WO2006059228A2 - Polypeptides involved in candida biofilm formation and uses thereof - Google Patents

Polypeptides involved in candida biofilm formation and uses thereof Download PDF

Info

Publication number
WO2006059228A2
WO2006059228A2 PCT/IB2005/003941 IB2005003941W WO2006059228A2 WO 2006059228 A2 WO2006059228 A2 WO 2006059228A2 IB 2005003941 W IB2005003941 W IB 2005003941W WO 2006059228 A2 WO2006059228 A2 WO 2006059228A2
Authority
WO
WIPO (PCT)
Prior art keywords
candida
yak1
biofilm
epa6
strain
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/IB2005/003941
Other languages
French (fr)
Other versions
WO2006059228A3 (en
Inventor
Guilhem Janbon
Ismail Iraqui Houssaini
Christophe Didier D'enfert
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Institut Pasteur
Original Assignee
Institut Pasteur
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Institut Pasteur filed Critical Institut Pasteur
Publication of WO2006059228A2 publication Critical patent/WO2006059228A2/en
Publication of WO2006059228A3 publication Critical patent/WO2006059228A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers

Definitions

  • the present invention relates to the field of fungal biofilm formation. More specifically, the present invention relates to the identification of polypeptides and polynucleotide sequences encoding the same which are involved in Candida biofilm formation. The present invention also relates to a method for identifying compounds that affect biofilm formation and use of such compounds in compositions and methods for the prevention and the impairment of biofilm and/or treatment/prevention of candidiasis, such as those caused by Candida albicans or Candida glabatra.
  • a biofilm is a community of micro-organisms attached to a surface: it contains an exopolymeric matrix and exhibits distinctive phenotypic properties (Donlan and Costerton, 2002). This type of cell development is predominant under many environmental conditions. For micro-organisms of clinical importance, implanted devices (and indwelling intravascular catheters in particular) provide pathogens with surfaces on which they can adhere and subsequently form biofilms (Donlan and Costerton, 2002).
  • Transcriptome and proteome analysis has revealed that under these growth conditions, bacterial cells adopt a metabolic profile which differs to that seen in cells growing under planktonic conditions (Becker ⁇ t al., 2001 ; Whiteley et al., 2001 ; Schembri et al., 2003; Beloin et al., 2004). Consequently, biofilms have been shown to be more tolerant or resistant to both host defence machinery and antimicrobial agents than free swimming cells: as a result, implant infections are difficult to treat (Baillie and Douglas, 1999; Donlan and Costerton, 2002).
  • adhesins microbial surface molecules able to bind to abiotic surfaces
  • adhesins microbial surface molecules able to bind to abiotic surfaces
  • surface associated proteins such as SpaP and Fap1 have been found to function as high-affinity adhesins and play an important role in biofilm initiation and development (Bowen et al., 1991 ; Froeliger and Pives-Taylor, 2001 ).
  • Other adhesins are needed for cell-cell stabilization of the biofilm structure.
  • glucan-binding proteins GbpA, GbpB and GbpC are involved in structural and functional regulation of plaque biofilms in Streptococcus mutans (Hazlett ef a/., 1999).
  • Candida species are now ranked as the fourth most common cause of bloodstream infection in the United States and Candida glahrata represents the second leading cause of candidiasis after Candida albicans in the United States and in France (Pfaller et al., 1999; Vazquez et al., 1999) (F. Dromer on behalf of the French Mycoses Study Group. Initiation of an active surveillance program on yeast-related bloodstream infections in France (ASPYRIF). Abstract P9861 , 4th European Congress of Clinical Microbiology and Infectious Diseases, Prague 2004). Although the majority of implant infections are caused by bacteria, the prevalence of implant infections due to fungal pathogens has dramatically increased over the last ten years.
  • C. albicans biofilm formation occurs in three steps. The first is the adherence of the cells to the surface, and is followed by an intermediate phase during which the microcolonies produce extracellular matrix. Finally, a maturation phase occurs, during which biofilm growth is accomplished by cells completely embedded in extracellular material (Chandra et al., 2001). C. glabrata has also been shown to be capable of forming a biofilm on a range of plastic surfaces, although the presence of extracellular matrix has not been demonstrated (Nikawa et al., 1997; Kumamoto, 2002; Shin et al., 2002). Various adhesin classes have been identified in C. albicans, and some have been shown to be involved in biofilm formation (Sundstrom, 1999).
  • ALS1 expression is induced in biofilms (Chandra et al., 2001 ; Garcfa-Sanchez et al., 2004; Green et al., 2004).
  • ALS3 is necessary for wild-type biofilm formation in C. albicans (Zhao, X., Daniels, J.K., Oh, S., Green, CB. , Soil, D.R. and Hoyer L. L. Abstract 33C, 7th ASM conference on Candida and candidiasis, 2004).
  • C. albicans Zao, X., Daniels, J.K., Oh, S., Green, CB. , Soil, D.R. and Hoyer L. L. Abstract 33C, 7th ASM conference on Candida and candidiasis, 2004.
  • EPA1 adhesin encoding genes
  • EPA2 adhesin encoding genes
  • EP A3, EPA4 and EPA5 adhesin encoding genes
  • EPA1 is mainly expressed during the exponential growth phase: it encodes a Ca 2+ -dependent lectin which recognizes N-acetyl lactosamine and which is necessary for the mediation of yeast cell adherence to cultured human epithelial cells (Cormack et al., 1999).
  • the five EPA genes are organized into two clusters located within sub-telomeric regions and consequently, EPA2 to EPA5 are not expressed in wild type C. glabrata under all tested conditions (De las Penas et al., 2003).
  • the present invention satisfies at least one of the above-mentioned needs.
  • an object of the invention is to provide a method of screening for a compound that affects expression of a gene involved in biofilm formation of a Candida strain, said gene being selected from the group consisting of EPA6, EPA7 and YAK1 , the method comprising the steps of:
  • Another object is to provide a method for detecting the presence or absence of a Candida biofilm in a sample, comprising the steps of:
  • a comparison sample comprising Yak1 , Epa7 or Epa6 polypeptides which specifically bind to said antibody; wherein said antibody, reagent, biological reference sample, and comparison sample are present in an amount sufficient to perform said detection.
  • kits for the early diagnostic of a Candida strain forming a biofilm comprising:
  • primers, probes, reagents, biological reference sample, and comparison sample are present in an amount sufficient to perform said determination.
  • the present invention also provides a method for selecting a biofilm formation inhibitor of a Candida strain acting through a Yak1 dependent pathway, comprising the following steps:
  • the present invention is also concerned with an in vitro screening method for an inhibitor of the activity of a Yak1 polypeptide of Candida, comprising the steps of :
  • the present invention is further concerned with a purified or isolated purified polypeptide having a kinase activity sensitive to N-MPP1 comprising the amino acid sequence SEQ ID NO: 9.
  • FIG. 1 Biofilm formed by C. glabrata strain BG2 on a plastic slide. Biofilm was formed in YPD medium at 37°C on the surface of a Thermanox slide. At the highest magnification, residual extracellular polymeric material is visible.
  • A magnification X200
  • B magnification X2000
  • C magnification X20000.
  • Epa ⁇ p influences biofilm formation in C. glabrata (A)
  • FIG. 6 Variation of URA3 gene expression when inserted at the EPA6 locus.
  • Each strain of C. glabrata was grown on YPD medium at 37 0 C under agitation. The cells were then washed with sterile water: serial dilutions of cells (10 7 , 10 6 and 10 5 ) were spotted on YPD, SD and FOA media and incubated at 37 0 C for 24h.
  • FIG. 7 Biofilm formation is regulated by sub-telomeric silencing in C. glabrata.
  • A Biofilm formation by BG2, CG145 (sir4 ⁇ ), CG149 (rif1 ⁇ ), BG676 (sir3 ⁇ ), BG592 (rap1-21) and CG170 (sir4 ⁇ epa6 ⁇ ) strains was monitored by an XTT reduction assay. 100% Ac correspond to the amount of the XTT reduced by the wild type strain (BG2). The reported values are the means ⁇ SD of three independent experiments.
