-fungal activity of A b AFPl, ^rAFPl and PeAFPl against plant pathogenic fungi
Organism Inoculum Medium ^δAFPl ΛrAFPl PeAFPl
(IC50 ppm) (IC50 ppm) (IC50 ppm)
Fungi:
Alternaria brassicicola conidia SFM 10 15 3
Bipolaήs sorokiniana conidia SFM 10 30 3
Botrytis cinerea conidia SFM 10 5 4
Ceratocystis paradoxa conidia SFM 80 50 4
Colletotrichum falcatum conidia SFM 200 >200 100
Eutypa lata conidia SFM >200 >200 10
Fusarium oxysporum conidia SFM 200 200 10 vasinfectum
Phoma lingam conidia SFM 3 5 1.5
Sclerotinia minor ascospores SFM 3 2 2
Vericillium dahliae conidia SFM 5 20 2
The results presented in the preceding table indicate that the prototype peptides have activity against a broad range of fungi. These fungi represent root, vascular and foliar pathogens of pulse crops, grapes sunflower, sugar cane, banana, cotton, canola and most broad leaf crops. Against this panel of fungi PeAFPl is the most potent generally causing a 50% reduction in hyphal growth at lower concentrations than the other two peptides.
Example 6 Anti-fungal Potency of the Purified Peptide ^46AFPl
Against Fungal Pathogens of Plants
The in vitro antifungal activity of A b AFPl was evaluated on seven fungal strains responsible for major field damage to crops using the second procedure described above in General Methods. The seven strains were: Michrodochium nivale, Fusarium culmorum, Fusarium graminearum, Fusarium moniliforme subglutinans, Fusarium moniliforme profilferatum, Sclerotinia sclerotiorum, Septoria tritici. The results of the evaluations are presented in the following table in which the data are for inhibition efficacy (%) at 5, 10 and 20 ppm.
Table 2 Inhibition efficacy (%) of ^6AFPl against plant pathogenic fungi
Fungus Peptide Time (hours) (ppm)
24 48 72 96 120 144
Fusarium culmorum 5 0 0 0 4 5 8
10 0 0 0 3 6 10
20 39 15 12 8 12 16
F. graminearum 5 3 10 15 18 20 17
10 0 2 8 9 11 12
20 0 0 5 6 11 12
F. moniliforme proliferatum 5 0 0 0 0 0 0
10 0 0 0 0 0 0
20 0 0 0 0 4 0
F. moniliforme subglutinans 5 6 12 16 16 15 21
10 0 10 11 9 8 16
20 0 11 9 10 11 12
Microdochium nivale 5 100 83 97 90 88 72
10 85 84 100 92 100 96
20 97 85 86 82 63 48 Sclerotinia sclerotiorum 5 100 100 100 100 100 100
10 100 100 100 100 100 100
20 100 100 100 100 100 100
Septoria tritici 5 100 100 100 100 100 97
10 100 100 100 100 100 100
20 100 100 100 100 100 100
The results presented in the preceding table show that native AbASVl shows a degree of specificity of activity against the pathogens tested. Little activity was evident against the various Fusarium species at the concentrations tested. However, even at the lowest concentration tested (5ppm) the peptide had an efficacy of greater than 90% against Steptoria tritici, Sclerotinia sclerotiorum and Microdochium nivale. The efficacy was at its maximum between 3 and 5 days and decreased slightly thereafter, this decrease probably being due to degradation of the peptide.
Example 7 Molecular Cloning and Sequencing of the Corresponding cDNAs
Mature seeds were used for RNA extraction. Megagametophyte tissue was obtained, sliced into lmm thick slices and immersed in RNAlater™ (Ambion Inc) RNA stabilisation solution and stored at -8O0C. Total RNA was extracted from 4-5g of frozen tissue by using the Hot Borate method of Wilkins and Smart (1996) [p 21-41
Figure imgf000026_0001
Laboratory Guide to RNA: Isolation, Analysis and Synthesis, PA Krieg (ed.), Wiley-Liss]. Poly (A)+ mRNA was purified by affinity separation using the Oligotex™ system (QIAGEN Pty Ltd). Double stranded cDNA was prepared from the mRNA using the SMART™ PCR cDNA synthesis kit (Clontech).
The software package Mac Vector 6.0™ was used to predict degenerate probes from the degenerate reverse translations from the amino acid sequences. The same software was then used to predict the suitability of the probes as PCR primers. Degenerate primers were synthesised for use in 3' RACE. The following degenerate oligonucleotide primer was designed from amino acids 9-15 present in the known sequence of AbAFPl.
