WO2006060561A2 - Methods and applications of molecular beacon imaging for cancer cell detection - Google Patents

Abstract

A method for detecting the level of gene expression in a sample of cells for cancer detection. In one embodiment, the method includes the steps of providing a sample of cells, simultaneously delivering molecular beacons (MBs) targeting survivin and cyclin Dl mRNAs to the sample of cells so that fluorescent signals associated with the survivin and cyclin D1 mRNAs of the sample of cells can be obtained, and determining whether the sample of cells has viable cancer cells expressed in survivin and/or cyclin Dl mRNAs from the fluorescent signals.

Description

METHODS AND APPLICATIONS OF MOLECULAR BEACON IMAGING FOR CANCER CELL DETECTION

This application is being filed as PCT International Patent application in the name of Emory University, a U.S. national corporation, Applicants for all countries except the U.S., and Lily Yang, a U.S. resident, Applicant for the designation of the U.S. only, on December 1, 2005.

STATEMENT AS TO RIGHTS UNDER FEDERALLY-SPONSORED RESEARCH

This invention was made with Government support under Contract Nos. CA80017 and CA95643 awarded by the National Institutes of Health of the United States, and under Contract No. BC021952 awarded by the Department of Defense of the United States. Accordingly, the United States Government may have certain rights in this invention pursuant to these grants.

CROSS-REFERENCE TO RELATED PATENT APPLICATION

This application is a continuation-in-part of U.S. patent application Serial No. 10/542,117 filed July 12, 2005, entitled "Methods of Detecting Gene Expression in Normal and Cancerous Cells," by Lily Yang, Gang Bao, Charles Staley and Cynthia Cohen, the disclosure of which is hereby incorporated herein by reference in its entirety, which status is pending and itself claims the benefit, pursuant to 35 U.S. C. §119(e), of U.S. provisional patent application Serial No. 60/439,771, filed January 13, 2003, by Lily Yang et al., which is incorporated herein by reference in its entirety. This application also claims the benefit, pursuant to 35 U.S. C. §119(e), of U.S. provisional patent application Serial No. 60/632,666, filed December 1, 2004, entitled "Methods and Applications of Molecular Beacon Imaging for Cancer Cell Detection," by Lily Yang, which is incorporated herein by reference in its entirety.

Some references, which may include patents, patent applications and various publications, are cited and discussed in the description of this invention. The citation and/or discussion of such references is provided merely to clarify the description of the present invention and is not an admission that any such reference is "prior art" to the invention described herein. All references cited and discussed in this specification are incorporated herein by reference in their entireties and to the same extent as if each reference was individually incorporated by reference. In terms of notation, hereinafter, "[n]" represents the nth reference cited in the reference list. For example, [18] represents the 18th reference cited in the reference list, namely, Yang, L., Cao, Z., Yan, H. & Wood, W. C, Coexistence of high levels of apoptotic signaling and inhibitor of apoptosis proteins in human tumor cells: implication for cancer specific therapy. Cancer Res 63, 6815-6824 (2003).

FIELD OF THE INVENTION

The present invention relates generally to detection of cancer cells, and in particular to methods that utilize molecular beacon imaging for detecting, identifying or quantitating the presence of, or alterations in gene expression of, various tumor markers in cells and tissues of a subject.

BACKGROUND OF THE INVENTION

Development of novel approaches for detecting cancer cells and determining the responses of the cells to therapeutic reagents holds great promise to increase the survival of cancer patients. It is known that development of human cancer is a multistage process that involves a series of genetic alterations in oncogenes and tumor suppressor genes, and abnormalities in the level of gene expression that provide growth advantage and metastatic potential to the cells [1-3, 32, 33]. Methods for specific detection of abnormal gene expression in intact single cancer cells should provide new tools for identifying cancer cells in clinical samples, studying biological effects and evaluating the effects of therapeutic reagents on specific molecular targets in cancer cells.

Molecular beacons (MBs) are stem-loop type oligonucleotide probes dual- labeled with a fluorophore and a quencher. In the absence of a target, the stem of a molecular beacon (MB) brings the fluorophore and quencher molecules together, which prevents the production of a fluorescent signal. When the MB hybrids to its specific target sequence, the stem is forced to break apart, which enables it to generate a fluorescent signal [4-6]. During the last several years, MB technology has been utilized in various applications to detect oligonucleotides in solution, including DNA mutation detection, real-time enzymatic cleavage assay, protein-DNA interaction, real-time monitoring of PCR, analysis of loss of heterozygosity and mRNA detection in living cells [6-8, 9, 11, 13, 35, 36]. Results of those studies have demonstrated that the MB detection is a reliable and specific approach for examining target oligonucleotides in solution.

The ability of MB probes to detect specific target molecules without washing away or separation of unbound probes also provides an opportunity to detect intracellular mRNA molecules in intact cells. The feasibility of detecting intracellular mRNA has been examined in several laboratories [9-12]. It has been shown that MBs were able to visualize mRNA molecules in several human and animal cell lines after being introduced into cells through microinjection or liposome delivery [9-11, 13]. Properly designed MBs could discriminate between targets that differ by as little as a single nucleotide [5, 7, 34]. Although previous studies suggested that detection of intracellular mRNA using MBs is a feasible approach, the question remains how to develop this technology into a simple yes novel procedure that can be used broadly in basic research and clinical laboratories for detecting the expression of tumor marker genes in cancer cells and tissues. It is known that survivin and cyclin Dl mRNAs are highly expressed in breast cancer cells [14]. Survivin is a member of the inhibitor of apoptosis (LAP) protein family that plays a crucial role in the apoptosis resistance of tumor cells [15]. Increasing evidence indicates that survivin is also a promising tumor marker since it is normally expressed during fetal development but is not expressed in most normal adult tissues [16]. However, high levels of survivin are detected in many human cancer types including 71% of breast cancers [17, 18]. The role of survivin in blocking the apoptotic response and fostering resistance to chemotherapy drugs and radiotherapy by cancer cells has been well elucidated [19, 20]. Also, cyclin Dl, an important regulator of cell cycle, is overexpressed in 50-80% of breast cancer tissues whereas it is low or absent in normal breast tissues [14]. It is possible to detect the expression of survivin and cyclin Dl genes in human breast cancer cells using the MB-imaging technology. Additionally, pancreatic cancer is the fourth leading cause of cancer death in the United States because of its extremely aggressive tumor biology. About 80% of these patients have either locally advanced or metastatic disease at presentation and the median survival of the patients is around 3-12 months [30, 31]. Therefore, it is important to develop novel approaches to identify pancreatic cancer cells in clinical samples of the patients, such as tissue biopsy and pancreatic juice.

It has been shown that K-ras oncogene is one of the most attractive molecular markers for pancreatic cancer [38-40]. Point mutations of the K-ras gene are found in over 90% of pancreatic carcinomas [38, 39]. Further, most of these mutations are concentrated at codon 12, which makes design and synthesis of mutation-specific MBs feasible. Recently, the genes of an LAP protein family have been characterized. IAPs are able to inhibit the cascade of the apoptotic pathway by inhibiting activation of caspases [41, 42] . Survivin, a member of the IAP family, is normally expressed during fetal development but not in most normal adult tissues. However, a high level of survivin is detected in many human cancers, suggesting that survivin may be a specific marker for many common tumor types [16, 17]. Recent studies demonstrated the presence of survivin in 77 to 83% of pancreatic duct cell adenocarcinomas and 56% of intraductal papillary-mucinous tumors [43, 44]. Expression of survivin could be detected in all stages of pancreatic duct cell carcinoma including the early stage of neoplastic transition. However, survivin was not detected in pancreatic tissues obtained from normal subjects and patients with chronic pancreatitis [43]. Absence of survivin expression in normal pancreas and pancreatic tissue of chronic pancreatitis makes it an ideal molecular marker for the detection of pancreatic cancer cells.

It is well established that cancer cells develop due to genetic alterations in oncogenes and tumor suppressor genes and abnormalities in gene expression that provide growth advantage and metastatic potential to the cells. A hereunto for utilized method of achieving early detection of cancer would be to identify the cancer cells through detection of mRNA transcripts that are expressed in the cancer cells but is low or not expressed in normal cells. Therefore, a hereto fore-unaddressed need exists in the art to address the aforementioned deficiencies and inadequacies. SUMMARY OF THE INVENTION

The present invention, in one aspect, relates to a method for detecting the level of gene expression in a sample of cells for cancer detection. In one embodiment, the method comprises the steps of providing a sample of cells, simultaneously delivering molecular beacons (MBs) targeting survivin and cyclin Dl mRNAs to the sample of cells so that fluorescent signals associated with the survivin and cyclin Dl mRNAs of the sample of cells can be obtained, and determining whether the sample of cells has viable cancer cells expressed in survivin and/or cyclin Dl mRNAs from the fluorescent signals. Each of the MBs targeting survivin and cyclin Dl mRNAs is designed to possess a fluorophore of a unique color such that when one MB targets its corresponding mNRA, the fluorophore of the MB fluoresces, thereby generating a fluorescent signal with the corresponding mNRA in the unique color of the fluorophore of the MB in the sample of cells. The fluorescent signals associated with the survivin and cyclin Dl mRNAs are distinguishable by colors of the fluorescent signals. In one embodiment, the simultaneously delivering step comprises the step of delivering a mixture of survivin and cyclin Dl MBs into fixed cells.

The method may further comprise the step of determining the relative level of gene expression in viable cancer cells from the intensity of the fluorescent signals of a sample of cells having viable cancer cells, where the intensity of the fluorescent signals of the sample of cells having viable cancer cells is corresponding to the level of the survivin and cyclin Dl mRNAs expressed in the sample of cells.

The sample of cells has viable cancer cells if the intensity of the fluorescent signals associated with one of the survivin and cyclin Dl mRNAs is no less than an intensity threshold. The sample of cells substantially has no viable cancer cells if the intensity of the fluorescent signals associated with each of the survivin and cyclin Dl mRNAs is less than the intensity threshold. The intensity threshold is predetermined, and may be dependent on the type of cancer.

The intensity of the fluorescent signals of a sample of cells having viable cancer cells is stronger than the intensity of the fluorescent signals of a sample of cells having no viable cancer cells. Furthermore, the intensity of the fluorescent signals of a sample of cells having viable cancer cells is at least twice stronger than the intensity of the fluorescent signals of a sample of cells having no viable cancer cells. The sample can be taken from at least one source of blood, urine, pancreatic juice, ascites, breast ductal lavage, nipple aspiration, needle biopsy or tissue. In one embodiment, the sample is taken from a breast ductal lavage. In another embodiment, the sample is taken from pancreatic juice. The tissue in one embodiment is a biopsy from the pancreas or breast. The tissue may be a frozen section. In one embodiment, the sample of cells has viable breast cancer cells.

In another aspect, the present invention relates to a diagnostic kit for detecting the level of gene expression in a sample of cells for cancer detection, which has a system suitable for carrying out the method as described above. In yet another embodiment, the present invention relates to a method of detecting the level of gene expression in a sample of cells for cancer detection. In one embodiment the method includes the steps of providing a sample of cells, treating the sample of cells with molecular beacons (MBs) targeting tumor marker mRNAs that are found in a predetermined type of cancer so that corresponding fluorescent signals of the sample of cells can be obtained, and detecting whether the sample of cells has viable cancer cells from the fluorescent signals. The method may further include the step of delivering a mixture of survivin and K-ras MBs to the sample of cells. Each of the MBs targeting tumor marker mRNAs is designed to possess a fluorophore of a unique color such that when one MB targets its corresponding tumor marker mNRA, the fluorophore of the MB fluoresces, thereby generating a fluorescent signal associated with the corresponding tumor marker mNRA in the unique color of the fluorophore of the MB in the sample of cells, where the fluorescent signals are distinguishable by colors of the fluorescent signals.

The sample of cells has viable cancer cells if the intensity of the fluorescent signals in one color is no less than an intensity threshold. The sample of cells substantially has no viable cancer cells if the intensity of the fluorescent signals in each color is less than the intensity threshold. The intensity threshold is predetermined, and may be dependent on the type of cancer. The sample of cells may include viable pancreatic cancer cells. The intensity of the fluorescent signals of a sample of cells having viable cancer cells is stronger than the intensity of the fluorescent signals of a sample of cells having no viable cancer cells. The intensity of the fluorescent signals of a sample of cells having viable cancer cells is about at least twice stronger than the intensity of the fluorescent signals of a sample of cells having no viable cancer cells.

In one embodiment, the tumor marker mRNAs include mutant K-ras and survivin. The mutant K-ras MBs selectively bind to mutant K-ras mRNAs in fixed cancer cells, resulting a stronger intensity of the fluorescent signals of a sample of cells having viable cancer cells.

In a further aspect, the present invention relates to a diagnostic kit for detecting the level of gene expression in a sample of cells for cancer detection, which has a system suitable for carrying out the method comprising the steps of providing a sample of cells, treating the sample of cells with molecular beacons (MBs) targeting tumor marker mRNAs that are found in a predetermined type of cancer so that corresponding fluorescent signals of the sample of cells can be obtained, and detecting whether the sample of cells has viable cancer cells from the fluorescent signals. hi yet a further aspect, the present invention relates to a method for detection the presence of cancer cells in a sample of cells and/or tissues of a subject using molecular beacon (MB) imaging. In one embodiment, the method has the steps of designing a number of MBs, each being capable of targeting a corresponding tumor marker mRNA, simultaneously delivering the number of MBs to the sample of cells and/or tissues so as to produce MB-target hybrids in the sample of cells and/or tissues, detecting fluorescent signals emitted from the MB-target hybrids, and detecting, identifying or quantitating the presence of cancer cells in the sample cells and/or tissues from the detected fluorescent signals, where each MB-target hybrid is a hybridization of an MB with its corresponding tumor marker mRNA. In one embodiment, each of the number of MBs is designed to possess a fluorophore of a unique color, respectively, such that when one MB targets its corresponding tumor marker mNRA, an MB-target hybrid is produced and emits a fluorescent signal in the unique color of the fluorophore of the MB in the sample of cells and/or tissues. Accordingly, the detected fluorescent signals can be characterized with different colors, each color is associated with a corresponding tumor marker mNRA in the sample cells and/or tissues. In one embodiment, the fluorophore comprises Cy3 fluorophore, Alexa Fluor 488, Alexa Fluor 350, CMAC (7-amino-4-chloromethylcoumarin), 6-FAM, FITC, or any combination of them. In one embodiment, the detecting, identifying or quantitating step comprises the step of identifying the colors of the detected fluorescent signals.

The sample of cells and/or tissues has cancer cells if the intensity of the fluorescent signals in one color is no less than an intensity threshold. The sample of cells and/or tissues substantially has no cancer cells if the intensity of the fluorescent signals in each color is less than the intensity threshold. The intensity threshold is predetermined, AND may be dependent on the type of cancer.

The method may also include the step of correlating the intensity of the detected fluorescent signals in each color with the level of expression of the corresponding tumor marker mNRA in the sample of cells and/or tissues. The intensity of the fluorescent signals in one color is corresponding to the level of the corresponding tumor marker mRNA expressed in the sample of cells and/or tissues. In one embodiment, the level of expression of the corresponding tumor marker mNRAs in the sample of cells and/or tissues is detected using a real-time reverse transcription-PCR assay and/or Western bolt analysis.

The tumor marker mNRAs comprise at least one of survivin, cyclin Dl, Her2/neu, a mutant K-ras, basic fibroblast growth factor, EGF receptor, XIAP, carcinoembryonic antigen, prostate specific antigen, alpha-fetoprotein, beta-2- microglobulin, bladder tumor antigen, chromogranin A, neuron-specific enolase, S- 100, TA-90, tissue polypeptide antigen, and human chorionic gonadotropin.

In a further aspect, the present invention relates to a method for real-time detection of the level of expression of a marker gene in viable cells. In one embodiment, the method has the steps of providing a sample of viable cells containing the marker gene, treating the sample of viable cells with at least one of survivin and GAPDH MBs, and measuring intensities of fluorescent signals emitted from the treated sample of viable cells at different time points to detect the level of expression of the marker gene in the sample of viable cells as a function of time. In one embodiment, the marker gene comprises a survivin mRNA. The measuring step can be performed with FACScan analyzer, a fluorescence microplate reader or fluorescence microscope. In one embodiment, the treating step includes the steps of transfecting the sample of viable cells with a mixture of survivin and GAPDH MBs for a first period of time, and treating the transfected sample of viable cells with EGF or docetaxel for a second period of time, where the first period of time and the second period of time are different or substantially same. In another embodiment, the treating step has the steps of transducing the sample of the viable cells with Ad p53 vector or control vector AdCMV for a period of time, and delivering survivin or GAPDH MBs into the tranduced cell.