  • B Transcription of EPA6 and EPA7 as assessed by RT-PCR.
  • BG2, CG145 (sir4 ⁇ ), CG149 (rif1 ⁇ ) and CG170 (sir4 ⁇ epa ⁇ ) strains were grown under planktonic growth conditions (late stationary phase of growth) (see Examples Section). ACT1 was used as control.
  • FIG. 8 The biofilm signal and Yaki p (Yak1 protein) act through a sub- telomeric silencing-dependent Mpk1 p-independent pathway
  • A Biofilm formation by BG2, CG145 (sirf ⁇ ), CG172 (sir4 ⁇ yak1) and CG174 (mpk1 ⁇ ) strains was monitored by XTT reduction assay. 100% Ac correspond to the amount of the XTT reduced by the, wild type strain (BG2).
  • B Transcription of EPA6 and EPA7 as assessed by RT-PCR.
  • BG2, CG145 (sir4 ⁇ ), CG149 (rlfi ⁇ ), BG676 (sir3 ⁇ ), CG172 ⁇ sir4 ⁇ yak1) and CG174 (mpk1 ⁇ ) strains were grown under planktonic (late stationary phase of growth) or biofilm growth conditions in the 96-well plate model (see Examples Section). ACT1 was used as control.
  • Figure 9 Model for EPA6-EPA7 regulation in C. glabrata.
  • YAK1 is necessary to the formation of biofilm in Candida albicans. Strains yak1D of C. albicans do not possess growth defects on complete media (YPD) but their filament process is altered (Lee medium). These strains do not produce biofilm microfermentor or tubular models.
  • FIG. 12 YAK1 analogue sensitive kinase allele in C. albicans.
  • a copy of the yak1 gene with a mutation (Phe507 : Ala) was introduced in the ⁇ yak1/ ⁇ yak1 strain to create a YAK1 analogue sensitive kinase allele with an enlarged binding pocket.
  • Figure 19 Nucleic acid sequence encoding the Candida glabrata Epa ⁇ amino acid sequence of figure 15 (SEQ ID NO: 6).
  • Figure 21 Nucleic acid sequence encoding the Candida albicans Yak1 amino acid sequence derivative of figure 17 (SEQ ID NO: 8).
  • FIG. 23 Candida glabrata Yak1 amino acid sequence (SEQ ID NO: 10).
  • the invention is particularly concerned with a method of screening for a compound that affects biofilm formation of a Candida strain such as Candida glabrata or Candida albicans. More specifically, the method contemplated by the present invention is for the screening of a compound that affects expression of a gene involved in biofilm formation of a Candida strain, wherein the genes are selected from the group consisting of EPA6, EPA7, SIR4, RIF1 and YAK1.
  • the method of the invention comprises the steps of:
  • the compound inhibits expression of gene EPA6, EPA7 and/or YAK1 by down-regulating the transcription of the gene EPA6, EPA7 and/or YAK1 , or by down-regulating the translation of mRNA in a protein encoded by the gene EPA6, EPA7 and/or YAK1. More preferably, the down-regulation of transcription is evaluated by measuring the mRNA level whereas the the down-regulation of translation is evaluated by measuring the protein level.
  • the methods for measuring the above-mentioned levels are well within the common knowledge of a person in the art and will thus not be further detailed.
  • a method for an early diagnostic of a Candida strain forming a biofilm comprising the steps of:
  • overexpression of EPA6, EPA7 and/or YAK1 genes in said cell sample compared to the control cell culture is indicative of the presence of a Candida strain forming a biofilm.
  • the gene whose mRNA level is measured is EPA6, EPA7 and/or YAK1
  • the gene whose mRNA level is measured is YAK1.
  • mRNA level is preferably quantified by RT-PCR, it will be understood that any method known to be suitable for the quantification of the level of mRNA, such as a hybridization assay, is within the scope of the present invention.
  • the Yak1 recombinant polypeptide has an amino acid sequence substantially identical to SEQ ID NO: 1 , 4 or 10.
  • the selecting method of the invention may be combined with the in vitro screening method of the invention for selecting a biofilm formation inhibitor of a Candida strain acting through a Yak1 dependent pathway.
  • the present invention concerns a compound obtained by the above-mentioned in vitro screening and/or selecting methods of the invention. Such a compound has the capacity of affecting biofilm formation of a Candida strain, such as Candida albicans or Candida glabatra.
  • a method for detecting the presence or absence of a Candida biofilm in a sample comprising the steps of:
  • the at least one molecule preferably specifically recognises the Yak1 , Epa7 or Epa ⁇ polypeptide
  • the at least one molecule preferably specifically recognises the Yak1 polypeptide
  • sample refers to a variety of sample types obtained from an individual and can be used in a detection assay or method.
  • the Yak1 , Epa ⁇ and Epa7 polypeptides comprise respectively an amino acid sequence substantially identical to SEQ ID NO: 1 (and 10 for Yak1 ) , 2 and 3 or functional derivatives thereof.
  • substantially identical it will be understood that the Candida Yak1 , Epa ⁇ or Epa7 polypeptides contemplated by the present invention preferably have an amino acid sequence having at least 80% identity, or even preferably 85% identity, or even more preferably 95% identity to part or all respectively of SEQ ID NO:1 (and SEQ ID NO: 10 for Yak1 ), SEQ ID NO:2 and SEQ ID NO:3, or functional derivatives thereof.
  • Candida Yak1 , Epa6 and Epa7 polypeptides comprise an amino acid sequence having 100% identity respectively with SEQ ID NO:1 (and SEQ ID NO: 10 for Yak1 ), SEQ ID NO:2 and SEQ ID NO:3.
  • the invention further concerns a purified or isolated polypeptide having a kinase activity sensitive to N-MPP1 comprising the amino acid sequence SEQ ID NO: 9.
  • isolated is meant, when referring to a polypeptide, that the indicated molecule is separate and discrete from the whole organism with which the molecule is found in nature or is present in the substantial absence of other biological macro-molecules of the same type.
  • isolated with respect to a polynucleotide is a nucleic acid molecule devoid, in whole or part, of sequences normally associated with it 'in nature; or a sequence, as it exists in nature, but having heterologous sequences in association therewith; or a molecule disassociated frpm the chromosome.
  • a protein/peptide is said to be a "chemical derivative" of another protein/peptide when it contains additional chemical moieties not normally part of the protein/peptide, said moieties being added by using techniques well known in the art. Such moieties may improve the protein/peptide solubility, absorption, bioavailability, biological half life, and the like. Any undesirable toxicity and side-effects of the protein/peptide may be attenuated and even eliminated by using such moieties.
  • a derivative with regards to Yak1 protein is a polypeptide having an amino acid sequence as shown in SEQ ID NO: 4 and comprising the sequence coding for the kinase activity.
  • This program compares amino acid sequences and finds the optimal alignment by inserting spaces in either sequence as appropriate. It is possible to calculate amino acid identity or homology for .an optimal alignment.
  • a program like BLASTp will align the longest stretch of similar sequences and assign a value to the fit. It is thus possible to obtain a comparison where several regions of similarity are found, each having , a different score. Both types of identity analysis are contemplated in the present invention.
  • Yak1 , Epa6 and Epa7 amino acid sequences used in accordance with the biofilm detection method of the invention are preferably encoded respectively by a nucleotide sequence substantially identical to SEQ ID NOS: 5 (and 11 for
  • nucleotide sequence contemplated by the present invention preferably has a nucleic acid sequence which is at least 65% identical, more particularly 80% identical and even more particularly 95% identical to part or all of any one of SEQ ID NOS 5,
  • a “functional fragment”, as is generally understood and used herein, refers to a nucleic acid sequence that encodes for a functional biological activity that is substantially similar to the biological activity of the whole nucleic acid sequence. In other words, it refers to a nucleic acid that substantially retains the capacity of encoding a polypeptide involved in Candida biofilm formation.
