WO2006065230A1 - Method of nucleic acid signal detection - Google Patents

Method of nucleic acid signal detection Download PDF

Info

Publication number
WO2006065230A1
WO2006065230A1 PCT/SG2005/000422 SG2005000422W WO2006065230A1 WO 2006065230 A1 WO2006065230 A1 WO 2006065230A1 SG 2005000422 W SG2005000422 W SG 2005000422W WO 2006065230 A1 WO2006065230 A1 WO 2006065230A1
Authority
WO
WIPO (PCT)
Prior art keywords
signal
molecule
probe
nucleic acid
tdt
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/SG2005/000422
Other languages
French (fr)
Inventor
Jing Guang Li
Chew Kiat Heng
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
National University of Singapore
Original Assignee
National University of Singapore
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by National University of Singapore filed Critical National University of Singapore
Publication of WO2006065230A1 publication Critical patent/WO2006065230A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813Hybridisation assays
    • C12Q1/6816Hybridisation assays characterised by the detection means

Definitions

  • the present invention relates to a method of nucleic acid signal detection.
  • SNPs single nucleotide polymorphisms
  • DNA microarray Gut, 2001
  • minisequencing technique is widely used to discriminate alternative alleles of genes, by which a single fluorophore-labeled dideoxynucleotide (ddNTP) molecule is incorporated into the probe in the presence of DNA polymerase once the probe-target hybrid is successfully formed (Pastinen et al, 1997; Hirschhorn et al, 2000; Lovmar et al, 2003).
  • ddNTP dideoxynucleotide
  • Minisequencing has been demonstrated to be a very specific strategy for genotyping because it is mediated by the high-fidelity DNA polymerase, and many commercially available genotyping platforms are based on this approach.
  • ddNTPs dideoxynucleotides
  • a large proportion of the probes is not accessible by the targets due to, but not limited to, the following two reasons.
  • One is the high density of the probes spotted on the solid support (chip) and the other is the variable sizes of the targets (so called steric hindrance) (Southern et al, 1999).
  • steric hindrance the variable sizes of the targets
  • DNA polymerase the DNA polymerase
  • Another major application of the DNA microarray format or platform is in the analysis of gene expression profiles. It provides a powerful means to measure quantitatively the expression levels of a large number of genes simultaneously.
  • a second commonly criticized feature of DNA chip formats such as GeneChip® is its requirement of multiple probes (11 pairs) for each individual gene, which probably contributed partially to the cost of production of such chips. Last but not least, it has been demonstrated that a large proportion of genes expressed at moderate or low levels cannot be detected by DNA chips.
  • the present invention addresses the problem mentioned above and generally provides a method of detecting at least one signal in a nucleic acid.
  • the invention provides a method of detecting at least one signal in a nucleic acid, the method comprising:
  • the template-independent enzyme is terminal deoxyribonucleotidyl transferase (TdT).
  • a method of detecting at least one signal in a nucleic acid hybridization reaction comprising: (a) providing at least one nucleic acid target sequence and at least one probe; (b) allowing the at least one probe to hybridize to the target sequence to form hybridized molecule; (c) discriminating between hybridized molecules to form at least one discriminated molecule; and (d) adding at least one signal molecule using at least one template-independent enzyme to the discriminated molecule, thereby detecting the at least one signal.
  • the invention provides a method of detecting at least one signal in a nucleic acid hybridization reaction wherein the discriminating is by an invader cleavage reaction. More in particular, there is provided a method of detecting at least one signal in a nucleic acid hybridization reaction, the method comprising: providing a first probe, a second probe and a third probe to react with the target sequence, wherein the first probe is complementary to a 5' portion of the target sequence and the second and third probes are allele-specific probes and complementary to a 3' portion of the target sequence; allowing formation of hybridized molecules comprising allele-specific cleavage structures; and discriminating between allele-specific cleavage structures with at least one cleavage means, the at least one cleavage means releasing a portion of a probe to form a discriminated molecule; and adding at least one signal molecule using at least one template-independent enzyme to the discriminated molecule, thereby allowing detection of the at least one signal.
  • the cleavage means may be
  • the invention provides a method of detecting at least one signal in a nucleic acid hybridization reaction wherein the discriminating is by an oligonucleotide ligation assay. More in particular, there is provided a method of detecting at least one signal in a nucleic acid hybridization reaction, the method comprising: providing a first probe and a second probe wherein the first and second probes hybridize to contiguous portions of the target sequence, wherein either probe has at least one terminal base complementary with an allelic difference in the target sequence; allowing the two probes to hybridize to the target sequence; ligating the two probes with a ligase to form a discriminated molecule; and adding at least one signal molecule using at least one template- independent enzyme to the discriminated molecule, thereby allowing detection of the at least one signal.
  • the invention provides a method of detecting at least one signal in a nucleic acid hybridization reaction wherein the discriminating is by chemical cleavage of mismatch reaction. More in particular, there is provided a method of detecting at least one signal in a nucleic acid hybridization reaction, the method comprising: providing at least a first chemical that recognises and binds to a first type of nucleotide, at least a second chemical that recognises and binds to a second type of nucleotide, at least one target sequence and at least one labelled probe; allowing the probe(s) and the target sequence(s) to form hybridzed molecules; adding at least a third chemical to cleave the hybridized molecules at the nucleotide bases with bound to the first and second chemicals, thereby forming at least one discriminated molecule and adding at least one signal molecule using at least one template-independent enzyme to the discriminated molecule, thereby allowing detection of the at least one signal.
  • the first chemical may be hydroxylamine and the first type of nucleotide cytosine.
  • the second chemical may be osmium tetroxide or potassium permanganate / tetraethylammonium chloride, and the second type of nucleotide thymine.
  • the third chemical may be piperidine.
  • the method can further comprise separating the at least one discriminated molecule.
  • the invention provides a method of detecting at least one signal in a nucleic acid hybridization reaction wherein the discriminating is by allele-specific minisequencing.
  • the method in general may further comprise removal of unhybridized molecules.
  • the template-independent enzyme may be, for example, terminal deoxyribonucleotidyl transferase (TdT).
  • TdT terminal deoxyribonucleotidyl transferase
  • the at least one signal molecule is capable of being labeled and/or detected.
  • the detection may be, for example, by photometric, fluorescent, radioactive and/or enzymatic means.
  • the adding of the at least one signal molecule can be repeated to amplify the signal detected.
  • the invention also provides a method of genotyping and/or analysis of gene expression, the method comprising: providing at least two allelic nucleic acid target sequences and at least one probe; allowing the at least one probe to hybridize to the target sequences to form hybridized molecules; discriminating between hybridized molecules based on presence of at least one allele to form at least one discriminated molecule; and adding at least one signal molecule using at least one template-independent enzyme to the discriminated molecule, thereby allowing detection of at least one allele.
  • a method of detecting Single Nucleotide Polymorphisms comprising: providing at least two allelic nucleic acid target sequences and at least one probe; allowing the at least one probe to hybridize to the target sequences to form hybridized molecules; discriminating between hybridized molecules based on presence of at least one SNP to form at least one discriminated molecule; and adding at least one signal molecule using at least one template-independent enzyme to the discriminated molecule, thereby allowing detection of at least one SNP.
  • the adding of the at least one signal molecule can be repeated to amplify the signal detected and the can be by invader cleavage reaction, oligonucleotide ligation assay, chemical cleavage by mismatch reaction and/or allele-specific minisequencing.
  • the template-independent enzyme may be terminal deoxyribonucleotidyl transferase (TdT).
  • the at least one signal molecule is capable of being labeled and/or detected and the detection may be, for example, by photometric, fluorescent, radioactive and/or enzymatic means.
  • the invention also provides a method of analyzing gene expression, the method comprising: providing at least two nucleic acid target sequence and at least one probe; allowing the at least one probe to hybridize to the target sequences to form hybridized molecules; discriminating hybridized and unhybridized molecules to form at least one discriminated molecule; and adding at least one signal molecule using at least one template-independent enzyme to the at least one molecule, thereby allowing detection of the at least one signal for analyzing gene expression.
  • the method of analysing gene expression is a quantitative method, and the at least two target sequences are complementary RNA (cRNA) and/or complementary DNA (cDNA) converted from messenger RNA (mRNA).
  • cRNA complementary RNA
  • cDNA complementary DNA
  • the adding the at least one signal molecule may be repeated to amplify the signal detected.
  • the template-independent enzyme may be terminal deoxyribonucleotidyl transferase (TdT).
  • TdT terminal deoxyribonucleotidyl transferase
  • the at least one signal molecule is capable of being labeled and/or detected and the detection may be, for example, by photometric, fluorescent, radioactive and/or enzymatic means.
  • the nucleic acid(s) may be selected from the group consisting of DNA, RNA and PNA.
  • the nucleic acid(s) may be either DNA or RNA or both.
  • the method can be conducted in a microarray format.
  • nucleic acid strand with at least one signal molecule at the 3' end.
  • kits for detecting at least one signal in a nucleic acid comprising at least one template-independent enzyme.
  • the template-independent enzyme may be terminal deoxyribonucleotidyl transferase (TdT).
  • TdT terminal deoxyribonucleotidyl transferase
  • the kit may further comprise at least a signal molecule.
  • the kit may further comprise at least one probe.
  • the kit may further comprise information pertaining to its use.
  • the kit is a kit for detecting at least one signal in a nucleic acid hybridisation reaction.
  • Fig. 1a shows how isothermal invader cleavage reaction (ICR) works.
  • ICR isothermal invader cleavage reaction
  • one invader probe and two allele-specific signal probes are included.
  • two signal probes also differ in their flaps (universal tags), which will later bind to its corresponding anti-tags immobilized on the slide.
  • Another feature of the signal probe is that its 3' end has to be blocked with a phosphate group to ensure that it cannot be elongated without ICR cleavage.
  • the invader probe it is complementary to the upstream sequence of the genomic DNA except the last base, which can be any one of the four dNTPs. The last base of invader probe is also where the SNP is located.
  • Fig. 1 b shows how TAPE introduces dye-labeled dNTPs onto the cleaved flap in liquid phase. Because ICR only happens on the signal probe with C allele, thus its flap has a free 3'-OH group. Subsequently, TdT can act on it and incorporate multiple dye-labeled dNTPs. The other signal probe with the T is not cleaved and remains blocked by phosphate group. As such, no dNTPs can be extended by TAPE.
  • Fig. 1c shows hybridization between the universal tags (flap) of the signal probes and their corresponding anti-tags spotted on the slide.
  • the artificial anti- tags are modified at their 3' ends with amino group (-NH2) so that they can be stably immobilized through the aldehyde group coated on the slide.
  • SNP genotype of a particular gene can be called by reading its corresponding two sites. If only one site is lighted up, it can be homozygote of either allele. Otherwise, it must be heterozygote.
  • Fig. 2 shows the microarray image of using the ICR-TAPE strategy on two candidate genes, CETP and ACE.
  • CETP is a A/C point mutation
  • ACE is a 288-bp insertion/deletion mutation.
  • only synthetic oligonucleotides are included to find out how effective ICR-TAPE is.
  • three different genotypes of both CETP and ACE are correctly genotyped.
  • Fig. 3a shows the difference in terms of synthesis of cRNA between current approach and TAPE-mediated one.
  • biotin is introduced into the cRNA during in vitro transcription (IVT).
  • IVT in vitro transcription
  • the amount of biotin in one particular cRNA fragment depends largely on its sequence, size and poly-U tail +/-.
  • TAPE normal NTP mixture is used during IVT.
  • the product of IVT is normal RNA sequence without any biotin.
  • Fig. 3b shows the introduction of biotin onto the cRNA fragment by TAPE on the chip. After fragmentation and binding to its corresponding probe which is synthesized on the chip, the cRNA fragment with 3' protruding end will be effectively elongated by TdT with multiple biotin-labeled deoxynucleotides (dNTPs).
  • dNTPs biotin-labeled deoxynucleotides
  • Fig. 4 shows the sensitivity of TAPE with Cy5-ddCTP.
  • Fig. 5A and 5B show incorporation of multiple labelled-nucleotides by TAPE.
  • Fig. 6 shows the attachment efficiency of elongated oligonucleotides.
  • Fig. 7 shows the time-based elongation by TAPE with Cy5-ddC. Elongation was shown to saturated by the first minute and no subsequent increase in signal was observed with longer incubation time.
  • Fig. 8 demonstrates SNP genotyping by ASMS-TAPE strategy.
  • the common homozygotes, heterozygotes and rare homozygotes were represented by subarray AA, AB and BB, respectively. It could be clearly observed in Figure 8A that only one allele-specific site of each SNP was fluorescently-labelled in subarray AA, and the other five sites were fluorescently-labelled in subarray BB, and no fluorescence were observed when two alleles were present (subarray AB).
  • the pattern of the genotyping result by ASMS-TAPE is exactly opposite to that by ASMS with TAMRA-ddNTPs (Fig. 8B).
  • Fig 9 is an electrophoresis gel showing RNA fragments elongated with dNTPs by TdT. Without TdT, the majority of the cRNA fragments were 100-200 nucleotides in length (Lane 2). In the presence of TdT, however, some of these fragments were clearly polymerized, as shown by their relatively slower migration (Lanes 3). This implies that RNA can also serve as substrate for elongation by TdT.
  • Fig. 10 shows elongation of synthetic oligonucleotides with/without 3'-modifiers by TdT.
  • the 3 1 unmodified oligonucleotide (-OH) serves as control in this study.
  • TdT- Cy5-ddCTP was not incorporated into the control (-OH(TdT-)).
  • -OH(TdT+) extremely intense fluorescent signal was obtained when TdT was present (-OH(TdT+)), confirming that TdT is essential for the process of elongation.
  • Fig. 11 is an electrophoresis gel showing TdT-assisted polymerization of 5 1 or S'-biotinylated oligonucleotide.
  • the labels are: 100bp DNA ladder (1); 5'- biotinylated oligonucleotide without TdT (2) or with TdT (3); and 3'-biotinylated oligonucleotide without TdT (4) or with TdT (5).
  • Polymerization of the 58-mer S'- biotinylated oligonucleotide and 40-mer 5'-biotinylated oligonucleotide by TdT was also observed by gel shift assay.
  • Fig 12 is a graph showing that the signal is indeed generated by elongation of a nucleotide carrying the signal. After elongation by TdT with Cy5-ddCTP, intense fluorescence signal was obtained. However, with Exo I treatment, the signal became very weak and the signal intensity ratio (Exo I+/Exo I-) was reduced by about 80%. This indicates that the majority of Cy5-ddCTP incorporated into oligonucleotide was digested by Exo I 1 which breaks phosphodiester bonds between nucleotides.
  • Fig. 13 shows structures of 3' modified oligonucleotides.
  • Allele - One of the variant forms of a gene at a particular locus, or location, on a chromosome. Different alleles produce variation in inherited characteristics such as hair color or blood type. In an individual, one form of the allele (the dominant one) may be expressed more than another form (the recessive one). Allele amplification - to increase the number of copies of an allele.
  • Biomolecules - biological molecules; for example, proteins (including polypeptides and amino acids) and nucleic acids (eg deoxyribonucleic acid, DNA and ribonucleic acid, RNA) and their derivatives such as peptide nucleic acids (PNA).
  • Complementary - two biomolecules are said to be complementary when they fit with or bind to each other due to their characteristics and under certain conditions.
  • Hybridization occurs when two complementary molecules bind to each other, for example, the binding of two complementary strands of nucleic acids such a probe with a target or an antibody to a protein.
  • Hybridization can also be referred to as annealing.
  • nucleic acid consists of nitrogenous bases that are either pyrimidines (Cytosine (C), uracil (U) 1 and thymine (T) or purines (adenine (A) and guanine (G)). These nitrogenous bases form hydrogen bonds consisting of a pyrimidine bonded to a purine, and the bonding of the pyrimidine to the purine is referred to as "base pairing.” More specifically, A will bond to T or U, and G will bond to C.
  • nucleic acid refers to more than one contiguous nucleic acid molecules.
  • nucleic acids refers to a strand of more than one contiguous nucleic acid molecules and are used interchangeably as guided by the context in which they are used.
  • complementary refers to the base pairing that occurs between two distinct nucleic acid sequences or two distinct regions of the same nucleic acid sequence.
  • oligonucleotide or its analog
  • DNA or RNA target DNA or RNA target.
  • the oligonucleotide or oligonucleotide analog need not be 100% complementary to its target sequence to be specifically hybridizable.
  • An oligonucleotide or analog is specifically hybridizable when binding of the oligonucleotide or analog to the target DNA or RNA molecule interferes with the normal function of the target DNA or RNA, and there is a sufficient degree of complementarity to avoid non-specific binding of the oligonucleotide or analog to non-target sequences under conditions in which specific binding is desired, for example, under physiological conditions in the case of in vivo assays. Such binding is referred to as "specific hybridization.” Hybridization conditions resulting in particular degrees of stringency will vary depending upon the nature of the hybridization method of choice and the composition and length of the hybridizing nucleic acid sequences.