AbAFPl Degenerate: 51 GNT TYT AYT GYA AYG AYG G 31 (SEQ ID NO: 18) This primer and the oligonucleotide primer specific to the cDNA prepared with the SMART™ system— ie, TS-PCR: 5' AAGCAGTGGTATCAACGCAGAGT 3' (SEQ ID NO: 19)— were used to amplify DNA fragments from the cDNA template. Control PCR reactions were also performed using only AbAFPl Degenerate or TS-PCR primers with the cDNA template. The thermocycling program included an initial step of 940C for 5min, followed by 30 cycles of 920C for 45sec, 5O0C for 30sec and 720C for 1 min before a final step of 720C for 7min. Amplification products were separated by electrophoresis on 1.5% (w/v) agarose gel. Bands present in the amplifications using AbAFPl Degenerate and TS-PCR primers together but absent when only or other primer was used in the PCR were excised from the gel, purified using a Concert™ DNA clean-up kit and cloned into the vector pGemT Easy™ (Promega) and transformed into E. coli (Top 10™, Invitrogen) using the procedures recommended by the various manufacturers. Inserts were sequenced using the fluorescent dideoxy terminator reaction procedure (PRISM™, ABI). The following degenerate oligonucleotide primer designed from amino acids 8 — 15 present in the known sequence of ArAFPl was used for performing 3' RACE of ArAFPl :
ArAFPl Degenerate: 5' GNC ARC ART AYT GYA AYA AYG G 3' (SEQ ID NO: 20) PCR was performed as described for the AbAFPl 3' RACE.
Similarly, the following degenerate oligonucleotide primer designed from amino acids 8 - 17 present in the known sequence of PeAFPl was used for performing 3' RACE of PeAFPl:
PeAFPl Degenerate: 5' GGN AGN ATH TAY TGY AAY AAR GGN CGN TG 3' (SEQ ID NO: 21)
PCR was performed as described for AbAFPl 3' RACE except that the annealing temperature used was 550C.
Sequencing of amplification products provided sequences that when translated conformed to the known amino acid sequences of the C-terminal ends of the peptides. From these sequences the software package MacVector 6.0™ was used to predict suitable anti-sense primers for 5' RACE. The respective primers were: AbAFPl Anti-sense: 5' AGA CTT GCT CGA TCT ACA CG 3' (SEQ ID NO: 22)
ArAFPl Anti-sense: 5' GTG AGG GCA GTA ACA CCG 3' (SEQ ID NO: 23) PeAFPl Anti-sense: 5' AAG CCA TTG GAT TGG AGG 3' (SEQ ID NO: 24) The AbAFPl and PeAFPl anti-sense primers were situated in the 3' UTR while the ArAFPl anti-sense primer was situated 51 of the stop codon. These primers were used in conjunction with the TS-PCR primer to amplify the respective cDNA pools under the amplification conditions described for the 3' RACE reactions. Strong amplifications not present in the control reactions were cloned and sequenced. In each case sequences complimentary to the respective sequences produced with 3' RACE were recovered. Contigs were created between the respective 3' and 5' RACE products.
The AbAFPl Contig (SEQ ID NO: 25) was approximately 600 nucleotides in length and included an ORF (open reading frame) encoding a 94 amino acid sequence (SEQ ID NO: 26) within which are the 43 amino acids corresponding exactly to AbAFPl . The ORF also encodes 26 N-terminal amino acids with a predicted signal peptide structure obeying the rules of von Heijne (1985, MoI. Biol. 184: 99-105). There are also C-terminal 25 amino acids of unknown function. It is predicted therefore that AbAFPl is part of a tripartite protein that undergoes post-translational processing before release of mature AbAFPl (Figure 3). The ArAFPl Contig (SEQ ID NO: 27) was approximately 550 nucleotides in length and included a coding region (SEQ ID NO: 28) that when translated included a sequence of 43 amino acids corresponding exactly to ArAFPl. There are 29 amino acids N-terminal to this sequence and 30 amino acids C-terminal. It is predicted therefore ArAFPl is part of a tripartite protein that undergoes post-translational processing before release of mature ArAFPl (Figure 6).
The PeAFPl Contig (SEQ ID NO: 29) was shorter at only 420 nucleotides. It is predicted that 5' RACE did not obtain the full 5' sequence. However, the sequence obtained when translated (SEQ ID NO: 30) included a sequence of 41 amino acids corresponding exactly to the sequence of PeAFPl obtained though peptide sequencing (Example 3). There are at least 15 amino acids N-terminal and 29 amino acids C-terminal to the PeAFPl coding sequence. It is predicted therefore PeAFPl is part of a tripartite protein that undergoes post- translational processing before release of mature PeAFPl (Figure 9).
Example 8 Demonstration of Chitin-binding Ability The similarity of AbAFPl, ArAFPl and PeAFPl to several classes of lectins