In one embodiment, the sample of viable cells is plated in a multi-well plate. The sample of viable cells may have cancer cells such as breast cancer cells or viable pancreatic cancer cells.

In one aspect, the present invention relates to a diagnostic kit for detecting alterations in gene expression in viable cells in real-time, which has a system suitable for carrying out the method that has the steps of providing a sample of viable cells containing the marker gene, treating the sample of viable cells with at least one of survivin and GAPDH MBs, and measuring intensities of fluorescent signals emitted from the treated sample of viable cells at different time points to detect the level of expression of the marker gene in the sample of viable cells as a function of time.

These and other aspects of the present invention will become apparent from the following description of the preferred embodiment taken in conjunction with the following drawings, although variations and modifications therein may be affected without departing from the spirit and scope of the novel concepts of the disclosure.

BRIEF DESCRIPTION OF THE DRAWINGS FIGS, l(a-b) provide a schematic illustration of MB design and examination of specific binding of the MBs to their oligonucleotide targets. FIG. Ia is a schematic illustration of the design and mechanism of survivin and cyclin Dl MBs. Both survivin and cyclin Dl MBs have 23 nt with 5 '-stem and loop sequences complementary to survivin or cyclin Dl gene. The stem length for survivin MB is 5 nt with the 5 '-end labeled with FITC and the 3 '-end labeled with a quencher, Dabcyl. Cyclin Dl MB has a stem containing 6 nt with the 5 '-end labeled with Texas-red and the 3'-end with Dabcyl. Survivin and cyclin Dl MB only generate fluorescent signals when hybridized to their specific DNA target. FIG. Ib shows the results from the examination of specificity of the MBs in vitro. Survivin or cyclin Dl MB was mixed with various synthesized DNA targets. The fluorescence units were measured using a fluorescence microplate reader. Survivin or cyclin D 1 MB only bound and generated strong fluorescent signal when mixed with its specific DNA target. MBs have a high specificity in hybridizing to their gene targets.

FIGS. 2(a-d) show the results from simultaneous detection of the levels of survivin and cyclin Dl mRNAs in breast cancer cells. FIG. 2a shows dual MB- imaging of breast cancer cells. A mixture of survivin and cyclin D 1 MBs was incubated with the fixed cells and then examined under a confocal microscope. Fluorescence images were taken as described in the Methods. FIG. 2b shows the results from quantitative analysis of the level of fluorescence intensity produced in breast cancer and normal cells. Fluorescence intensity was determined by measuring the mean fluorescence units from four randomly selected areas for each image taken under a confocal microscope. The mean fluorescence unit from four areas of each cell line is shown in the figure. Similar results were observed in repeat experiments. FIG. 2c shows the detection of the levels of survivin and cyclin Dl mRNA by Real Time RT-PCR. Relative level of survivin or cyclin Dl mRNA was calculated from a ratio of the quantity of survivin or cyclin Dl PCR products and the quantity of /3-actin PCR products. Real Time RT-PCR results on the levels of survivin or cyclin Dl mRNA in different tumor and normal cell lines correlated very well with the fluorescence intensities detected in the cell lines using MB detection (FIGS. 2a and 2b). FIG. 2d shows the examination of the levels of survivin protein in tumor and normal cell lines by Western blotting. The levels of survivin or cyclin D 1 protein correlated well with the levels of survivin or cyclin Dl mRNA detected in situ in fixed tumor cells using MB detection or with the Real-Time RT PCR results.

FIGS. 3(a-c) show the detection of survivin gene expression on frozen tissue sections obtained from breast cancer patients. FIG. 3a shows the expression of survivin gene was detected in different stages of breast cancer tissues. Frozen tissue sections were fixed with acetone and incubated with survivin MB-Cy3. The sections were counterstained with Hoechst 33342 (blue nuclei) and then examined under a fluorescence microscope. As shown, survivin-expressing cells (red) were found in all stages of breast cancer tissues including DCIS, invasive carcinoma and lymph node metastases, but not found in normal breast tissues. Different sections from the same tissues were also stained with a survivin antibody to confirm the presence of survivin positive cells (green). Yellow arrows indicate the detection of metastatic breast cancer cells in a lymph node by survivin MB or antibody. FIG. 3b shows that the western blot analysis showed a high level of survivin protein (16.5 KDa) in primary breast cancer and lymph node with metastases but not in normal breast tissues. FIG. 3c shows the detection of survivin gene expression in tumor endothelial cells in breast cancer tissues using double-labeling survivin MB-Cy3 with an antibody to CD31. Expression of survivin mRNA was labeled by survivin MB-Cy3 (Red) and tumor endothelial cells were labeled with an anti-CD31 antibody (Green). Another tissue section was double-labeled with goat anti-human survivin (FITC) and mouse anti- human CD31 antibodies (Red). A negative control section was stained with secondary antibody only without incubation with survivin-MB and primary antibody. All sections were counterstained with Hoechst 33342 (Blue). Arrows indicated that tumor endothelial cells expressed both survivin and CD31.

FIGS. 4(a-d) show the detection of the levels of survivin gene expression in viable cells using survivin MB. FIG. 4a shows that survivin MB-FITC produced green fluorescent signal in cytoplasma of breast cancer cells after transfection into viable cells. Treatment of the cancer cells with EGF for 1 hr or docetaxel for 24 hrs increased the fluorescence intensity in the cells. On the other hand, the fluorescence intensity generated by GAPDH MB-Cy3, which was cotransfected with the survivin MB, was relatively consistent in the cells. FIGS. 4b and 4c show that the level of survivin or GAPDH mRNA in MB-transfected cells could be measured by FACScan analysis to determine the mean fluorescence unit for each sample. Relative level of survivin mRNA was increased in EGF-stimulated cancer cell lines (green line), while there was no change in the fluorescence units detected in GAPDH MB transfected cells (red line). On the other hand, the level of survivin mRNA decreased in Ad p53 vector but not in AdCMV vector-transduced cells. FIG. 4d shows real time PCR analysis that showed the level of survivin mRNA was increased by EGF treatment but decreased after over-expression of p53. The numbers in the figure represent the mean numbers from three repeat samples. The relative level of survivin gene expression was calculated as a ratio of the quantity of survivin and GAPDH PCR product.

FIGS. 5(a-c) show the real time monitoring of the level of survivin gene expression in breast cancer cells. Cells cultured in 96-well plates were transfected with a mixture of survivin MB-FITC and GAPDH MB-Cy3 and then added human EGF or Docetaxel. The fluorescence intensity in each well was measured at different time points following treatment using a fluorescence microplate reader. Each point in the curve is a ratio of the mean fluorescence unit of survivin MB (FITC, Ex/Em 480/530) and mean fluorescence unit of GAPDH MB (Cy3, Ex/Em 530/590) from four repeat samples. Similar results were obtained from three independent studies. FIG. 5a shows that EGF treatment significantly increased the level of survivin mRNA (Student's t-test for all time points, P < 0.0005, where P, with a value ranging from zero to one, corresponds to a probability value of a statistical hypothesis test as known to people skilled in the art.). Analysis of the level of survivin protein by Western blotting further demonstrated that EGF increased survivin expression. FIG. 5b shows that the docetaxel treatment increased the level of survivin gene expression in both tumor cell lines. A significant increase in the level of survivin mRNA was seen 24 to 48 hrs following the treatment (Student's t-test, P < 0.05). The levels of survivin gene expression and survivin protein at different time points after treatment were also examined by Real Time RT-PCR (insert in the figure). Western blot analysis showed upregulation of survivin protein by docetaxel. FIG. 5c shows that the transfection of survivin or control GAPDH MB into viable cells did not significantly alter the level of survivin protein as determined by Western blot analysis of cell lysates after transfected with either survivin MB or GAPDH MB for 24 hrs. FIGS. 6(a-b) show the examination of specific binding of MBs to their DNA targets in solution. FIG. 6a shows the selective binding of K-ras MBs to specific mutant K-ras targets and specific hybridization of survivin MB to its DNA target. K- ras MBl, K-ras MB2 or survivin MB were mixed with various oligonucleotide targets for 1 hour. Relative fluorescence units were measured by a fluorescence microplate reader. The number in FIG. 6a was corresponding to the mean fluorescence unit of four repeat samples. As shown in FIG. 6a, 2 to 3.4 fold higher fluorescence units were detected in K-ras MB 1 mixing with Mut 1 target than mixing with Mut 2 or WT target. The differences between fluorescence units of K-ras MB2 mixed with K-ras Mut 2, and K-ras MB2 mixed with WT or K-ras Mut 1 were 1.7 and 2.2 fold. For both K-ras MBl and MB2, there was a significant difference between the relative fluorescence obtained when the MBs were mixed with specific mutant K-ras targets and those with non-specific mutants or WT K-ras target (Student's t-test: P< 0.001 for all groups). FIG. 6b shows the thermal profile of K-ras MBs hybridizing to DNA targets with wild type, specific and non-specific K-ras mutations. K-ras MBs were mixed with oligonucleotide targets for K-ras wild type (WT), Mut 1 and Mut 2 in 96- well PCR plates. The plates were placed immediately in a BioRad iCycler and relative fluorescence units were measured by the end of each temperature cycle using filters for Cy3 and Texas-red. Relative fluorescence units from each group were normalized with relative fluorescence units of Cy3 or Texas red dye at each temperature to correct the intrinsic changes of fluorescence signal due to temperature change. Significant differences in the fluorescence intensity were detected between K-ras MBs mixed with specific K-ras mutant target and those with WT K-ras or nonspecific K-ras mutant target (Curve statistic analysis by Student's t-test: K-ras MBl : P< IxIO^"9; K-ras MB2: P< IxIO^'13).

FIGS. 7(a-b) show the detection of pancreatic cancer cells using MBs targeting tumor marker genes. FIG. 7a shows the schematic illustration of detection of tumor marker gene-expressing cells using MB probes. A molecular beacon (MB) is a dual labeled anti-sense oligonucleotide probe with a complimentary sequence at its 5 'and 3 'ends. MB forms a hairpin structure in the absence of a specific target and prevents the fluorescent signal. Upon hybridizing with the target mRNAs in cells, the stem of the MBs opens up, leading to fluorescence in the cells. Since MBs can be labeled with different fluorophores, the expression of several genes can be detected simultaneously in single cells, hi this study, MBs designed to target tumor marker mRNAs such as K-ras mutations and survivin were delivered into fixed cells. Although single cells received all MBs, only the cells expressing the specific genes produced fluorescent signals. For example, in normal cells, which lack survivin gene expression and have a wild type K-ras gene, delivery of the MBs doesn't generate fluorescent signals. However, pancreatic cancer cells express survivin and/or mutant K-ras genes and delivery of MBs into the cancer cells produced green (survivin only) or green and red fluorescence (survivin and mutant K-ras genes). FIG. 7b shows the MB-imaging of pancreatic cancer cells expressing specific mutant K-ras and tumor marker survivin gene. Pancreatic cancer and normal cell lines were cultured in chamber slides and fixed with ice-cold acetone. The cells were then incubated with a mixture of MBs containing either K-ras MB 1 -Cy3 (GGT to GAT) or K-ras MB2- Texas red (GGT to GTT), and survivin MB-FITC. Fluorescent images were taken under a confocal microscope using a 4Ox lens. The same exposure time was used to take all images for each color. The cells with red fluorescence were pancreatic cancer cells expressing specific mutant K-ras as detected either by K-ras MBl or K-ras MB2. The cells expressing survivin gene showed green fluorescence.

FIGS. 8(a-b) show that the specific fluorescent signal produced in pancreatic cancer cells after delivery of Kras MBs targeting mutant K-ras mRNAs in the cells is not due to a difference in the level of K-ras gene expression. FIG. 8a shows quantitative analysis of fluorescence intensity in K-ras MB-stained cells. Fluorescence images were obtained from K-ras MB-stained cells under a confocal microscope using the same instrument setting for either Cy3 or Texas red. The numbers in the bar figure are the mean fluorescence units from 3 to 4 images with three areas measured in each image. Significant differences were detected in the relative fluorescence unit of the cells with a specific K-ras mutation after delivery of K-ras MBl or K-ras MB2 compared to the cells with a WT or non-specific K-ras gene (Student's t-test: P< 1x10^"5 for all groups). Similar results were obtained from three independent experiments. FIG. 8b shows the quantification of the level of K-ras mRNA in pancreatic cancer cell lines by Real Time RT PCR. cDNAs were amplified with K-ras primer pairs using a Bio-Rad iCycler. Amplification of j8-actin gene from the same cDNA samples was used as an internal control. The numbers in the figure were the average numbers of two to three repeat samples calculated from ratios of the starting quantity of survivin gene and the starting quantity of /3-actin gene.

FIGS. 9(a-b) show the specific imaging of pancreatic cancer cells expressing mutant K-ras and survivin mRNAs on frozen tissue sections of pancreatic cancer tissues. Frozen tissue sections were incubated with K-ras MBl or K-ras MB2 and counterstained with Hoechst 33342. All fluorescent images were taken by Nikon Eclipse E800 fluorescence microscope under a 40 x lens of using an Optronics Magnafire digital imaging system. FIG. 9a shows the detection of expression of specific mutant K-ras genes in pancreatic cancer cells on frozen sections using K-ras MBs. K-ras MBl detected the cancer cells expressing a GGT to GAT mutant K-ras gene on frozen sections of pancreatic cancer tissues from patient No. 1 and No. 2. However, bright red fluorescent cells were found on frozen sections of pancreatic cancer tissues from patient No. 5, which had a K-ras GGT to GTT mutation, only after incubation with K-ras MB2. The frozen sections from paired normal pancreatic tissues (patient No. 1 and No. 5) did not show bright red fluorescence signals following incubation with either K-ras MBl (patient No. 1) or K-ras MB2 (patient No. 5). The images of Hoechst staining of cellular nuclei (blue) on the frozen tissue sections are shown for the tissues with a weak or negative K-ras MB signal. FIG. 9b shows the detection of pancreatic cancer cells using survivin MB and a survivin antibody. Frozen sections from normal and pancreatic cancer tissues were incubated with either survivin MB or survivin antibody. The slides were examined under a fluorescence microscope after labeling with a secondary detection antibody and FITC- strept-avidin. As shown, survivin MB detected a high level of survivin mRNA in pancreatic cancer cells but not in normal pancreatic tissues. Immunofluorescence staining with survivin antibody further confirmed the presence of survivin protein in the pancreatic cancer cells. An anti-cytokeratin 8 antibody was used as a positive control for pancreatic cancer cells.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

The present invention is more particularly described in the following examples that are intended as illustrative only since numerous modifications and variations therein will be apparent to those skilled in the art. Various embodiments of the invention are now described in detail. Referring to the drawings, like numbers indicate like components throughout the views. As used in the description herein and throughout the claims that follow, the meaning of "a", "an", and "the" includes plural reference unless the context clearly dictates otherwise. Also, as used in the description herein and throughout the claims that follow, the meaning of "in" includes "in" and "on" unless the context clearly dictates otherwise. Moreover, titles or subtitles may be used in the specification for the convenience of a reader, which shall have no influence on the scope of the present invention. Additionally, some terms used in this specification are more specifically defined below.

DEFINITIONS The terms used in this specification generally have their ordinary meanings in the art, within the context of the invention, and in the specific context where each term is used. Certain terms that are used to describe the invention are discussed below, or elsewhere in the specification, to provide additional guidance to the practitioner regarding the description of the invention. For convenience, certain terms may be highlighted, for example using italics and/or quotation marks. The use of highlighting has no influence on the scope and meaning of a term; the scope and meaning of a term is the same, in the same context, whether or not it is highlighted. It will be appreciated that same thing can be said in more than one way. Consequently, alternative language and synonyms may be used for any one or more of the terms discussed herein, nor is any special significance to be placed upon whether or not a term is elaborated or discussed herein. Synonyms for certain terms are provided. A recital of one or more synonyms does not exclude the use of other synonyms. The use of examples anywhere in this specification including examples of any terms discussed herein is illustrative only, and in no way limits the scope and meaning of the invention or of any exemplified term. Likewise, the invention is not limited to various embodiments given in this specification.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. In the case of conflict, the present document, including definitions will control.