  • the temperature of hybridization and the ionic strength (especially the Na+ concentration) of the hybridization buffer will determine the stringency of hybridization.
  • Corresponding base - the base on one strand of nucleic acid that is aligned with another base of another strand of nucleic acid when the two strands share significant homology and are base paired for most of their length.
  • a base on one strand need not hybridize to its corresponding base on another strand in the case of single nucleotide polymorphism and this lack of hydridization can be used as a basis for detecting the SNP.
  • Discrimination The detection and identification of a biomolecule from another biomolecule based on some selection criteria. For example in the case of alleles, allele discrimination is a procedure by which the allele of a given sample is identified, thus discriminating it from another allele. Detection technologies used in discrimination include, but are not limited to, direct detection, electrochemical, fluorescence, fluorescence polarization, colorimetry, mass spectrometry, luminescence, optical, primer extension and minisequencing.
  • Invader cleavage reaction The invader cleavage reaction (ICR) is a means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences.
  • a nucleic acid cleavage structure is formed on a target sequence depending on whether the probe matches or does not match the target sequence.
  • the unique cleavage structures are then cleaved in a site-specific manner by the 5' nuclease activity of a variety of enzymes, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof.
  • ICR is taught in the following US patents: 5,846,717; 6,348,314; 6,001 ,657; 6,090, 543; 6,090,606; and 5,888,780, all of which are hereby incorporated in full by reference.
  • OLA oligation ligation assay
  • the oligation ligation assay is a technique for detecting single nucleotide polymorphisms.
  • OLA uses a pair of oligonucleotide probes (oligomers) that hybridize to adjacent or contiguous segments of DNA including the variable single base.
  • the oligomer on the 5' end of the pair is an allele-specific oligonucleotide (ASO) to one allele of the target.
  • ASO allele-specific oligonucleotide
  • the last base at the 3 1 end of this ASO is positioned at the site of the target DNA's polymorphism.
  • the ASO also has a biotin molecule at its 5' end that functions as a chemical hook.
  • the oligomer on the 3' end of the pair is the common oligomer (that is, the sequence is the same for the two different alleles.)
  • the common oligomer is positioned at an invariable site next to the target DNA's polymorphism and is labeled at its 3' end. If the ASO is perfectly complementary to the target sequence: the ASO hybridizes completely when annealed and will lie flat against that target, DNA ligase can then be used to covalently ligate the ASO to the common oligomer and this successful ligation can be detected.
  • One way to detect the successful ligation is to use the biotin hook to remove the ASO and the labeled common oligomer will also be removed, producing a detectable signal. However, the chemical hook need not be used if the ligated molecule can be detected by other means.
  • the OLA is taught in US Patent Numbers 4,988,617 and 5,830,711 , which are hereby incorporated in full by reference.
  • Chemical cleavage of mismatch detection is a DNA mutation detection system which involves the addition of the chemicals hydroxylamine and osmium tetroxide which react with free cytosine and thymine nucleotides respectively (Cotton & Campbell, 1999). By denaturing the double stranded DNA being screened and allowing it to hybridize with a single stranded labelled DNA probe, any mismatched cytosine or thymine nucleotides will be exposed and therefore be susceptible to reaction with the hydroxylamine and osmium tetroxide.
  • Genotyping The process of assessing genetic variation present in an individual.
  • Homology biomolecules like proteins and nucleic acids possess a sequence of amino acids and nucleotides respectively.
  • Homology refers to the degree of similarity between sequences.
  • homology refers to the degree of similarity between sequences of amino acids.
  • nucleic acids it refers to the sequential correspondence of nucleotide triplets in a nucleic acid molecule that permits nucleic acid hybridization.
  • Microarray - a microarray is a two-dimensional array, typically on a glass, filter, or silicon wafer, upon which genes or gene fragments are deposited or synthesized in a predetermined spatial order allowing them to be made available as probes in a high-throughput, parallel manner.
  • Microarray formats include, but are not limited to, bead arrays, bead based arrays, bioarrays, bioelectronic arrays, cDNA arrays, cell arrays, DNA arrays, encoded bead arrays, gel pad arrays, gene arrays, gene expression arrays, genome arrays, genomic arrays, high density oligonucleotide arrays, high density protein arrays, hybridization arrays, in situ arrays, low density arrays, microelectronic arrays, multiplex DNA hybridization arrays, nanoarrays, nylon macroarrays, oligo arrays, oligonucleotide arrays, oligosaccharide arrays, peptide arrays, planar arrays, protein arrays, solution arrays, spotted arrays, tissue arrays, exon arrays, filter arrays, macroarrays, small molecule microarrays, suspension arrays, theme arrays, tiling arrays, transcript arrays; and gene expression arrays.
  • Minisequencing - A solid-phase method for the detection of any known point mutation or allelic variation of DNA.
  • Moiety - A moiety is a functional group attached to a larger molecule.
  • Moieties can be used as modifiers to alter the characteristic of larger molecules.
  • a moiety may be added to the 3' end of a strand of nucleic acid to modify the characteristic of the nucleic acid strand such as changing its susceptibility to certain enzymes.
  • Nucleotide or nucleic acid - One of the structural components, or building blocks, of deoxyribonucleic acid (DNA) and ribonucleic acid (RNA).
  • a nucleotide consists of a base (one of four chemicals: adenine, thymine, guanine, and cytosine) plus a molecule of sugar and one of phosphoric acid.
  • a polynucleotide is a nucleic acid sequence (such as a linear sequence) of any length. Therefore, a polynucleotide includes oligonucleotides, and also gene sequences found in chromosomes.
  • An "oligonucleotide” is a plurality of joined nucleotides joined by native phosphodiester bonds.
  • An oligonucleotide is a polynucleotide of between 6 and 300 nucleotides in length.
  • An oligonucleotide analog refers to moieties that function similarly to oligonucleotides but have non-naturally occurring portions.
  • oligonucleotide analogs can contain non-naturally occurring portions, such as altered sugar moieties or inter-sugar linkages, such as a phosphorothioate oligodeoxynucleotide.
  • Functional analogs of naturally occurring polynucleotides can bind to RNA or DNA, and include peptide nucleic acid (PNA) molecules.
  • PNA peptide nucleic acid
  • PCR Polymerase chain reaction
  • Single nucleotide polymorphism (SNP) - SNPs are polymorphisms due to single nucleotide substitutions (transitions > transversions) or single nucleotide insertions/deletions in genomic DNA at a frequency of 1 % or higher.
  • Probes and primers - Probes and primers as used herein may, for example, include at least 10 nucleotides of the nucleic acid sequences that are shown to encode specific proteins. In order to enhance specificity, longer probes and primers may also be employed, such as probes and primers that comprise 15,20, 30,40, 50,60, 70,80, 90 or 100 consecutive nucleotides of the disclosed nucleic acid sequences.
  • the term specific for (a target sequence) indicates that the probe or primer hybridizes under stringent conditions substantially only to the target sequence in a given sample comprising the target sequence.
  • the present invention relates to a universal signal detection and/or amplification method and may be applied to various molecular biology reactions, such as complementary nucleic acid hybridizations and/or antibody-protein hybridizations, through the use of suitable enzymes. Accordingly, while the method according to the present invention is described with particular reference to its application for the detection of at lesat one signal in at least one nucleic acid, the method may also encompass the application to other biomolecules as mentioned above. As possible applications, SNP genotyping and gene expression studies through DNA microarray platforms are exemplified here to illustrate how the limitations associated with existing technologies can be circumvented by the present invention. However, the present invention is not limited to the use to the use of microarray format.
  • the invention provides generally a method of detecting at least one signal in a nucleic acid, the method comprising:
  • the template-independent enzyme is terminal deoxyribonucleotidyl transferase (TdT).
  • a method of detecting at least one signal in at least one nucleic acid hybridization reaction comprising: (a) providing at least one nucleic acid target sequence and at least one probe; (b) allowing the at least one probe to hybridize to the target sequence to form hybridized molecule; (c) discriminating between hybridized molecules to form at least one discriminated molecule; and (d) adding at least one signal molecule using at least one template-independent enzyme to the discriminated molecule, thereby allowing detection of the at least one signal.
  • the template-independent enzyme may be, for example, terminal deoxyribonucleotidyl transferase (TdT).
  • TdT catalyzes the addition of normal, fluorescent or biotin-labeled deoxynucleotides (dNTPs), dideoxynucleotides (ddNTPs) or ribonucleotides (NTPs) to the free 3'-OH termini of DNA in a unique template-independent manner.
  • dNTPs deoxynucleotides
  • ddNTPs dideoxynucleotides
  • NTPs ribonucleotides
  • the substrates for TdT are deoxynucleotides (dNTPs) and these could be labeled for use as signal molecules. Subsequently, multiple dNTPs can be incorporated onto each probe to amplify the signal as opposed to a single ddNTP by minisequencing. This feature of TAPE alone can remarkably improve the sensitivity to a great extent. Moreover, the signal introduction by TAPE is no longer dependent on formation of probe-target hybrid since it occurs on the 3 1 terminal of the probes.
  • dNTPs deoxynucleotides
  • minisequencing the main steric hindrance effects of minisequencing are circumvented.
  • four labeled dideoxynucleotides are needed in the course of minisequencing.
  • TAPE may be carried out under room temperature, thus requiring no special equipments or incubators.
  • TAPE is compatible with most current allele-discrimination chemistries other than minisequencing, such as invader cleavage reaction (ICR) (de Arruda et al, 2002; Lyamichev and Neri, 2003) catalyzed by specific flap endonuclease 1 (FEN1), oligonucleotide ligation assay (OLA) (Barany, 1991 ; Consolandi et al, 2003) catalyzed by DNA ligase, and even chemical cleavage of mismatch (CCM) (Cotton and Campbell, 1989; Ellis et al, 1998) which is a very specific SNP screening approach.
  • ICR invader cleavage reaction
  • FEN1 flap endonuclease 1
  • OLA oligonucleotide ligation assay
  • CCM chemical cleavage of mismatch
  • the invention provides a method of detecting at least one signal in a nucleic acid hybridization reaction wherein the discriminating is by an invader cleavage reaction.
  • a method of detecting at least one signal in a nucleic acid hybridization reaction comprising: providing a first probe, a second probe and a third probe to react with the target sequence, wherein the first probe is complementary to a 5' portion of the target sequence and the second and third probes are allele- specific probes and complementary to a 3' portion of the target sequence; allowing formation of hybridized molecules comprising allele-specific cleavage structures; and discriminating between allele-specific cleavage structures with at least one cleavage means, the at least one cleavage means releasing a portion of a probe to form a discriminated molecule; and adding at least one signal molecule using at least one template-independent enzyme to the discriminated molecule, thereby allowing detection of the at least one signal.
  • the cleavage means may
  • the invention provides a method of detecting at least one signal in a nucleic acid hybridization reaction wherein the discriminating is by an oligonucleotide ligation assay.
  • a method of detecting at least one signal in a nucleic acid hybridization reaction comprising: providing a first probe and a second probe wherein the first and second probes hybridize to contiguous portions of the target sequence, wherein either probe has at least one terminal base complementary with an allelic difference in the target sequence; allowing the two probes to hybridize to the target sequence; ligating the two probes with a ligase to form a discriminated molecule; and adding at least one signal molecule using at least one template-independent enzyme to the discriminated molecule, thereby allowing detection of the at least one signal.
  • the invention provides a method of detecting at least one signal in a nucleic acid hybridization reaction wherein the discriminating is by chemical cleavage of mismatch reaction. More in particular, there is provided a method of detecting at least one signal in a nucleic acid hybridization reaction, the method comprising: providing at least a first chemical that recognises and binds to a first type of nucleotide, at least a second chemical that recognises and binds to a second type of nucleotide, at least one target sequence and at least one labelled probe; allowing the probe(s) and the target sequence(s) to form hybridzed molecules; adding at least a third chemical to cleave the hybridized molecules at the nucleotide bases with bound to the first and second chemicals, thereby forming at least one discriminated molecule and adding at least one signal molecule using at least one template- independent enzyme to the discriminated molecule, thereby allowing detection of the at least one signal.
  • the first chemical may be hydroxylamine and the first type of nucleotide cytosine.
  • the second chemical may be osmium tetroxide or potassium permanganate / tetraethylammonium chloride, and the second type of nucleotide thymine.
  • the third chemical may be piperidine.
  • the method can further comprise separating the at least one discriminated molecule.
  • the invention also provides a method of genotyping and/or analysis of gene expression, the method comprising: providing at least two allelic nucleic acid target sequences and at least one probe; allowing the at least one probe to hybridize to the target sequences to form hybridized molecules; discriminating between hybridized molecules based on presence of at least one allele to form at least one discriminated molecule; and adding at least one signal molecule using at least one template-independent enzyme to the discriminated molecule, thereby allowing detection of at least one allele.
  • the invention provides a method of detecting Single Nucleotide Polymorphisms (SNP), the method comprising: providing at least two allelic nucleic acid target sequences and at least one probe; allowing the at least one probe to hybridize to the target sequences to form hybridized molecules; discriminating between hybridized molecules based on presence of at least one SNP to form at least one discriminated molecule; and adding at least one signal molecule using at least one template-independent enzyme to the discriminated molecule, thereby allowing detection of at least one SNP.
  • SNP Single Nucleotide Polymorphisms
  • the adding of the at least one signal molecule can be repeated to amplify the signal detected and the can be by invader cleavage reaction, oligonucleotide ligation assay and/or chemical cleavage by mismatch reaction.
  • the template- independent enzyme may be terminal deoxyribonucleotidyl transferase (TdT).
  • TdT terminal deoxyribonucleotidyl transferase
  • the at least one signal molecule is capable of being labeled and/or detected and the detection may be, for example, by photometric, fluorescent, radioactive and/or enzymatic means.
  • various genotyping and/or gene expression platforms may be developed by coupling TAPE with different allele- discrimination chemistries and/or technique(s).
  • various SNP genotyping and/or screening platforms may be developed by coupling TAPE with different allele-discrimination chemistries and/or technique(s).
  • the nucleic acid(s) may be selected from the group consisting of DNA, RNA and PNA.
  • the nucleic acid(s) may be either DNA or RNA or both.
  • the method can be conducted in a microarray format.
  • TAPE can be easily integrated into the existing "DNA chips” such as the GeneChip® platform from Affymetrix®, with only two modifications to its current protocol.
  • the first modification is during the synthesis of cRNA, in which only normal NTPs are introduced instead of NTPs with biotin-C/UTP under the present strategy.
  • the original target is the amount of messenger RNA (mRNA) that are transcribed for each gene.
  • mRNA messenger RNA
  • these mRNA are converted to complementary RNA or cRNA (if using Affymetrix®) or cDNA if using other methods, to form converted targets.
  • the converted targets are hybridized to complementary probes.
  • the second difference is an additional step after fragmentation and hybridization, in which fragments that successfully form hybrid with probes on chip will be equally elongated with biotin-labeled dNTPs by TAPE. After removal of un hybridized targets, signal molecules are added by TdT.
  • TdT signal molecules
  • RT-PCR Reverse Transcription-PCR
  • Cy3 and Cy5 typically Cy3 and Cy5.
  • cRNA targets are also pre-labelled before hybridization to the probes on the chips.
  • the different signal intensities between genes on one chip can now be attributed to different expression levels of different genes by the method of the present invention. As such, it is now possible to compare the signal intensities among the multiple fragments of one particular gene. It is also noteworthy that the price of biotin-dNTPs is lower than that of biotin-NTP. Therefore, the cost of using a gene chip platform can be remarkably reduced and the data analysis greatly simplified. Further, TAPE is able to improve the sensitivity of the current approach. By optimizing the reaction conditions of TAPE, more biotin-labeled dNTPs can be incorporated into the ends of cRNA fragments because TdT has been proven to be very effective in extending oligonucleotides carrying free 3'-OH group.
  • the potential applications of the present invention include, but not limited to, SNP genotyping and gene expression studies. Besides microarray-based platforms, many non-microarray platforms can also be developed with this invention.
  • the present invention relates to a universal signal detection and/or amplification approach as opposed to target amplification methods such as PCR.