  • fragment refers to a polynucleotide sequence (e.g., cDNA) which is an isolated portion of the subject nucleic acid constructed artificially (e.g.', by chemical synthesis) or by cleaving a natural product into multiple pieces, using restriction endonucleases or mechanical shearing, or a portion of a nucleic acid synthesized by PCR, DNA polymerase or any other polymerizing technique well known in the art, or expressed in a host cell by recombinant nucleic acid technology well known to one of skill in the art.
  • a fragment with respect to YAK1 gene is a polynucleotide having a' nucleic acid sequence as shown in SEQ ID NO 8.
  • Amino acid or nucleotide sequence “identity” and “similarity” are determined from an optimal global alignment between the two sequences being compared. An optimal global alignment is achieved using, for example, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. MoI. Biol. 48:443-453). "Identity” means that an amino acid or nucleotide at a particular position in a first polypeptide or polynucleotide is identical to a corresponding amino acid or nucleotide in a second polypeptide or polynucleotide that is in an optimal global alignment with the first polypeptide or polynucleotide. In contrast to identity, "similarity" encompasses amino acids that are conservative substitutions.
  • a “conservative” substitution is any substitution that has a positive score in the blosum62 substitution matrix (Hentikoff and Hentikoff, 1992, Proc. Natl. Acad. Sci. USA 89: 10915-10919).
  • sequence A is n% similar to sequence B
  • n% of the positions of an optimal global alignment between sequences A and B consists of identical residues or nucleotides and conservative substitutions.
  • sequence A is n% identical to sequence B
  • n% of the positions of an optimal global alignment between sequences A and B consists of identical residues or nucleotides.
  • the molecule preferably used in connection with the biofilm detection method of the invention is an antibody that specifically binds to said Yak1 , Epa6 or Epa7 polypeptides or functional derivative thereof. More preferably, the antibody is a monoclonal antibody.
  • the term “specifically binds to” refers to antibodies that bind with a relatively high affinity to one or more epitopes of a protein of interest, but which do not substantially recognize and bind to molecules other than the one(s) of interest.
  • the term “relatively high affinity” means a binding affinity between the antibody and the protein of interest of at least 10 "6 M, and preferably of at least about 10 ⁇ 7 M and even more preferably 10 "8 M to 10 "10 M. Determination of such affinity is preferably conducted under standard competitive binding immunoassay con'ditions which! is common knowledge to one skilled in the art.
  • an antibody refers to a glycoprotein produced by lymphoid cells in response to a stimulation with an immunogen. Antibodies possess the ability to react in vitro and in vivo specifically and selectively with an antigenic determinant or epitope eliciting their production or with an antigenic determinant closely related to the homologous antigen.
  • the term “antibody” is meant to encompass constructions using the binding (variable) region of such an antibody, and other antibody modifications.
  • an antibody useful in the method of the invention may comprise a whole antibody, an antibody fragment, a polyfunctional antibody aggregate, or in general a substance comprising one or more specific binding sites from an antibody.
  • an acceptable carrier means a vehicle for containing the compounds obtained by the method of the invention that can be administered to a animal host without adverse effects.
  • Suitable carriers known in the art include, but are not limited to, gold particles, sterile water, saline, glucose, dextrose, or buffered solutions.
  • Carriers may include auxiliary agents including, but not limited to, diluents, stabilizers (i. e., sugars and amino acids), preservatives, wetting agents, emulsifying agents, pH buffering agents, viscosity enhancing additives, colors and the like.
  • composition of the invention may also comprise other anti-fungal agents well known in the art.
  • the amount of compounds obtained by the method of the invention is preferably a therapeutically effective amount.
  • a therapeutically effective amount of compound obtained by the screening/selecting method of the invention is the amount necessary to allow the same to perform their biofilm formation inhibitor role without causing overly negative effects in the host to which the composition is administered.
  • the exact amount of compounds obtained by the method of the invention to be used and the composition to be administered will vary according to factors such as the mode of administration, as well as the other ingredients in the composition.
  • another embodiment of the invention is to provide a method for preventing and/or treating candidiasis in an animal, the method comprising the step of administering to the animal a therapeutically effective amount of a composition as defined above.
  • the animal is a human, and even more preferably an immunocompromised human.
  • An "immunocompromised subject” is an individual whose immune system is compromised or not functioning in a normal manner. For example, AIDS patients and patients undergoing immunotherapy are immunocompromised subjects. Further, various other conditions, such as certain cancers, viral infections and autoimmune diseases may render the affected individuals immunocompromised. Individuals who have undergone stem cell replacement therapy, bone marrow transplant, chemotherapy, radiotherapy and the like are also typically immunocompromised subjects.
  • kits for the detection of the presence or absence of a Candida biofilm comprising: at least one antibody that specifically binds to a Candida Yak1 , Epa7 or Epa6 protein;
  • primers, probes, reagents, biological reference sample, and comparison sample are present in an amount sufficient to perform said determination.
  • the yakip kinase controls expression of adhesins and biofilm formation in Candida glabrata in a sir4p dependent pathway
  • C. glabrata mutant strains with altered ability to form biofilms An insertional mutant library (Cormack and Falkow, 1999) was used to isolate C. glabrata strains with increased ability to form biofilm (phenotype Biofilm++) or those which were partially or completely defective in terms of biofilm formation (phenotype Biofilm-).
  • the inventors plated 5000 mutant cells on YPD, replicated them individually into 96-well microtiter plates and incubated the resulting cultures at 37 0 C (see Experimental procedures). After elimination of the least adherent cells, we used the XTT assay to estimate the quantity of cells which adhered strongly to the plastic surface.
  • Biofilm mutant strains had the same growth rate under planktonic conditions as the wild type strain (with, the same media and temperature used to grow biofilms).
  • the enzyme reducing XTT in yeast is a mitochondrial dehydrogenase (Baillie and Douglas, 1999)
  • the inventors checked that these Biofilm mutant strains were not affected in their mitochondrial metabolism by plating them on YPG (2% glycerol) medium.
  • Figure 3A shows a typical example of the structures produced by Biofilm- and Biofilm++ strains in the thermanox slide model of biofilm formation. In synthetic medium, the original strain and the Biofilm- strain (CG129) produce small structures that differ by their size and density.
  • the resulting C. albicans ura3/ura3 his1/his1 yak1 A ::URA3/yak1 A ::HIS1 strains were tested for their ability to form biofilms in two model of biofilm formation on a plastic surface.
  • the first model is based on the use of a micro- fermentor containing a ThermanoxTM slide which has been previously described (Garcia-Sanchez et a/., 2004).
  • ThermanoxTM slides are incubated at 37°C in minimal medium in a glass tube under continuous rotation for 2-48h.
  • the C. albicans yak1 ⁇ /yak1A strains were unable to develop a biofilm of significant biomass.
  • ThermanoxTM slide obtained using the second biofilm model revealed that the mutant strain was able to form microcolonies on the plastic surface. These micro-colonies consisted mostly of yeast cells with some hyphal or pseudo-hyphal forms (figure 10).
  • the resulting C. albicans ura3/ura3 his1/his1 yak1A ::URA3/yak1A ::HIS1 strains were tested for their ability to produce hyphae in Lee's medium (Lee et ah, 1975) which triggers the yeast-to-hypha transition in C. albicans. As shown in the figure 10, in contrast to wild-type C. albicans which readily forms hyphae after a few hours of incubation in Lee's medium, no true hypha was visible with the mutant strain and only pseudo-hyphae were observed.
  • An inoculum was prepared from an early-stationary-phase culture grown in flasks at 30 0 C in an orbital shaker and diluted to an optical density at 600 nm (OD 6O o) of 1.
  • Biofilms were produced in microfermentors (Ghigo J. M., 2001 ). These consist of a glass vessel with a 40-ml incubation chamber where two glass tubes are inserted to drive the entry of medium and air. Used medium is evacuated through a third tube. Medium flow is controlled by a recirculation pump (Ismatec) and pushed by the pressured air. Plastic slides (Thermanox; Nunc) glued to a glass spatula were immersed in the inoculum for 30 min at room temperature.