(chitinases, agglutinins and the like) presented the possibility that these peptides might also possess such activity. A 1 ml column was packed with chitin (poly-N-acetylglucosamine from crab shells, Sigma C-3132) particles that passed through a 30 mesh screen. The column was extensively washed with alternate cycles of 50 mM NH4Acetate (pH 7) and 100 mM acetic acid (pH 2.8) and the eluant monitored until no material absorbing at 280nm passed from the column. The column was then equilibrated with 50 mM NH4Acetate and 200 μg of either AbAFPl, ArAFPl or PeAFPl dissolved in the same buffer was loaded. The column was washed with 50 mM NH4Acetate until the A280 was less than 0.05 AUFS. Bound peptide was eluted by applying 100 mM acetic acid. In each case a single A28o absorbance peak eluted from the column and was collected. The fraction was dried and subject to mass spectrometric analysis. In each case the Mr corresponded to the respective peptide thereby confirming that these peptides exhibit affinity to chitin. Example 9
Anti-insect Activity Determination
The peptide PeAFPl exemplified above was tested for effects on lepidopteran larvae given that it has some similarity to a number of multivalent lectins that have been shown to possess anti-insect activity. PeAFPl was incorporated into the insect diet at 5 mg/niL and dispensed in 0.5 mL aliquots in small disposable plastic receptacles. Second instar larvae of Helicoverpa armigera were weighed and placed 1 per receptacle. Control insects were provided diet without PeAFPl or with the addition of 5 mg/mL BSA as a control protein. Each day insects were checked for mortality, on days 2, 3, 4, 5, and 7 after enclosure larvae were assessed for developmental stage (instar) and on days 3 and 7 after enclosure larvae were weighed. Twenty-four replicate insects were used for each treatment.
The experimental results are presented in Tables 3 and 4 below and Figures 11 to 13. In Table 3, the numbers in the "Weight" and "Instar" columns represent observations made on the days shown in the "Day" row. Day 0 is considered to be the day during which the insect larvae were first enclosed and exposed to the respective diets.
Table 3
Descriptive Statistics
. Control Treatment
Weight (mg) Instar
Day 0 3 7 0 2 3 4 5 7
Mean 1.3 8.3 58.7 2.0 2.3 2.7 2.8 3.2 3.7
SE 0.1 1.0 9.0 0.0 0.1 0.1 0.1 0.1 0.1
Range 0.5-2.7 1.8- 4.9- 2.0- 2.0- 2.0- 2.0- 2.0- 2.0-
21.5 147.0 2.0 3.0 3.0 3.0 4.0 4.0
B. BSA Treatment
Weight (mg) Instar
Day 0 3 7 0 2 3 4 5 7
Mean 1.2 7.7 56.3 2.0 2.3 2.6 2.8 3.2 3.6
SE 0.1 1.1 8.3 0.0 0.1 0.1 0.1 0.1 0.1
Range 0.8-2 .4 2.2- 11.6- 2.0- 2.0- 2.0- 2.0- 3.0- 3.0-
20.7 122.0 2.0 3.0 3.0 4.0 4.0 4.0
C. PeAFPl Treatment
Weight (mg) Instar
Day 0 3 7 0 2 3 4 5 7
Mean 1.2 2.6 10.5 2.0 2.0 2.2 2.6 2.8 2.8
SE 0.1 0.3 1.8 0.0 0.0 0.1 0.1 0.1 0.1
Range 0.6-2. 1 0.8-7.2 0.9- 2.0- 2.0- 2.0- 2.0- 2.0- 2.0-
38.0 2.0 2.0 3.0 3.0 3.0 4.0
Table 4
Summary
Test Weight SE Instar SE (∞g)
Control 58.7 9.0 3.7 0.1
BSA 56.3 8.3 3.6 0.1
PeAFPl 10.5 1.8 2.8 0.1 Increasing the amount of protein per se in the diets of the insects did not affect growth or development as can be seen from the use of BSA as the additive. However exposure of H. armigera larvae to PeAFPl in the diet had a significant affect on growth as assessed by weight and development as assessed by instar. No mortality was observed in the 7 day period of the experiment.
The foregoing embodiments are illustrative only of the principles of the invention, and various modifications and changes will readily occur to those skilled in the art. The invention is capable of being practiced and carried out in various ways and in other embodiments. It is also to be understood that the terminology employed herein is for the purpose of description and should not be regarded as limiting.
The term "comprise" and variants of the term such as "comprises" or "comprising" are used herein to denote the inclusion of a stated integer or stated integers but not to exclude any other integer or any other integers, unless in the context or usage an exclusive interpretation of the term is required.
Any reference to publications cited in this specification is not an admission that the disclosures constitute common general knowledge in Australia.