  • the specificity of any platforms based on this invention is dependent on their molecular recognition chemistries.
  • the allele-discrimination chemistry employed is crucial to the specificity of the method.
  • the hybridization between probes and cRNA fragments determines how specific the assay is. By repeating several runs of TAPE as desired, the sensitivity of the method of the present invention may be increased.
  • the invention also provides a method of analyzing gene expression, the method comprising: providing at least two nucleic acid target sequence and at least one probe; allowing the at least one probe to hybridize to the target sequences to form hybridized molecules; discriminating hybridized and unhybridized molecules to form at least one discriminated molecule; and adding at least one signal molecule using at least one template- independent enzyme to the at least one molecule, thereby allowing detection of the at least one signal for analyzing gene expression.
  • the adding the at least one signal molecule may be repeated to amplify the signal detected.
  • the template-independent enzyme may be terminal deoxyribonucleotidyl transferase (TdT).
  • TdT terminal deoxyribonucleotidyl transferase
  • the at least one signal molecule is capable of being labeled and/or detected and the detection may be, for example, by photometric, fluorescent, radioactive and/or enzymatic means.
  • a method of detecting a strand of nucleic acids comprising: providing a strand of nucleic acids, wherein the nucleotide at the 3' end of the strand does not comprise a free hydroxyl group, and at least one modifier molecule; adding a tag to the strand by the modifier molecule; introducing at least one signal molecule; and catalyzing the adding of the at least one signal molecule to the 3' end of the strand of nucleic acids with template-independent enzyme.
  • the template- independent enzyme may terminal deoxyribonucleotidyl transferase (TdT).
  • TdT terminal deoxyribonucleotidyl transferase
  • the tag may be any known tag suitable for the purpose of the invention.
  • the at least one tag may comprise at least a hydroxyl group, an amino group, a biotin group and/or a C3 linker group.
  • the method of the present invention can be incorporate various analytical chemistries to highlight various genetic events (in SNP, gene expression, and the like).
  • nucleic acid strand obtained by the method of detecting a strand of nucleic acids wherein the 3' end of the strand does not comprise a free hydroxyl group.
  • kits for detecting at least one signal in a nucleic acid comprising at least one template- independent enzyme.
  • the template-independent enzyme may be terminal deoxyribonucleotidyl transferase (TdT).
  • TdT terminal deoxyribonucleotidyl transferase
  • the kit may further comprise a at least a signal molecule.
  • the kit may further comprise at least , one probe.
  • the kit may further comprise information pertaining to its use.
  • the kit is a kit for detecting at least one signal in a nucleic acid hybridisation reaction.
  • kits for detecting a strand of nucleic acids where the 3' end of the strand was terminated by a base not possessing a free hydroxyl group comprising at least one template-independent enzyme.
  • the template-independent enzyme may be terminal deoxyribonucleotidyl transferase (TdT).
  • TdT terminal deoxyribonucleotidyl transferase
  • the kit may further comprise at least one modifier molecule and at least one tag.
  • the tag may comprises at least a hydroxyl group, an amino group, a biotin group and/or a C3 linker group.
  • the kit may further comprise information pertaining to its use.
  • the variations under the present invention comprises, but are not limited to: 1) introduction of modified nucleotides into regular probes for immobilization on solid substrate or support such as aldehyde-coated slides, magnetic beads, microtitre plates or other microarray formats; 2) incorporation of fluorescent nucleotides onto oligonucleotides of DNA or RNA fragments, thus serving as a signal generating and amplification tool; and 3) leveraging on the ability of TdT to extend multiple fluorescently labelled dNTPs contiguously for nucleic acids that do not possess a free hydroxyl moiety, the method of the present invention can be used as a signal amplification tool for detecting targets of low abundance.
  • the person skilled in the art will also appreciate that other signal molecules for signal detection means by photometry, radioactivity or enzymatic action can be used under the present invention.
  • the power of TAPE for genotyping studies is demonstrated by the ICR-TAPE strategy of the present invention, i.e., the different alleles of genes is molecularly recognized by invader cleavage reaction and the signal is introduced and amplified by TAPE.
  • the invader assay depends on the unique ability of cleavase enzymes to discriminate a special overlap structure between the probes (including signal and invader probes) and the targets (Fig. 1a).
  • the DNA targets there are one invader probe and two allele-specific signal probes in each assay.
  • the 3' ends of signal probes are blocked with phosphate group to ensure that no TAPE can happen without cleavage of the signal probes to expose their 3'-OH group.
  • the signal probes also differ from each other in being tagged with different universal sequences at their 5' ends so that the two alleles of genes can be addressed by their corresponding anti-tags immobilized on chip by hybridization.
  • the invader probes are sequence completely complementary to the upstream sequence of the SNP site with the last base where SNP is located to be any dNTP of the four. If perfect match happens between the signal probes and the targets at SNP site (C/G in Fig.
  • cleavage will occur to release the universal tags with free 3'-OH groups, which will be elongated with fluorescently labeled dNTPs (Fig. 1b). Otherwise, the signal probes (T/G in Fig. 1a) will remain intact so that signal cannot be introduced by TAPE (Fig. 1b).
  • CETP cholesterol ester transfer protein
  • ACE angiotensin l-converting enzyme
  • the invader probes are: ipCETP: GCAGCCAATGATCTCAGAGGCTGTATACCCT (SEQ ID NO: 5)
  • ipACE TCTAGACCTGCTGCCTATACAGTCACTTTTC (SEQ ID NO: 6)
  • the 3' blocked allele-specific signal probes (universal tags are underlined, SNP is bold letter) are: bpCETPa: CCGTCATAATCTCTAGACCGACCCAGAGTTATTTTATGCATATCp
  • antitagOI CGGTCTAGAGATTATGACGGttttttttttttttttttttt-NH2 (SEQ ID NO: 11)
  • antitagO2 GCTTTAATGTCGGACGACTTtttttttttttttttttttt-NH2 (SEQ ID NO: 12)
  • antitagO3 TGCGACCTCAGCATCGACCTCAGCttttttttttttttttttttttttttt-NH2 (SEQ ID NO:
  • antitagO4 CAGCACCTGACCATCGATCGCAGCttttttttttttttttttttttttttttt-NH2 (SEQ ID NO:
  • Each 10 ⁇ l invader reaction mixture contains the following components: 200ng of Cleavase® VIII enzyme purchased from Third Wave Technologies (Madison, Wl), 1.85 ⁇ l of invader buffer (5.5X), 50fmols of each invader probe, 200fmols of each signal probe and 50fmols of each synthetic target.
  • Three synthetic target pools which contain either CETPCoC and ACECoT, or CETPCoA and ACECoA, or all four, simulate three different genotypes of two genes, C and T homozygotes, A and A homozygotes, or CA and TA heterozygotes, respectively.
  • the reaction is performed isothermally at 63 0 C for about 2 hours.
  • TAPE reaction typically contains 2 units of TdT, 2 ⁇ l of TdT buffer (5X), and 10 ⁇ M Cy3-dCTP.
  • This reaction is carried out at room temperature or in 37 0 C incubator for 20-30 minutes, followed by 75 0 C for 15 minutes to inactivate the TdT enzyme.
  • about 5 ⁇ l of the TAPE products are directly placed on chip to allow for hybridization between tags of the signal probes and anti-tags on chip (55 0 C, 1-2 hours). After washing by 0.2%SDS once for 5 minutes and water twice for 3 minutes, the chip is scanned to acquire the fluorescence signal by ScanArray® 5000 (Packard BioScience Ltd, UK).
  • oligonucleotides with NH2-modifier from 1st BASE were re-suspended to 20 ⁇ M with ArrayltTM micro-spotting solution (TeleChem) prior to spotting on aldehyde-coated slides (CEL) using a PixSys 7500 arrayer (Cartesian).
  • the quadruplicate spots were arranged in a 2 x 2 format. After incubation (37 0 C, overnight), the slides were washed sequentially with 2 x SSC (3 min), 0.2% SDS (3 min), boiling water (3 min) and water (3 min). The materials thus prepared were then used in the examples below.
  • oligonucleotide probe with a 3'-NH2 group with a 15 dT spacer or (TCGATCCAGTCACGTCGCTAtttttttttttttttttttttttttttt; SEQ ID NO: 15) was immobilized as described above.
  • the 15-dT spacer was introduced to facilitate hybridization through the capitalized sequence.
  • a 38-mer oligonucleotide tagged with a complementary sequence (TAGCGACGTGACTGGATCGAgggaacacctccgacacc; SEQ ID NO: 16) to the probe was serially (1/2) diluted from 40fmols/ ⁇ l to 2.5fmols/ ⁇ l.
  • Another oligonucleotide with 5'-NH2 (tttttttttttttttttttttttttttCCTATACAGTCACTTTT; SEQ ID NO: 17) was also immobilized on the slides as described above. Due to the availability of 3'-OH group of this oligonucleotide, elongation by TdT can be carried out on the slide. The objective of this experiment was to find out whether multiple labelled-nucleotides could be incorporated by TdT.
  • TAPE has a good sensitivity of 10fmols.
  • the signal intensity increased correspondingly but plateaued out beyond 20fmols when the saturation point of the scanner was reached.
  • TAPE with Cy5-dU or Cy5-dU/dNTPs generated much stronger fluorescence (2-3 times higher) than that with Cy5-ddU, indicating the occurrence of multiple-incorporation of Cy5-dU ( Figure 5A).
  • Example 5 The time-based TAPE
  • the oligonucleotide immobilized through 5'-NH2 as taught in Example 2 was also used to investigate time-based TAPE because such reaction could be terminated at various time intervals by washing away active TdT and redundant Cy5-ddC from the slide as described earlier.
  • the 5 ⁇ l reaction cocktail contained 1 U of TdT 1 1 pmol of Cy5-ddC, 1 ⁇ l of TdT buffer and 2 ⁇ l of diH2O. These were loaded onto the slides and incubated at time intervals of 1 , 2, 3, 4, 5, 10, 15 and 20 min. At each time point, the corresponding slide was stringently washed to remove TdT and Cy5-ddC before scanning.
  • FIG. 6 shows that intense fluorescence could be obtained within one minute of elongation by TAPE with Cy5-ddC. By incubation of up to 20 minutes, however, the fluorescence intensity did not increase correspondingly. This suggests that elongation by TdT is extremely rapid.
  • TAPE SNP genotyping. This was demonstrated by integrating TAPE with allele-specific minisequencing (ASMS). A pair of allele-specific primers has their 3' ends bearing the complementary base of the SNP.
  • ASMS-TAPE The principle behind ASMS-TAPE is that, when the SNP of interest is a homozygote, one of the two allele-specific primers will be extended by minisequencing with regular ddNTPs, while the other is still available for elongation by TAPE with a fluorescent ddNTP. In the case of heterozygote, both primers will be blocked so that no fluorescence can be introduced by the subsequent TAPE reaction.
  • the two allele-specific oligonucleotides of each SNP are complementary to each other. These oligonucleotides served as both probes to be immobilized on the slides and synthetic targets for allele-specific minisequencing reaction.
  • Allele-specific minisequencing was performed typically in an 8 ⁇ l cocktail containing 1 U of ThermoSequenase DNA polymerase, IOOfmols of allele- specific primers which were complementary to the capitalized sequences of the synthetic oligonucleotides listed in Table 1 , 20fmols of synthetic targets from one of the three pools and 20pmols of ddNTPs.
  • the initial temperature was 95 0 C (5 min), followed by 30 cycles of 95 0 C (30 sec), 5O 0 C (20 sec) and 54 0 C (30 sec). The final extension was 6O 0 C (5 min).
  • SNPs were also genotyped by ASMS with four TAMRA-labelled ddNTPs to serve as control. Following ASMS, hybridization was directly carried out for genotype calling.
  • RNA fragments from frozen liver tissue of mouse were prepared according to the standard protocol of Affymetrix®. Following the protocol, total RNA was isolated using Trizol reagent (Life Technologies) and then purified with RNeasy® Mini Kit (Qiagen). Following this, 10 ⁇ g of purified RNA was reverse transcribed to cDNA with Superscript Il (Invitrogen). Subsequently, cDNA was in vitro transcribed to biotinylated cRNA using the RNA transcript Labeling Kit (Affymetrix®).
  • reaction mixtures Two reaction mixtures were prepared and both contained 2 ⁇ l of cRNA fragments and 1 ⁇ l of dNTPs (10OnM). 100 U of TdT were introduced into only one mixture. After topping up to 20 ⁇ l with diH2O, the mixtures were incubated in a thermal cycler (37°C, 2.5 hours), followed by separation on a 2% agarose gel for visualization of the elongation products.
  • RNA can also serve as substrate for elongation by TdT.
  • Example 8 Elongation of 3' chemically modified oligonucleotides.
  • oligonucleotides with and without 3'-modifiers that were used in this example are summarized in Table 2. Their structures are illustrated in Figure 13. With the exception of 3C3Oligo (Operon, USA) and 3BioOligo (Alpha DNA 1 Canada), all other oligonucleotides were synthesized by 1st BASE (Singapore).
  • the 3NH2Oligo serves as probes for other 3 1 modified oligonucleotides. They have a 15-dT spacer added to make them more accessible for hybridization.
  • Each reaction cocktail contained 11 ) of TdT (Fermentas), 0.5 ⁇ l of TdT buffer (10 X) and 1 pmol of Cy5-ddC (Amersham) and topped up to 5 ⁇ l with deionized H 2 O. This mixture was loaded on the slide for elongation at room temperature for 20 minutes. The slide was then washed once with 2% SSC (4 min) and twice with distilled H 2 O (3 min) before being scanned to obtain the signal of Cy5 (633 nm) by ScanArray® 5000. Both laser power and photo-multiplier tube (PMT) were set to 100%. Finally, the fluorescence intensities were measured by QuantArray® 3.0.
  • the reaction mixture was prepared as described for elongation on slide, with the addition of 50fmols of oligonucleotides which have complementary sequences of the probes. Elongation was similarly carried out at room temperature for 20 minutes. Prior to being loaded on the slide, the reaction mixture with TdT was inactivated by both the addition of 1 ⁇ l EDTA (0.5M, pH 8.0), and incubation at 95 0 C for 15min. Hybridization was carried out in a sealed humidified cassette immersed in a water bath (50 0 C, 1 hour). The slide was subsequently washed and scanned to obtain fluorescence signal as described earlier.
  • Elongation was also carried out on: one 5'-biotinylated oligonucleotide (ttttttttttagtgag-atggtcatgtgtggcggctcacta, 40- mer; SEQ ID NO: 24) and
  • each reaction mixture was given 50pmols of each oligonucleotide and 2OU of TdT. Incubation was also carried out at room temperature for one hour before gel shift assay.
  • TdT-assisted elongation of oligonucleotides with and without 3'-modifiers are shown in Figure 10. Except for 3NH2Oligo and 5N3POIigo which were immobilized on the slides, all other oligonucleotides were elongated in liquid phase before hybridization was carried out. The 3' unmodified oligonucleotide (3OHOIigo) serves as control in this study. In the absence of TdT, Cy5-ddCTP was not incorporated into the control (-OH(TdT-)).
  • the modified oligonucleotide 3NH2Oligo was used for the Exo I experiment as it could be immobilized on the slide and be elongated by TdT. This ensured that any signal reduction was not due to washing away of some elongated products from the hybrid.
  • TdT After elongation by TdT with Cy5-ddCTP, intense fluorescence signal was obtained. However, with Exo I treatment, the signal became very weak and the signal intensity ratio (Exo I+/Exo I-) was reduced to about 20% (Fig. 12). This implied that the majority of Cy5-ddCTP incorporated into 3NH2Oligo was digested by Exo I.
  • TdT can polymerize DNA by adding nucleotides repetitively to its 3' terminus (Ramadan et al., 2004).
  • TdT is evidently unique because it can catalyze such process entirely in the absence of DNA template.
  • Another common belief is that, an oligonucleotide that is modified at its 3' end cannot be polymerized. This is because DNA synthesis proceeds in 5' ⁇ 3' direction, and the free 3'-OH group of oligonucleotide is required .for forming a phosphodiester bond with the subsequent nucleotide during chain elongation.
  • in vitro synthesis of oligonucleotide advances in an opposite direction (3' ⁇ 5'). If a 3' modifier is introduced, however, the terminal 3'-OH will be replaced when synthesis is complete.
  • the 3'-NH2 modifier molecule also carries a -OH group which might be recognized by TdT as a substitute for the 3'-OH group on the deoxyribose sugar.
  • TdT a substitute for the 3'-OH group on the deoxyribose sugar.
  • another -OH (circled) on the carbon chain is present along with the 3'-NH2 modifier.
  • This moiety was initially engaged by succinyl-long chain alkylamino (lcaa) group so that the modifier can be attached to controlled pore glass (CPG) support.
  • CPG controlled pore glass
  • oligonucleotides with different 3'-modifiers or tags such as biotin, C3 linker and phosphoryl group.
  • these oligonucleotides could not be immobilized on the slide, hybridization was carried out following TdT-assisted elongation in solution. Subsequently, they were hybridized to complementary oligonucleotides immobilized on the slide so that fluorescence signal could be detected if elongation did occur.
  • the reaction cocktail was treated with EDTA and heated at 95 0 C for 15 minutes to inactivate TdT before it was loaded onto the slide.
  • Oligonucleotides modified with either 3'-biotin or 3'-C3 linker tags could be efficiently elongated by TdT.
  • These two modified oligonucleotides and 3'-NH2 oligonucleotides have an extra -OH group introduced by their respective modifier molecule, despite differences in the linkers. Elongation did not occur without such a -OH group, as was the case for 3'-phosphorylated oligonucleotide and oligonucleotides with dual modifications at their 5' and 3 1 ends (5'-NH2, 3'-PO4).
  • the main difference between 3'-NH2 and 5'-NH2 modifiers is that an extra -OH group is introduced by the former via its linker. Therefore, we conclude that TdT can elongate 3' modified oligonucleotides if recognizable extrinsic -OH group is introduced as a tag.
  • Exo I can catalyze the removal of nucleotides (3' ⁇ 5') from single- stranded DNA (ssDNA) strand by breaking the phosphodiester bond within DNA.
  • ssDNA single- stranded DNA
  • TdT could catalyze the elongation of oligonucleotides with certain 3' chemical modifiers or tags such as amino, biotin or C3 linker.
  • this finding implies that TdT could potentially catalyze DNA synthesis in the absence of primers if an appropriate modifier molecule with a tag such as an OH group is provided.
  • This discovery may be industrially applied in the addition of nucleotides to a strand of nucleic acids that do not possess a free OH group at its 3' end by first adding a modifier molecule possessing a tag such as a free OH group to the terminal 3' base and then using TdT to add other nucleic acids or derivatives to the strand.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Physics & Mathematics (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