  • Ismatec recirculation pump
  • the inventors have restored the capacity of a double mutant ⁇ yakU Ayaki of C. albicans to form biofilm by reintroducing in such a strain the wild-type gene of YAK1.
  • the inventors have introduced an allele of the YAK1 gene sensitive to N-MPP1 in a double ⁇ yakH Ayaki of C. albicans strain.
  • the mutated kinase is active and the double mutated strains containing the allele of the YAK1 gene sensitive to N-MPP1 have the capacity of forming normal filament when the filamentation is induced in LEE medium.
  • the capacity of the mutated kinase is specifically inhibited and the strains have thus lost their capacity of forming filaments.
  • the kinase focused collection (ChemDiv, Inc) will be screened to select inhibitors of biofilm formation in a Yakip-dependent or -independent way.
  • the 96-wells plate model of C. glabrata biofilm will be used in this procedure.
  • two concomitant screens will be conducted. A first assay on the wild-type strain will identify molecules able to inhibit biofilm formation.
  • a second assay will be conducted using a sir4 mutant strain since deletion of the sir4 gene suppresses the biofilm-deficient phenotype of a yak1 mutant strain.
  • Molecules inhibiting biofilm formation through the inhibition of Yak1 should theoretically inhibit biofilm formation in a wild-type background but not in a sir4 background. Molecules identified though these assays will then be tested on C. albicans.
  • a Fluorescent/Luminescent Kinase Assay adapted for screening in 96 well-plate format will first be set up. Following up, the activity of Yak1 will be tested in the presence of known serine/threonine kinase inhibitors. A collection of 3000 molecules of the kinase focused library will be selected (ChemDiv, Inc) and tested for their inhibitory potency on the Yak1 activity. The results obtained on the assay on the recombinant protein will be compared to the in vivo tests on C. albicans and C. glabrata
  • Primer name Primer sequence (5" ->3' )
  • MKRfRlFl CAGACCTGATTTGCATCCCACTAGTTAAGCCAGCCCCGACACCC
  • Virulence-related surface glycoproteins in the yeast pathogen Candida glabrata are encoded in subtelomeric clusters and subject to RAP1- and S/f?-dependent transcriptional silencing. Genes Dev 17: 2245-2258.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Analytical Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Mycology (AREA)
  • Botany (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The present invention relates to the field of fungal biofilm formation. More specifically, the present invention relates to the identification of polypeptides and polynucleotide sequences encoding the same which are involved in Candida biofilm formation. The present invention also relates to a method for identifying compounds that affect biofilm formation and use of such compounds in compositions and methods for the prevention and the impairment of biofilm and/or treatment/prevention of candidiasis, such as those caused by Candida albicans or Candida glabatra.

Description

POLYPEPTIDES INVOLVED IN CANDIDA BIOFILM FORMATION
AND USES THEREOF
FIELD OF THE INVENTION
The present invention relates to the field of fungal biofilm formation. More specifically, the present invention relates to the identification of polypeptides and polynucleotide sequences encoding the same which are involved in Candida biofilm formation. The present invention also relates to a method for identifying compounds that affect biofilm formation and use of such compounds in compositions and methods for the prevention and the impairment of biofilm and/or treatment/prevention of candidiasis, such as those caused by Candida albicans or Candida glabatra.
BRIEF DESCRIPTION OF THE PRIOR ART
'
A biofilm is a community of micro-organisms attached to a surface: it contains an exopolymeric matrix and exhibits distinctive phenotypic properties (Donlan and Costerton, 2002). This type of cell development is predominant under many environmental conditions. For micro-organisms of clinical importance, implanted devices (and indwelling intravascular catheters in particular) provide pathogens with surfaces on which they can adhere and subsequently form biofilms (Donlan and Costerton, 2002). Transcriptome and proteome analysis has revealed that under these growth conditions, bacterial cells adopt a metabolic profile which differs to that seen in cells growing under planktonic conditions (Becker έt al., 2001 ; Whiteley et al., 2001 ; Schembri et al., 2003; Beloin et al., 2004). Consequently, biofilms have been shown to be more tolerant or resistant to both host defence machinery and antimicrobial agents than free swimming cells: as a result, implant infections are difficult to treat (Baillie and Douglas, 1999; Donlan and Costerton, 2002). Since surface attachment is a prerequisite for biofilm formation, the early stages of biofilm formation are primarily conditioned by microbial surface molecules able to bind to abiotic surfaces (referred to as adhesins). For example, in Streptococci, surface associated proteins such as SpaP and Fap1 have been found to function as high-affinity adhesins and play an important role in biofilm initiation and development (Bowen et al., 1991 ; Froeliger and Pives-Taylor, 2001 ). Other adhesins are needed for cell-cell stabilization of the biofilm structure. For example, three glucan-binding proteins (GbpA, GbpB and GbpC) are involved in structural and functional regulation of plaque biofilms in Streptococcus mutans (Hazlett ef a/., 1999).
Candida species are now ranked as the fourth most common cause of bloodstream infection in the United States and Candida glahrata represents the second leading cause of candidiasis after Candida albicans in the United States and in France (Pfaller et al., 1999; Vazquez et al., 1999) (F. Dromer on behalf of the French Mycoses Study Group. Initiation of an active surveillance program on yeast-related bloodstream infections in France (ASPYRIF). Abstract P9861 , 4th European Congress of Clinical Microbiology and Infectious Diseases, Prague 2004). Although the majority of implant infections are caused by bacteria, the prevalence of implant infections due to fungal pathogens has dramatically increased over the last ten years.
In C. albicans, biofilm formation occurs in three steps. The first is the adherence of the cells to the surface, and is followed by an intermediate phase during which the microcolonies produce extracellular matrix. Finally, a maturation phase occurs, during which biofilm growth is accomplished by cells completely embedded in extracellular material (Chandra et al., 2001). C. glabrata has also been shown to be capable of forming a biofilm on a range of plastic surfaces, although the presence of extracellular matrix has not been demonstrated (Nikawa et al., 1997; Kumamoto, 2002; Shin et al., 2002). Various adhesin classes have been identified in C. albicans, and some have been shown to be involved in biofilm formation (Sundstrom, 1999). For instance, ALS1 expression is induced in biofilms (Chandra et al., 2001 ; Garcfa-Sanchez et al., 2004; Green et al., 2004)., and ALS3 is necessary for wild-type biofilm formation in C. albicans (Zhao, X., Daniels, J.K., Oh, S., Green, CB. , Soil, D.R. and Hoyer L. L. Abstract 33C, 7th ASM conference on Candida and candidiasis, 2004). In C. glabrata, five adhesin encoding genes (EPA1, EPA2, EP A3, EPA4 and EPA5) have been previously identified (Cormack et al., 1999; De las Penas et al., 2003), although none has been studied for its involvement in biofilm formation. EPA1 is mainly expressed during the exponential growth phase: it encodes a Ca2+-dependent lectin which recognizes N-acetyl lactosamine and which is necessary for the mediation of yeast cell adherence to cultured human epithelial cells (Cormack et al., 1999). The five EPA genes are organized into two clusters located within sub-telomeric regions and consequently, EPA2 to EPA5 are not expressed in wild type C. glabrata under all tested conditions (De las Penas et al., 2003).
In view of the above, there is a need to provide new polypeptides as well as polynucleotides encoding such polypeptides involved in regulation of Candida biofilm formation. There is also a need to provide for new compositions comprising inhibitors of such polypeptides in the treatment and impairment of biofilm formation in animals.
SUMMARY OF THE INVENTION
The present invention satisfies at least one of the above-mentioned needs.