As used herein, "around", "about" or "approximately" shall generally mean within 20 percent, preferably within 10 percent, and more preferably within 5 percent of a given value or range. Numerical quantities given herein are approximate, meaning that the term "around", "about" or "approximately" can be inferred if not expressly stated.

"Hybridization" and "complementary" as used herein, refer to the capacity for precise pairing between two nucleotides. For example, if a nucleotide at a certain position of an oligonucleotide is capable of hydrogen bonding with a nucleotide at the same position of a DNA or RNA molecule, then the oligonucleotide and the DNA or RNA are considered to be complementary or hybridizable to each other at that position. The oligonucleotide and the DNA or RNA hybridize when a sufficient number of corresponding positions in each molecule are occupied by nucleotides which can hydrogen bond with each other. It is understood in the art that the sequence of an antisense oligonucleotide need not be 100% complementary to that of its target nucleic acid to hybridize thereto. An oligonucleotide is specifically hybridizable when binding of the compound to the target DNA or RNA molecule, and there is a sufficient degree of complementarity to avoid non-specific binding of the antisense oligonucleotide to non-target sequences under conditions in which specific binding is desired, e.g., under physiological conditions in the case of in vivo assays or therapeutic treatment, or, in the case of in vitro assays, under conditions in which the assays are performed. As used herein, the term "oligonucleotide" refers to an oligomer or polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or mimetics thereof. This term includes, but is not limited to, oligonucleotides composed of naturally occurring and/or synthetic nucleobases, sugars, and covalent internucleoside (backbone) linkages. Such modified or substituted oligonucleotides are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid targets, and/or increased stability in the presence of nucleases.

The term, as used herein, "molecular beacons" or its acronym "MBs" are single-stranded oligonucleotide hybridization probes that form a stem-and-loop structure. The loop contains a probe sequence that is complementary to a target sequence, and the stem is formed by the annealing of complementary arm sequences that are located on either side of the probe sequence. A fluorophore is covalently linked to the end of one arm and a quencher is covalently linked to the end of the other arm. Molecular beacons do not fluoresce when they are free in solution. However, when they hybridize to a nucleic acid strand containing a target sequence they undergo a conformational change that enables them to fluoresce brightly. In the absence of targets, the probe is dark, because the stem places the fluorophore so close to the nonfluorescent quencher that they transiently share electrons, eliminating the ability of the fluorophore to fluoresce. When the probe encounters a target molecule, it forms a probe-target hybrid that is longer and more stable than the stem hybrid. The rigidity and length of the probe-target hybrid precludes the simultaneous existence of the stem hybrid. Consequently, the molecular beacon undergoes a spontaneous conformational reorganization that forces the stem hybrid to dissociate and the fluorophore and the quencher to move away from each other, restoring fluorescence.

FIG. Ia shows schematically designs of two MBs: a survivin MB and a cyclin Dl MB. Although by no means limiting, typically, the fluorophore is attached to the 5' end while the quencher is attached to the 3' end. They are designed to form a stem-loop structure when their target mRNAs are not present such that the fluorescence of the fluorophore is quenched. The loop portion has a probe sequence complementary to a target mRNA molecule. Typical fluorophores that are contemplated to be used include, but are not limited to, Cy3 fluorophore (Cy3

Amidite, Amersham Pharmacia Biotech, Piscataway, New Jersey), Alexa Fluor 488 (Molecular Probes), Alexa Fluor 350 (blue), CMAC (7-amino-4- chloromethylcoumarin), 6-FAM and FITC. Typical quenchers include, but are not limited to, Dabcyl (4-(4'-dimethylaminophenylazo) benzoic acid, Dabcyl-CPG, Glen Research, Sterling, VA).

When the MB encounters a target mRNA molecule, the loop and a part of the stem hybridize to the target mRNA, causing a spontaneous conformational change that forces the stem apart. The quencher moves away from the fluorophore, leading to the restoration of fluorescence [4, 56]. One major advantage of the stem-loop probes is that they can recognize their targets with a higher specificity than the linear oligonucleotide probes. Properly designed MBs can discriminate between targets that differ by as little as a single nucleotide [7]. The MBs have been utilized in a variety of applications including DNA mutation detection, protein-DNA interactions, realtime monitoring of PCR, gene typing and mRNA detection in living cells [7, 9, 10, 57]. The term "gene" or "genes" as used herein refers to nucleic acid sequences (including both RNA or DNA) that encode genetic information for the synthesis of a whole RNA, a whole protein, or any portion of such whole RNA or whole protein.

The term "expressed" or "expression" as used herein refers to the transcription from a gene to give an RNA nucleic acid molecule at least complementary in part to a region of one of the two nucleic acid strands of the gene. The term "expressed" or "expression" as used herein may also refer to the translation from said RNA nucleic acid molecule to give a protein or polypeptide or a portion thereof.

By the use of the term "enriched" in reference to nucleic acid it is meant that the specific DNA or RNA sequence constitutes a significantly higher fraction of the total DNA or RNA present in the cells or solution of interest than in normal or diseased cells or in the cells from which the sequence was taken. Enriched does not imply that there are no other DNA or RNA sequences present, just that the relative amount of the sequence of interest has been significantly increased. The other DNA may, for example, be derived from a yeast or bacterial genome, or a cloning vector, such as a plasmid or a viral vector. The term significant as used herein is used to indicate that the level of increase is useful to the person making such an increase.

The terms "vector" and "nucleic acid vector" as used herein refer to a natural or synthetic single or double stranded plasmid or viral nucleic acid molecule that can be transfected or transformed into cells and replicate independently of, or within, the host cell genome. A circular double stranded plasmid can be linearized by treatment with an appropriate restriction enzyme based on the nucleotide sequence of the plasmid vector. A nucleic acid can be inserted into a vector by cutting the vector with restriction enzymes and ligating the pieces together. The nucleic acid molecule can be RNA or DNA.

The term "transfection" as used herein refers to the process of inserting a nucleic acid into a host. Many techniques are known to those skilled in the art to facilitate transfection of a nucleic acid into a prokaryotic or eukaryotic organism. These methods involve a variety of techniques, such as treating the cells with high concentrations of salt such as, but not only a calcium or magnesium salt, an electric field, detergent, or liposome mediated transfection, to render the host cell competent for the uptake of the nucleic acid molecules. Acronyms and abbreviations used herein, "MB" refers to molecular beacon; "Dabcyl" stands for 4-({4'-(dimethylamino)phenyl]azo) benzoic acid; "mNRA" messenger ribonucleic acid; "NDA" refers to deoxyribonucleic acid; "GAPDH" stands for glyceraldehyde-3 -phosphate dehydrogenase; "WT" represents wild type; "IAP" represents inhibitor of apoptosis protein; "Mut" stands for mutation; "EGF" stands for epidermal growth factor, "Doc" refers to docetaxel; "RF-U" refers to relative fluorescence unit; "DCIS" stands for ductal carcinoma in situ; "MOI" represents multiplicity of infection; and "RT-PCR" refers to reverse transcription polymerase chain reaction.

OVERVIEW OF THE INVENTION

The present invention provides methods for detecting gene expression in normal and cancerous cells. Specifically, provided are methods for detecting, identifying or quantitating the presence of, or alterations in gene expression of, various tumor markers in a sample of cells and/or tissues of a subject using molecular beacon (MB) imaging. MBs are oligonucleotides with a stem-loop hairpin structure, dual-labeled with a fluorophore at one end and a quencher at the other. Delivering MBs into cells will result in a fluorescence signal if the MBs hybridize to target mRNAs. Thus, when the target mRNAs correspond to the molecular markers of a cancer, cancer cells (bright) can be distinguished from normal cells (dark).

The various embodiments of the present invention provide methods for: detecting the presence of at least one tumor marker mRNA in a sample of cells; detecting the presence of a mutant gene in a tumor cell; monitoring alterations in gene expression in viable cells; detecting or monitoring the presence or progression of breast cancer in a subject that includes monitoring or detecting the presence of a breast cancer marker; detecting or monitoring presence or progression of pancreatic cancer in a subject that includes detecting or monitoring for the presence of a pancreatic cancer marker; and, detecting cancerous cells in a sample that includes treating a sample of cells with an oligonucleotide that targets a cancer-specific marker gene sequence. In one embodiment, a method includes the steps of the steps of designing a number of MBs, each being capable of targeting a corresponding tumor marker mRNA, simultaneously delivering the number of MBs to the sample of cells and/or tissues so as to produce MB-target hybrids in the sample of cells and/or tissues, detecting fluorescent signals emitted from the MB-target hybrids, and detecting, identifying or quantitating the presence of cancer cells in the sample cells and/or tissues from the detected fluorescent signals, where each MB-target hybrid is a hybridization of an MB with its corresponding tumor marker mRNA.

According to embodiments of the present invention, each of the number of MBs is designed to possess a fluorophore of a unique color, respectively, such that when one MB targets its corresponding tumor marker mNRA, an MB-target hybrid is produced and emits a fluorescent signal in the unique color of the fluorophore of the MB in the sample of cells and/or tissues. The fluorophore includes Cy3 fluorophore, Alexa Fluor 488, Alexa Fluor 350, CMAC (7-amino-4-chloromethylcoumarin), 6- FAM, FITC, or any combination of them. Other fluorophores can also be used to practice the current invention.

Accordingly, the detected fluorescent signals can be characterized with different colors, and each color is associated with a corresponding tumor marker mNRA in the sample cells and/or tissues. Therefore, cancer cells expressed by corresponding tumor marker mNRAs can be detected by identifying the corresponding colors of the detected fluorescent signals. Furthermore, the intensity of the fluorescent signals in one color is corresponding to the level of the corresponding tumor marker mRNA expressed in the sample of cells and/or tissues, that is, the level of expression of the corresponding tumor marker mNRA in the sample of cells and/or tissues can be quantitated by the intensity of the fluorescent signals in the color. In other words, the sample of cells and/or tissues has cancer cells if the intensity of the fluorescent signals in one color is no less than an intensity threshold, or the sample of cells and/or tissues substantially has no cancer cells if the intensity of the fluorescent signals in each color is less than the intensity threshold. The intensity threshold is predetermined, AND may be dependent on the type of cancer.

In various embodiments, the present invention provides a method of detecting the presence of at least one tumor marker mRNA in a sample using the molecular beacon technology described herein. As one so skilled in the art will readily appreciate, the methods of the present invention can be utilized to detect the presence of any tumor marker mRNA present in a sample. Such markers include but are not limited to, survivin, cyclin Dl, Her2/neu, a mutant K-rαs, basic fibroblast growth factor, EGF receptor, XIAP, carcinoembryonic antigen, prostate specific antigen, alpha-fetoprotein, beta-2-microglobulin, bladder tumor antigen, chromogranin A, neuron-specific enolase, S-IOO, TA-90, tissue polypeptide antigen and human chorionic gonadotropin.

Samples of cells to be tested can be obtained through routine diagnostic procedures. Such samples can include, but are not limited to, blood, urine, fine needle aspirates, breast ductal lavage, pancreatic juice, ascites, nipple aspiration samples, or any other tissue, including, but not limited to, a biopsy from anywhere from the patient, including, but not limited to, the breast, the pancreas or a lymph node. The tissue sample can be any type of routine pathologically prepared sample including any type of tissue affixed to a microscope slide, plate or well. In a preferred embodiment, the tissue sample is a frozen section of tissue. In another preferred embodiment, the sample is taken from a breast ductal lavage. In still another preferred embodiment, the sample is taken from pancreatic juice.

Another aspect of the present invention provides a method for real-time detection of the level of expression of a marker gene in viable cells. Such method includes the steps of providing a sample of viable cells containing the marker gene, treating the sample of viable cells with at least one of survivin and GAPDH MBs, and measuring intensities of fluorescent signals emitted from the treated sample of viable cells at different time points to detect the level of expression of the marker gene in the sample of viable cells as a function of time.

In one embodiment, the treating step includes the steps of transfecting the sample of viable cells with a mixture of survivin and GAPDH MBs for a first period of time, and treating the transfected sample of viable cells with EGF or docetaxel for a second period of time, where the first period of time and the second period of time are different or substantially same. In another embodiment, the treating step has the steps of transducing the sample of the viable cells with Ad p53 vector or control vector AdCMV for a period of time, and delivering survivin or GAPDH MBs into the tranduced cell.

The method for real-time detection of the level of expression of a marker gene in viable cells will allow for the monitoring expression of target genes including, but not limited to, tumor markers, mutant genes or the like. Thus, clinicians will be able to detect and monitor the development of cancers in for example, individuals who have been determined to be genetically predisposed to certain cancers. In this way, proper treatments can be implemented early in the course of the development of the disease, which may indeed prevent or diminish the onset of tumor or cancer growth.

Importantly, detection of the level of gene expression in viable cells will allow one to measure the changes of gene expression real-time in the same cell population after various treatments. This approach can be used for the examination of alternation of gene expression in tumor cells by biological reagents as well as for the evaluation of the expression of molecular target genes after treatment of the cancer cells with therapeutic reagents.

One exemplary embodiment of the present invention provides a method of detecting or monitoring the presence or progression of breast cancer in a subject using the molecular beacon imaging described herein. The present invention provides methods for detecting breast cancer cells from ductal lavage and fine needle aspiration (FNA) using a combination of MBs targeting the mRNAs of genes that have been shown to be expressed in the early stage of tumori genesis in breast cancer. The inventor has shown the predictive values of the detection of each gene or monitoring the co-expression of two or three genes in the diagnosis of ductal carcinoma in situ. In certain embodiments of the present invention, methods are provided for simultaneously detecting the overexpression of survivin, cyclin D 1 and Her-2/neu genes in breast ductal epithelial cells. The methods of the present invention are useful to detect the presence of these tumor markers especially when a tumor single cell expresses more than one marker gene. In a preferred embodiment, a method is provided for the detection of survivin, cyclin D 1 and/or Her-2/neu expressing cells in the ductal lavage.

It is contemplated that any oligonucletide constructed for the use as an MB as described above can be used in methods of the present invention. In the exemplary embodiment, MBs were designed to specifically hybridize to mRNAs of survivin, cyclin D 1 or Her-2/neu. The inventor has demonstrated the specificity and sensitivity of the MBs in human breast cancer cell lines, normal mammary epithelial and normal fibroblast cell lines as well as in identifying the isolated tumor cells in a background of normal cells with different cancer-to normal-cell ratios. The provided methods can be utilized to detect the expression of these tumor markers in the cellular fractions of ductal lavage and aspirates of fine needle aspirates obtained from early stage breast cancer or ductal carcinoma ion situ (DCIS) patients at different stages of the disease and normal control subjects.

It is contemplated that samples can be obtained through any routine diagnostic procedure for breast cancer patients or women at a high risk for developing breast cancer. As a non-limiting example, a ductal lavage from a cancer patient is collected when the patient is undergoing surgery to remove the breast cancer or in a routine visit to doctor's office. Under anesthesia, a microcathether is inserted into the duct and saline infused. The effluent fluid iscollected and cellular fraction enriched by centrifugation. The enriched cell fraction from ductal lavage or aspirates are then placed on glass slides. Typically, about 10 to 15 cytospin slides are obtained from one ductal lavage with a median of 13,500 epithelial cells per duct. After fixing the cells in ice-cold acetone, the slides are incubated with one or more MBs, either sequentially or simultaneously, at optimized incubation conditions and then examined under a fluorescence microscope. Since MBs for each gene are labeled with different fluorescent dyes, the number of the cells over-expressing any or all of the genes for the target tumor markers in a sample are determined. It is contemplated that results obtained from one type of sample collection can be compared with those obtained from another in order to aid in the identification, monitoring or detection of a tumor marker or in the diagnosis of, or monitoring the progression of the cancer. Subsequently, the same slides can be stained and analyzed by a cytopathologist for the presence of benign, atypical or malignant cells. Such staining can include routing cytological stains such as H&E or immuostaining with specific antibodies.