There is provided a method of detecting at least one signal in a nucleic acid, the method comprising: (a) providing at least one nucleic acid; and (b) adding at least one signal molecule to the nucleic acid using at least one template-independent enzyme. There is also provided a method of detecting at least one signal in a nucleic acid comprising the steps of: (a) providing at least one nucleic acid target sequence and at least one probe; (b) allowing the at least one probe to hybridize to the target sequence to form hybridized molecule; (c) discriminating between hybridized molecules to form at least one discriminated molecule; and (d) adding at least one signal molecule using at least one template-independent enzyme to the discriminated molecule, thereby detecting the at least one signal. The method of the invention may be used for genotyping and/or analysis of gene expression.

Description

Method of nucleic acid signal detection
Field of the invention
The present invention relates to a method of nucleic acid signal detection.
Background of the invention
Studies on single nucleotide polymorphisms (SNPs) in the human genome are promising to identify disease-causing genes and many SNP genotyping technologies are currently available, including DNA microarray (Gut, 2001). Among them, the minisequencing technique is widely used to discriminate alternative alleles of genes, by which a single fluorophore-labeled dideoxynucleotide (ddNTP) molecule is incorporated into the probe in the presence of DNA polymerase once the probe-target hybrid is successfully formed (Pastinen et al, 1997; Hirschhorn et al, 2000; Lovmar et al, 2003). Minisequencing has been demonstrated to be a very specific strategy for genotyping because it is mediated by the high-fidelity DNA polymerase, and many commercially available genotyping platforms are based on this approach. However, there are at least two drawbacks born from such method.
First, only one fluorophore can be introduced into individual probe in the form of dideoxynucleotides (ddNTPs). As such, the sensitivity of minisequencing by single base extension is limited by the target concentration.
Secondly, a large proportion of the probes is not accessible by the targets due to, but not limited to, the following two reasons. One is the high density of the probes spotted on the solid support (chip) and the other is the variable sizes of the targets (so called steric hindrance) (Southern et al, 1999). Subsequently, only a small proportion of the probes can be extended by DNA polymerase, and this decreases the sensitivity of minisequencing further. Another major application of the DNA microarray format or platform is in the analysis of gene expression profiles. It provides a powerful means to measure quantitatively the expression levels of a large number of genes simultaneously. One of the successful platforms is that of Affymetrix's® GeneChip® (Lipshutz et al, 1999; Lescallett et al, 2004). However, the current strategy adopted by DNA chip formats such as GeneChip® have a number of problems to be addressed (Botwell, 1999; Yang and Speed, 2002).
One key limitation is that comparison between genes on the array is virtually impossible because the fragmented complementary ribonucleic acid (cRNA) vary a lot in terms of their GC contents, sizes and with/without poly-U tails. If biotin is introduced only in the form of either CTP or UTP during the synthesis of cRNA, the signals generated from different fragmented cRNAs of one gene will be different. Naturally, the fragments with poly-U tails serve as the best targets because they will carry more biotins to generate stronger signals. As for the rest, the signal intensities depend completely on how many biotin-C/UTP the sequences contain. Accordingly, stronger signal intensity generated from one individual gene cannot be simply interpreted as its higher expression level than the others since it is so dependent on the nature of its specific cRNA fragments (GC contents, sizes and poly-U tails).
A second commonly criticized feature of DNA chip formats such as GeneChip® is its requirement of multiple probes (11 pairs) for each individual gene, which probably contributed partially to the cost of production of such chips. Last but not least, it has been demonstrated that a large proportion of genes expressed at moderate or low levels cannot be detected by DNA chips.
Accordingly, there is a need in this field of technology for new and/or improved method that overcomes or at least alleviates these shortcomings of the current art. Summary of the invention
The present invention addresses the problem mentioned above and generally provides a method of detecting at least one signal in a nucleic acid.
In particular, the invention provides a method of detecting at least one signal in a nucleic acid, the method comprising:
(i) providing at least one nucleic acid; and
(ii) adding at least one signal molecule to the nucleic acid by at least a template-independent enzyme, thereby detecting the at least one nucleic acid.
The template-independent enzyme is terminal deoxyribonucleotidyl transferase (TdT).
There is also provided a method of detecting at least one signal in a nucleic acid hybridization reaction, the method comprising: (a) providing at least one nucleic acid target sequence and at least one probe; (b) allowing the at least one probe to hybridize to the target sequence to form hybridized molecule; (c) discriminating between hybridized molecules to form at least one discriminated molecule; and (d) adding at least one signal molecule using at least one template-independent enzyme to the discriminated molecule, thereby detecting the at least one signal.
In particular, the invention provides a method of detecting at least one signal in a nucleic acid hybridization reaction wherein the discriminating is by an invader cleavage reaction. More in particular, there is provided a method of detecting at least one signal in a nucleic acid hybridization reaction, the method comprising: providing a first probe, a second probe and a third probe to react with the target sequence, wherein the first probe is complementary to a 5' portion of the target sequence and the second and third probes are allele-specific probes and complementary to a 3' portion of the target sequence; allowing formation of hybridized molecules comprising allele-specific cleavage structures; and discriminating between allele-specific cleavage structures with at least one cleavage means, the at least one cleavage means releasing a portion of a probe to form a discriminated molecule; and adding at least one signal molecule using at least one template-independent enzyme to the discriminated molecule, thereby allowing detection of the at least one signal. The cleavage means may be a cleavase enzyme.
In particular, the invention provides a method of detecting at least one signal in a nucleic acid hybridization reaction wherein the discriminating is by an oligonucleotide ligation assay. More in particular, there is provided a method of detecting at least one signal in a nucleic acid hybridization reaction, the method comprising: providing a first probe and a second probe wherein the first and second probes hybridize to contiguous portions of the target sequence, wherein either probe has at least one terminal base complementary with an allelic difference in the target sequence; allowing the two probes to hybridize to the target sequence; ligating the two probes with a ligase to form a discriminated molecule; and adding at least one signal molecule using at least one template- independent enzyme to the discriminated molecule, thereby allowing detection of the at least one signal.
In particular, the invention provides a method of detecting at least one signal in a nucleic acid hybridization reaction wherein the discriminating is by chemical cleavage of mismatch reaction. More in particular, there is provided a method of detecting at least one signal in a nucleic acid hybridization reaction, the method comprising: providing at least a first chemical that recognises and binds to a first type of nucleotide, at least a second chemical that recognises and binds to a second type of nucleotide, at least one target sequence and at least one labelled probe; allowing the probe(s) and the target sequence(s) to form hybridzed molecules; adding at least a third chemical to cleave the hybridized molecules at the nucleotide bases with bound to the first and second chemicals, thereby forming at least one discriminated molecule and adding at least one signal molecule using at least one template-independent enzyme to the discriminated molecule, thereby allowing detection of the at least one signal. The first chemical may be hydroxylamine and the first type of nucleotide cytosine. The second chemical may be osmium tetroxide or potassium permanganate / tetraethylammonium chloride, and the second type of nucleotide thymine. The third chemical may be piperidine. The method can further comprise separating the at least one discriminated molecule.
In particular, the invention provides a method of detecting at least one signal in a nucleic acid hybridization reaction wherein the discriminating is by allele- specific minisequencing.
The method in general may further comprise removal of unhybridized molecules. The template-independent enzyme may be, for example, terminal deoxyribonucleotidyl transferase (TdT). The at least one signal molecule is capable of being labeled and/or detected. The detection may be, for example, by photometric, fluorescent, radioactive and/or enzymatic means. The adding of the at least one signal molecule can be repeated to amplify the signal detected.
The invention also provides a method of genotyping and/or analysis of gene expression, the method comprising: providing at least two allelic nucleic acid target sequences and at least one probe; allowing the at least one probe to hybridize to the target sequences to form hybridized molecules; discriminating between hybridized molecules based on presence of at least one allele to form at least one discriminated molecule; and adding at least one signal molecule using at least one template-independent enzyme to the discriminated molecule, thereby allowing detection of at least one allele. In particular, there is provided a method of detecting Single Nucleotide Polymorphisms (SNP), the method comprising: providing at least two allelic nucleic acid target sequences and at least one probe; allowing the at least one probe to hybridize to the target sequences to form hybridized molecules; discriminating between hybridized molecules based on presence of at least one SNP to form at least one discriminated molecule; and adding at least one signal molecule using at least one template-independent enzyme to the discriminated molecule, thereby allowing detection of at least one SNP.
The adding of the at least one signal molecule can be repeated to amplify the signal detected and the can be by invader cleavage reaction, oligonucleotide ligation assay, chemical cleavage by mismatch reaction and/or allele-specific minisequencing. The template-independent enzyme may be terminal deoxyribonucleotidyl transferase (TdT).
The at least one signal molecule is capable of being labeled and/or detected and the detection may be, for example, by photometric, fluorescent, radioactive and/or enzymatic means.
In particular, the invention also provides a method of analyzing gene expression, the method comprising: providing at least two nucleic acid target sequence and at least one probe; allowing the at least one probe to hybridize to the target sequences to form hybridized molecules; discriminating hybridized and unhybridized molecules to form at least one discriminated molecule; and adding at least one signal molecule using at least one template-independent enzyme to the at least one molecule, thereby allowing detection of the at least one signal for analyzing gene expression.
The method of analysing gene expression is a quantitative method, and the at least two target sequences are complementary RNA (cRNA) and/or complementary DNA (cDNA) converted from messenger RNA (mRNA).
The adding the at least one signal molecule may be repeated to amplify the signal detected. The template-independent enzyme may be terminal deoxyribonucleotidyl transferase (TdT). The at least one signal molecule is capable of being labeled and/or detected and the detection may be, for example, by photometric, fluorescent, radioactive and/or enzymatic means.
According to the present invention, the nucleic acid(s) may be selected from the group consisting of DNA, RNA and PNA. In particular, the nucleic acid(s) may be either DNA or RNA or both. The method can be conducted in a microarray format.
There is also provided a nucleic acid strand with at least one signal molecule at the 3' end.
There is also provided a kit for detecting at least one signal in a nucleic acid, the kit comprising at least one template-independent enzyme. For example, the template-independent enzyme may be terminal deoxyribonucleotidyl transferase (TdT). The kit may further comprise at least a signal molecule. The kit may further comprise at least one probe. The kit may further comprise information pertaining to its use. In particular, the kit is a kit for detecting at least one signal in a nucleic acid hybridisation reaction.
Brief description of the figures
Fig. 1a shows how isothermal invader cleavage reaction (ICR) works. In each reaction, one invader probe and two allele-specific signal probes are included. Besides the SNP site, two signal probes also differ in their flaps (universal tags), which will later bind to its corresponding anti-tags immobilized on the slide. Another feature of the signal probe is that its 3' end has to be blocked with a phosphate group to ensure that it cannot be elongated without ICR cleavage. As for the invader probe, it is complementary to the upstream sequence of the genomic DNA except the last base, which can be any one of the four dNTPs. The last base of invader probe is also where the SNP is located. Only when a perfect match takes place between signal probe and genomic DNA at (eg G-C)1 cleavage reaction will occur with the help of FEN 1 , which releases the flap with a free 3'-OH group. Otherwise, the signal probe (G≠T) cannot be cleaved and is kept intact.
Fig. 1 b shows how TAPE introduces dye-labeled dNTPs onto the cleaved flap in liquid phase. Because ICR only happens on the signal probe with C allele, thus its flap has a free 3'-OH group. Subsequently, TdT can act on it and incorporate multiple dye-labeled dNTPs. The other signal probe with the T is not cleaved and remains blocked by phosphate group. As such, no dNTPs can be extended by TAPE.
Fig. 1c shows hybridization between the universal tags (flap) of the signal probes and their corresponding anti-tags spotted on the slide. The artificial anti- tags are modified at their 3' ends with amino group (-NH2) so that they can be stably immobilized through the aldehyde group coated on the slide. After scanning, SNP genotype of a particular gene can be called by reading its corresponding two sites. If only one site is lighted up, it can be homozygote of either allele. Otherwise, it must be heterozygote.
Fig. 2 shows the microarray image of using the ICR-TAPE strategy on two candidate genes, CETP and ACE. CETP is a A/C point mutation, while ACE is a 288-bp insertion/deletion mutation. In this demonstration, only synthetic oligonucleotides are included to find out how effective ICR-TAPE is. As shown in the figure, three different genotypes of both CETP and ACE are correctly genotyped.
Fig. 3a shows the difference in terms of synthesis of cRNA between current approach and TAPE-mediated one. In the existing procedure recommended by the manufacturer of Affymetrix chips, biotin is introduced into the cRNA during in vitro transcription (IVT). Hence the amount of biotin in one particular cRNA fragment depends largely on its sequence, size and poly-U tail +/-. With TAPE, normal NTP mixture is used during IVT. Subsequently, the product of IVT is normal RNA sequence without any biotin.
Fig. 3b shows the introduction of biotin onto the cRNA fragment by TAPE on the chip. After fragmentation and binding to its corresponding probe which is synthesized on the chip, the cRNA fragment with 3' protruding end will be effectively elongated by TdT with multiple biotin-labeled deoxynucleotides (dNTPs).
Fig. 4 shows the sensitivity of TAPE with Cy5-ddCTP.
Fig. 5A and 5B show incorporation of multiple labelled-nucleotides by TAPE.
Fig. 6 shows the attachment efficiency of elongated oligonucleotides.
Fig. 7 shows the time-based elongation by TAPE with Cy5-ddC. Elongation was shown to saturated by the first minute and no subsequent increase in signal was observed with longer incubation time.
Fig. 8 demonstrates SNP genotyping by ASMS-TAPE strategy. The common homozygotes, heterozygotes and rare homozygotes were represented by subarray AA, AB and BB, respectively. It could be clearly observed in Figure 8A that only one allele-specific site of each SNP was fluorescently-labelled in subarray AA, and the other five sites were fluorescently-labelled in subarray BB, and no fluorescence were observed when two alleles were present (subarray AB). As expected, the pattern of the genotyping result by ASMS-TAPE is exactly opposite to that by ASMS with TAMRA-ddNTPs (Fig. 8B). In ASMS- TAPE, the incorporation of ddNTP at the 3' end blocks elongation by TdT and thus no signal is generated while in ASMS, it is the ddNTP that carries the signal. When the signal intensity ratios between alleles were plotted against the logarithm values of the sum of the signals, three distinct clusters were observed, further confirming the success of both ASMS-TAPE (Fig 8C) and ASMS (Fig 8D) in accurately genotyping SNPs. Fig 9 is an electrophoresis gel showing RNA fragments elongated with dNTPs by TdT. Without TdT, the majority of the cRNA fragments were 100-200 nucleotides in length (Lane 2). In the presence of TdT, however, some of these fragments were clearly polymerized, as shown by their relatively slower migration (Lanes 3). This implies that RNA can also serve as substrate for elongation by TdT.
Fig. 10 shows elongation of synthetic oligonucleotides with/without 3'-modifiers by TdT. The 31 unmodified oligonucleotide (-OH) serves as control in this study. In the absence of TdT (TdT-), Cy5-ddCTP was not incorporated into the control (-OH(TdT-)). In contrast, extremely intense fluorescent signal was obtained when TdT was present (-OH(TdT+)), confirming that TdT is essential for the process of elongation. Besides control oligonucleotides, other oligonucleotides with different 3'-modifiers (e.g., 3'-NH2, 3'-biotin and 3'-C3 linker) were also efficiently elongated by TdT. In fact, the average signal intensities of these elongated oligonucleotides with 3' modifiers were only slightly lower than that of the control ((-OH(TdT+). Only oligonucleotides with 3'-phosphoryl group (PO4) could resist elongation by TdT, including those with dual modifications (5'-NH2, 3'-PO4).
Fig. 11 is an electrophoresis gel showing TdT-assisted polymerization of 51 or S'-biotinylated oligonucleotide. The labels are: 100bp DNA ladder (1); 5'- biotinylated oligonucleotide without TdT (2) or with TdT (3); and 3'-biotinylated oligonucleotide without TdT (4) or with TdT (5). Polymerization of the 58-mer S'- biotinylated oligonucleotide and 40-mer 5'-biotinylated oligonucleotide by TdT was also observed by gel shift assay. Without TdT, both oligonucleotides could not be elongated (Lanes 2 and 4). In the presence of TdT, both oligonucleotides were clearly polymerized (Lanes 3 and 5), as shown by the slower migration relative to Lanes 2 and 4. Fig 12 is a graph showing that the signal is indeed generated by elongation of a nucleotide carrying the signal. After elongation by TdT with Cy5-ddCTP, intense fluorescence signal was obtained. However, with Exo I treatment, the signal became very weak and the signal intensity ratio (Exo I+/Exo I-) was reduced by about 80%. This indicates that the majority of Cy5-ddCTP incorporated into oligonucleotide was digested by Exo I1 which breaks phosphodiester bonds between nucleotides.
Fig. 13 shows structures of 3' modified oligonucleotides.
Definitions
Allele - One of the variant forms of a gene at a particular locus, or location, on a chromosome. Different alleles produce variation in inherited characteristics such as hair color or blood type. In an individual, one form of the allele (the dominant one) may be expressed more than another form (the recessive one). Allele amplification - to increase the number of copies of an allele. Biomolecules - biological molecules; for example, proteins (including polypeptides and amino acids) and nucleic acids (eg deoxyribonucleic acid, DNA and ribonucleic acid, RNA) and their derivatives such as peptide nucleic acids (PNA).
Complementary - two biomolecules are said to be complementary when they fit with or bind to each other due to their characteristics and under certain conditions. Hybridization occurs when two complementary molecules bind to each other, for example, the binding of two complementary strands of nucleic acids such a probe with a target or an antibody to a protein. Hybridization can also be referred to as annealing.