More specifically, an object of the invention is to provide a method of screening for a compound that affects expression of a gene involved in biofilm formation of a Candida strain, said gene being selected from the group consisting of EPA6, EPA7 and YAK1 , the method comprising the steps of:
- providing a Candida biofilm with an initial expression level for said
1 gene;
- contacting said biofilm with at least one compound to be tested;
- evaluating expression of the gene; and - identifying the compound that inhibits the initial expression level of said gene in the biofilm.
Another object of the invention concerns a compound that affects biofilm formation of a Candida strain obtained by the method as defined above. A related object is to provide a composition for preventing and/or treating candidiasis, comprising a compound of the invention and an acceptable carrier.
A further object is to provide a method for an early diagnostic of a Candida strain forming a biofilm, comprising the steps of:
a) obtaining a cell sample of said Candida strain;
b) measuring the mRNA level of EPA6, EPA7 and/or YAK1 genes in said cell sample; and
c) measuring the mRNA level of said gene in a control Candida cell culture at early planktonic growth,
wherein overexpression of EPA6, EPA7 and/or YAK1 genes in said cell sample compared to the control cell culture, is indicative of the presence of a Candida strain forming a biofilm.
Alternatively, a further object is to provide a method for an early in vitro diagnostic of a Candida strain forming a biofilm, comprising the steps of:
a) measuring the mRNA level of EPA6, EPA7 and/or YAK1 genes in a cell sample of said Candida strain; and
b) measuring the mRNA level of said gene in a control Candida cell culture at early planktonic growth,
wherein overexpression of EPA6, EPA7 and/or YAK1 genes in said cell sample compared to the control cell culture, is indicative of the presence of a Candida strain forming a biofilm. Yet, another object is to provide a method for detecting the presence or absence of a Candida biofilm in a sample, comprising the steps of:
a) contacting the sample with at least one molecule that specifically recognizes a Candida Yak1 , Epa7 or Epa6 polypeptide for a time and under conditions sufficient to form a complex; and
b) detecting the presence or absence of the complex formed in a).
Another object of the invention is to provide a method for preventing and/or treating candidiasis in an animal, the method comprising the step of administering to the animal, a therapeutically effective amount of a composition as defined above.
Furthermore, the present invention is concerned with the use of the compound of the invention in the preparation of a medicament for preventing or treating candidiasis. The present invention is further concerned with the use of at least one Candida protein selected from the group consisting of Epa6, Epa7, Sir4, Rifi and Yak1 or at least one gene encoding said protein as a target for identifying a compound capable of impairing biofilm formation of a Candida strain.
Yet, another embodiment of the invention is to provide a kit for the detection of the presence or absence of a Candida biofilm, comprising:
- at least one antibody that specifically binds to a Candida Yak1 , Epa7 or Epa6 protein;
a reagent to detect polypeptide-antibody immune complex;
optionally a biological reference sample lacking Yak1 , Epa7 or Epa6 polypeptides; and
- optionally a comparison sample comprising Yak1 , Epa7 or Epa6 polypeptides which specifically bind to said antibody; wherein said antibody, reagent, biological reference sample, and comparison sample are present in an amount sufficient to perform said detection.
Yet, a further embodiment of the invention is to provide a kit for the early diagnostic of a Candida strain forming a biofilm, comprising:
- specific primers for Candida EPA6, EPA7 and/or YAK1 genes;
- specific probes for Candida EPA6, EPA7 and/or YAK1 genes;
- reagents for detecting the mRNA level of EPA6, EPA7 and/or YAK1 genes;
- a control sample of Candida cell culture at an early planktonic growth phase;
- optionally a biological reference sample lacking Epa6, Epa7 and/or Yak1 polynucleotides; and
- optionally a comparison sample comprising EPA6, EPA7 and/or YAK1
I polynucleotides which specifically hybridize with said primers or probes;
wherein said primers, probes, reagents, biological reference sample, and comparison sample, are present in an amount sufficient to perform said determination.
The present invention also provides a method for selecting a biofilm formation inhibitor of a Candida strain acting through a Yak1 dependent pathway, comprising the following steps:
a) contacting a compound with a biofilm of a wild type Candida strain and determining if it inhibits biofilm formation of said Candida strain;
b) contacting the compound selected in a) with a biofilm of a sir4 mutant Candida strain and determining if it inhibits biofilm formation of said Candida strain; c) selecting the compound identified in a) if said compound inhibits the formation of biofilm of the wild-type Candida strain and do not inhibit the formation of biofilm of the sir4 mutant Candida strain.
The present invention is also concerned with an in vitro screening method for an inhibitor of the activity of a Yak1 polypeptide of Candida, comprising the steps of :
a) contacting a purified or isolated Yak1 recombinant polypeptide or a fragment thereof retaining the kinase activity with a candidate compound;
b) measuring the capacity of said candidate compound to inhibit the kinase activity of the Yak1 polypeptide or fragment thereof, said kinase activity being measured by a fluorescent and/or luminescent kinase assay.
The present invention is also concerned with a purified or isolated polypeptide involved in Candida biofilm formation comprising an amino acid sequence substantially identical to SEQ ID NO: 1 , and a purified polynucleotide encoding said purified polypeptide.
The present invention is further concerned with a purified or isolated purified polypeptide having a kinase activity sensitive to N-MPP1 comprising the amino acid sequence SEQ ID NO: 9.
BRIEF DESCRIPTION OF THE FIGURES
Figure 1. Biofilm formed by C. glabrata strain BG2 on a plastic slide. Biofilm was formed in YPD medium at 37°C on the surface of a Thermanox slide. At the highest magnification, residual extracellular polymeric material is visible. (A) magnification X200; (B) magnification X2000; (C) magnification X20000.
Figure 2. C. glabrata cells are more adherent in the stationary phase. (A) Influence of the growth phase on biofilm formation by C. glabrata strain BG2. The cells were grown on YPD medium and the OD60O of the culture was followed. At different stage of growth (OD6oo = 0.5, 2, 4, 5.4 and 12.5) an aliquot was recovered. The cells were washed, resuspended in YPD medium (OD6oo = 1 ). The relationship between the OD6oo and the number of cell in the suspension was not affected by the stage of growth (2.7 ± 0.3 cell/ml for OD6oo = 1 ). The cells were then distributed into microtiter plate wells. After 24h of growth at 37°C, less-adherent cells were eliminated by serial washes and XTT reduction was measured. (B) Kinetics of XTT reduction according to the time of incubation of adherent cells with the XTT.
Figure 3. C. glabrata Biofilm mutants. (A) Biofilm formed by C. glabrata mutant strains on a plastic slide. Biofilms were formed in SC medium at 370C on the surface of a Thermanox slide. The Biofilm- strains produced smaller structures at the plastic surface whereas Biofilm++ strains produced very large and complex structures (B) Strains were grown under biofilm conditions in 96 well plates in SC medium at 370C, with less-adherent cells being eliminated by serial washes. Adherent cells were examined and photographed using an inverted microscope (Zeiss Axiovert 200M) at two different magnifications. Wells containing wildtype strain (BG2), Biofilm- (CG129) and Biofilm++ (CG 137) mutant strains are shown.
Figure 4. EPA6 and EPA7 in Candida glabrata. (A) Schematic representations ■ of the EPA6-7 gene and the disruption strategy. (B) Southern-blot analysis of the DNA digested by C/al or Hinά\\\ and hybridized with the EPA6-EPA 7 specific probe.
1 Figure 5. Epaδp (Epa6 protein) influences biofilm formation in C. glabrata (A)
Biofilm formation by the CG122 (βpaβ-1), CG164 (epaβΔ), CG129 (yak1) and
; BG570 (epa1-5Δ) strains as monitored by an XTT reduction assay). 100% Ac corresponds to the amount of the XTT reduced by the wild type strain (BG2). The reported values are the means ± SD of three independent experiments. (B)
, Transcription of EPAQ and EPA7 as assessed by RT-PCR. Cells were grown were grown under planktonic (late stationary phase of growth) or biofilm growth conditions (see Examples Section). ACT1 was used as a control. (C) Transcription of EPA6 at different stages of the planktonic growth on SC medium at 37°C as compare to biofilm growth. Cells were grown under planktonic growth and an aliquot was recovered after (1 ) 2h of growth (DO600 = 0.1 ); (2) 4h of growth (DO600 = 0.24); (3) 6h of growth (DO600 = 0.72); (4) 8h of growth (DO600 = 2.1 ); (5) 1Oh of growth (DO600 = 4.9); (6) 24h of growth (DO600 = 7.7); (7) 48h of growth (DO600 = 7.42); (8) Cells were grown under biofilm growth conditions for 24h using the 96 well plate model (see Examples Section). ACT1 was used as a control.