Detection of the hybridization of an MB with its target sequence in intact cells, either fixed or viable, can be accomplished by fluorescence microscopy, FACS analysis and fluorescence microplate reader. As a non-limiting example, the breast cancer cells were co-transfected with survivin and GAPDH MBs and then treated with EGF. The alternation of survivin gene expression after EGF treatment was monitored real time in microplate reader for 3 hours. The results showed that EGF induced an increase in survivin gene expression within 30 minutes of the treatment.

Another exemplary embodiment of the present invention provides a method of detecting or monitoring the presence or progression of pancreatic cancer in a subject using the molecular beacon technology described herein.

One of the crucial issues for early detection of pancreatic cancer is to develop assays that are capable of identifying a few tumor cells in a pool of a large number of normal cells. At present, RT-PCR is the most sensitive assay for detection of the genes that are highly expressed in tumor cells or for mutated gene products such as mutant K-ras gene, or carcinoembryonic antigen. Though RT-PCR can detect one tumor cell in 104 to 105cells, such assays may generate'false positives', hi addition, using current molecular markers, RT-PCR detection of gene expression or mutant gene in peripheral blood and pancreatic juice cannot localize the cancer to pancreas since many types of cancers as well as other non-malignant diseases may also express those molecular markers. Furthermore, RT-PCR assays are very time consuming, typically detecting one gene at a time, making it difficult to become an efficient clinical procedure for cancer diagnosis.

A sensitive and more efficient method as disclosed herein has been developed as part of the present invention that can identify a small number of pancreatic cancer cells in peripheral blood and pancreatic juice samples. The MB-based methods disclosed herein can be used to detect pancreatic cancer or tumor cells from a mixed cell population using a single MB type or a combination of several MBs. The methods provided can be used to detect K-ras mutations after RT-PCR amplification of K-ras exon 1. In addition, various cytological or immunostaining procedures can be used in conjunction with the disclosed methods.

For early detection of pancreatic cancer in the high-risk patient population or patients suspected to have pancreatic cancer, it is important to develop clinical assays from patient samples that can be obtained non-invasively or by a minimally invasive procedure. Increasing evidence has revealed the presence of disseminated tumor cells in blood, bone marrow and peritoneal cavity of pancreatic cancer patients [42, 57-59]. For example, by immunohistochemical staining using antibodies detecting several cytokeratin-and tumor markers, the cancer cells were found in 28% of the blood samples obtained from patients with pancreatic cancers. The prevalence of finding cancer cells in blood samples increased with tumor stage. However, it failed to find cancer cells in the blood samples of stage 1 pancreatic cancer patients [60]. The present invention provides sensitive methods in which various samples from pancreatic cancer patients of all stages can be examined using the MB technology disclosed herein to identify cells expressing pancreatic tumor markers including, but not limited to, mutant K-ras and survivin genes.

It is contemplated that results obtained from one type of sample collection can be compared with those obtained from another in order to aid in the identification, monitoring or detection of a tumor marker or in the diagnosis of, or monitoring the progression of the cancer. Subsequently, the same slides can be stained and analyzed by a cytopathologist for the presence of benign, atypical or malignant cells. Such staining can include routing cytological stains such as H&E or immuostaining with specific antibodies. The sensitivity of the MB-based detection using blood and pancreas juice is evaluated by comparing the size and stages of the pancreatic cancer lesions diagnosed by imaging technologies such as helical CT, MRI or endoscopic ultrasound or pathological diagnosis after surgical resection of the cancer.

A diagnostic kit for detecting alterations in gene expression in viable cells in real-time is also contemplated that would comprise any systems, materials or reagents suitable for carrying out the disclosed methods.

These and other aspects of the present invention are more specifically described below.

IMPLEMENTATIONS AND EXAMPLES OF THE INVENTION

Without intent to limit the scope of the invention, exemplary methods and their related results according to the embodiments of the present invention are given below. Note that titles or subtitles may be used in the examples for convenience of a reader, which in no way should limit the scope of the invention. Moreover, certain theories are proposed and disclosed herein; however, in no way they, whether they are right or wrong, should limit the scope of the invention so long as the invention is practiced according to the invention without regard for any particular theory or scheme of action.

EXAMPLE l: REAL-TIME DETECTION OF GENE EXPRESSION IN BREAST CANCER CELLS USING MOLECULAR BEACON IMAGING

MATERIALS AND METHODS:

Human Tumor and Normal Cell Lines: Breast cancer cell lines SKJBr-3, MDA-MB-231 and MCF-7, and normal immortalized human mammary epithelial cell line MCF-IOA were obtained from the American Type Culture Collection (ATCC, Manassas, Virginia). Another breast cancer cell line, MDA-MB-435, was provided by Dr. Zhen Fan (M.D. Anderson Cancer Center, Houston, Texas). Human breast cancer cell lines were maintained in DMEM/F-12 medium (50:50, Mediatech, Herndon, Virginia). All the above media were supplemented with 10% fetal bovine serum (FBS) (Hyclone, Logan, Utah), 2 niM L-glutamine, 100 IU/ml penicillin and 100 μg/ml streptomycin (Mediatech Inc., Herndon, Virginia). MCF-IOA cells were cultured in DMEM/F12 medium supplemented with 20 ng/ml epidermal growth factor, 500 ng/ml hydrocortisome, 100 ng/ml of cholera toxin, 10 μg/ml insulin, 2 mM L-glutamine and 5% FBS .

Human Breast Cancer and Normal Tissues: Frozen human breast cancer and normal tissues were obtained according to an approved IRB (Independent Research Board) protocol at Emory University from breast cancer patients during surgery to remove the tumors. The pathology of breast tissues was confirmed by pathologists at Emory University. Tissues were frozen immediately in liquid nitrogen and stored in a -80⁰C freezer for the study.

Design and Synthesis of MBs: The sequences of MBs targeting survivin or cyclin Dl mRNAs, selected from the GenBank, were unique for each gene. All survivin MBs contain the sequence regions with non-homology with other members of the inhibitor of apoptosis proteins. These include: 1) survivin MB-FITC (33 to 50 nt of the gene): 5 '-FITC-TGGTCCTTGAGAAAGGGCGACCA-Dabcyl-3 '; 2) Survivin MB-Cy3 (27 to 43 nt of the gene): 5'-Cy3- CTGAGAAAGGGCTGCCAGTCICAG-Dabcyl-3'; and 3) Cyclin Dl MB-Texas red (375 to 393 nt of the gene): 5'-Texas-red-TGGAGTTGTCGGTGTAGACTCCA- Dabcyl-3'. The design of the survivin and cyclin Dl MBs and illustration of the mechanism of binding MBs to specific oligonucleotide targets are shown in Fig. Ia. Control MBs for targeting human glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene at 503 to 521 nt, GAPDH MB-Cy 3 or GAPDH MB-6-FAM, were also synthesized as the following: 5'-Cy3 or 6-FAM-

CGAGTCCTTCCACGAT ACCACTCG-Dabcvl-3 ' . For each MB design, the stem region has 5 to 6 nucleotides. Sequences of one arm of the stem and the loop region of the MBs were complementary to a segment of the target genes. The underlined bases were those added to form a stem with an optimal Tm condition. All MBs were synthesized in MWG-Biotech Inc. (High Point, North Carolina).

Determination of Specificity of the MBs Binding to their Oligonucleotide Targets in Solution: The oligonucleotide targets for each MB were synthesized at Sigma Genosys Inc., (Woodlands, Texas). These include: 1) survivin target (13 to 72 nt): 5'-

CCTGCCTGGCAGCCCTTTCTCAAGGACCACCGCATCTCTACATTCAAGAAC -3'; 2) cyclin D 1 target (364 to 399 nt): 5'- AGAAGCTGTGCATCTACACCGACAACTCCATCCGGC-3'; 3) Her-2/Neu gene target (72 to 108 nt): 5'-

AGTGTGCACCGGCACAGACATGAAGCTGCGGCTCCCT-S'; and 4) K-ras gene (22 to 78 nt): 5'-GTAGTTGGAGCTGGTGGCGTAGGCAAGAGTGCCTTGA CGATACAGCTAATT CAG-3'. Her-2/Neu and K-ras gene targets were used as non-specific target controls. Specific binding of survivin or cyclin Dl MB to various DNA targets was determined by mixing 200 nM of the MBs with 1 μM of oligonucleotide targets in 100 μl of Opti-MEM medium (Invitrogen, Carlsbad, California) in 96- well plates. After incubating at 37 ⁰C for 60 minutes, fluorescence intensity in the mixture of 96 well was measured by a fluorescence microplate reader (Bioteck FL600 Fluorometer, Winooski, Vermont).

Real-time Reverse Transcription-PCR: Total RNAs were isolated using a RNA Bee kit (Tel-test, Friendswood, TX). 2 μg of RNA samples were amplified with an Omniscript RT kit using an oligo dT primer (QIAGEN Inc., Valencia, California) to generate 20 μl of cDNAs. 1 to 2 μl of cDNA was then quantified by real time PCR with primer pairs for survivin, cyclin Dl, /3-actin, or GAPDH using SYBR Green PCR Master mix. Real-time PCR was performed on an ABI PRISM 7000 sequence detection system (Applied Biosystems, Foster City, California). The primer pairs for detecting the expression of survivin gene were survivin forward, 5'- TCCACTGCCCCACTGAGAAC-3' and survivin reverse, 5'-

TGGCTCCCAGCCTTCCA -3', which amplify a 76 nt PCR product located from 130 to 206 nt of survivin mRNA. PCR primers for cyclin Dl (from 364 to 453 nt) were forward 5 '- AGAAGCTGTGC ATCT ACACCGAC AACTCC ATCCGGC-3 ' and reverse 5'-GGTTCCACTTGAGCTTGTTCACAA-S' . Amplification of /3-actin or GAPDH gene was used as an internal control for Real-time RT-PCR. The primer pair for /3-actin gene were /3-actin forward, 5'- AAAGACCTGT ACGCC AAC AC AGTGCTGTCTGG-3' and /3-actin reverse, 5'- CGTC ATACTCCTGCTTGCTGATCC AC ATCTGC-3 ' , which generate a 219 nt PCR product from 870 to 1089 nt of the /3-actin mRNA sequence. Primer pairs for GAPDH (from 10 to 953 nt were: 5'-TGAAGGTCGGAGTCAACGGATTTGGT-S' and 5'-CATGTGGGCCATGAGGTCCACCAC-S'. The quantity of PCR products from amplification of the survivin gene was standardized with the quantity of /3-actin or GAPDH products for each sample to obtain a relative level of gene expression.

Western Blot Analyses: Cell lysates were collected after different treatments and total cellular protein was resolved on polyacrylamide SDS gels. Western blot analysis for the level of survivin protein was done according to a standard protocol as described [19]. Cells were lysed in 50 mM HEPES, 50 mM NaCl, 5 mM EDTA, 10 mM Na2P2θ7 10 H2O, 50 mM NaF, 1 mM NaVC-4, 1 % Triton X- 100 and protease inhibitor cocktail tablets (Complete mini, Roche Molecular Biochemical, Indianapolis, Indiana). 50 μg of protein was resolved on 12-15% polyacrylamide SDS gels and then transferred to PVDF membranes (Bio-Rad laboratories, Richmond, California). The membranes were blocked with 5% of non-fat milk in Tris-buffered saline for 1 hour and then incubated for 2 hours with goat anti-human survivin (1 :600) (Santa Cruz Biotechnology, Santa Cruz, California) or mouse monoclonal anti-/3-actin antibody (1:2000) (Sigma Chemical Co, St. Louis, Missouri). After three washings, the membranes were incubated with horseradish-peroxidase conjugated with anti-goat or mouse secondary antibody (Santa Cruz Biotechnology) for 1 hour. The levels of specific proteins in each lysate were detected by Enhanced Chemiluminescence using ECL plus (Amersham International, Buckingham, United Kingdom) followed by autoradiography.

Detection of Gene Expression in Fixed Cells: Human breast cancer cell lines and a normal immortalized mammary epithelial cell line, MCF-IOA, were plated on chamber slides for 24 hrs and then fixed with ice-cold acetone for 510 minutes. After air drying, the slides were stained immediately or stored in a -80⁰C freezer until use. A mixture of 200 nM of survivin MB-FITC and cyclin D 1 MB-Texas red in Opti-

MEM medium was incubated with the slides at 37 ⁰C for 60 minutes. The slides were then examined using a confocal microscope (LSM 510 Meta, Carl Zeiss Microimaging, Inc., Thornwood, New York).

For detecting survivin gene expression on tissue sections, 5 μ frozen sections of breast normal and cancer tissues fixed with ice-cold acetone were incubated with 200 nM survivin MB-Cy3 for 60 minutes and then counter-stained with 10 μg/ml Hoechst 33342 (Molecular Probes, Inc., Eugene, Oregon). The tissue slides were observed under a Nikon fluorescence microscope (Nikon Eclipse E800, Nikon Instruments Inc. Melville, New York). Fluorescence images were taken using an Optronics Magnafire digital imaging system (Meyer Instruments, Houston, Texas). For each experiment, the same exposure time was used to take all images for each color.

Therefore, fluorescence intensity for each image was consistent with the actual image observed under the microscope. Immunofluorescence Staining: Acetone-fixed frozen sections were incubated with a polyclonal goat anti-human survivin antibody for 60 minutes (Santa Cruz Biotechnology). After washing with PBS, the slides were incubated with FITC- conjugated donkey anti-goat antibody for 30 minutes and then examined under a Nikon fluorescence microscope. For double labeling survivin MB and human endothelial cell marker CD31 , frozen sections of an invasive breast cancer tissue were fixed and incubated with survivin MB-Cy3 and then with an anti-CD31 antibody followed by a FITC-conjugated secondary anti-mouse antibody. One tissue section was double-labeled with goat anti-human survivin and mouse anti-human CD31 antibodies. The secondary antibodies used were FITC-labeled donkey anti-goat antibody, or biotinylated-horse anti-mouse antibody followed by Texas-red avidin.

Quantification of the Level of Gene Expression in Viable Cells Using MBs: (i) FACScan analysis: Cells cultured in 2% FBS medium or transduced with an adenoviral vector expressing a wild type p53 gene (Ad p53, Qbiogene, Carlsbad, California) or control adenoviral vector without gene (Ad CMV) at a multiplicity of infection (MOI) of 50 (PFU) for 24 hrs were collected by EDTA- trypsin digestion and divided into two groups. One group of the cells was transfected in suspension with 400 nM of survivin MB-FITC and the other was transfected with 400 nM of GAPDH MB-6-FAM using Lipofectamine 2000 in Opti-MEM medium (Invitrogen). GAPDH MB Cy3 was not used for this experiment since FACscan could not detect Cy3 fluorescent signal. Three hours following transfection, 100 ng of human recombinant EGF (Invitrogen) was added to EGF- treated group for 1 hr. After a brief wash with PBS, fluorescence intensity of the cells from all groups was examined using FACScan analysis and the results were analyzed using Cell-Quest software (FACScan, Becton Dickinson, Mansfield, Massachusetts). (U) Fluorescence microplate reader: Cells were plated in 96-well tissue culture plates at 80% confluence for 24 hrs. All groups except the no-MB control group were then transfected with a mixture of 400 nM of survivin MB-FITC and internal control GAPDH MB-Cy 3 in Opti-MEM medium using Lipofectamine 2000. 3 hrs following transfection, basal levels of the fluorescence unit in the wells were measured using a fluorescence microplate reader (Bioteck FL600 Fluorometer). 100 ng of EGF was then added to the wells in the EGF-treated group and 10 to 50 nM of docetaxel (Aventis Pharma, Bridgewater, New Jersey) were added to docetaxel-treated groups. The culture plates were immediately placed in the microplate reader and fluorescence units in each well were measured every 30 min for 3 hrs. For docetaxel-treated groups, the plates were also measured at 24 and 48 hrs.

RESULTS AND DISCUSSION:

Survivin and Cyclin Dl MBs Specifically Bind to DNA Targets: The designs for survivin and cyclin Dl MBs are shown in Fig. Ia. It is demonstrated that survivin or cyclin Dl MB specifically bound to its DNA target and generated strong fluorescent signals. Survivin MB produced a 5 to 6 fold higher fluorescent signal when mixed with survivin target compared with other DNA targets such as cyclin Dl, Her-2/neu and K-ras (Fig. Ib). Similarly, 7 to 8 fold higher fluorescent signals were detected in the mixture of cyclin Dl MB and cyclin Dl target but not in other groups (Fig. Ib).