For nucleic acids, hybridization is the process wherein oligonucleotides and their analogs bind by hydrogen bonding, which includes Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary bases. Generally, nucleic acid consists of nitrogenous bases that are either pyrimidines (Cytosine (C), uracil (U)1 and thymine (T) or purines (adenine (A) and guanine (G)). These nitrogenous bases form hydrogen bonds consisting of a pyrimidine bonded to a purine, and the bonding of the pyrimidine to the purine is referred to as "base pairing." More specifically, A will bond to T or U, and G will bond to C. The term "polynucleic acid" refer to more than one contiguous nucleic acid molecules. In general, the a person skilled in the art will understand that the terms "nucleic acids", "polynucleic acid", "nucleic acid strand" refer to a strand of more than one contiguous nucleic acid molecules and are used interchangeably as guided by the context in which they are used. The term "complementary" refers to the base pairing that occurs between two distinct nucleic acid sequences or two distinct regions of the same nucleic acid sequence. The terms "specifically hybridizable" and "specifically complementary" are terms which indicate a sufficient degree of complementarity such that stable and specific binding occurs between the oligonucleotide (or its analog) and the DNA or RNA target. The oligonucleotide or oligonucleotide analog need not be 100% complementary to its target sequence to be specifically hybridizable. An oligonucleotide or analog is specifically hybridizable when binding of the oligonucleotide or analog to the target DNA or RNA molecule interferes with the normal function of the target DNA or RNA, and there is a sufficient degree of complementarity to avoid non-specific binding of the oligonucleotide or analog to non-target sequences under conditions in which specific binding is desired, for example, under physiological conditions in the case of in vivo assays. Such binding is referred to as "specific hybridization." Hybridization conditions resulting in particular degrees of stringency will vary depending upon the nature of the hybridization method of choice and the composition and length of the hybridizing nucleic acid sequences. Generally, the temperature of hybridization and the ionic strength (especially the Na+ concentration) of the hybridization buffer will determine the stringency of hybridization. Corresponding base - the base on one strand of nucleic acid that is aligned with another base of another strand of nucleic acid when the two strands share significant homology and are base paired for most of their length. A base on one strand need not hybridize to its corresponding base on another strand in the case of single nucleotide polymorphism and this lack of hydridization can be used as a basis for detecting the SNP.
Discrimination - The detection and identification of a biomolecule from another biomolecule based on some selection criteria. For example in the case of alleles, allele discrimination is a procedure by which the allele of a given sample is identified, thus discriminating it from another allele. Detection technologies used in discrimination include, but are not limited to, direct detection, electrochemical, fluorescence, fluorescence polarization, colorimetry, mass spectrometry, luminescence, optical, primer extension and minisequencing. Invader cleavage reaction - The invader cleavage reaction (ICR) is a means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. Under this method, a nucleic acid cleavage structure is formed on a target sequence depending on whether the probe matches or does not match the target sequence. The unique cleavage structures are then cleaved in a site-specific manner by the 5' nuclease activity of a variety of enzymes, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof. ICR is taught in the following US patents: 5,846,717; 6,348,314; 6,001 ,657; 6,090, 543; 6,090,606; and 5,888,780, all of which are hereby incorporated in full by reference. Oligonucleotide ligation assay - The oligation ligation assay (OLA) is a technique for detecting single nucleotide polymorphisms. OLA uses a pair of oligonucleotide probes (oligomers) that hybridize to adjacent or contiguous segments of DNA including the variable single base. The oligomer on the 5' end of the pair is an allele-specific oligonucleotide (ASO) to one allele of the target. The last base at the 31 end of this ASO is positioned at the site of the target DNA's polymorphism. In some embodiments, the ASO also has a biotin molecule at its 5' end that functions as a chemical hook. The oligomer on the 3' end of the pair is the common oligomer (that is, the sequence is the same for the two different alleles.) The common oligomer is positioned at an invariable site next to the target DNA's polymorphism and is labeled at its 3' end. If the ASO is perfectly complementary to the target sequence: the ASO hybridizes completely when annealed and will lie flat against that target, DNA ligase can then be used to covalently ligate the ASO to the common oligomer and this successful ligation can be detected. One way to detect the successful ligation is to use the biotin hook to remove the ASO and the labeled common oligomer will also be removed, producing a detectable signal. However, the chemical hook need not be used if the ligated molecule can be detected by other means. The OLA is taught in US Patent Numbers 4,988,617 and 5,830,711 , which are hereby incorporated in full by reference.
Chemical cleavage of mismatch detection - The chemical cleavage mismatch detection (CCM) technique is a DNA mutation detection system which involves the addition of the chemicals hydroxylamine and osmium tetroxide which react with free cytosine and thymine nucleotides respectively (Cotton & Campbell, 1999). By denaturing the double stranded DNA being screened and allowing it to hybridize with a single stranded labelled DNA probe, any mismatched cytosine or thymine nucleotides will be exposed and therefore be susceptible to reaction with the hydroxylamine and osmium tetroxide. The addition of piperidine results in cleavage of the DNA being screened at any such sites allowing identification of mutations after gel electrophoresis. Potassium permanganate and tetraethylammonium chloride are safe and effective substitutes for osmium tetraoxide in solid phase fluorescent chemical cleavage of mismatch reactions. The use of potassium permanganate and tetraethylammonium chloride rather than osmium tetraoxide enhances cleavage at T/G mismatched pairs.
Genotyping - The process of assessing genetic variation present in an individual. Homology - biomolecules like proteins and nucleic acids possess a sequence of amino acids and nucleotides respectively. Homology refers to the degree of similarity between sequences. In proteins, homology refers to the degree of similarity between sequences of amino acids. In nucleic acids, it refers to the sequential correspondence of nucleotide triplets in a nucleic acid molecule that permits nucleic acid hybridization.
Microarray - a microarray is a two-dimensional array, typically on a glass, filter, or silicon wafer, upon which genes or gene fragments are deposited or synthesized in a predetermined spatial order allowing them to be made available as probes in a high-throughput, parallel manner. Microarray formats include, but are not limited to, bead arrays, bead based arrays, bioarrays, bioelectronic arrays, cDNA arrays, cell arrays, DNA arrays, encoded bead arrays, gel pad arrays, gene arrays, gene expression arrays, genome arrays, genomic arrays, high density oligonucleotide arrays, high density protein arrays, hybridization arrays, in situ arrays, low density arrays, microelectronic arrays, multiplex DNA hybridization arrays, nanoarrays, nylon macroarrays, oligo arrays, oligonucleotide arrays, oligosaccharide arrays, peptide arrays, planar arrays, protein arrays, solution arrays, spotted arrays, tissue arrays, exon arrays, filter arrays, macroarrays, small molecule microarrays, suspension arrays, theme arrays, tiling arrays, transcript arrays; and gene expression arrays.
Minisequencing - A solid-phase method for the detection of any known point mutation or allelic variation of DNA.
Moiety - A moiety is a functional group attached to a larger molecule. Moieties can be used as modifiers to alter the characteristic of larger molecules. For example, a moiety may be added to the 3' end of a strand of nucleic acid to modify the characteristic of the nucleic acid strand such as changing its susceptibility to certain enzymes.
Nucleotide or nucleic acid - One of the structural components, or building blocks, of deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). A nucleotide consists of a base (one of four chemicals: adenine, thymine, guanine, and cytosine) plus a molecule of sugar and one of phosphoric acid. A polynucleotide is a nucleic acid sequence (such as a linear sequence) of any length. Therefore, a polynucleotide includes oligonucleotides, and also gene sequences found in chromosomes. An "oligonucleotide" is a plurality of joined nucleotides joined by native phosphodiester bonds. An oligonucleotide is a polynucleotide of between 6 and 300 nucleotides in length. An oligonucleotide analog refers to moieties that function similarly to oligonucleotides but have non-naturally occurring portions. For example, oligonucleotide analogs can contain non-naturally occurring portions, such as altered sugar moieties or inter-sugar linkages, such as a phosphorothioate oligodeoxynucleotide. Functional analogs of naturally occurring polynucleotides can bind to RNA or DNA, and include peptide nucleic acid (PNA) molecules.
Polymerase chain reaction (PCR) - A laboratory technique to rapidly amplify pre- determined regions of double- stranded DNA. Universal PCR is the amplification of multiple loci of interest.
Single nucleotide polymorphism (SNP) - SNPs are polymorphisms due to single nucleotide substitutions (transitions > transversions) or single nucleotide insertions/deletions in genomic DNA at a frequency of 1 % or higher. Probes and primers - Probes and primers as used herein may, for example, include at least 10 nucleotides of the nucleic acid sequences that are shown to encode specific proteins. In order to enhance specificity, longer probes and primers may also be employed, such as probes and primers that comprise 15,20, 30,40, 50,60, 70,80, 90 or 100 consecutive nucleotides of the disclosed nucleic acid sequences. When referring to a probe or primer, the term specific for (a target sequence) indicates that the probe or primer hybridizes under stringent conditions substantially only to the target sequence in a given sample comprising the target sequence. Detailed description of the invention
Bibliographic references mentioned in the present specification are for convenience listed in the form of a list of references and added at the end of the examples. The whole content of such bibliographic references is herein incorporated by reference.
The present invention relates to a universal signal detection and/or amplification method and may be applied to various molecular biology reactions, such as complementary nucleic acid hybridizations and/or antibody-protein hybridizations, through the use of suitable enzymes. Accordingly, while the method according to the present invention is described with particular reference to its application for the detection of at lesat one signal in at least one nucleic acid, the method may also encompass the application to other biomolecules as mentioned above. As possible applications, SNP genotyping and gene expression studies through DNA microarray platforms are exemplified here to illustrate how the limitations associated with existing technologies can be circumvented by the present invention. However, the present invention is not limited to the use to the use of microarray format. Any other suitable technique know in the art, for example magnetic bead(s) or any other solid substrate such as microtitre plate(s) may be used. As suitable enzyme for the purpose of the present invention, a template-independent enzyme may be used. In particular, the template-independent enzyme may be terminal deoxynucleotidyl transferase (TdT). Accordingly, such applications of the present invention wherein a probe is elongated by TdT is termed TdT-assisted probe elongation (TAPE). A novel capability of the TdT enzyme is also described under the present invention. However, the present invention is not limited to TAPE. Further, the present invention is not limited to application of SNP detection and/or genotipying. According to one aspect, the invention provides generally a method of detecting at least one signal in a nucleic acid, the method comprising:
(i) providing at least one nucleic acid; and
(ii) adding at least one signal molecule to the nucleic acid by at least a template-independent enzyme, thereby detecting the at least one nucleic acid.
Preferably, the template-independent enzyme is terminal deoxyribonucleotidyl transferase (TdT).
There is also provided a method of detecting at least one signal in at least one nucleic acid hybridization reaction, the method comprising: (a) providing at least one nucleic acid target sequence and at least one probe; (b) allowing the at least one probe to hybridize to the target sequence to form hybridized molecule; (c) discriminating between hybridized molecules to form at least one discriminated molecule; and (d) adding at least one signal molecule using at least one template-independent enzyme to the discriminated molecule, thereby allowing detection of the at least one signal.
The template-independent enzyme may be, for example, terminal deoxyribonucleotidyl transferase (TdT).
In nature, TdT catalyzes the addition of normal, fluorescent or biotin-labeled deoxynucleotides (dNTPs), dideoxynucleotides (ddNTPs) or ribonucleotides (NTPs) to the free 3'-OH termini of DNA in a unique template-independent manner. TdT is able to add multiple deoxynucleotides to the 3 termini of probes. Although TdT can act on DNA with either even ends, recessive ends, or protruding ends, the incorporation efficiency is highest for DNA with 3' protruding ends. According to the method of the invention, these features may be used to overcome the main disadvantages of minisequencing. Unlike minisequencing, the substrates for TdT are deoxynucleotides (dNTPs) and these could be labeled for use as signal molecules. Subsequently, multiple dNTPs can be incorporated onto each probe to amplify the signal as opposed to a single ddNTP by minisequencing. This feature of TAPE alone can remarkably improve the sensitivity to a great extent. Moreover, the signal introduction by TAPE is no longer dependent on formation of probe-target hybrid since it occurs on the 31 terminal of the probes.
Accordingly, the main steric hindrance effects of minisequencing are circumvented. In addition, we demonstrate below that only one fluorophore- labeled deoxynucleotide is required to generate a detectable signal using TAPE. In contrast, four labeled dideoxynucleotides are needed in the course of minisequencing. It is also noteworthy that TAPE may be carried out under room temperature, thus requiring no special equipments or incubators. Further, TAPE is compatible with most current allele-discrimination chemistries other than minisequencing, such as invader cleavage reaction (ICR) (de Arruda et al, 2002; Lyamichev and Neri, 2003) catalyzed by specific flap endonuclease 1 (FEN1), oligonucleotide ligation assay (OLA) (Barany, 1991 ; Consolandi et al, 2003) catalyzed by DNA ligase, and even chemical cleavage of mismatch (CCM) (Cotton and Campbell, 1989; Ellis et al, 1998) which is a very specific SNP screening approach.
Accordingly to one aspect, the invention provides a method of detecting at least one signal in a nucleic acid hybridization reaction wherein the discriminating is by an invader cleavage reaction. In particular, there is provided a method of detecting at least one signal in a nucleic acid hybridization reaction, the method comprising: providing a first probe, a second probe and a third probe to react with the target sequence, wherein the first probe is complementary to a 5' portion of the target sequence and the second and third probes are allele- specific probes and complementary to a 3' portion of the target sequence; allowing formation of hybridized molecules comprising allele-specific cleavage structures; and discriminating between allele-specific cleavage structures with at least one cleavage means, the at least one cleavage means releasing a portion of a probe to form a discriminated molecule; and adding at least one signal molecule using at least one template-independent enzyme to the discriminated molecule, thereby allowing detection of the at least one signal. The cleavage means may be a cleavase enzyme.
According to another aspect, the invention provides a method of detecting at least one signal in a nucleic acid hybridization reaction wherein the discriminating is by an oligonucleotide ligation assay. In particular, there is provided a method of detecting at least one signal in a nucleic acid hybridization reaction, the method comprising: providing a first probe and a second probe wherein the first and second probes hybridize to contiguous portions of the target sequence, wherein either probe has at least one terminal base complementary with an allelic difference in the target sequence; allowing the two probes to hybridize to the target sequence; ligating the two probes with a ligase to form a discriminated molecule; and adding at least one signal molecule using at least one template-independent enzyme to the discriminated molecule, thereby allowing detection of the at least one signal.
According to another aspect, the invention provides a method of detecting at least one signal in a nucleic acid hybridization reaction wherein the discriminating is by chemical cleavage of mismatch reaction. More in particular, there is provided a method of detecting at least one signal in a nucleic acid hybridization reaction, the method comprising: providing at least a first chemical that recognises and binds to a first type of nucleotide, at least a second chemical that recognises and binds to a second type of nucleotide, at least one target sequence and at least one labelled probe; allowing the probe(s) and the target sequence(s) to form hybridzed molecules; adding at least a third chemical to cleave the hybridized molecules at the nucleotide bases with bound to the first and second chemicals, thereby forming at least one discriminated molecule and adding at least one signal molecule using at least one template- independent enzyme to the discriminated molecule, thereby allowing detection of the at least one signal. The first chemical may be hydroxylamine and the first type of nucleotide cytosine. The second chemical may be osmium tetroxide or potassium permanganate / tetraethylammonium chloride, and the second type of nucleotide thymine. The third chemical may be piperidine. The method can further comprise separating the at least one discriminated molecule.
The invention also provides a method of genotyping and/or analysis of gene expression, the method comprising: providing at least two allelic nucleic acid target sequences and at least one probe; allowing the at least one probe to hybridize to the target sequences to form hybridized molecules; discriminating between hybridized molecules based on presence of at least one allele to form at least one discriminated molecule; and adding at least one signal molecule using at least one template-independent enzyme to the discriminated molecule, thereby allowing detection of at least one allele.
In particular, the invention provides a method of detecting Single Nucleotide Polymorphisms (SNP), the method comprising: providing at least two allelic nucleic acid target sequences and at least one probe; allowing the at least one probe to hybridize to the target sequences to form hybridized molecules; discriminating between hybridized molecules based on presence of at least one SNP to form at least one discriminated molecule; and adding at least one signal molecule using at least one template-independent enzyme to the discriminated molecule, thereby allowing detection of at least one SNP.
The adding of the at least one signal molecule can be repeated to amplify the signal detected and the can be by invader cleavage reaction, oligonucleotide ligation assay and/or chemical cleavage by mismatch reaction. The template- independent enzyme may be terminal deoxyribonucleotidyl transferase (TdT). The at least one signal molecule is capable of being labeled and/or detected and the detection may be, for example, by photometric, fluorescent, radioactive and/or enzymatic means.
Under the present invention, various genotyping and/or gene expression platforms may be developed by coupling TAPE with different allele- discrimination chemistries and/or technique(s). In particular, various SNP genotyping and/or screening platforms may be developed by coupling TAPE with different allele-discrimination chemistries and/or technique(s).