Figure 6. Variation of URA3 gene expression when inserted at the EPA6 locus. Each strain of C. glabrata was grown on YPD medium at 370C under agitation. The cells were then washed with sterile water: serial dilutions of cells (107, 106 and 105) were spotted on YPD, SD and FOA media and incubated at 370C for 24h.
Figure 7. Biofilm formation is regulated by sub-telomeric silencing in C. glabrata. (A) Biofilm formation by BG2, CG145 (sir4Δ), CG149 (rif1Δ), BG676 (sir3Δ), BG592 (rap1-21) and CG170 (sir4Δepa6Δ) strains was monitored by an XTT reduction assay. 100% Ac correspond to the amount of the XTT reduced by the wild type strain (BG2). The reported values are the means ± SD of three independent experiments. (B) Transcription of EPA6 and EPA7 as assessed by RT-PCR. BG2, CG145 (sir4Δ), CG149 (rif1Δ) and CG170 (sir4Δ epaβΔ) strains were grown under planktonic growth conditions (late stationary phase of growth) (see Examples Section). ACT1 was used as control.
Figure 8. The biofilm signal and Yaki p (Yak1 protein) act through a sub- telomeric silencing-dependent Mpk1 p-independent pathway (A) Biofilm formation by BG2, CG145 (sirfΔ), CG172 (sir4Δyak1) and CG174 (mpk1Δ) strains was monitored by XTT reduction assay. 100% Ac correspond to the amount of the XTT reduced by the, wild type strain (BG2). (B) Transcription of EPA6 and EPA7 as assessed by RT-PCR. BG2, CG145 (sir4Δ), CG149 (rlfiΔ), BG676 (sir3Δ), CG172 {sir4Δ yak1) and CG174 (mpk1Δ) strains were grown under planktonic (late stationary phase of growth) or biofilm growth conditions in the 96-well plate model (see Examples Section). ACT1 was used as control.
Figure 9. Model for EPA6-EPA7 regulation in C. glabrata.
Figure 10. YAK1 is necessary to the formation of biofilm in Candida albicans. Strains yak1D of C. albicans do not possess growth defects on complete media (YPD) but their filament process is altered (Lee medium). These strains do not produce biofilm microfermentor or tubular models.
Figure 11. Restoration of the capacity of biofilm formation of double mutant Δyak1/Δyak1 of C. albicans after the introduction of wild-type yak1 gene.
Figure 12. YAK1 analogue sensitive kinase allele in C. albicans. A copy of the yak1 gene with a mutation (Phe507 : Ala) was introduced in the Δyak1/Δyak1 strain to create a YAK1 analogue sensitive kinase allele with an enlarged binding pocket.
Figure 13. Sensitivity of Yak (Phe507 : Ala) of C. albicans to 1-N-MPP1.Hyphal differentiation in LEE medium of the condition allele strain.
Figure 14. Candida albicans Yak1 amino acid sequence (SEQ ID NO: 1 ).
Figure 15. Candida glabrata Epaδ amino acid sequence (SEQ ID NO: 2).
Figure 16. Candida glabrata Epa7 amino acid sequence (SEQ ID NO: 3).
Figure 17. Amino acid sequence of a Candida albicans Yak1 functional derivative (SEQ ID NO: 4). Figure 18. Nucleic acid sequence encoding the Candida albicans Yak1 amino acid sequence of figure 14 (SEQ ID NO: 5).
Figure 19. Nucleic acid sequence encoding the Candida glabrata Epaδ amino acid sequence of figure 15 (SEQ ID NO: 6).
Figure 20. Nucleic acid sequence encoding the Candida glabrata Epa7 amino acid sequence of figure 16 (SEQ ID NO: 7).
Figure 21. Nucleic acid sequence encoding the Candida albicans Yak1 amino acid sequence derivative of figure 17 (SEQ ID NO: 8).
Figure 22. Amino acid sequence of Candida albicans N-MPP1 -sensitive mutant Yak1 protein (SEQ ID NO: 9)
Figure 23. Candida glabrata Yak1 amino acid sequence (SEQ ID NO: 10).
Figure 24. Nucleic sequence encoding the Candida glabrata Yak1 amino acid sequence of Figure 23 (SEQ ID NO: 11 ).
DETAILED DESCRIPTION OF THE INVENTION
The inventors have surprinsingly found Candida genes and encoded polypeptides (or proteins) that are implicated in the formation of Candida biofilm. In this connection, the present invention specifically relates to the use of said polypeptides in methods for identifying compounds that affect Candida biofilm forόnation. Such compounds shall be used in compositions and methods for the impairment and the prevention of Candida biofilm and/or for the treatment/prevention of candidiasis, such as those caused by Candida albicans or Candida glabatra. The present invention further relates to detection methods of Candida biofilms. 1. Methods of screening/selection and compounds
In a first embodiment, the present invention is thus concerned with the use of at least one Candida protein selected from the group consisting of Epa6, Epa7, Sir4, Rif1 and Yak1 or at least one gene encoding said protein as a target for identifying a compound capable of impairing biofilm formation of a Candida strain. The present invention is also concerned with the use uf such a compound in the preparation of a medicament for preventing or treating candidiasis.
As used herein, the expression "biofilm formation" refers to either already formed biofilm or to a Candida cell culture which is in conditions that induce or facilitate the formation of a biofilm.
In a related aspect, the invention is particularly concerned with a method of screening for a compound that affects biofilm formation of a Candida strain such as Candida glabrata or Candida albicans. More specifically, the method contemplated by the present invention is for the screening of a compound that affects expression of a gene involved in biofilm formation of a Candida strain, wherein the genes are selected from the group consisting of EPA6, EPA7, SIR4, RIF1 and YAK1. The method of the invention comprises the steps of:
- providing a Candida biofilm with an initial expression level for said gene;
- contacting said biofilm with at least one compound to be tested;
- evaluating expression of the gene; and
- identifying the compound that inhibits the initial' expression level of said gene in the biofilm.
The screening method of the invention may further comprises a step of evaluating inhibition of biofilm formation by the compound.
According to a preferred embodiment of the screening method of the invention, the compound inhibits expression of gene EPA6, EPA7 and/or YAK1 by down-regulating the transcription of the gene EPA6, EPA7 and/or YAK1 , or by down-regulating the translation of mRNA in a protein encoded by the gene EPA6, EPA7 and/or YAK1. More preferably, the down-regulation of transcription is evaluated by measuring the mRNA level whereas the the down-regulation of translation is evaluated by measuring the protein level. The methods for measuring the above-mentioned levels are well within the common knowledge of a person in the art and will thus not be further detailed.
It will be further be noted that in the case where the Candida strain preferably consists of Candida glabatra, the gene whose expression is evaluated is preferably EPA6, EPA7 or YAK1 , whereas where the Candida strain preferably consists of Candida albicans, the gene whose expression is evaluated is preferably YAK1.
In another embodiment, the present invention concerns a compound obtained by the above-mentioned screening method of the invention. Such a compound has the capacity of affecting biofilm formation of a Candida strain, such as Candida albicans or Candida glabatra. It will be understood that the compound of the invention affects biofilm formation (for instance, by inhibiting or preventing biofilm formation or its development) preferably by decreasing the expression of the polypeptide and/or the polynucleotide contemplated by the present invention, in said fungus.
As it may be appreciated, the compound of the invention finds a particular use as an anti-fungal agent.