Claims

1. An isolated or synthetic peptide comprising the sequence: X1PX2CSPAGX3X4YCNX5GRCCSX6X7NWCGX8TAAYCX9X1OX11NCIAX12CWZ (SEQ ID NO: 1) wherein, each X is independently any amino acid residue other than C, and Z is a carboxy group or the dipeptide PG.
2. The peptide of claim 1 , wherein X1 is D or E.
3. The peptide of claim 1, wherein X2 is a polar, hydrophilic, neutral amino acid residue.
4. The peptide of claim 3, wherein X2 is T or S.
5. The peptide of claim 1, wherein X3 is a polar, hydrophilic, positively charged or neutral amino acid residue.
6. The peptide of claim 5, wherein X3 is R or Q.
7. The peptide of claim 1 , wherein X4 is F, I or Q.
8. The peptide of claim 1 , wherein X5 is a polar hydrophilic amino acid residue.
9. The peptide of claim 8, wherein X5 is D, N or K.
10. The peptide of claim I3 wherein X6 is a polar hydrophilic, positively charged amino acid residue.
11. The peptide of claim 103 wherein X6 is R or K.
12. The peptide of claim 1 , wherein X7 is a neutral amino acid residue.
13. The peptide of claim 12, wherein X7 is S or F.
14. The peptide of claim 1, wherein X8 is a polar, hydrophilic, neutral amino acid residue.
15. The peptide of claim 14, wherein X8 is N or S .
16. The peptide of claim 1 , wherein X9 is K, A or Q.
17. The peptide of claim 1 , wherein X10 is a polar hydrophilic, positively charged amino acid residue.
18. The peptide of claim 17, wherein X10 R or K.
19. The peptide of claim 1, wherein X11 is a neutral amino acid residue.
20. The peptide of claim 19, wherein X11 is P or G
21. The peptide of claim 1 , wherein X12 is a polar, hydrophilic, neutral amino acid residue.
22. The peptide of claim 21 , wherein X12 is N or Q.
23. The peptide of claim 1 comprising the sequence
Asp-Pro-Thr-Cys-Ser-Pro-Ala-Gly-Arg-Phe-Tyr-Cys-Asn-Asp-Gly-Arg-Cys- Cys-Ser-Arg-Ser-Asn-Trp-Cys-Gly-Asn-Thr-Ala-Ala-Tyr-Cys-Lys-Arg-Pro-
Asn-Cys-Ile-Ala-Gln-Cys-Trp-Pro-Gly (SEQ ID NO: 2).
24. The peptide of claim 1 comprising the sequence
Asp-Pro-Ser-Cys-Ser-Pro-Ala-Gly-Gln-Gln-Tyr-Cys-Asn-Asn-Gly-Arg-Cys- Cys-Ser- Lys-Phe-Asn-Trp-Cys-Gly-Ser-Thr-Ala-Ala-Tyr-Cys-Gln-Lys-Pro- Asn-Cys-Ile-Ala-Gln-Cys-Trp-Pro-Gly (SEQ ID NO: 3).
25. The peptide of claim 1 comprising the sequence
Glu-Pro-Thr-Cys-Ser-Pro-Ala-Gly-Arg-Ile-Tyr-Cys-Asn-Lys-Gly-Arg-Cys- Cys-Ser-Lys-Phe-Asn-Trp-Cys-Gly-Asn-Thr-Ala-Ala-Tyr-Cys-Ala-Lys-Gly- Asn-Cys-Ile-Ala-Asn-Cys-Trp (SEQ ID NO: 4).
26. An isolated or synthetic DNA which encodes a peptide according to claim 1.
27. A DNA construct which includes at least one DNA according to claim 26 operatively linked to elements for the expression of peptide encoded by said DNA.
28. A host cell transformed with a DNA construct according to claim 27.
29. A transgenic plant transformed with a DNA construct according to claim 27.
30. Reproductive material of a transgenic plant according to claim 29.
31. A composition comprising at least one peptide according to claim 1 together with an agriculturally acceptable carrier, diluent or excipient.
32. A composition comprising at least one peptide according to claim 1 together with a pharmaceutically acceptable carrier, diluent or excipient.
33. A method of controlling insect, microbial or viral infestation of a plant, the method comprising: i) introducing a DNA construct according to claim 27 into said plant; or ii) treating said plant with a peptide according to claim 1 or a composition according to claim 31.
34. A method of controlling microbial infestation of a mammalian subject, the method comprising treating said subject with a peptide according to claim 1 or a composition according to claim 32.
35. Use of a peptide according to claim 1 in the preparation of a medicament for controlling microbial infestation of a mammalian subject.
36. The method of claim 34 or the use of claim 35, wherein said subject is a human subject.
PCT/AU2005/001967 2004-12-24 2005-12-23 Chitin-binding peptides Ceased WO2006066355A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
AU2004907323 2004-12-24
AU2004907323A AU2004907323A0 (en) 2004-12-24 Chitin-Binding Peptides