Detection of Human Breast Cancer Cells Using MBs Targeting Tumor Marker mRNAs: It is examined whether MBs targeting different tumor marker mRNAs can be labeled with different fluorophores and expression of the tumor marker genes can be determined simultaneously in single cells. The results demonstrated that a combination of survivin and cyclin Dl MBs detected the expression of both survivin and cyclin Dl genes simultaneously and generate fluorescent signals corresponding to either survivin (green) or cyclin Dl (red) mRNA in the cancer cells (Fig. 2a). Importantly, the fluorescent signal was very low for both survivin and cyclin Dl MBs in a normal immortalized human mammary epithelial cell line (MCF-IOA), indicating that survivin and/or cyclin Dl MBs can be used as fluorescence probes for the detection of breast cancer cells (Fig. 2a). The results of examination of fluorescence intensity and the level of survivin or cyclin Dl gene expression in tumor and normal cell lines further showed that the fluorescent signals detected by the MBs correlated very well with the levels of survivin or cyclin D 1 gene expression, both in mRNA and protein levels (Figs. 2b, 2c and 2d). For example, MDA-MB-435 and SKBr-3 expressed very high levels of survivin as detected by Real Time RT-PCR assay and Western blot analysis, and the strongest fluorescent signal was detected in these cell lines. Conversely, these cell lines expressed low levels of cyclin Dl gene and showed a weak red fluorescence staining (Figs. 2a, 2b, 2c and 2d). Another breast cancer cell line, MCF-7, expressed a moderate level of survivin gene but had a very high level of cyclin Dl gene expression (Figs. 2a, 2b, 2c and 2d). Delivery of survivin and cyclin Dl MBs into this cell line produced a strong red fluorescent signal (cyclin Dl) and an intermediate level of green fluorescent signal (survivin) (Figs. 2a, 2b, 2c and 2d). The results demonstrate that a combination of MB technology with fluorescence imaging is a novel approach to simultaneously detect the levels of multiple gene expressions in intact single cells. MBs Detect Cancer Cells on Frozen Sections of Breast Cancer Tissues: At present, pathological diagnosis of breast cancer in patient samples such as fine needle aspiration, core biopsy and surgically resected tissues mainly depends on morphological classification [21]. Although antibodies against various tumor markers such as Her-2/Neu and EGF receptor have been used to identify breast cancer cells, only 30 to 50 % of breast cancers express these tumor markers [22, 23]. However, it has been shown that over 70% of breast cancer tissues express a high level of survivin [17, 18]. A simple and fast procedure has been developed that allows survivin gene expression in situ on frozen tissue sections. It has been shown that survivin MB-Cy3 was able to produce strong red fluorescent signals in breast cancer cells (Fig. 3a). Using this method, it was found that survivin gene expression was an early event in the tumorigenesis of breast cancer, and was present in the ductal carcinoma in situ (DCIS) stage. A high level of survivin gene expression was also consistently detected in most breast cancer tissues of invasive ductal carcinoma and lymph node metastases but not in normal breast tissues (Fig. 3a). In addition, it was found that survivin gene- expressing cells in breast cancer tissues included cancer cells as well as cells in the vascular structures (Fig. 3c). When the same section was doublelabeled with an antibody specific for a CD 31 human endothelial cell marker [24], those survivin expressing cells were shown to be endothelial cells (Fig. 3c). Establishment of this MB detection method at the level of gene expression in situ should provide pathologists with a revolutionary tool to identify cancer cells in clinical samples. Monitoring the Level of Real-Time Gene Expression Using Survivin MB: Development of a sensitive method for determining the change of expression of specific genes will facilitate studies of cancer biology and the development of new cancer drugs, especially for therapeutic reagents targeting specific molecules in cancer cells. Unlike the traditional linear probes where unbound probes also generate fluorescent signals, MBs should only produce fluorescent signals when hybridized specifically to their target mRNAs, which makes them ideal probes for detecting the level of mRNAs in viable cells. Three model systems were used to determine whether survivin MB was able to detect changes of survivin gene expression in viable cells, including EGF or docetaxel induced upregulation, and tumor suppressor gene p53-induced down regulation of survivin gene expression [25, 26]. Human breast cancer cells were transfected with a mixture of survivin and GAPDH MBs and observed under a fluorescence microscope after treated with EGF for 1 hr or docetaxel for 24 hrs. The results showed that treatment of the cells with EGF or docetaxel increased the level of survivin gene expression. Under a fluorescence microscope, the green fluorescence intensity (survivin MB-FITC) was stronger in the cells treated with either EGF or docetaxel compared to untreated control while the fluorescent signal for GAPDH MB (Cy3, red) was relatively consistent (Fig. 4). FACScan analysis was further used to determine the mean fluorescence intensity of all cell populations. Consistent with the observations with the fluorescence microscopy, higher levels of fluorescent signal in EGF-treated cells compared to the untreated group in both MCF-7 and MDA-MB-231 cells was observed (Fig. 4b). The relative level of survivin mRNA could be quantified from the FACScan data using the fluorescence unit of GAPDH gene as an internal control. It was found that EGF treatment induced about 1.5 fold increases in the level of survivin gene expression in breast cancer cells.

In addition to the detection of levels of up-regulated genes, the feasibility of quantifying the relative level of gene expression that was down-regulated in the cells was examined. It had been shown that over-expression of p53 gene decreases the expression of survivin gene [26]. The tumor cells were transduced with Ad p53 vector or control vector AdCMV for 24 hrs and then delivered survivin or GAPDH MBs into the transduced cells. Using FACScan analysis, it was found that the relative fluorescence was decreased about 2 fold in Ad p53 vector- transduced cells compared to the untreated or empty AdCMV vector control group (Fig. 4c). The ability of MBs to detect the level of gene expression decrease in the cells suggests that the fluorescent signals detected intracellularly after MB transfection were not from nonspecific degradation of the MBs, since the same amount of survivin and GAPDH MBs were delivered into Ad p53 and control vector-transduced cells. The results from Real time RT-PCR further confirmed that EGF increased the transcription of survivin gene and overexpression of the p53 gene decreased the level of survivin mRNA (Fig. 4d).

Although detection of the level of gene expression by FACScan can accurately measure the fluorescence intensity in individual cells as well as in cell populations, the procedure for FACScan is time-consuming and does not easily detect changes of gene expression real-time in the same cell population. To develop a high throughput method for monitoring the changes of gene expression real-time in viable cells, the feasibility of detecting levels of gene expression in cells cultured in 96-well plates using the MB-transfection approach was examined. Breast cancer cells were plated in 96-well plates and transfected with a mixture of survivin and GAPDH MBs for 3 hrs. After adding EGF or docetaxel, the plates were immediately placed in the fluorescence microplate reader and the fluorescence units in each well were measured at different time points. It was found that EGF-induced up-regulation of survivin gene expression occurred as early as 15 minutes following the treatment and lasted for over 3 hrs (Fig. 5a). There were 2.3 (MCF-7) to 2.8 (MDA-MB-231) fold increases in the relative levels of survivin mRNA after EGF treatment. The level of survivin protein using Western blot analysis was also examined and further confirmed that the level of survivin protein increased following EGF treatment. For real-time detection of the level of gene expression in viable cells, it is important to determine how long the MB probes will stay in the cells and still be able to produce fluorescent signals that reflect the relative level of the gene expression. It has been shown that chemotherapy drug docetaxel increases in the level of survivin gene expression as early as 4 hours following the docetaxel treatment [25]. The level of survivin gene expression real time in survivin and GAPDH MB-transfected cells following docetaxel treatment from 0 to 48 hrs was examined. It was found that compared to untreated cells, the level of survivin mRNA was increased at 5 hrs and reached a higher level 24 and 48 hrs after treatment (Fig. 5b). The relative level of survivin mRNA was about 1.5 fold higher in docetaxel-treated cells than control cells and the difference detected 48 hrs after docetaxel treatment was statistically significant (Student's t-test, P< 0.05 for both MCF-7 and MDA-MB-231 cell lines). It was also found a similar level of increase in the level of survivin mRNA detected by Real time RT PCR compared to survivin MB detection and the level of increase in survivin protein after docetaxel treatment (Fig. 5b; insert is Real-time RTPCR result.). One of the important issues to be addressed in developing an oligo-based approach for detecting gene expression in viable cells is whether the binding of the MB probes to their target RNA leads to degradation of the mRNA by RNAase H, which may affect the level of target mRNA [27]. To answer this question, breast cancer cells were transfected with either survivin MB or control GAPDH MB for 24 hrs, and then examined the level of survivin protein by Western blot analysis. It was found that compared to cells transfected with a non-specific GAPDH MB, presence of the survivin MB in the cells did not have a significant effect on the level of survivin protein (Fig. 5c). At present, the mechanisms for retaining the level of survivin protein in survivin MB-transfected cells are still to be determined.

Accordingly, a novel MB-based molecular imaging approach that allows identification of tumor cells expressing specific marker genes has been developed. It is demonstrated that survivin and cyclin Dl MBs can be used to detect breast cancer cells and to determine the relative level of gene expression in viable cancer cells.

Human cancers contain heterogeneous cell populations with various genetic changes [28]. Simultaneous detection of over-expression of several tumor marker genes, especially when a single cell expresses more than one marker gene, may have a high predicative value for identifying cancer cells, and therefore increase the sensitivity and specificity of cancer detection. Since MB is highly specific in detecting target mRNAs, and MBs targeting various genes can be labeled with different fluorescent-dye molecules and delivered into single cells, expression of several tumor marker genes in a single cell can be analyzed at the same time. Using MBs targeting survivin and cyclin Dl mRNAs, it has been demonstrated that delivery of a mixture of survivin and cyclin Dl MBs into fixed cells produced fluorescent signals in breast cancer cells but not in normal breast cells. Interestingly, the fluorescence intensities in the cells correlated well with the level of the gene expression in different tumor cell lines. Previous methods for detecting gene expression in situ were not quantitative since the signals were amplified by either the presence of multiple fluorescent-dye labeled nucleotides in an oligonucleotide probe or amplification of the signals with secondary antibodies to labeled nucleotides. Since each MB has only one fluorophore and unbound MBs do not fluoresce, the fluorescence intensity generated by hybridization of the MB with a specific mRNA should reflect more accurately the level of the mRNA expressed in the cells.

The quantitative measurement of mRNA levels by MBs is important for the future use of this technology for cancer cell detection since many tumor marker genes are not unique to cancer cells and the difference between normal and cancer cells can be only the level of gene expression. Although two MBs are used to detect the expression of tumor marker genes, a proof of principle from this study will lead to the use of more MBs with multiple dye molecules to analyze the expression of several tumor genes. Additionally, since only a small amount of abnormal cells are present in a large amount of normal cell background in clinical samples, there is a clear advantage of direct fluorescence imaging of individual cells expressing tumor marker genes for early detection of cancer cells compared to conventional RT-PCR to amplify the expression of tumor marker genes from isolated total RNA, which may be difficult to detect the differences in the level of gene expression in a few cancer cells over the normal background.

Current methods for the identification and classification of cancer cells from clinical samples rely on examining the morphology of the cells or immunostaining with antibodies for tumor-related protein markers. Although the in situ hybridization using labeled linear probes has been used to detect gene expression on tissue sections, it is very time-consuming and usually accompanied by a high background since unbound probes also produce fluorescent signals. It was found that MBs could be used to detect the expression of genes on frozen tissue sections. The procedure is novel yet simple and results can be examined within 30 to 60 minutes without the extensive staining and washing steps as required by the in situ hybridization protocol. Demonstration of the feasibility of combining the MB and immunofluorescence approaches to examine the levels of gene expression and protein in situ in the same cell population makes its potential application in pathological diagnosis of human cancers more appealing. At present, MB technology has been mainly used in various applications in vitro, which were performed in solutions with defined MB-target conditions. For example, MBs targeting a breast cancer gene BRCA 1 were coated on a miniature biochip to detect the presence of BRCA 1 in solution [29]. Although previous studies showed the feasibility of detecting mRNAs and monitoring the transportation of RNAs in cells, the procedure for delivery of the MBs through microinjection into individual cells or by liposome delivery has made it difficult to apply this technology into broad research areas or into a routine clinical procedure [9-12]. This MB-based and high throughput procedure is developed for the detection of gene expression in viable cells. It was demonstrated that transfecting survivin MB into cells produced a strong fluorescent signal in survivin-expressing tumor cells and the level of survivin gene expression could be monitored real-time in cells either by FACScan or by using a fluorescence microplate reader. Using these methods, an increase in the level of survivin gene expression following EGF and docetaxel treatment was detected. Although GAPDH MB was used as an internal control for the experiments, simultaneous detection of survivin and GAPDH gene expression real time in viable cells indicated that it was also feasible to monitor the levels of expression of several genes in the same cell population using MBs labeled with different fluorophores.

One concern in the delivery of unmodified MBs to viable cells is that the MBs may be digested by nucleases in the cells or non-specific interaction between MBs and cellular proteins may open up the stem of the MBs, resulting in non-specific fluorescence. However, the results showed that the fluorescence intensity detected either by FACScan or microplate reader correlated well with the level of survivin mRNA in the tumor cells. Since a similar level of the MBs in a mixture of survivin and GAPDH MBs was delivered into the tumor cells, it seemed that increases in the fluorescence intensity in EGF and docetaxel treated cells or a decrease in p53 expressing cells were not due to non-specific degradation of the MBs. It was demonstrated that MB imaging of tumor cells is a simple and specific approach for the detection of breast cancer cells. The present invention is the first to apply state of the art MB-based methodology for cancer cell detection and for real time monitoring the level of expression of tumor marker genes in viable cells. Based on this invention, high throughput assays for measuring the expression of multiple genes critical for drug response can be developed for screening cancer drugs that target specific molecules or pathways in cancer cells. To increase the specificity of MB detection, the MBs can be further modified to make them resistant to nuclease or RNAase H, such as by using 2'0-Methyl MB probes, or detecting fluorescence resonance energy transfer from two MBs that hybridize to nearby mRNA sequences [12]. EXAMPLE 2:

MOLECULAR BEACON IMAGING OF TUMOR MARKER GENE EXPRESSION FOR DETECTION OF PANCREATIC CANCER CELLS

MATERIALS AND METHODS:

Human Tumor and Normal Cell Lines: Pancreatic cancer cell lines PANC-I, Capan-2, MIA PaCa-2 and BXPC-3 were obtained from the American Type Culture Collection (ATCC, Manassas, VA). The primary normal human dermal fibroblast cell line HDF was purchased from the Emory University Skin Disease Center (Atlanta, GA). BXPC-3 and PANC-I cell lines were cultured in RPMI- 1640 medium and MIA PaCa-2 cells were cultured in DMEM medium. The Capan-2 cell line was cultured in McCOY' 5 A medium. All the above media were from Mediatech, Herndon, VA and supplemented with 10% fetal bovine serum (FBS) (Hyclone, Logan, UT), 2 mM L-glutamine, 100 IU/ml penicillin and 100 μg/ml streptomycin. The FfDF cell line was maintained in DMEM medium with 20% FBS.

Human Normal and Pancreatic Cancer Tissues: Frozen human pancreatic cancer and normal tissues were obtained according to an approved IRB protocol at Emory University from pancreatic cancer patients during surgery to remove the tumor. The paired pancreatic cancer and normal tissues were collected by pathologists at Emory University, frozen immediately in liquid nitrogen and stored in a -80 ⁰C freezer until further study.