According to another embodiment of the invention, it is provided a method for an early diagnostic of a Candida strain forming a biofilm, comprising the steps of:
a) obtaining a cell sample of said Candida strain;
b) measuring the mRNA level of EPA6, EPA7 and/or YAK1 genes in said cell sample; and c) measuring the mRNA level of said gene in a control Candida cell culture at early planktonic growth,
wherein overexpression of EPA6, EPA7 and/or YAK1 genes in said cell sample compared to the control cell culture, is indicative of the presence of a Candida strain forming a biofilm.
Alternatively, it is provided a method for an early in vitro diagnostic of a Candida strain forming a biofilm, comprising the steps of:
a) measuring the mRNA level of EPA6, EPA7 and/or YAK1 genes in a cell sample of said Candida strain; and
b) measuring the mRNA level of said gene in a control Candida cell culture at early planktonic growth,
wherein overexpression of EPA6, EPA7 and/or YAK1 genes in said cell sample compared to the control cell culture, is indicative of the presence of a Candida strain forming a biofilm.
It will be further be noted, that in the case where the Candida strain consists of Candida glabatra, the gene whose mRNA level is measured is EPA6, EPA7 and/or YAK1 , whereas where the Candida strain consists of Candida albicans, the gene whose mRNA level is measured is YAK1.
Although the mRNA level is preferably quantified by RT-PCR, it will be understood that any method known to be suitable for the quantification of the level of mRNA, such as a hybridization assay, is within the scope of the present invention.
According to a further object of the invention, there is provided a method for selecting a biofilm formation inhibitor of a Candida strain acting through a Yak1 dependent pathway, comprising the following steps: a) contacting a compound with a biofilm of a wild type Candida strain, such as Candida glabrata, and determining if it inhibits biofilm formation of said Candida strain;
b) contacting the compound selected in a) with a biofilm of a sir4 mutant Candida strain, such as Candida glabrata, and determining if it inhibits biofilm formation of said Candida strain;
c) selecting the compound identified in a) if said compound inhibits the formation of biofilm of the wild-type Candida strain and do not inhibit the formation of biofilm of the sir4 mutant Candida strain.
Preferably, the above mentioned method for selecting a biofilm formation inhibitor may advantageously used the sir4 mutant Candida glabrata strain Cg145 of the present invention, which was filed at the CN. C. M. (Institut Pasteur, 25 rue du docteur Roux, 75724 Paris cedex 15, France) on November 30, 2005 under the reference number I-3532.
There is also provided an in vitro screening method for an inhibitor of the activity of a Yak1 polypeptide of Candida, comprising the steps of :
a) contacting a purified or isolated Yak1 recombinant polypeptide or a fragment thereof retaining the kinase activity with a candidate compound;
b) measuring the capacity of said candidate compound to inhibit the kinase activity of the Yak1 polypeptide or fragment thereof, said kinase activity being measured by a fluorescent and/or luminescent kinase assay. Preferably, the Yak1 recombinant polypeptide has an amino acid sequence substantially identical to SEQ ID NO: 1 , 4 or 10.
As one skilled in the art may appreciate; the selecting method of the invention may be combined with the in vitro screening method of the invention for selecting a biofilm formation inhibitor of a Candida strain acting through a Yak1 dependent pathway. In another embodiment, the present invention concerns a compound obtained by the above-mentioned in vitro screening and/or selecting methods of the invention. Such a compound has the capacity of affecting biofilm formation of a Candida strain, such as Candida albicans or Candida glabatra.
According to a further object of the invention, there is provided a method for detecting the presence or absence of a Candida biofilm in a sample, comprising the steps of:
a) contacting the sample with at least one molecule that specifically recognizes a Candida Yak1 , Epa7 or Epa6 polypeptide for a time and under conditions sufficient to form a complex; and
b) detecting the presence or absence of the complex formed in a).
It will be further be noted that in the case where the Candida strain is preferably Candida glabatra, the at least one molecule preferably specifically recognises the Yak1 , Epa7 or Epaβ polypeptide, whereas where the Candida strain is preferably Candida albicans, the at least one molecule preferably specifically recognises the Yak1 polypeptide.
As used herein, the term "sample" refers to a variety of sample types obtained from an individual and can be used in a detection assay or method.
The definition encompasses blood and other liquid samples of biological origin, solid tissue samples such as a biopsy specimen or tissue cultures or cells derived therefrom.
, According to preferred embodiments of the biofilm detection method of the invention and of the in vitro screening method of the invention, the Yak1 , Epaδ and Epa7 polypeptides comprise respectively an amino acid sequence substantially identical to SEQ ID NO: 1 (and 10 for Yak1 ) , 2 and 3 or functional derivatives thereof. By "substantially identical", it will be understood that the Candida Yak1 , Epaδ or Epa7 polypeptides contemplated by the present invention preferably have an amino acid sequence having at least 80% identity, or even preferably 85% identity, or even more preferably 95% identity to part or all respectively of SEQ ID NO:1 (and SEQ ID NO: 10 for Yak1 ), SEQ ID NO:2 and SEQ ID NO:3, or functional derivatives thereof.
Yet, more preferably, the Candida Yak1 , Epa6 and Epa7 polypeptides comprise an amino acid sequence having 100% identity respectively with SEQ ID NO:1 (and SEQ ID NO: 10 for Yak1 ), SEQ ID NO:2 and SEQ ID NO:3.
As used herein, the terms "polypeptide" and "protein" are used interchangeably to denote an amino acid polymer or a set of two or more interacting or bound amino acid polymers.
In this connection, the present invention further concerns a purified or isolated polypeptide involved in Candida biofilm formation. Such a polypeptide comprises an amino acid sequence substantially identical to SEQ ID NO: 1. The present invention is also concerned with a purified or isolated polynucleotide encoding the polypeptide contemplated by the invention. Such a polynucleotide preferably comprises the nucleic acid sequence SEQ ID NO: 5.
The invention further concerns a purified or isolated polypeptide having a kinase activity sensitive to N-MPP1 comprising the amino acid sequence SEQ ID NO: 9.
By "isolated" is meant, when referring to a polypeptide, that the indicated molecule is separate and discrete from the whole organism with which the molecule is found in nature or is present in the substantial absence of other biological macro-molecules of the same type. The term "isolated" with respect to a polynucleotide is a nucleic acid molecule devoid, in whole or part, of sequences normally associated with it 'in nature; or a sequence, as it exists in nature, but having heterologous sequences in association therewith; or a molecule disassociated frpm the chromosome.
Broadly defined, the terms "purified polypeptide" or "purified polynucleotide" refer to polypeptides or polynucleotides that are sufficiently free of other proteins or polynucleotide, or carbohydrates, and lipids with which they are naturally associated. The polypeptide or polynucleotide may be purified by any process by which the protein or polynucleotide are separated from other elements or compounds on the basis for instance, of charge, molecular size, or binding affinity.
A "functional derivative", as is generally understood and used herein, refers to a protein/peptide sequence that possesses a functional biological activity that is substantially similar to the biological activity of the whole protein/peptide sequence. In other words, it refers to a polypeptide or fragment(s) thereof that substantially retain(s) the capacity of being involved in fungal biofilm formation. A functional derivative of a protein/peptide may or may not contain post-translational modifications such as covalently linked carbohydrates, if such modification is not necessary for the performance of a specific function. The term "functional derivative" is meant to encompass the "fragments", "segments", "variants", "analogs" or "chemical derivatives" of a protein/peptide. As used herein, a protein/peptide is said to be a "chemical derivative" of another protein/peptide when it contains additional chemical moieties not normally part of the protein/peptide, said moieties being added by using techniques well known in the art. Such moieties may improve the protein/peptide solubility, absorption, bioavailability, biological half life, and the like. Any undesirable toxicity and side-effects of the protein/peptide may be attenuated and even eliminated by using such moieties. For instance, such a derivative with regards to Yak1 protein is a polypeptide having an amino acid sequence as shown in SEQ ID NO: 4 and comprising the sequence coding for the kinase activity.