According to the present invention, the nucleic acid(s) may be selected from the group consisting of DNA, RNA and PNA. In particular, the nucleic acid(s) may be either DNA or RNA or both. The method can be conducted in a microarray format.
In the gene expression example given below, TAPE can be easily integrated into the existing "DNA chips" such as the GeneChip® platform from Affymetrix®, with only two modifications to its current protocol.
The first modification is during the synthesis of cRNA, in which only normal NTPs are introduced instead of NTPs with biotin-C/UTP under the present strategy. Under the methods of the prior art such as that for the GeneChip® platform from Affymetrix®, the original target is the amount of messenger RNA (mRNA) that are transcribed for each gene. For the present invention, these mRNA are converted to complementary RNA or cRNA (if using Affymetrix®) or cDNA if using other methods, to form converted targets. To determine the amount of gene expressed, the converted targets are hybridized to complementary probes.
The second difference is an additional step after fragmentation and hybridization, in which fragments that successfully form hybrid with probes on chip will be equally elongated with biotin-labeled dNTPs by TAPE. After removal of un hybridized targets, signal molecules are added by TdT. It will be appreciated by a person skilled in the art that gene expression analysis by the method of the present invention is quantitative, rather than merely qualitative, as the signal intensity for each gene is an indication of how many copies are being transcribed.
This method of the present invention is contrasted with the method of the priora art wherein the targets are themselves pre-labelled during Reverse Transcription-PCR (RT-PCR) with typically Cy3 and Cy5. For Affymetrix®, the cRNA targets are also pre-labelled before hybridization to the probes on the chips.
The advantages of introducing TAPE into the current strategy of DNA chips such as GeneChip® can be shown in a few aspects. First of all, comparison between genes on the same array can be performed. The crucial step in gene expression strategy by AffymetrixΘ's GeneChip® is the introduction of biotin, which originally depended largely on the GC content, size of the fragmented cRNAs, and whether or not the cRNAs have poly-U tails. With TAPE, those factors are no longer relevant as the number of biotin molecules to be incorporated is now template-independent.
As such, the different signal intensities between genes on one chip can now be attributed to different expression levels of different genes by the method of the present invention. As such, it is now possible to compare the signal intensities among the multiple fragments of one particular gene. It is also noteworthy that the price of biotin-dNTPs is lower than that of biotin-NTP. Therefore, the cost of using a gene chip platform can be remarkably reduced and the data analysis greatly simplified. Further, TAPE is able to improve the sensitivity of the current approach. By optimizing the reaction conditions of TAPE, more biotin-labeled dNTPs can be incorporated into the ends of cRNA fragments because TdT has been proven to be very effective in extending oligonucleotides carrying free 3'-OH group.
The potential applications of the present invention include, but not limited to, SNP genotyping and gene expression studies. Besides microarray-based platforms, many non-microarray platforms can also be developed with this invention.
Further, the present invention relates to a universal signal detection and/or amplification approach as opposed to target amplification methods such as PCR. As such, the specificity of any platforms based on this invention is dependent on their molecular recognition chemistries. In the case of SNP genotyping methods, for example, the allele-discrimination chemistry employed is crucial to the specificity of the method. In gene expression studies, however, the hybridization between probes and cRNA fragments determines how specific the assay is. By repeating several runs of TAPE as desired, the sensitivity of the method of the present invention may be increased.
According to another aspect, the invention also provides a method of analyzing gene expression, the method comprising: providing at least two nucleic acid target sequence and at least one probe; allowing the at least one probe to hybridize to the target sequences to form hybridized molecules; discriminating hybridized and unhybridized molecules to form at least one discriminated molecule; and adding at least one signal molecule using at least one template- independent enzyme to the at least one molecule, thereby allowing detection of the at least one signal for analyzing gene expression. The adding the at least one signal molecule may be repeated to amplify the signal detected. The template-independent enzyme may be terminal deoxyribonucleotidyl transferase (TdT). The at least one signal molecule is capable of being labeled and/or detected and the detection may be, for example, by photometric, fluorescent, radioactive and/or enzymatic means.
According to another aspect, there is also provided a method of detecting a strand of nucleic acids, the method comprising: providing a strand of nucleic acids, wherein the nucleotide at the 3' end of the strand does not comprise a free hydroxyl group, and at least one modifier molecule; adding a tag to the strand by the modifier molecule; introducing at least one signal molecule; and catalyzing the adding of the at least one signal molecule to the 3' end of the strand of nucleic acids with template-independent enzyme. The template- independent enzyme may terminal deoxyribonucleotidyl transferase (TdT). The tag, may be any known tag suitable for the purpose of the invention. For example, the at least one tag may comprise at least a hydroxyl group, an amino group, a biotin group and/or a C3 linker group.
Thus, depending on what is expected to achieve, appropriate analytical chemistry can be chosen to practise the present invention. The method of the present invention can be incorporate various analytical chemistries to highlight various genetic events (in SNP, gene expression, and the like).
According to another aspect, there is also provided a nucleic acid strand obtained by the method of detecting a strand of nucleic acids wherein the 3' end of the strand does not comprise a free hydroxyl group.
According to another aspect, there is also provided a kit for detecting at least one signal in a nucleic acid , the kit comprising at least one template- independent enzyme. For example, the template-independent enzyme may be terminal deoxyribonucleotidyl transferase (TdT). The kit may further comprise a at least a signal molecule. The kit may further comprise at least, one probe. The kit may further comprise information pertaining to its use. In particular, the kit is a kit for detecting at least one signal in a nucleic acid hybridisation reaction. There is also provided a kit for detecting a strand of nucleic acids where the 3' end of the strand was terminated by a base not possessing a free hydroxyl group, the kit comprising at least one template-independent enzyme. For example, the template-independent enzyme may be terminal deoxyribonucleotidyl transferase (TdT). The kit may further comprise at least one modifier molecule and at least one tag. The tag may comprises at least a hydroxyl group, an amino group, a biotin group and/or a C3 linker group. The kit may further comprise information pertaining to its use.
From the general description and the following non-limiting examples, a person skilled in the art will appreciate the characteristic(s) and/or advantage(s) of the present invention and that the signal detection and amplification method of the present invention may be applied to a number of hybridization platforms and discrimination chemistries such as ICR, OLA and CCM. The method(s) and kit(s) according to any aspect or embodiment of the invention may encompass any of the variation as follows. The variations under the present invention comprises, but are not limited to: 1) introduction of modified nucleotides into regular probes for immobilization on solid substrate or support such as aldehyde-coated slides, magnetic beads, microtitre plates or other microarray formats; 2) incorporation of fluorescent nucleotides onto oligonucleotides of DNA or RNA fragments, thus serving as a signal generating and amplification tool; and 3) leveraging on the ability of TdT to extend multiple fluorescently labelled dNTPs contiguously for nucleic acids that do not possess a free hydroxyl moiety, the method of the present invention can be used as a signal amplification tool for detecting targets of low abundance. The person skilled in the art will also appreciate that other signal molecules for signal detection means by photometry, radioactivity or enzymatic action can be used under the present invention. - -
While applications of the present invention to nucleic acid hybridization reactions have been described, a person skilled in the art will appreciate that the invention may also be applied to hybridization of other biological molecules such as that between proteins, antibodies and their derivatives.
Having now generally described the invention, the same will be more readily understood through reference to the following examples which are provided by way of illustration, and are not intended to be limiting of the present invention.
EXAMPLES
Standard molecular biology techniques known in the art and not specifically described were generally followed as described in Sambrook and Russel, Molecular Cloning: A Laboratory Manual, Cold Springs Harbor Laboratory, New York (2001).
Example 1 : ICR-TAPE strategy
The power of TAPE for genotyping studies is demonstrated by the ICR-TAPE strategy of the present invention, i.e., the different alleles of genes is molecularly recognized by invader cleavage reaction and the signal is introduced and amplified by TAPE. The invader assay depends on the unique ability of cleavase enzymes to discriminate a special overlap structure between the probes (including signal and invader probes) and the targets (Fig. 1a).
Besides the DNA targets, there are one invader probe and two allele-specific signal probes in each assay. The 3' ends of signal probes are blocked with phosphate group to ensure that no TAPE can happen without cleavage of the signal probes to expose their 3'-OH group. Besides the SNP site, the signal probes also differ from each other in being tagged with different universal sequences at their 5' ends so that the two alleles of genes can be addressed by their corresponding anti-tags immobilized on chip by hybridization. The invader probes are sequence completely complementary to the upstream sequence of the SNP site with the last base where SNP is located to be any dNTP of the four. If perfect match happens between the signal probes and the targets at SNP site (C/G in Fig. 1a), cleavage will occur to release the universal tags with free 3'-OH groups, which will be elongated with fluorescently labeled dNTPs (Fig. 1b). Otherwise, the signal probes (T/G in Fig. 1a) will remain intact so that signal cannot be introduced by TAPE (Fig. 1b).
Using synthetic targets to simulate the 2 respective alleles of each SNP, we demonstrated ICR-TAPE on two representative genes, CETP (cholesteryl ester transfer protein) and ACE (angiotensin l-converting enzyme). CETP is a C/A point mutation while ACE is a 288bp insertion/deletion. The 70-mer synthetic targets of both genes (bold letter corresponding to SNP site) are:
CETPCoA:
TTCCTTGATATGCATAAAATAACTCTGGGTGGGTATACAGCCTCTGAGATC
ATTGGCTGCCTCCGGGAGA (SEQ ID NO: 1)
CETPCoC:
TTCCTTGATATGCATAAAATAACTCTGGGGGGGTATACAGCCTCTGAGATC
ATTGGCTGCCTCCGGGAGA (SEQ ID NO: 2)
ACECoA:
AGAGCTGGAATAAAATTGGCGAAACCACATAAAAGTGACTGTATAGGCAGC
AGGTCTAGAGAAATGGGAG (SEQ ID NO: 3)
ACECoT:
CAGAGCGAGACTCCGTCTCAAAAAAAAAAAAAAAGTGACTGTATAGGCAG
CAGGTCTAGAGAAATGGGAG (SEQ ID NO: 4)
The invader probes are: ipCETP: GCAGCCAATGATCTCAGAGGCTGTATACCCT (SEQ ID NO: 5) ipACE: TCTAGACCTGCTGCCTATACAGTCACTTTTC (SEQ ID NO: 6)
The 3' blocked allele-specific signal probes (universal tags are underlined, SNP is bold letter) are: bpCETPa: CCGTCATAATCTCTAGACCGACCCAGAGTTATTTTATGCATATCp
(SEQ ID NO: 7) bpCETPc: AAGTCGTCCGACATTAAAGCCCCCAGAGTTATTTTATGCATATCp
(SEQ ID NO: 8) bpACEa:
GCTGAGGTCGATGCTGAGGTCGCAATGTGGTTTCGCCAATTTTATTp (SEQ
ID NO: 9) bpACEt:
GCTGCGATCGATGGTCAGGTGCTGTTTTTTTTTTTGAGACGGAGTCp (SEQ
ID NO: 10)
The universal anti-tags (3'-modified with amino group to allow for immobilization on chip) are: antitagOI : CGGTCTAGAGATTATGACGGttttttttttttttt-NH2 (SEQ ID NO: 11) antitagO2: GCTTTAATGTCGGACGACTTttttttttttttttt-NH2 (SEQ ID NO: 12) antitagO3: TGCGACCTCAGCATCGACCTCAGCttttttttttttttt-NH2 (SEQ ID NO:
13) antitagO4: CAGCACCTGACCATCGATCGCAGCttttttttttttttt-NH2 (SEQ ID NO:
14)
Each 10μl invader reaction mixture contains the following components: 200ng of Cleavase® VIII enzyme purchased from Third Wave Technologies (Madison, Wl), 1.85μl of invader buffer (5.5X), 50fmols of each invader probe, 200fmols of each signal probe and 50fmols of each synthetic target. Three synthetic target pools, which contain either CETPCoC and ACECoT, or CETPCoA and ACECoA, or all four, simulate three different genotypes of two genes, C and T homozygotes, A and A homozygotes, or CA and TA heterozygotes, respectively. The reaction is performed isothermally at 630C for about 2 hours. Afterwards, 5μl of the invader products are directly used to run TAPE reaction, which typically contains 2 units of TdT, 2μl of TdT buffer (5X), and 10μM Cy3-dCTP. This reaction is carried out at room temperature or in 370C incubator for 20-30 minutes, followed by 750C for 15 minutes to inactivate the TdT enzyme. Subsequently, about 5μl of the TAPE products are directly placed on chip to allow for hybridization between tags of the signal probes and anti-tags on chip (550C, 1-2 hours). After washing by 0.2%SDS once for 5 minutes and water twice for 3 minutes, the chip is scanned to acquire the fluorescence signal by ScanArray® 5000 (Packard BioScience Ltd, UK).
As shown in Fig.2, all 3 different genotypes of CETP and ACE, representing a pool of nucleic acids, were correctly genotyped by ICR-TAPE.
Example 2 - Immobilization of oligonucleotides with NH2 modifier
Commercially available oligonucleotides with NH2-modifier from 1st BASE (Singapore) were re-suspended to 20μM with Arraylt™ micro-spotting solution (TeleChem) prior to spotting on aldehyde-coated slides (CEL) using a PixSys 7500 arrayer (Cartesian). The quadruplicate spots were arranged in a 2 x 2 format. After incubation (370C, overnight), the slides were washed sequentially with 2 x SSC (3 min), 0.2% SDS (3 min), boiling water (3 min) and water (3 min). The materials thus prepared were then used in the examples below.
Example 3 - The sensitivity of TAPE
An oligonucleotide probe with a 3'-NH2 group with a 15 dT spacer or (TCGATCCAGTCACGTCGCTAttttttttttttttt; SEQ ID NO: 15) was immobilized as described above. The 15-dT spacer was introduced to facilitate hybridization through the capitalized sequence. In order to determine the sensitivity of TAPE, a 38-mer oligonucleotide tagged with a complementary sequence (TAGCGACGTGACTGGATCGAgggaacacctccgacacc; SEQ ID NO: 16) to the probe was serially (1/2) diluted from 40fmols/μl to 2.5fmols/μl. One microliter of these dilutions were separately elongated by TdT (1 U) with Cy5-ddC (1pmol) in a 5μl solution at room temperature (RT) for 20 minutes, followed by addition of 1μl of 0.5M EDTA (pH 8.0) and incubation at 950C for 10 minutes to inactivate TdT. These mixtures were then loaded on the slide and placed in a humidified cassette to allow for hybridization in a water bath (500C, 1 hr). Finally, the slide was washed sequentially with 2 x SSC (3 min) and water (3 min, twice), and scanned by ScanArray® 5000 (Packard BioScience Ltd, UK) at 90% laser power and 90% PMT.
Example 4 - Incorporation of multiple labelled nucleotides by TAPE
Another oligonucleotide with 5'-NH2 (tttttttttttttttCCTATACAGTCACTTTT; SEQ ID NO: 17) was also immobilized on the slides as described above. Due to the availability of 3'-OH group of this oligonucleotide, elongation by TdT can be carried out on the slide. The objective of this experiment was to find out whether multiple labelled-nucleotides could be incorporated by TdT. For this purpose, three mixtures were prepared, containing either O.δpmols of Cy5-ddU alone, O.δpmols of Cy5-dU alone, or both O.δpmols of Cyδ-dU and 2pmols of normal dNTPs. Each mixture contained 1 unit of TdT and was made up to δμl with deionized water (diH2O). The mixtures were loaded onto three subarrays to permit elongation of the probes on the slide (RT, 20 min). Subsequently, the slide was washed and scanned as described earlier.
In addition, we also carried out elongation of the 38-mer oligonucleotide (SEQ ID NO: 16) (20pmols) with 40pmols of either biotin-dU, FITC-dU or both. In this set up, it is only when both biotin-dU and FITC-dU are incorporated into the same oligonucleotide that it will be captured and detected. In each reaction, there were 2OU of TdT and 400pmols of dNTPs. Following incubation (RT, 2hrs), an aliquot of the mixture was captured by streptavidin-coated beads (Dynal Biotech) (RT1 1 hr). After washing, the solution was transferred to 96-well plate to be read by Wallac VICTOR2 V multi-label plate counter (PerkinElmer).
Results for Examples 3 and 4
It is shown in Figure 4 that TAPE has a good sensitivity of 10fmols. When the amount of the target oligonucleotide was doubled to 20fmols, the signal intensity increased correspondingly but plateaued out beyond 20fmols when the saturation point of the scanner was reached. Moreover, TAPE with Cy5-dU or Cy5-dU/dNTPs generated much stronger fluorescence (2-3 times higher) than that with Cy5-ddU, indicating the occurrence of multiple-incorporation of Cy5-dU (Figure 5A). This was further substantiated by performing TAPE with biotin- /FITC-dU. With the presence of either biotin-dU or FITC-dU, the fluorescence was very low. When both were present, the intensity increased more than 5 folds, implying that both biotin-dU and FITC-dU were incorporated into the same oligonucleotide (Figure 5B).
Array fabrication with unmodified oligonucleotides by TAPE
Intense fluorescence was observed from all spots after TAPE with Cy5-ddC was carried out on the array fabricated from oligonucleotides elongated with aminoallyl-dUTP. This implies that elongation was efficient and the amino moiety facilitated the immobilization of these oligonucleotides on aldehyde- coated slides. The array shown in Figure 6 was fabricated by immobilizing regular oligonucleotides which were previously extended by TAPE with aminoallyl-dUTP, and evaluation of the quality of this custom-made array was accomplished by another TAPE with Cy5-ddC.
Example 5 - The time-based TAPE
The oligonucleotide immobilized through 5'-NH2 as taught in Example 2 was also used to investigate time-based TAPE because such reaction could be terminated at various time intervals by washing away active TdT and redundant Cy5-ddC from the slide as described earlier. The 5μl reaction cocktail contained 1 U of TdT1 1 pmol of Cy5-ddC, 1 μl of TdT buffer and 2μl of diH2O. These were loaded onto the slides and incubated at time intervals of 1 , 2, 3, 4, 5, 10, 15 and 20 min. At each time point, the corresponding slide was stringently washed to remove TdT and Cy5-ddC before scanning.
3' aminoallylation of unmodified oligonucleotides by TAPE for array fabrication
A small aliquot (450pmols) of each synthetic oligonucleotide (Table 1 below) was elongated in a 15μl solution containing 2OU of TdT and 1 nmol of aminoallyl-dUTP (Fermentas). The mixture was incubated in a thermal cycler (37°C, 2 hrs), followed by heat inactivation (95°C, 10 min). After the concentration of the oligonucleotide was adjusted to 15μM with Arraylt micro- spotting solution, they were spotted on the aldehyde-coated slides as described earlier. In order to find out the immobilization efficiencies of these elongated oligonucleotides, TAPE reaction with Cy5-ddC was carried out on the slide.
Figure 6 shows that intense fluorescence could be obtained within one minute of elongation by TAPE with Cy5-ddC. By incubation of up to 20 minutes, however, the fluorescence intensity did not increase correspondingly. This suggests that elongation by TdT is extremely rapid.
Example 6 - SNP qenotvpinq by ASMS-TAPE