Detection ofK-ras Mutation: Genomic DNA samples from pancreatic cancer cell lines and tissues were isolated using a Wizard Genomic DNA Purification Kit (Promega, Madison, WI). Since the human pancreatic cancer tissues consisted of a mixture of normal and cancer cells, a mutant-enriched PCR was used to determine the presence and type of mutant K-ras gene in the pancreatic cancer tissues [45]. 1 μg of DNA samples were amplified by PCR using a K-ras exon 1 primer pair designed to enrich the mutant K-ras gene. K-ras primers were: K-ras forward, 5'- GAGAGAATTCT AT AAACTTGTGGTAGTTGGACCT-S' and K-ras reverse, 5'- GAGAGAATTCATCTGTATCAAAGAATGGTC-S'. The bold region of the primer pair was an EcoR 1 site for cloning the PCR products. The underlined base contained a G to C mutation that created a BstNl restriction site (5'-CCTGG-3') if a wild type K-ras (GGT) exon 1 region was amplified. When the K-ras gene was mutated at codon 12 from wide type GGT to GAT, GTT or TGT, this abolished the BstNl restriction site. Therefore, after BstNl enzyme digestion, PCR fragments derived from the wild type gene were cut and lost their binding sequences for K-ras forward primer. As a result, only PCR products containing a mutant K-ras gene could be further amplified by the K-ras primer pair. Following the second PCR amplification, PCR fragments were further digested by BstNl and EcoR 1. The resulting fragments were purified by gel electrophoresis and cloned into pcDNA 3 (-) plasmid (Invitrogen, Carisbad, CA). The plasmids were then transformed into Top 10 E. coli competent cells (hi vitro gen) and positive clones were selected. After PCR amplification of the K-ras fragments from the selected clones, PCR products were sequenced in the DNA Sequence Core Facility at Emory University.

Design and Synthesis of MBs for Detection ofmRNAs: The designs of MBs targeting mutant K-ras and survivin mRNAs are shown in Table 1. For each MB design, the sequence of one arm of the stem and the loop region of the MBs was complementary to a segment of its target gene. In Table 1, the underlined bases were those added to form a stem. K-ras MBl, K-ras MB2 and survivin MBs were synthesized by MWG Biotech Inc. (High Point, NC). A Cy3, Texas-red or FITC fluorophore was conjugated to the 5 '-end of the oligonucleotide and a quencher, 4- ({4'-(dimethylamino)phenylazo) benzoic acid (Dabcyl), was linked to its 3'- end.

Table 1 : Design of molecular beacons for detection of expression of mutant K-ra and survivin genes and corresponding target sequences.

MBs Target sequences Design of the MBs

K-ras MBl K-ras codon 12 GGT to GAT 5'-Cv 3-CCTACGCCATCAGCTCCGTAGG-Dabcyl-3' mutation

K-ras MB2 K-ras codon 12 GGT to GTT 5'-Texas-red -CCTACGCCAACAGCTCCGIAGG-Dabcyl-3' mutation

Survivin Survivin cDNΛ from 27 to 43 5'-Cy3-CTGAGAAAGGGCTGCCAGTCI£AG.-Dabcyl-3' MB-Cy3 nucleotide

Survivin Survivin cDNA from 33 to 50 5'-FITC-TGGTCCTTGAGAAAGGGCGA£CA-Dabcyl-3' MB-FITC nucleotide

GAPDH GAPDH cDNA from 504 to 5'-Cv3-GAGTCCTTCCACGATACCGACTC-Dabcvl-3'

MB 521 nucleotide

Determination of Specificity of the MBs in Solution: The oligonucleotide targets for each MB, shown in Table 1, were synthesized at Integrated DNA Technologies, Inc. (Coralville, IA). Two methods were used to determine the specificity of the MBs: (i) Examination of binding of the MBs to specific DNA targets using a fluorescence microplate reader. 200 nM of MBs were mixed with 1 μM of oligonucleotide targets in 100 μl of Opti-MEM medium (Invitrogen) in 96-well plates. After incubation at 37 ⁰C (survivin MB) or 45 ⁰C (K-ras MB) for 60 minutes, fluorescence intensity in each well was measured by a fluorescence microplate reader (Bioteck FL600 Fluorometer, Winooski, VT). (ii) Detection of thermal profile of the MB/target hybridizations using a thermal cycler. The thermal profiles of K-ras MBs hybridizing to their oligonucleotide targets or non-specific targets were examined using a BioRad iCycler (BioRad Laboratories, Hercules, CA). 200 nM of K-ras MB were mixed with 1 μM of various DNA targets in 50 μl of Opti-MEM medium. The relative fluorescence unit was then measured at temperatures ranging from 15 to 80 ⁰C. Specifically, the temperature was first held at 95 ⁰C for 3 minutes. After the first cycle of 80 ⁰C for 10 minutes, the fluorescence intensity was recorded at the end of the cycle. The temperature was decreased by 5 ⁰C increments to 15 ⁰C with each step lasting for 10 minutes. Cy 3 or Texas-red fluorescent dye was used as an internal control to correct for intrinsic changes of fluorescence with temperature.

Specific Detection of Mutant K-ras and Survivin Gene Expression in Pancreatic Cancer Cells Using the MBs: For the detection of gene expression in fixed cells, human pancreatic cancer cell lines, PANC-I, Capan-2, MIA PaCa-2 and BXPC-3, and the control normal cell line HDF were plated on chamber slides and then fixed with ice-cold acetone for 8 minutes. After air drying, the slides were stained immediately or stored in a -80 ⁰C freezer until use. A mixture of 200 nM of survivin MB and 50 nM of K-ras MBl or K-ras MB2 diluted in Opti-MEM medium was incubated with the fixed cells at 45 ⁰C for 60 minutes. The slides were washed briefly with PBS and examined under a confocal microscope (LSM 510 Meta, Carl Zeiss Microimaging, Inc., Thornwood, New York). The fluorescent images were taken using the same instrument setting for each color.

For detection of the cancer cells expressing tumor marker genes in human cancer tissues, 5 μ frozen sections of pancreatic normal and cancer tissues, fixed with ice-cold acetone for 8 minutes, were incubated with 100 to 200 nM of the MBs for 60 minutes and then counterstained with 10 μg/ml Hoechst 33342 (Molecular Probes, Eugene, OR). The slides were observed under a Nikon fluorescence microscope (Nikon Eclipse E800, Nikon Instrument Inc. Melville, New York). Fluorescence images were taken using Optronics Magnafire digital imaging system (Meyer Instrument, Houston, Texas). Real-Time Reverse Transcription-PCR: Total RNAs from pancreatic cancer and normal cell lines were isolated using RNA Bee kit (Tel-test, Friendswood, Texas). 2 μg of RNA samples were amplified with an Omniscript RT kit using an oligo dT primer (QIAGEN Inc, Chatsworth, California) to generate 20 μl of cDNAs. 1 to 2 μl of cDNA was then quantified by Real Time PCR with primer pairs for K-ras exon 1 or /3-actin using QuantiTect SYBR Green PCR kit (QIAGEN Inc., Valencia, California) and detected by Bio-Rad iCycler (BioRad Laboratories). The primer pairs for detection of K-ras gene expression were El Forward 5'- AT AAACTTGTGGTAGTTGGAGCT-S' and E2 Reverse, 5 'CACAAAGAAAGCCCTCC CCA-3'. Amplification of the /3-actin gene was used as an internal control for Real-time RT-PCR. The primer pairs for the /3-actin gene were 0-actin forward, 5 '-AAAGACCTGTACGCCAACACAGTGCTGTCTGG-S' and /3-actin reverse, 5'-CGTCATACTCCTGCTTGCTGATCCACATCTGC-S'. The starting quantity of PCR products from amplification of the K-ras gene was standardized with the starting quantity of /3-actin products for each sample to obtain the relative level of gene expression.

Immunofluorescence Staining: Frozen sections of normal and cancer tissues from pancreatic cancer patients were incubated with a goat anti-human survivin antibody (Santa Cruz Biotechnology, Santa Cruz, California) or a mouse monoclonal anti-cytokeratin 8 antibody (Sigma-Aldrich, St. Louis, Missouri) for 1 hour. After washing with PBS, the slides were incubated with either biotin-coηjugated donkey anti-goat or anti-mouse secondary antibody for 1 hour and then strept-avidin-FITC for 30 minutes (Pierce, Rockford, Illinois). The slides were then examined under a Nikon fluorescence microscope.

RESULTS AND DISCUSSION:

Detection ofK-ras Mutations in Pancreatic Cancer Cell Lines and Tissues by DNA Sequencing: Although previous publications showed types of K-ras mutations in pancreatic cancer cell lines, K-ras mutations in the cancer cell lines were examined to confirm the presence of specific K-ras mutations in the cells [46, 47]. Whether and which K-ras mutations were present in pancreatic cancer tissues from patients were also determined, using a mutant-enriched PCR procedure as described above. Consistent with previous reports, it was found that the PANC-I cell line has a

K-ras codon 12 GGT to GAT mutation. The Capan-2 cell line had a GGT to GTT mutation. The BXPC-3 cell line contained a wild type K-ras gene (Table 2). The K- ras mutation in the MIA PaCa-2 cell line was referenced from previous studies [46, 47]. The results from analysis of genomic DNA isolated from pancreatic cancer tissues by the mutant-enriched PCR and DNA sequencing demonstrated the presence of K-ras codon 12 mutations in the DNA samples from pancreatic cancer patients as shown in Table 2. Analysis of types of K-ras mutations of pancreatic cancer patients from five previous studies showed that K-ras codon 12 GGT to GAT and GGT to GTT mutations was the most common types of K-ras mutations. Over 75 % of the cancer patients have one of these mutations (Table 2) [38, 46, 48-50]. Therefore, K- ras MBs targeting K-ras codon 12 GGT to GAT (K-ras MBl) or GGT to GTT mutation (K-ras MB2) were designed and synthesized to evaluate the feasibility of identifying pancreatic cancer cells by MBs.

Percentage of each K-ras codon 12 mutation in pancreatic cancer tissues was summarized from five studies [38, 47-51]. ^b)Types of K-ras point mutation in PANC-I, Capan-2 and BXPC-3 cell lines were confirmed in our laboratory by sequencing genomic DNA, which was consistent with the previous reports [47, 48]. ^c)Presence of K-ras mutations in pancreatic cancer tissue samples collected in the laboratory was determined by the mutant-enriched PCR.

K-ras and Survivin MBs Bound Specifically to Their Oligonucleotide Targets in Solution: To determine the specificity of the MBs, the binding of the MBs to their DNA targets in vitro were examined and the specificity of the binding were evaluated by measuring changes of fluorescent signal after incubating the MBs with corresponding and control DNA targets. After mixing K-ras MBl or MB2 with K-ras wild type (WT), Mut 1 (GGT to GAT) or Mut 2 (GGT to GTT) target, the fluorescence intensity in each group was measured with a fluorescence microplate reader. It was found that a stronger fluorescent signal was produced (1.7-3.4 folds) when the K-ras MBs were mixed with their specific K-ras mutant targets, compare to non-specific targets (Fig. 6a). Further, the K-ras MBs were highly specific to K-ras DNA target. The relative fluorescence units in K-ras MBl or MB2 mixed with their specific mutant K-ras targets were 51 to 68 fold higher than K-ras MBs mixed with survivin DNA targets (Fig. 6a). About 4-fold higher fluorescence intensity was also detected in survivin MB mixed with its oligonucleotide target as compared with other groups (Fig. 6a). The results from this study demonstrated that K-ras and survivin MBs bound to specific oligonucleotide sequences and produced strong fluorescent signals in vitro. In addition, K-ras MBs differentially bound to K-ras targets with a single base mutation.

To determine optimal hybridization temperatures for K-ras MBs, the effect of temperature on specific binding of the MBs to DNA targets were examined. Using a thermal cycle, changes of the fluorescence signal at temperatures ranging from 15 to 80 ⁰C after mixing the K-ras MBs with different DNA targets were monitored. It was found that in solution, K-ras MBl selectively hybridized to K-ras Mut 1 while K-ras MB2 preferentially bound to K-ras Mut 2 DNA target at temperatures ranging from 15 to 55 ⁰C (Fig. 6b). Both K-ras MBs showed a low binding affinity with K-ras WT or non-specific mutant K-ras target. However, when the temperature was over 55 ⁰C, K-ras MBs began to dissociate from their targets and the stem of the MBs started to break apart, resulting in increased fluorescent signal in the mixtures of K-ras MBs and non-specific DNA targets (Fig. 6b).

The results of this study demonstrated that K-ras MB was able to recognize a single base change in oligonucleotide targets and that it is feasible to use MBs for detecting expression of mutant K-ras and survivin genes in pancreatic cancer cells.

Delivery of K-ras and Survivin MBs Produced Fluorescent Signals in Pancreatic Cancer Cells Expressing Mutant K-ras And Survivin Genes: Although the thermal profile of the K-ras MBs in solution showed that the MBs selectively bound to specific K-ras mutant targets at temperature ranging from 15 to 55 ⁰C, initial study on the pancreatic cancer cell lines suggested that incubation of the fixed cells with K- ras MBs at lower temperature, such as below 37 ⁰C, produced a high background fluorescence in the cells expressing a wild type or nonspecific K-ras mRNA (data not shown). The background was significantly reduced when the incubation temperature was raised to 42 to 50⁰C. Therefore, incubation temperatures of 45 to 50 ⁰C were used for the study. Since pancreatic cancer cells consist of heterogeneous cell populations that express different tumor markers, it is important to develop a method that can detect the expression of several tumor marker genes simultaneously in single cells. The feasibility of detection of both mutant K-ras and survivin mRNA in single cells were examined. The mechanism of the action for the detection of pancreatic cancer cells using K-ras and survivin MBs is illustrated in Fig. 7a. Acetone-fixed pancreatic cancer and normal cells were incubated with a mixture of 50 nM of either K-ras MBl (Cy3) or MB2 (Texas-red) and 200 nM of survivin MB (FITC) at 45 ⁰C for 60 minutes. After a brief wash, the slides were observed under a confocal microscope. It was found that K-ras MBs preferentially produced strong fluorescent signals in the pancreatic cancer cells with specific K-ras mutations. As shown in Fig. 7b, after incubation of K-ras MBl with PANC-I and Capan-2 cells, a stronger fluorescent signal was produced in PANC-I cells that contained a GGT to GAT mutation compared to Capan-2 cells that expressed a GGT to GTT mutant K-ras mRNA. On the other hand, brighter fluorescence was observed in Capan-2 cells after incubation with K-ras MB2, which detected a GGT to GTT mutation (Fig. 7b) compared to PANC-I cells. The specificity of the K-ras MBs on pancreatic cancer cell lines that express a different type of mutant K-ras gene or contain a wild type K-ras mRNA were further examined. It was found that incubation of either K-ras MBl or MB2 with MIA PaCa-2 cell line, which expresses a GGT to TGT mutant K-ras gene, did not generate a strong fluorescence signal in the cells (Fig. 7b). Moreover, BXPC-3 cells expressed a wild type K-ras gene and both K-ras MBs failed to generate a strong fluorescent signal in these cells. In addition, normal cell line HDF was also negative after incubation with both K-ras MBs (Fig. 7b). However, regardless of fluorescence intensities generated by K-ras MBs, simultaneous delivery of survivin MB into the pancreatic cancer cells produced intermediate to strong green fluorescence in all tumor cell lines but not in normal HDF cell line (Fig. 7b). In PANC-I and Capan-2 cells, which have both survivin and mutant K-ras gene expression, both green and red fluorescence signals were observed, suggesting that MBs were able to examine the expression of multiple genes simultaneously in single cells.

The fluorescence intensity from the images taken from the confocal microscope was further quantified. The results confirmed the microscopic observation. After incubating with K-ras MBl, the mean fluorescence intensity in PANC-I cells was 3.5, 5.2, 7.3 or 11 fold higher than that detected in BXPC-3, Capan-2, MIA PaCa-2 or HDF cells respectively. On the other hand, delivery of K- ras MB2 produced a high level of fluorescence in Capan-2 cells, which was 3, 9, 11, or 20 fold higher than that detected in PANC-I , BXPC-3, HDF or MIA PaCa-2 cells respectively (Fig. 8a).

To determine that differential fluorescent signals in pancreatic cancer cells produced by the K-ras MBs were indeed due to the specific binding of the MBs to mutant K-ras transcripts but not to differences in the levels of K-ras gene expression, K-ras gene expression in pancreatic cancer cell lines were examined by Real Time RT PCR. High levels of K-ras mRNA were detected in PANC-I, Capan-2 and MIA PaCa-2 cell lines (Fig. 8b). However, the cell lines expressing a wild type K-ras, such as BXPC-3 and HDF, showed a low level of K-ras gene expression. Since a high level of K-ras mRNA were detected in MIA PaCa-2 cells that had a low level of fluorescence signal after incubation with both K-ras MBl and MB2, it is unlikely that the difference in fluorescence intensity detected in those cell lines was entirely the result of levels of gene expression, hi addition, the detection of strong fluorescent signals in Capan-2 cells by K-ras MB2 but not K-ras MBl or in PANC-I cells by K- ras MBl but not K-ras MB2 further supported the conclusion. The results of this study demonstrated that K-ras MBs bound selectively to mutant K-ras mRNA and generated a strong fluorescent signal in pancreatic cancer cells.