Publications (1)

Publication Number Publication Date
WO2006066355A1 true WO2006066355A1 (en) 2006-06-29

Family

ID=36601289

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/AU2005/001967 Ceased WO2006066355A1 (en) 2004-12-24 2005-12-23 Chitin-binding peptides

Country Status (1)

Country Link
WO (1) WO2006066355A1 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006117464A1 (en) * 2005-04-29 2006-11-09 Laboratoire Nuxe Skin protective composition based on araucaria grain extracts
US11883450B1 (en) 2023-04-28 2024-01-30 King Faisal University Extract of Agathis robusta as antifungal agent

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
MURAKI M. ET AL.: "Chemically prepared hevein domains: effect of C-terminal truncation and the mutagenesis of aromatic residues on the affinity for chitin", PROTEIN ENGINEERING, vol. 13, no. 6, 2000, pages 385 - 389 *
NIELSEN K.K. ET AL.: "Characterization of a New Antifungal Chitin-Binding Peptide from Sugar Beet Leaves", PLANT PHYSIOL., vol. 113, 1997, pages 83 - 91, XP002213469, DOI: doi:10.1104/pp.113.1.83 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006117464A1 (en) * 2005-04-29 2006-11-09 Laboratoire Nuxe Skin protective composition based on araucaria grain extracts
US11883450B1 (en) 2023-04-28 2024-01-30 King Faisal University Extract of Agathis robusta as antifungal agent

Similar Documents

Publication Publication Date Title
JP3375130B2 (en) Biocidal protein
US6187904B1 (en) Biocidal proteins
KR101957550B1 (en) Antifungal plant proteins, peptides, and methods of use
US5986176A (en) Transgenic plants expressing biocidal proteins
US20020168392A1 (en) Antimicrobial proteins
US5750504A (en) Antimicrobial proteins
US5861480A (en) Antimicrobial proteins from aralia and impatiens
EP0672146B1 (en) Biocidal chitin binding proteins
EP0593501B1 (en) Biocidal proteins
CZ289646B6 (en) Antimicrobial proteins, recombinant DNAs encoding thereof, antimicrobial preparation containing thereof and method of fighting fungi or bacteria
WO2006066355A1 (en) Chitin-binding peptides
AU723474B2 (en) Antimicrobial proteins
WO1997028185A1 (en) Anti-microbial protein
AU1536997A (en) Anti-microbial protein

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KM KN KP KR KZ LC LK LR LS LT LU LV LY MA MD MG MK MN MW MX MZ NA NG NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SM SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU LV MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 05821482

Country of ref document: EP

Kind code of ref document: A1

WWW Wipo information: withdrawn in national office

Ref document number: 5821482

Country of ref document: EP