One potential application that we have exploited TAPE was SNP genotyping. This was demonstrated by integrating TAPE with allele-specific minisequencing (ASMS). A pair of allele-specific primers has their 3' ends bearing the complementary base of the SNP. The principle behind ASMS-TAPE is that, when the SNP of interest is a homozygote, one of the two allele-specific primers will be extended by minisequencing with regular ddNTPs, while the other is still available for elongation by TAPE with a fluorescent ddNTP. In the case of heterozygote, both primers will be blocked so that no fluorescence can be introduced by the subsequent TAPE reaction. In order to prove the principle of ASMS-TAPE, five representative SNPs, C>T, OA, C>G, G>A and G>T with the exception of A>T (as we do not have an A > T SNP in our current panel) were genotyped using synthetic oligonucleotides (Table 1 below). Three pools were prepared from these oligonucleotides to simulate three genotypes of a SNP. One pool comprised of one allele-specific target of all SNPs to simulate common homozygotes, another pool contained the other allele-specific targets to simulate rare homozygotes, and the third pool was composed of all targets to simulate heterozygotes.
Table 1 The synthetic oligonucleotides used for SNP genotyping by ASMS-TAPE
SNPs Alleles Sequences (5'— 3') *
G ctggagtcgcaggtgtccctGGTGTCGGAGGTGTTCCCGG
Eln-422 A ccgggaacacctccgacacIAGGGACACCTGCGACTCCAG
C ttctcaacccatgtccccagGTGTGACTAAGGCTCACGGG
Eln-290
T cccgtgagccttagtcacaJ_CTGGGGACATGGGTTGAGAA
G caattctgaaaagtagctaaGGCTCATTTGGTAGTGAAGT
ANGR T acttcactaccaaatgagcATTAGCTACTTTTCAGAATTG
C tctcagaggctgtatacccCCCCAGAGTTATTTTATGCAT
CETP A atgcataaaataactctgggIGGGTATACAGCCTCTGAGA
C acaccttccccactctcttaGGGTACAGAAAGGAGATGCA
ATIIID G tgcatctcctttctgtaccGTAAGAGAGTGGGGAAGGTGT
With the exception of the SNP site which is underlined, the two allele-specific oligonucleotides of each SNP are complementary to each other. These oligonucleotides served as both probes to be immobilized on the slides and synthetic targets for allele-specific minisequencing reaction.
The capitalized sequences of these oligonucleotides are exactly complementary to their corresponding allele-specific primers for ASMS.
Allele-specific minisequencing was performed typically in an 8μl cocktail containing 1 U of ThermoSequenase DNA polymerase, IOOfmols of allele- specific primers which were complementary to the capitalized sequences of the synthetic oligonucleotides listed in Table 1 , 20fmols of synthetic targets from one of the three pools and 20pmols of ddNTPs. The initial temperature was 950C (5 min), followed by 30 cycles of 950C (30 sec), 5O0C (20 sec) and 540C (30 sec). The final extension was 6O0C (5 min). Following this, a 2μl mixture with 0.5U of SAP was introduced to digest redundant ddNTPs which might compete with Cy5-ddC in subsequent elongation by TdT. After heat-inactivation of SAP (950C, 10 min), 1 μl of this solution was mixed with 1 U of TdT and 1 pmol of Cy5-ddC to elongate the oligonucleotides which were not terminated by ASMS (RT, 20 min). After inactivation of TdT, the solution was loaded on the array prepared from elongated oligonucleotides with aminoallyl-dUTP. Following hybridization (500C, 1 hr) in a water bath and washing (2 x SSC, 3 min; water, 3 min, twice), the array was scanned to acquire fluorescence.
These SNPs were also genotyped by ASMS with four TAMRA-labelled ddNTPs to serve as control. Following ASMS, hybridization was directly carried out for genotype calling.
Three pools of five SNPs were all specifically genotyped by ASMS-TAPE using the custom-made oligonucleotide arrays mentioned earlier. The common homozygotes, heterozygotes and rare homozygotes were represented by subarray AA, AB and BB, respectively. It could be clearly observed in Figure 8A that only one allele-specific site of each SNP was fluorescently-labelled in subarray AA, and the other 5 sites were fluorescently-labelled in subarray BB, and no fluorescence were observed when two alleles were present (subarray AB). As expected, the pattern of the genotyping result by ASMS-TAPE is exactly opposite to that by ASMS with TAMRA-ddNTPs (Figure 8B). When the signal intensity ratios between alleles were plotted against the logarithm values of the sum of the signals, three distinct clusters were observed, further confirming the success of both ASMS-TAPE and ASMS in accurately genotyping SNPs (Figure 8C, D). Example 7 - Elongation of RNA fragments by TAPE
RNA fragments from frozen liver tissue of mouse were prepared according to the standard protocol of Affymetrix®. Following the protocol, total RNA was isolated using Trizol reagent (Life Technologies) and then purified with RNeasy® Mini Kit (Qiagen). Following this, 10μg of purified RNA was reverse transcribed to cDNA with Superscript Il (Invitrogen). Subsequently, cDNA was in vitro transcribed to biotinylated cRNA using the RNA transcript Labeling Kit (Affymetrix®).
Two reaction mixtures were prepared and both contained 2μl of cRNA fragments and 1 μl of dNTPs (10OnM). 100 U of TdT were introduced into only one mixture. After topping up to 20μl with diH2O, the mixtures were incubated in a thermal cycler (37°C, 2.5 hours), followed by separation on a 2% agarose gel for visualization of the elongation products.
Without TdT, the majority of the cRNA fragments were 100-200 nucleotides in length (Lane 2, Figure 9). In the presence of TdT, however, some of these fragments were clearly polymerized, as shown by their relatively slower migration (Lanes 3, Figure 9). This implies that RNA can also serve as substrate for elongation by TdT.
Example 8 - Elongation of 3' chemically modified oligonucleotides.
Here we demonstrate an unusual and surprising property of TdT that hitherto has not been described. We showed that certain modified probes such as 31- NH2 modified oligonucleotide probes immobilized on aldehyde-coated microarray slides did not prevent elongation by TdT. Oligonucleotides with other 3'-modifiers or tags such as 3'-biotin, 3'-C3 linker and 3'-PO4 were also investigated as described in this example.
The oligonucleotides with and without 3'-modifiers that were used in this example are summarized in Table 2. Their structures are illustrated in Figure 13. With the exception of 3C3Oligo (Operon, USA) and 3BioOligo (Alpha DNA1 Canada), all other oligonucleotides were synthesized by 1st BASE (Singapore).
Table 2 - The oligonucleotides with/out 3'-modifiers included in this study
Oligonucleotide Sequence and 3'-modifier*
30HOIigo TAGCGACGTGACTGGATCGAtccgggaacacctccgacac (OH)
(SEQ ID NO: 18)
3NH2Oligo TCGATCCAGTCACGTCGCTAttttttttttttttt(NH2) (SEQ ID NO: 19)
3BioOligo TAGCGACGTGACTGGATCGAttcaggtgtcctgttgccccctcc(Biotin)
(SEQ ID NO: 20)
3C3Oligo TAGCGACGTGACTGGATCGAttttt(C3 linker) (SEQ ID NO: 21)
3PO4Oligo TAGCGACGTGACTGGATCGAttttt(PO4) (SEQ ID NO: 22)
5N3POIigo (NH2) tttttttttttttttTCGATCCAGTCACGTCGCTA(P04) (SEQ ID
NO: 23)
* The capitalized sequences that are underlined are complementary to the capitalized sequences without underline.
Immobilization of oligonucleotides with NH2-modifier
Of the probes tested in this study, only 3NH2Oligo and 5N3POIigo can be immobilized onto the aldehyde-coated slides as they have a -IMH2 modifier at either end. Prior to being spotted, they were re-suspended to a concentration of 20μM with Arraylt™ micro-spotting solution as described earlier. The spotting was performed by a PixSys7500 arrayer with quadruplicate spots for each oligonucleotide in a 2 x 2 format. After an overnight 370C incubation in a humidified oven, the slides were washed sequentially with 0.2% SDS (2 min), water (2 min), boiling water (2 min), sodium borohydride solution (5 min), 0.2% SDS (2 min) and water (2 min). The 3NH2Oligo serves as probes for other 31 modified oligonucleotides. They have a 15-dT spacer added to make them more accessible for hybridization.
Elongation on slide (for 3NH2Oligo and 5N3POIigo)
Each reaction cocktail contained 11) of TdT (Fermentas), 0.5μl of TdT buffer (10 X) and 1 pmol of Cy5-ddC (Amersham) and topped up to 5μl with deionized H2O. This mixture was loaded on the slide for elongation at room temperature for 20 minutes. The slide was then washed once with 2% SSC (4 min) and twice with distilled H2O (3 min) before being scanned to obtain the signal of Cy5 (633 nm) by ScanArray® 5000. Both laser power and photo-multiplier tube (PMT) were set to 100%. Finally, the fluorescence intensities were measured by QuantArray® 3.0. Following this, a reaction mixture containing 10U of Exonuclease I (Exo I, Fermentas) and 0.5μl of buffer (10 X) with a final volume of 5μl was loaded on the slide. The slide was then placed in a humidified cassette and incubated in a water bath (37°C, 30 min). After washing, the slide was re-scanned to obtain the signal of Cy5.
Elongation in solution (for all oligonucleotides except 3NH2Oligo and 5N3POIigo)
In this set of experiments, the reaction mixture was prepared as described for elongation on slide, with the addition of 50fmols of oligonucleotides which have complementary sequences of the probes. Elongation was similarly carried out at room temperature for 20 minutes. Prior to being loaded on the slide, the reaction mixture with TdT was inactivated by both the addition of 1 μl EDTA (0.5M, pH 8.0), and incubation at 950C for 15min. Hybridization was carried out in a sealed humidified cassette immersed in a water bath (500C, 1 hour). The slide was subsequently washed and scanned to obtain fluorescence signal as described earlier.
Elongation was also carried out on: one 5'-biotinylated oligonucleotide (ttttttttttagtgag-atggtcatgtgtggcggctcacta, 40- mer; SEQ ID NO: 24) and
another 3'-biotinylated oligonucleotide
(gtcgtgagcggctgaggtcgatgctgaggtcgcactcaggtgtcctgttgccccctcc, 58-mer; SEQ ID NO: 25),
followed by separation on a 2% agarose gel for visualization of elongated products. As much more oligonucleotides are required to be visualized on a gel, each reaction mixture was given 50pmols of each oligonucleotide and 2OU of TdT. Incubation was also carried out at room temperature for one hour before gel shift assay.
Elongation of 3' modified oligonucleotides c
TdT-assisted elongation of oligonucleotides with and without 3'-modifiers are shown in Figure 10. Except for 3NH2Oligo and 5N3POIigo which were immobilized on the slides, all other oligonucleotides were elongated in liquid phase before hybridization was carried out. The 3' unmodified oligonucleotide (3OHOIigo) serves as control in this study. In the absence of TdT, Cy5-ddCTP was not incorporated into the control (-OH(TdT-)).
In contrast, extremely intense fluorescent signal was obtained when TdT was present (-OH(TdT+)), confirming that TdT is essential for the process of elongation. Besides control oligonucleotides, other oligonucleotides with different 3'-modifiers or tags (e.g., 3'-NH2, 3'-biotin and 3'-C3 linker) were also efficiently elongated by TdT. In fact, the average signal intensities of these elongated oligonucleotides with 3' modifiers were only slightly lower than that of the control ((-OH(TdT+), Fig. 10). In this study, only oligonucleotides with 31- phosphoryl group (PO4) could resist elongation by TdT, including those with dual modifications (5'-NH2, 3'-PO4). Polymerization of a 58-mer 3'-biotinylated oligonucleotide (SEQ ID NO: 25) by TdT was also observed by gel shift assay (Fig. 11). A 40-mer 5'-biotinylated oligonucleotide (SEQ ID NO: 24) was included in this assay as a control. Without TdT, both oligonucleotides could not be elongated (Lanes 2 and 4). In the presence of TdT, in contrast, both oligonucleotides were clearly polymerized (Lanes 3 and 5), as shown by the slower migration relative to Lanes 2 and 4.
Digestion by Exonuclease I
The modified oligonucleotide 3NH2Oligo was used for the Exo I experiment as it could be immobilized on the slide and be elongated by TdT. This ensured that any signal reduction was not due to washing away of some elongated products from the hybrid. After elongation by TdT with Cy5-ddCTP, intense fluorescence signal was obtained. However, with Exo I treatment, the signal became very weak and the signal intensity ratio (Exo I+/Exo I-) was reduced to about 20% (Fig. 12). This implied that the majority of Cy5-ddCTP incorporated into 3NH2Oligo was digested by Exo I.
Like other members of polymerase X family, TdT can polymerize DNA by adding nucleotides repetitively to its 3' terminus (Ramadan et al., 2004). However, TdT is evidently unique because it can catalyze such process entirely in the absence of DNA template. Another common belief is that, an oligonucleotide that is modified at its 3' end cannot be polymerized. This is because DNA synthesis proceeds in 5'→3' direction, and the free 3'-OH group of oligonucleotide is required .for forming a phosphodiester bond with the subsequent nucleotide during chain elongation. Typically, in vitro synthesis of oligonucleotide advances in an opposite direction (3'→5'). If a 3' modifier is introduced, however, the terminal 3'-OH will be replaced when synthesis is complete.
We observed that Cy5-ddC could be incorporated into 31 modified oligonucleotides by TdT despite the fact that terminal 3'-OH sites were unavailable for extension. The oligonucleotides were modified with 3'-NH2 to permit their immobilization on aldehyde-coated slides. In this study, the slides were stringently washed to remove unbound oligonucleotides after the immobilization procedures. As such, only 3' NH2-containing oligonucleotides could remain on the slide after the washing steps.
This showed that the elongation observed was not due to the presence of any remaining unmodified oligonucleotides, but that TdT has undoubtedly the ability to elongate oligonucleotides despite them bearing a 3'-NH2 modifier.
One explanation for this phenomenon would be that the 3'-NH2 modifier molecule also carries a -OH group which might be recognized by TdT as a substitute for the 3'-OH group on the deoxyribose sugar. As shown in Figure 13, other than -OH moieties on the phosphate group, another -OH (circled) on the carbon chain is present along with the 3'-NH2 modifier. This moiety was initially engaged by succinyl-long chain alkylamino (lcaa) group so that the modifier can be attached to controlled pore glass (CPG) support. When oligonucleotide synthesis is complete, succinyl-lcaa will be removed and the - OH is then exposed.
To validate this speculation, a few oligonucleotides with different 3'-modifiers or tags, such as biotin, C3 linker and phosphoryl group, were investigated. As these oligonucleotides could not be immobilized on the slide, hybridization was carried out following TdT-assisted elongation in solution. Subsequently, they were hybridized to complementary oligonucleotides immobilized on the slide so that fluorescence signal could be detected if elongation did occur. To prevent elongation of immobilized oligonucleotides, the reaction cocktail was treated with EDTA and heated at 950C for 15 minutes to inactivate TdT before it was loaded onto the slide.
Oligonucleotides modified with either 3'-biotin or 3'-C3 linker tags could be efficiently elongated by TdT. These two modified oligonucleotides and 3'-NH2 oligonucleotides have an extra -OH group introduced by their respective modifier molecule, despite differences in the linkers. Elongation did not occur without such a -OH group, as was the case for 3'-phosphorylated oligonucleotide and oligonucleotides with dual modifications at their 5' and 31 ends (5'-NH2, 3'-PO4). The main difference between 3'-NH2 and 5'-NH2 modifiers is that an extra -OH group is introduced by the former via its linker. Therefore, we conclude that TdT can elongate 3' modified oligonucleotides if recognizable extrinsic -OH group is introduced as a tag.
We believe the unusual elongation by TdT can be partially attributed to its template-independent feature. Even if an appropriate -OH group is introduced and it can be recognized by other DNA polymerases, chain elongation will still not occur because they are dependent on a DNA template for incorporation of corresponding nucleotides.
The enzyme Exo I can catalyze the removal of nucleotides (3'→5') from single- stranded DNA (ssDNA) strand by breaking the phosphodiester bond within DNA. In this study, treatment with Exo I was only performed on immobilized oligonucleotides following elongation by TdT.
Our result showed that the majority of elongated oligonucleotides were digested by Exo I, as can be seen by an 80% reduction in signal intensity (Fig. 12). When a second run of Exo I digestion was carried out, the signal was further reduced. Similarly, when oligonucleotides immobilized via a 5'-NH2 (instead of 3'-NH2) modification were treated with Exo I following elongation by TdT, incorporated Cy5-ddCTP was largely digested but not completely. The partial digestion could be attributed to the high density of the immobilized oligonucleotides, in which case some incorporated Cy5-ddCTP could not be easily accessed by Exo I.
Nevertheless, the successful digestion by Exo I indicates that canonical phosphodiester bonds were formed when oligonucleotides with and without free 3'-OH groups were elongated by TdT. This observation does not support the hypothesis by another study that an unusual DNA structure is produced by TdT polymerization and that such structure is resistant to digestion by nucleases (Ramadan et al., 2004).
It was reported that human DNA polymerase lambda, another member of polymerase X family, could elongate RNA primers (Ramadan et al., 2003). Through this study, we found that TdT could also elongate RNA fragments with dNTPs (Figure 9). Hence, both DNA and RNA can be elongated by TdT. All nucleotides (dNTPs, NTPs and ddNTPs), regardless of being labelled or not, can serve as substrates for such elongation (Flickinger et al., 1992; lgloi et al., 1993; Boule et al., 2001). It was also observed that elongation by TdT was extremely rapid, and very intense signal could be obtained within one minute (Figure 7).
This example demonstrated that TdT could catalyze the elongation of oligonucleotides with certain 3' chemical modifiers or tags such as amino, biotin or C3 linker. Significantly, this finding implies that TdT could potentially catalyze DNA synthesis in the absence of primers if an appropriate modifier molecule with a tag such as an OH group is provided. This discovery may be industrially applied in the addition of nucleotides to a strand of nucleic acids that do not possess a free OH group at its 3' end by first adding a modifier molecule possessing a tag such as a free OH group to the terminal 3' base and then using TdT to add other nucleic acids or derivatives to the strand. References
Barany, F. (1991). "Genetic disease detection and DNA amplification using cloned thermostable ligase." Proc Natl Acad Sci U S A 88(1): 189-93.
Bowtell, D. D., Options available-from start to finish—for obtaining expression data by microarray. Nat Genet, 1999. 21(1 Suppl): p. 25-32.
Boule, J. B., F. Rougeon and C. Papanicolaou (2001). "Terminal deoxynucleotidyl transferase indiscriminately incorporates ribonucleotides and deoxyribonucleotides." J Biol Chem 276(33): 31388-93.
Cotton, R.G. and R. D. Campbell, Chemical reactivity of matched cytosine and thymine bases near mismatched and unmatched bases in a heteroduplex between DNA strands with multiple differences. Nucleic Acids Res, 1989. 17(11): p. 4223-33. de Arruda, M., V. I. Lyamichev, P. S. Eis, et al. (2002). "Invader technology for DNA and RNA analysis: principles and applications." Expert Rev MoI Diagn 2(5): 487- 96.
Ellis, T. P., et al., Chemical cleavage of mismatch: a new look at an established method. Hum Mutat, 1998. 11 (5): p. 345-53.
Flickinger, J. L., G. Gebeyehu, G. Buchman, et al. (1992). "Differential incorporation of biotinylated nucleotides by terminal deoxynucleotidyl transferase." Nucleic Acids Res 20(9): 2382.
Gut, I. G., Automation in genotyping of single nucleotide polymorphisms. Hum Mutat, 2001. 17(6): p. 475-92.
Hirschhorn, J. N., et al., SBE-TAGS: an array-based method for efficient single- nucleotide polymorphism genotyping. Proc Natl Acad Sci U S A, 2000. 97(22): p. 12164-9.
Igloi, G. L. and E. Schiefermayr (1993). "Enzymatic addition of fluorescein- or biotin-riboUTP to oligonucleotides results in primers suitable for DNA sequencing and PCR." Biotechniques 15(3): 486-8, 490-2, 494-7,
Lescallett, J., M. E. Chicurel, R. Lipshutz, et al. (2004). "Monitoring eukaryotic gene expression using oligonucleotide microarrays." Methods MoI Biol 258: 71-94.
Lipshutz, R.J., S. P. Fodor, T. R. Gingeras, et al. (1999). "High density synthetic oligonucleotide arrays." Nat Genet 21 (1 Suppl): 20-4.
Lovmar, L., M. Fredriksson, U. Liljedahl, et al. (2003)_. "Quantitative evaluation by minisequencing and microarrays reveals accurate multiplexed SNP genotyping of whole genome amplified DNA." Nucleic Acids Res 31 (21): e129.
Lyamichev, V. and B. Neri (2003). "Invader assay for SNP genotyping." Methods MoI Biol 212: 229-40. Pastinen, T., A. Kurg, A. Metspalu, et al. (1997). "Minisequencing: a specific tool for DNA analysis and diagnostics on oligonucleotide arrays." Genome Res 7(6): 606-14.
Ramadan, K., G. Maga, I. V. Shevelev, et al. (2003). "Human DNA polymerase lambda possesses terminal deoxyribonucleotidyl transferase activity and can elongate RNA primers: implications for novel functions." J MoI Biol 328(1): 63-72.
Ramadan, K., I. V. Shevelev, G. Maga, et al. (2004). De novo DNA synthesis by human DNA polymerase lambda, DNA polymerase mu and terminal deoxyribonucleotidyl transferase. J MoI Biol. 339: 395-404.
Southern, E., K. Mir and M. Shchepinov (1999). "Molecular interactions on microarrays." Nat Genet 21 (1 Suppl): 5-9.
Yang, Y.H. and T. Speed, Design issues for cDNA microarray experiments. Nat Rev Genet, 2002. 3(8): p. 579-88.