K-ras and Survivin MBs Being Able to Detect Cancer Cells in Frozen Tissue Sections: At present, the pathological diagnosis of pancreatic cancer mainly depends on morphological classification and immunohistochemical staining with tissue or tumor markers. Development of novel and simple approaches for the detection of cancer cells by examining the expression of multiple tumor marker genes on the same tissue section may increase the sensitivity and specificity. To address this issue, the feasibility of detecting cancer cells on frozen tissue sections using the MBs were examined. Frozen tissue sections of paired pancreatic normal and cancer tissues were incubated with 100 nM of either K-ras MBl or MB2 for 60 minutes. The slides were observed under a fluorescence microscope. Results from examination of tissue samples from five pancreatic cancer patients showed that K-ras MBs were able to detect cancer cells expressing specific mutant K-ras mRNAs on frozen tissue sections. For example, cells with red fluorescence on frozen sections of cancer tissues were detected from patient No. 1 and No. 2, who had a GGT to GAT mutant K-ras gene, after incubation with K-ras MBl (GGT to GAT) but not K-ras MB2 (Fig. 4 A). On the tissue sections from patient No. 5, who had a K-ras codon 12 GGT to GTT mutation, the cells with a bright fluorescence signal were detected after incubating with K-ras MB2 but not K-ras MBl (Fig. 9a). However, examination of paired normal pancreatic tissue from patient No. 1 after incubating the K-ras MBl or patient No. 5 following delivery of K-ras MB2 failed to detect any cells with strong fluorescent signals (Fig. 9a).

The feasibility of detection of survivin gene expression in pancreatic cancer tissues by survivin MB was also examined. At first, expression of survivin in pancreatic cancer tissues was demonstrated by immunofluorescence staining with an anti-survivin antibody. It was shown that survivin protein was highly expressed in pancreatic cancer tissues but was undetectable in normal pancreas (Fig. 9b). Next, the frozen tissue sections from cancer and normal tissues were incubated with survivin MB-FITC for 60 minutes and observed under a fluorescence microscope. A high level of fluorescence signal was detected in the cancer cells on the frozen sections of pancreatic cancer but not in normal tissues (Fig. 9b). Immuofluorescence staining with an anti-cytokeratin 8 antibody showed that survivin-expressing cells on frozen sections were epithelial-type cancer cells in pancreas (Fig. 9b).

The results with in situ detection of tumor marker gene expression in pancreatic cancer tissues indicate that MB-imaging of tumor marker genes may provide a simple and specific means for pathologists to identify cancer cells on frozen tissue sections or other sources of clinical samples, such as fine needle aspirates and cellular fraction of body fluids.

Increasing evidence has indicated that molecular beacons have a great advantage in detecting specific oligonucleotide sequences compared to linear probes [4,51]. The design of MBs allows specific binding of the MBs to their target nucleotide sequences and reports the hybridization by generating a fluorescent signal without the separation of unbound probes from the MB-target complex since free MBs do not fluoresce. Therefore, MBs should be an excellent tool for detecting specific nucleotide sequences, such as mRNA and DNA, with a high signal to noise ratio in intact cells as well as in solution. The ability of the MB probes to detect specific target molecules without the washing-away or separation of unbound probes also allowed one to detect intracellular mRNA molecules. It has been shown that the detection limit of preformed MB/β-actin mRNA duplexes microinjected into the cells was 10 mRNA molecules, suggesting that MB technology is a very sensitive method for detecting mRNAs in cells [9]. Although previous studies have shown that it is feasible to detect mRNAs in cells using MBs [9-11, 13], the significance of using this technology to address issues in cancer research and clinical applications has not been explored. Methods of applying MB technology for clinical research have yet to be developed.

In the present invention, a simple yet novel MB approach for the detection of pancreatic cancer cells was developed. The MBs targeting tumor marker mRNAs that are found in pancreatic cancer, such as mutant K-ras and survivin were designed. From the study of pancreatic cancer cell lines and tissues, it was demonstrated that the K-ras MBs selectively bound to mutant K-ras mRNAs in fixed cancer cells, resulting in strong fluorescence signals in the cells. Previous studies on mutation detection by MBs were carried out in solution. It has been shown that properly designed MBs can detect single base mutations in intact cells. By optimizing hybridization conditions such as temperature, buffer condition, MB concentration and method and time of fixation, a high fluorescent signal in cancer cells expressing specific mutant K-ras mRNA could be achieved and the background or nonspecific fluorescence in cells expressing a different type of mutant K-ras mRNA or containing a wild type K-ras gene could be reduced. Although only 2 to 3 fold higher fluorescence intensity in solution were detected when K-ras MBs mixed with specific mutant K-ras DNA target than that mixed with non-specific K-ras target, 3 to 20 fold higher levels of differences were observed when K-ras MBs were delivered into the cells expressing specific mutant K-ras mRNA compared to the cells expressing a wild type or nonspecific K-ras gene. It is possible that a higher level of fluorescent signal observed in the cells expressing specific K-ras mRNA is due to different hybridization dynamics between a K-ras MB with a short DNA target and a K-ras MB with an mRNA molecule inside a cell. In addition, results of Real time RT PCR showed that the levels of K-ras gene expression in pancreatic cancer cells with K-ras mutations were higher than the cells expressing a wild type K-ras gene. It is also possible that the difference in fluorescence intensity was further enhanced in the cells with a high level of mutant K-ras gene expression. During last decade, extensive studies have been carried out to detect K-ras mutations in blood, pancreatic juice and cancer tissue samples from pancreatic cancer patients using PCR or mutant-enriched PCR [38, 52]. Utilization of MBs to detect K- ras mutations specifically in PCR products of DNA samples isolated from lung cancers has been reported [53]. Although identification of K-ras mutations by PCR is a fairly sensitive molecular approach, the procedures for PCR and subsequent assays for the identification of mutations are very time-consuming, making them difficult as a routine clinical procedure. A major advantage of using an MB-based approach as compared to PCR and immunohistochemistry is that a mixture of MBs targeting multiple tumor-specific mRNAs can be delivered into single cells at the same time, and the expression of all these markers can be observed in a single assay using a fluorescence microscope. hi addition, K-ras mutations were also found in 30-40% of patients with pancreatic duct cysts or chronic pancreatitis [54, 55]. A better way to identify a cancer cell is to detect expression of mutant K-ras gene together with several other tumor marker genes. The expression of another tumor marker gene, survivin, in pancreatic cancer cell lines using an MB targeting survivin mRNA was examined. Since survivin is not found in normal pancreatic tissues but is highly expressed in over 70% of pancreatic cancer tissues including early stage carcinomas [43], a combination of the detection of survivin with mutant K-ras mRNAs may further enhance specificity of the detection. It has been demonstrated that delivery of survivin MBs into cells produced a strong fluorescent signal in cancer cells but not in normal cells. A mixture of survivin and K-ras MBs generated different fluorescent signals in pancreatic cancer cell lines expressing survivin and/or specific mutant K-ras mRNA. To detect pancreatic cancer cells in clinical samples, it is important to identify a few abnormal cells that are mixed with large amounts of normal cells. MB- imaging individual cells expressing tumor marker genes may allow the detection of those cancer cells. In the present invention, it has been shown that it is doable to identify pancreatic cancer cells through detection of both mutant K-ras and survivin mRNAs using the MB-technology. This technology offers an opportunity to detect specific expression of several tumor marker genes in single cells by a simple staining. The results demonstrated that the MBs could be used for determination of the presence of mutations in tumor suppressor genes or oncogenes as well as for the examination of expression of tumor marker genes in the cancer cells, hi order to detect point mutations, it is necessary to synthesize the MBs that are specific for each mutation in the gene. Thus, a limitation of using MBs is that it is best for genes with a few hot- spot mutations, such as K-ras codon 12 mutations in pancreatic cancers. However, the ability of MBs to detect the expression of genes that are highly expressed in tumor cells but lacking or low in normal cells, such as the survivin gene, should allow the development of approaches for detecting cancer cells in many common types of human cancers. Traditional methods for classifying the cancer cells on tissue sections or aspirates of fine needle biopsy involve thorough examination of the morphology of the cells after H&E staining or immunostaining with antibodies for cellular and tumor-related protein markers. Although in situ hybridization method has been used to detect gene expression on tissue sections, it is very time-consuming and usually involves high background expression since unbound probes also produce a fluorescent signal, hi the present invention, it was found that MBs could be used to detect the expression of tumor marker genes and to identify specific mutations on frozen tissue sections. The procedure for the detection of mRNA by MBs is very simple and the results can be observed within one hour after a brief washing without extensive washing steps and days of procedures as required by in situ hybridization protocol. Development of this MB approach for detection of gene expression on tissue section should provide us with a new method to identify and classify the types of cancer cells on tissue sections, aspirates from fine needle biopsy, blood and exfoliated cells in body fluids. In summary, a simple yet novel MB approach to examine the expression of tumor marker genes in human cancer cells has been developed. It has been demonstrated that MBs can be used to identify cancer cells expressing oncogenes with point mutations as well as overexpressing tumor marker genes. The results of the study indicate that molecular imaging of cancer cells with MBs has great potential for the development of a simple and specific procedure for cancer detection.

The foregoing description of the exemplary embodiments of the invention has been presented only for the purposes of illustration and description and is not intended to be exhaustive or to limit the invention to the precise forms disclosed. Many modifications and variations are possible in light of the above teaching.

The embodiments were chosen and described in order to explain the principles of the invention and their practical application so as to enable others skilled in the art to utilize the invention and various embodiments and with various modifications as are suited to the particular use contemplated. Alternative embodiments will become apparent to those skilled in the art to which the present invention pertains without departing from its spirit and scope. Accordingly, the scope of the present invention is defined by the appended claims rather than the foregoing description and the exemplary embodiments described therein.

LIST OF REFERENCES:

[ 1 ] Hanahan, D. & Weinberg, R. A. The hallmarks of cancer. Cell 100, 57-70

(2000). [2] Dickson, R.B.a.L., M. E. in Principles and practice of Oncology, (ed. S.H. V.T.J. DeVita, and S.A. Rosenberg) 1633-1645 (Lippincott Williams & Wilkins, Philadelphia; 2001). [3] Nathanson, K.L., Wooster, R., Weber, B. L. & Nathanson, K.N. Breast cancer genetics: what we know and what we need. Nat Med 7, 552-556 (2001). [4] Tyagi, S. & Kramer, F.R. Molecular beacons: probes that fluoresce upon hybridization. Nat Biotechnol 14, 303-308 (1996).

[5] Bonnet, G., Tyagi, S., Libchaber, A. & Kramer, F.R. Thermodynamic basis of the enhanced specificity of structured DNA probes. Proc Natl Acad Sd USA 96, 6171-6176 (1999). [6] Tan, W., Fang, X., Li, J. & Liu, X. Molecular beacons: a novel DNA probe for nucleic acid and protein studies. Chemistry 6, 1107-1111 (2000). [7] Tyagi, S., Bratu, D.P. & Kramer, F.R. Multicolor molecular beacons for allele discrimination. Nat Biotechnol 16, 49-53 (1998).

[8] Heyduk, T. & Heyduk, E. Molecular beacons for detecting DNA binding proteins. Nat Biotechnol 20, 171-176. (2002).

[9] Sokol, D.L., Zhang, X., Lu, P. & Gewirtz, A.M. Real time detection of

DNA.RNA hybridization in living cells. Proc Natl Acad Sd USA 95, 11538- 11543 (1998). [ 10] Dirks, R. W., Molenaar, C. & Tanke, HJ. Methods for visualizing RNA processing and transport pathways in living cells. Histochem Cell Biol 115, 3-

11. (2001).

[11] Fang, X. et al. Molecular beacons: fluorogenic probes for living cell study. Cell Biochem Biophys 37, 71-81 (2002).

[12] Bratu, D.P., Cha, BJ., Mhlanga, M.M., Kramer, F.R. & Tyagi, S. Visualizing the distribution and transport of mRNAs in living cells. Proceedings of the

National Academy of Sciences of the United States of America 100, 13308-

13313 (2003). [13] Perlette, J. & Tan, W. Real-time monitoring of intracellular mRNA hybridization inside single living cells. Anal Chem 73, 5544-5550 (2001). [14] Weinstat-Saslow, D. et al. Overexpression of cyclin D mRNA distinguishes invasive and in situ breast carcinomas from non-malignant lesions. Nat Med 1,

1257-1260 (1995). [15] Altieri, D. C. Survivin and apoptosis control. Adv Cancer Res 88, 31-52

(2003). [16] Altieri, D. C. The molecular basis and potential role of survivin in cancer diagnosis and therapy. Trends MoI Med 7, 542-547. (2001). [17] Tanaka, K. et al. Expression of survivin and its relationship to loss of apoptosis in breast carcinomas. Clin Cancer Res 6, 127-134 (2000).

[18] Yang, L., Cao, Z., Yan, H. & Wood, W.C. Coexistence of high levels of apoptotic signaling and inhibitor of apoptosis proteins in human tumor cells: implication for cancer specific therapy. Cancer Res 63, 6815-6824 (2003). [19] Asanuma, K. et al. A role for survivin in radioresi stance of pancreatic cancer cells. Jpn J Cancer Res 93, 1057-1062. (2002).

[20] Zaffaroni, N. & Daidone, M.G. Survivin expression and resistance to anticancer treatments: perspectives for new therapeutic interventions. Drug

Resist Updat 5, 65-72. (2002).

[21] Baselga, J. & Norton, L. Focus on breast cancer. Cancer Cell 1, 319-322 (2002).

[22] Slamon, DJ. et al. Human breast cancer: correlation of relapse and survival with amplification of the HER-2/neu oncogene. Science 235, 177-182 (1987). [23] Brandt, R. et al. Mammary gland specific hEGF receptor transgene expression induces neoplasia and inhibits differentiation. Oncogene 19, 2129-2137 (2000).

[24] Favaloro, EJ., Moraitis, N., Bradstock, K. & Koutts, J. Co-expression of haemopoietic antigens on vascular endothelial cells: a detailed phenotypic analysis. Br J Haematol 74, 385-394 (1990).

[25] Ling, X., Bernacki, RJ., Brattain, M.G. & Li, F. Induction of survivin expression by taxol (paclitaxel) is an early event, which is independent of taxol-mediated G2/M arrest. J Biol Chem 279, 15196-15203 (2004). [26] Hoffman, W.H., Biade, S., Zilfou, J.T., Chen, J. & Murphy, M.

Transcriptional repression of the anti-apoptotic survivin gene by wild type p53. J Biol Chem 277, 32473257. (2002). [27] Rizzo, J., Gifford, L., Zhang, X., Gewirtz, A. & Lu, P. Chimeric RNA-DNA molecular beacon assay for ribonuclease H activity. MoI Cell Probes 16, 277.

(2002). [28] Perou, CM. et al. Molecular portraits of human breast tumours. Nature 406,

747-752 (2000). [29] Culha, M., Stokes, D.L., Griffin, G.D. & Vo-Dinh, T. Application of a miniature biochip using the molecular beacon probe in breast cancer gene BRCAl detection. Biosens Bioelectron 19, 1007- 1012 (2004).