Claims

Claims
1. A method of detecting at least one signal in a nucleic acid, the method comprising:
(i) providing at least one nucleic acid; and
(ii) adding at least one signal molecule to the nucleic acid by at least a template-independent enzyme, thereby detecting the at least one nucleic acid.
2. The method according to claim 1 , wherein the template-independent enzyme is terminal deoxyribonucleotidyl transferase (TdT).
3. A method of detecting at least one signal in a nucleic acid hybridization reaction, the method comprising:
(a) providing at least one nucleic acid target sequence and at least one probe;
(b) allowing the at least one probe to hybridize to the target sequence to form hybridized molecule;
(c) discriminating between hybridized molecules to form at least one discriminated molecule; and
(d) adding at least one signal molecule using at least one template- independent enzyme to the discriminated molecule, thereby allowing detection of the at least one signal.
4. The method according to claim 3, wherein the discriminating is by an invader cleavage reaction.
5. The method according to claim 3 or 4, the method comprising:
(a) providing a first probe, a second probe and a third probe to react with the target sequence, wherein the first probe is complementary to a 5' portion of the target sequence and the second and third probes are allele-specific probes and complementary to a 3' portion of the target sequence;
(b) allowing formation of hybridized molecules comprising allele- specific cleavage structures, and
(c) discriminating between allele-specific cleavage structures with at least one cleavage means, the at least one cleavage means releasing a portion of a probe to form a discriminated molecule; and
(d) adding at least one signal molecule using at least one template- independent enzyme to the discriminated molecule, thereby allowing detection of the at least one signal.
6. The method according to claim 5, wherein the cleavage means is a cleavase enzyme.
7. The method according to claim 3, wherein the discriminating is by an oligonucleotide ligation assay.
8. The method according to claim 3 or 7, the method comprising:
(a) providing a first probe and a second probe wherein the first and second probes hybridize to contiguous portions of the target sequence, wherein either probe has at least one terminal base complementary with an allelic difference in the target sequence;
(b) allowing the two probes to hybridize to the target sequence;
(c) ligating the two probes with a ligase to form a discriminated molecule; and
(d) adding at least one signal molecule using at least one template- independent enzyme to the discriminated molecule, thereby allowing detection of the at least one signal.
9. The method according to claim 3, wherein the discriminating is by chemical cleavage of mismatch reaction.
10. The method according to claim 3 or 9, the method comprising:
(a) providing at least a first chemical that binds to a first type of nucleotide, at least a second chemical that binds to a second type of nucleotide, at least one target sequence and at least one labelled probe;
(b) allowing the probe(s) and the target sequence(s) to form hybridzed molecules;
(c) adding at least a third chemical to cleave the hybridized molecules at the nucleotide bases with bound to the first and second chemicals, thereby forming at least one discriminated molecule; and
(d) adding at least one signal molecule using at least one template- independent enzyme to the discriminated molecule, thereby allowing detection of the at least one signal.
11. The method according to claim 9, wherein the first chemical is hydroxylamine, the first type of nucleotide is cytosine, the second chemical is osmium tetroxide or potassium permanganate / tetraethylammonium chloride, the second type of nucleotide is thymine, and the third chemical is piperidine.
12. The method according to claim 10 or 11 , wherein step (c) is followed by separating the at least one discriminated molecule.
13. The method according to claim 3, wherein the discrimination is by allele- specific minisequencing.
14. The method according to any one of claims 3 to 13, wherein the discriminating is followed by removal of unhybridized molecules.
15. The method according to any one of claims 3 to 14, wherein the template-independent enzyme is terminal deoxyribonucleotidyl
' transferase (TdT).
16. The method according to any one of the preceding claims, wherein the at least one signal molecule is capable of being labeled and/or detected.
17. The method according to any one of the preceding claims, wherein the at least one signal molecule is capable of being detected by photometric, fluorescent, radioactive and/or enzymatic means.
18. The method according to any one of the preceding claims, wherein the adding of the at least one signal molecule is repeated to amplify the signal detected.
19. A method of detecting Single Nucleotide Polymorphisms (SNP)1 the method comprising:
(a) providing at least two allelic nucleic acid target sequences and at least one probe;
(b) allowing the at least one probe to hybridize to the target sequences to form hybridized molecules;
(c) discriminating between hybridized molecules based on presence of at least one SNP to form at least one discriminated molecule; and
(d) adding at least one signal molecule using at least one template- independent enzyme to the discriminated molecule, thereby allowing detection of at least one SNP.
20. The method according to claim 19, wherein the adding of the at least one signal molecule is repeated to amplify the signal detected.
21. The method according to claim 19 or 20, wherein the discriminating is by invader cleavage reaction.
22. The method according to claim 19 or 20, wherein the discriminating is by oligonucleotide ligation assay.
23. The method according to claim 19 or 20, wherein the discriminating is by chemical cleavage by mismatch reaction.
24. The method according to claim 19 or 20, wherein the discriminating is by allele-specific minisequencing.
25. The method according to any one of claims 19 to 24, wherein the template-independent enzyme is terminal deoxyribonucleotidyl transferase (TdT).
26. The method according to any of claims 19 to 25, wherein the at least one signal molecule is capable of being labeled and/or detected.
27. The method according to any of claims 19 to 26, wherein the at least one signal molecule is capable of being detected by photometric, fluorescent, radioactive and/or enzymatic means.
28. A method of analyzing gene expression, the method comprising:
(a) providing at least two nucleic acid target sequences and at least one probe; (b) allowing the at least one probe to hybridize to the target sequences to form hybridized molecules;
(c) discriminating hybridized and unhybridized molecules to form at least one discriminated molecule; and
(d) adding at least one signal molecule using at least one template- independent enzyme to the at least one molecule, thereby allowing detection of the at least one signal for analyzing gene expression.
29. The method according to claim 28, wherein the method of analysing gene expression is a quantitative method.
30. The method according to claim 28, wherein the at least two target sequences are complementary RNA and/or complementary DNA.
31. The method according to claim 29, wherein the complementary RNA and/or complementary DNA were converted from messenger RNA.
32. The method according to claim 28, wherein the adding the at least one signal molecule is repeated to amplify the signal detected.
33. The method according to any one of claims 28 to 32, wherein the template-independent enzyme is terminal deoxyribonucleotidyl transferase (TdT).
34. The method according to any of claims 28 to 33, wherein the at least one signal molecule is capable of being labeled and/or detected.
35. The method according to any of claims 28 to 34, wherein the at least one signal molecule is capable of being detected by photometric, fluorescent, radioactive and/or enzymatic means.
36. The method according to any of the preceding claims, wherein the nucleic acid(s) are selected from the group of DNA, RNA and PNA.
37. The method according to any of the preceding claims, wherein the method is conducted in a microarray format.
38. A kit for detecting at least one signal in a nucleic acid, the kit comprising at least a template-independent enzyme.
39. The kit according to claim 35, the kit further comprising at least a probe and at least one signal molecule.
40. The kit according to claim 38 or 39, wherein the template-independent enzyme is terminal deoxyribonucleotidyl transferase (TdT).
41. The kit according to any one of claims 38 to 40, wherein the kit is for detecting at least one signal in a nucleic acid hybridisation reaction.
PCT/SG2005/000422 2004-12-15 2005-12-15 Method of nucleic acid signal detection Ceased WO2006065230A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US63638404P 2004-12-15 2004-12-15
US60/636,384 2004-12-15

Publications (1)

Publication Number Publication Date
WO2006065230A1 true WO2006065230A1 (en) 2006-06-22

Family

ID=36588175

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/SG2005/000422 Ceased WO2006065230A1 (en) 2004-12-15 2005-12-15 Method of nucleic acid signal detection

Country Status (1)

Country Link
WO (1) WO2006065230A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110468181A (en) * 2019-08-16 2019-11-19 中国人民解放军国防科技大学 A kind of method that dual amplification detects DNA or protein

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
BERTAZZONI B ET AL: "Radioactive Labeling and Analysis of 3'-Terminal Nucleotides of DNA Fragments.", BIOCHIMICA AT BIOPHYSICA ACTA., vol. 312, 1973, pages 192 - 201 *
KWON K Y ET AL: "Expression of apoptotic nuclei by ultrastructural terminal deoxyribonucleotidyl transferase mediated dUTP nick end labeling and detection of FasL, caspases and PARP protein molecules in cadmium induced acute alveolar cell injury.", TOXICOLOGY., vol. 218, 2006, pages 197 - 204 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110468181A (en) * 2019-08-16 2019-11-19 中国人民解放军国防科技大学 A kind of method that dual amplification detects DNA or protein

Similar Documents

Publication Publication Date Title
US11821030B2 (en) Multiplex targeted amplification using flap nuclease
CA2810931C (en) Direct capture, amplification and sequencing of target dna using immobilized primers
US7459273B2 (en) Methods for genotyping selected polymorphism
US10155976B2 (en) Methods for genotyping selected polymorphism
US7414115B2 (en) Length determination of nucleic acid repeat sequences by discontinuous primer extension
US20110003301A1 (en) Methods for detecting genetic variations in dna samples
US20100112556A1 (en) Method for sample analysis using q probes
WO2006065230A1 (en) Method of nucleic acid signal detection

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KM KN KP KR KZ LC LK LR LS LT LU LV LY MA MD MG MK MN MW MX MZ NA NG NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SM SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU LV MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 05815251

Country of ref document: EP

Kind code of ref document: A1