[30] Boring CC, Squires TS, Tong T, Montgomery S: Cancer statistics, 1994. CA

Cancer JCHn 1994, 44:7-26 [31] Warshaw AL, Fernandez-del Castillo C: Pancreatic carcinoma. N EnglJMed

1992, 326:455-465 [32] Loeb LA: A mutator phenotype in cancer. Cancer Res 2001, 61 :3230-3239 [33] Kinzler KW, Vogelstein B: Lessons from hereditary colorectal cancer. Cell

1996, 87:159-170 [34] Frutos AG, Pal S, Quesada M, Lahiri J: Method for detection of single-base mismatches using bimolecular beacons. J Am Chem Soc 2002, 124:2396-2397 [35] Broude NE: Stem-loop oligonucleotides: a robust tool for molecular biology and biotechnology. Trends Biotechnol 2002, 20:249-256. [36] Fang X, Li JJ, Tan W: Using molecular beacons to probe molecular interactions between lactate dehydrogenase and single-stranded DNA. Anal

Chem 2000, 72:3280-3285. [37] Zhou W, Galizia G, Lieto E, Goodman SN, Romans KE, Kinzler KW,

Vogelstein B, Choti MA, Montgomery EA: Counting alleles reveals a connection between chromosome 18q loss and vascular invasion. Nat

Biotechnol 2001, 19:78-81

[38] Hruban RH, van Mansfeld AD, Offerhaus GJ, van Weering DH, Allison DC, Goodman SN, Kensler TW, Bose KK, Cameron JL, Bos JL: K-ras oncogene activation in adenocarcinoma of the human pancreas. A study of 82 carcinomas using a combination of mutant-enriched polymerase chain reaction analysis and allele-specific oligonucleotide hybridization. Am J Pathol 1993,

143:545-554 [39] Minamoto T, Mai M, Ronai Z: K-ras mutation: early detection in molecular diagnosis and risk assessment of colorectal, pancreas, and lung cancers—a review. Cancer Detect Prev 2000, 24:1-12 [40] Futakawa N, Kimura W, Yamagata S, Zhao B, Ilsoo H, Inoue T, Sata N,

Kawaguchi Y, Kubota Y, Muto T: Significance of K-ras mutation and CEA level in pancreatic juice in the diagnosis of pancreatic cancer. J Hepatobiliary

Pancreat Surg 2000, 7:63-71 [41] Deveraux QL, Roy N, Stennicke HR, Van Arsdale T, Zhou Q, Srinivasula SM,

Alnemri ES, Salvesen GS, Reed JC: IAPs block apoptotic events induced by caspase-8 and cytochrome c by direct inhibition of distinct caspases. Embo J 1998, 17:2215-2223.

[42] LaCasse EC, Baird S, Korneluk RG, MacKenzie AE: The inhibitors of apoptosis (IAPs) and their emerging role in cancer. Oncogene 1998, 17:3247-

3259.

[43] Satoh K, Kaneko K, Hirota M, Masamune A, Satoh A, Shimosegawa T: Expression of survivin is correlated with cancer cell apoptosis and is involved in the development of human pancreatic duct cell tumors. Cancer 2001,

92:271-278 [44] Sarela AI, Verbeke CS, Ramsdale J, Davies CL, Markham AF, Guillou PJ:

Expression of survivin, a novel inhibitor of apoptosis and cell cycle regulatory protein, in pancreatic adenocarcinoma. Br J Cancer 2002, 86:886-892.

[45] Apple SK, Hecht JR, Novak JM, Nieberg RK, Rosenthal DL, Grody WW: Polymerase chain reaction-based K-ras mutation detection of pancreatic adenocarcinoma in routine cytology smears. Am J Clin Pathol 1996, 105:321- 326

[46] Berrozpe G, Schaeffer J, Peinado MA, Real FX, Perucho M: Comparative analysis of mutations in the p53 and K-ras genes in pancreatic cancer. IntJ Cancer 1994, 58:185-191

[47] Moore PS, Sipos B, Orlandini S, Sorio C, Real FX, Lemoine NR, Gress T, Bassi C, Kloppel G, Kalthoff H, Ungefroren H, Lohr M, Scarpa A: Genetic profile of 22 pancreatic carcinoma cell lines. Analysis of K- ras, p53, pl6 and DPC4/Smad4. Virchows Arch 2001, 439:798-802.

[48] Rozenblum E, Schutte M, Goggins M, Hahn SA, Panzer S, Zahurak M, Goodman SN, Sohn TA, Hruban RH, Yeo CJ, Kern SE: Tumor-suppressive pathways in pancreatic carcinoma. Cancer Res 1997, 57:1731-1734

[49] Nomoto S, Nakao A, Ando N, Takeda S, Kasai Y, Inoue S, Kaneko T, Takagi H: Clinical application of K-ras oncogene mutations in pancreatic carcinoma: detection of micrometastases. Semin Surg Oncol 1998, 15:40-46

[50] Hruban RH, Sturm PD, Slebos RJ, Wilentz RE, Musler AR, Yeo CJ, Sohn TA, van Velthuysen ML, Offerhaus GJ: Can K-ras codon 12 mutations be used to distinguish benign bile duct proliferations from metastases in the liver? A molecular analysis of 101 liver lesions from 93 patients. Am J Pathol 1997, 151:943-949

[51] Bonnet G, Krichevsky O, Libchaber A: Kinetics of conformational fluctuations in DNA hairpin-loops. Proc Natl Acad Sci USA 1998, 95:8602- 8606

[52] Shibata K, Mori M, Kitano S, Akiyoshi T: Detection of ras gene mutations in peripheral blood of carcinoma patients using CD45 imrnunomagnetic separation and nested mutant allele specific amplification. Int J Oncol 1998, 12:1333-1338

[53] Clayton SJ, Scott FM, Walker J, Callaghan K, Haque K, Liloglou T, Xinarianos G, Shawcross S, Ceuppens P, Field JK, Fox JC: K-ras point mutation detection in lung cancer: comparison of two approaches to somatic mutation detection using ARMS allele-specific amplification. Clin Chem 2000, 46:1929-1938

[54] Queneau PE, Adessi GL, Thibault P, Cleau D, Heyd B, Mantion G, Carayon P: Early detection of pancreatic cancer in patients with chronic pancreatitis: diagnostic utility of a K-ras point mutation in the pancreatic juice. Am J Gastroenterol 2001, 96:700-704.

[55] Tabata T, Fujimori T, Maeda S, Yamamoto M, Saitoh Y: The role of Ras mutation in pancreatic cancer, precancerous lesions, and chronic pancreatitis. Int J Pancreatol 1993, 14:237-244.

[56] Dubertret et al., Nat Biotechnol 19:365-370 (2001). [57] Li et al., Nature 396: 580- 584 (1998). [58] Tamm et al., Cancer Research 58: 5315-5320 (1998). [59] Ambrosini et al, Nature Medicine 3: 917-921 (1997). [60] Z'graggen et al., Surgery 129: 537-545 (2001).

Claims

CLAIMSWhat is claimed is:

1. A method for detecting the level of gene expression in a sample of cells for cancer detection, comprising the steps of: a. providing a sample of cells; b. simultaneously delivering molecular beacons (MBs) targeting survivin and cyclin Dl mRNAs to the sample of cells so that fluorescent signals associated with the survivin and cyclin Dl mRNAs of the sample of cells can be obtained; and c. determining whether the sample of cells has viable cancer cells expressed in survivin and/or cyclin Dl mRNAs from the fluorescent signals.

2. The method of claim 1, wherein each of the MBs targeting survivin and cyclin Dl mRNAs is designed to possess a fluorophore of a unique color such that when one MB targets its corresponding mNRA, the fluorophore of the MB fluoresces, thereby generating a fluorescent signal associated with the corresponding mNRA in the unique color of the fluorophore of the MB in the sample of cells.

3. The method of claim 2, wherein the fluorescent signals associated with the survivin and cyclin Dl mRNAs are distinguishable by colors of the fluorescent signals.

4. The method of claim 3, wherein the sample of cells has viable cancer cells if the intensity of the fluorescent signals associated with one of the survivin and cyclin Dl mRNAs is no less than an intensity threshold.

5. The method of claim 4, wherein the sample of cells substantially has no viable cancer cells if the intensity of the fluorescent signals associated with each of the survivin and cyclin Dl mRNAs is less than the intensity threshold.

6. The method of claim 5, wherein the intensity threshold is predetermined.

7. The method of claim 6, wherein the intensity threshold may be dependent on the type of cancer.

8. The method of claim 1, wherein the intensity of the fluorescent signals of a sample of cells having viable cancer cells is stronger than the intensity of the fluorescent signals of a sample of cells having no viable cancer cells.

9. The method of claim 8, wherein the intensity of the fluorescent signals of a sample of cells having viable cancer cells is at least twice stronger than the intensity of the fluorescent signals of a sample of cells having no viable cancer cells.

10. The method of claim 9, wherein the sample of cells having viable cancer cells has viable breast cancer cells.

11. The method of claim 1 , further comprising the step of determining the relative level of gene expression in viable cancer cells from the intensity of the fluorescent signals of a sample of cells having viable cancer cells.

12. The method of claim 11 , wherein the intensity of the fluorescent signals of a sample of cells having viable cancer cells is corresponding to the level of the survivin and cyclin Dl mRNAs expressed in the sample of cells.

13. The method of claim 1, wherein the simultaneously delivering step comprises the step of delivering a mixture of survivin and cyclin Dl MBs into fixed cells.

14. The method of claim 1, wherein the sample is taken from at least one source of blood, urine, pancreatic juice, ascites, breast ductal lavage, nipple aspiration, needle biopsy or tissue.

15. The method of claim 14, wherein the tissue is a biopsy from the pancreas or breast.

16. The method of claim 14, wherein the tissue is a frozen section.

17. The method of claim 1 , wherein the sample is taken from a breast ductal lavage.

18. The method of claim 1 , wherein the sample is taken from pancreatic juice.

19. A diagnostic kit for detecting the level of gene expression in a sample of cells for cancer detection comprising a system suitable for carrying out the method of claim 1.

20. A method of detecting the level of gene expression in a sample of cells for cancer detection, comprising the steps of: a. providing a sample of cells; b. treating the sample of cells with molecular beacons (MBs) targeting tumor marker mRNAs that are found in a predetermined type of cancer so that corresponding fluorescent signals of the sample of cells can be obtained; and c. detecting whether the sample of cells has viable cancer cells from the fluorescent signals.

21. The method of claim 20, wherein each of the MBs targeting tumor marker mRNAs is designed to possess a fluorophore of a unique color such that when one MB targets its corresponding tumor marker mNRA, the fluorophore of the MB fluoresces, thereby generating a fluorescent signal associated with the corresponding tumor marker mNRA in the unique color of the fluorophore of the MB in the sample of cells.

22. The method of claim 21, wherein the fluorescent signals are distinguishable by colors of the fluorescent signals.

23. The method of claim 22, wherein the sample of cells has viable cancer cells if the intensity of the fluorescent signals in one color is no less than an intensity threshold.

24. The method of claim 23, wherein the sample of cells substantially has no viable cancer cells if the intensity of the fluorescent signals in each color is less than the intensity threshold.

25. The method of claim 24, wherein the intensity threshold is predetermined.

26. The method of claim 25, wherein the intensity threshold may be dependent on the type of cancer.

27. The method of claim 20, wherein the intensity of the fluorescent signals of a sample of cells having viable cancer cells is stronger than the intensity of the fluorescent signals of a sample of cells having no viable cancer cells.

28. The method of claim 20, wherein the sample of cells having viable cancer cells has viable pancreatic cancer cells.

29. The method of claim 28, wherein the intensity of the fluorescent signals of a sample of cells having viable cancer cells is about at least twice stronger than the intensity of the fluorescent signals of a sample of cells having no viable cancer cells.

30. The method of claim 20, wherein the tumor marker mRNAs include mutant K-ras and survivin.

31. The method of claim 30, wherein the mutant K-ras MBs selectively bind to mutant K-ras mRNAs in fixed cancer cells, resulting a stronger intensity of the fluorescent signals of a sample of cells having viable cancer cells.

32. The method of claim 30, further comprising the step of delivering a mixture of survivin and K-ras MBs to the sample of cells.

33. The method of claim 20, wherein the sample is taken from at least one source of blood, urine, pancreatic juice, ascites, breast ductal lavage, nipple aspiration, needle biopsy or tissue.

34. A diagnostic kit for detecting the level of gene expression in a sample of cells for cancer detection comprising a system suitable for carrying out the method of claim 20.

35. A method for detection the presence of cancer cells in a sample of cells and/or tissues of a subject using molecular beacon (MB) imaging, comprising the steps of: a. designing a number of MBs, each being capable of targeting a corresponding tumor marker mRNA; b. simultaneously delivering the number of MBs to the sample of cells and/or tissues so as to produce MB-target hybrids in the sample of cells and/or tissues, each MB-target hybrid being a hybridization of an MB with its corresponding tumor marker mRNA; c. detecting fluorescent signals emitted from the MB-target hybrids; and d. detecting, identifying or quantitating the presence of cancer cells in the sample cells and/or tissues from the detected fluorescent signals.

36. The method of claim 35, wherein each of the number of MBs is designed to possess a fluorophore of a unique color, respectively, such that when one MB targets its corresponding tumor marker mNRA, an MB-target hybrid is produced and emits a fluorescent signal in the unique color of the fluorophore of the MB in the sample of cells and/or tissues.

37. The method of claim 36, wherein the detected fluorescent signals are characterized with different colors, each color associated with a corresponding tumor marker mNRA in the sample cells and/or tissues.

38. The method of claim 37, wherein the detecting, identifying or quantitating step comprises the step of identifying the colors of the detected fluorescent signals.

39. The method of claim 37, wherein the sample of cells and/or tissues has cancer cells if the intensity of the fluorescent signals in one color is no less than an intensity threshold.

40. The method of claim 39, wherein the sample of cells and/or tissues substantially has no cancer cells if the intensity of the fluorescent signals in each color is less than the intensity threshold.

41. The method of claim 40, wherein the intensity threshold is predetermined.

42. The method of claim 41 , wherein the intensity threshold may be dependent on the type of cancer.

43. The method of claim 39, further comprising the step of correlating the intensity of the detected fluorescent signals in each color with the level of expression of the corresponding tumor marker mNRA in the sample of cells and/or tissues.

44. The method of claim 43, wherein the intensity of the fluorescent signals in one color is corresponding to the level of the corresponding tumor marker mRNA expressed in the sample of cells and/or tissues.

45. The method of claim 43, wherein the level of expression of the corresponding tumor marker mNRAs in the sample of cells and/or tissues is detected using a real-time reverse transcription-PCR assay and/or Western bolt analysis.

46. The method of claim 36, wherein the fluorophore comprises Cy3 fluorophore, Alexa Fluor 488, Alexa Fluor 350, CMAC (7-amino-4- chloromethylcoumarin), 6-FAM, FITC, or any combination of them.

47. The method of claim 35, wherein the tumor marker mNRAs comprise at least one of survivin, cyclin Dl, Her2/neu, a mutant K-ras, basic fibroblast growth factor, EGF receptor, XIAP, carcinoembryonic antigen, prostate specific antigen, alpha- fetoprotein, beta-2-microglobulin, bladder tumor antigen, chromogranin A, neuron-specific enolase, S-100, TA-90, tissue polypeptide antigen, and human chorionic gonadotropin.

48. A method for real-time detection of the level of expression of a marker gene in viable cells, comprising the steps of: a. providing a sample of viable cells containing the marker gene; b. treating the sample of viable cells with at least one of survivin and GAPDH MBs; and c. measuring intensities of fluorescent signals emitted from the treated sample of viable cells at different time points to detect the level of expression of the marker gene in the sample of viable cells as a function of time.

49. The method of claim 48, wherein the sample of viable cells is plated in a multi-well plate.

50. The method of claim 48, wherein the sample of viable cells comprises cancer cells.

51. The method of claim 50, wherein the sample of viable cells comprises breast cancer cells or viable pancreatic cancer cells.

52. The method of claim 51, wherein the marker gene comprises a survivin mRNA.

53. The method of claim 52, wherein the treating step comprises the steps of: a. transfecting the sample of viable cells with a mixture of survivin and GAPDH MBs for a first period of time; and b. treating the transfected sample of viable cells with EGF or docetaxel for a second period of time, wherein the first period of time and the second period of time are different or substantially same.

54. The method of claim 52, wherein the treating step comprises the steps of: a. transducing the sample of the viable cells with Ad p53 vector or control vector AdCMV for a period of time; and b. delivering survivin or GAPDH MBs into the tranduced cell.

55. The method of claim 48, wherein the measuring step is performed with FACScan analyzer, a fluorescence microplate reader or fluorescence microscope.

56. A diagnostic kit for detecting alterations in gene expression in viable cells in real-time comprising a system suitable for carrying out the method of claim 48.