One can use a program such as the CLUSTAL program to compare amino acid sequences. This program compares amino acid sequences and finds the optimal alignment by inserting spaces in either sequence as appropriate. It is possible to calculate amino acid identity or homology for .an optimal alignment. A program like BLASTp will align the longest stretch of similar sequences and assign a value to the fit. It is thus possible to obtain a comparison where several regions of similarity are found, each having , a different score. Both types of identity analysis are contemplated in the present invention.
Moreover and according to other preferred embodiments, the preferred
Yak1 , Epa6 and Epa7 amino acid sequences used in accordance with the biofilm detection method of the invention are preferably encoded respectively by a nucleotide sequence substantially identical to SEQ ID NOS: 5 (and 11 for
Yak1), 6 and 7, or functional fragments thereof.
By "substantially identical", it will be understood that the nucleotide sequence contemplated by the present invention preferably has a nucleic acid sequence which is at least 65% identical, more particularly 80% identical and even more particularly 95% identical to part or all of any one of SEQ ID NOS 5,
11 , 6 or 7 or functional fragments thereof.
A "functional fragment", as is generally understood and used herein, refers to a nucleic acid sequence that encodes for a functional biological activity that is substantially similar to the biological activity of the whole nucleic acid sequence. In other words, it refers to a nucleic acid that substantially retains the capacity of encoding a polypeptide involved in Candida biofilm formation.
The term "fragment", as used herein, refers to a polynucleotide sequence (e.g., cDNA) which is an isolated portion of the subject nucleic acid constructed artificially (e.g.', by chemical synthesis) or by cleaving a natural product into multiple pieces, using restriction endonucleases or mechanical shearing, or a portion of a nucleic acid synthesized by PCR, DNA polymerase or any other polymerizing technique well known in the art, or expressed in a host cell by recombinant nucleic acid technology well known to one of skill in the art. For instance, such a fragment with respect to YAK1 gene is a polynucleotide having a' nucleic acid sequence as shown in SEQ ID NO 8.
Amino acid or nucleotide sequence "identity" and "similarity" are determined from an optimal global alignment between the two sequences being compared. An optimal global alignment is achieved using, for example, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. MoI. Biol. 48:443-453). "Identity" means that an amino acid or nucleotide at a particular position in a first polypeptide or polynucleotide is identical to a corresponding amino acid or nucleotide in a second polypeptide or polynucleotide that is in an optimal global alignment with the first polypeptide or polynucleotide. In contrast to identity, "similarity" encompasses amino acids that are conservative substitutions. A "conservative" substitution is any substitution that has a positive score in the blosum62 substitution matrix (Hentikoff and Hentikoff, 1992, Proc. Natl. Acad. Sci. USA 89: 10915-10919). By the statement "sequence A is n% similar to sequence B", it is meant that n% of the positions of an optimal global alignment between sequences A and B consists of identical residues or nucleotides and conservative substitutions. By the statement "sequence A is n% identical to sequence B", it is meant that n% of the positions of an optimal global alignment between sequences A and B consists of identical residues or nucleotides.
As one skilled in the art may appreciate, the molecule preferably used in connection with the biofilm detection method of the invention is an antibody that specifically binds to said Yak1 , Epa6 or Epa7 polypeptides or functional derivative thereof. More preferably, the antibody is a monoclonal antibody.
As used herein, the term "specifically binds to" refers to antibodies that bind with a relatively high affinity to one or more epitopes of a protein of interest, but which do not substantially recognize and bind to molecules other than the one(s) of interest. As used herein, the term "relatively high affinity" means a binding affinity between the antibody and the protein of interest of at least 10"6 M, and preferably of at least about 10~7 M and even more preferably 10"8 M to 10"10 M. Determination of such affinity is preferably conducted under standard competitive binding immunoassay con'ditions which! is common knowledge to one skilled in the art.
As used herein, the term "antibody" refers to a glycoprotein produced by lymphoid cells in response to a stimulation with an immunogen. Antibodies possess the ability to react in vitro and in vivo specifically and selectively with an antigenic determinant or epitope eliciting their production or with an antigenic determinant closely related to the homologous antigen. The term "antibody" is meant to encompass constructions using the binding (variable) region of such an antibody, and other antibody modifications. Thus, an antibody useful in the method of the invention may comprise a whole antibody, an antibody fragment, a polyfunctional antibody aggregate, or in general a substance comprising one or more specific binding sites from an antibody. The antibody fragment may be a fragment such as an Fv, Fab or F(ab')2 fragment or a derivative thereof, such as a single chain Fv fragment. The antibody or antibody fragment may be non- recombinant, recombinant or humanized. The antibody may be of an immunoglobulin isotype, e.g., IgG, IgM, and so forth. In addition, an aggregate, polymer, derivative and conjugate of an immunoglobulin or a fragment thereof can be used where appropriate.
2. Methods of use and compositions
The compounds obtained by the screening/selecting methods of the invention may be used in many ways in the prevention and/or treatment of candidiasis, preferably caused by the formation of biofilm by Candida strains.
In this connection, another embodiment of the present invention relates to a composition for preventing and/or treating candidiasis, and more particularly for preventing and/or impairing the formation of biofilm by Candida strains. The composition of the present invention advantageously comprises a compound of the invention and an acceptable carrier.
As used herein, the term "impairing" refers to a process by which the formation or development of a Candida biofilm, such as one of C. albicans pr glabatra, is affected or completely destroyed. As used herein, the term "preventing" when referring to biofilm formation, refers to a process by which with the formation or development of a Candida biofilm, such as C. albicans or glabatra, is obstructed or delayed. When referring in general to candidiasis, the term "preventing or prevention" refers to a process by which the symptoms of candidiasis is obstructed or delayed. By the term "treating" is intended, for the purposes of this invention, that the symptoms of candidiasis be ameliorated or completely eliminated.
As used herein, the expression "an acceptable carrier" means a vehicle for containing the compounds obtained by the method of the invention that can be administered to a animal host without adverse effects. Suitable carriers known in the art include, but are not limited to, gold particles, sterile water, saline, glucose, dextrose, or buffered solutions. Carriers may include auxiliary agents including, but not limited to, diluents, stabilizers (i. e., sugars and amino acids), preservatives, wetting agents, emulsifying agents, pH buffering agents, viscosity enhancing additives, colors and the like.
Further agents can be added to the composition of the invention. For instance, the composition of the invention may also comprise other anti-fungal agents well known in the art.
The amount of compounds obtained by the method of the invention is preferably a therapeutically effective amount. A therapeutically effective amount of compound obtained by the screening/selecting method of the invention is the amount necessary to allow the same to perform their biofilm formation inhibitor role without causing overly negative effects in the host to which the composition is administered. The exact amount of compounds obtained by the method of the invention to be used and the composition to be administered will vary according to factors such as the mode of administration, as well as the other ingredients in the composition.
The composition of the invention may be given to an animal through various routes of administration. For instance, the composition may be administered in the form of sterile injectable preparations, such as sterile injectable aqueous or oleaginous suspensions. These suspensions may be formulated according to techniques known in the art using suitable dispersing or wetting agents and suspending agents. The sterile injectable preparations may also be sterile injectable solutions or suspensions in non-toxic parenterally- acceptable diluents or solvents. They may be given parenterally, for example intravenously, intramuscularly or sub-cutaneously by injection, by infusion or per os. Suitable dosages will vary, depending upon factors such as the amount of each of the components in the composition, the desired effect (short or long term), the route of administration, the age and the weight of the mammal to be treated. Any other methods well known in the art may be used for administering the composition of the invention.
Yet, another embodiment of the invention is to provide a method for preventing and/or treating candidiasis in an animal, the method comprising the step of administering to the animal a therapeutically effective amount of a composition as defined above. Preferably, the animal is a human, and even more preferably an immunocompromised human. An "immunocompromised subject" is an individual whose immune system is compromised or not functioning in a normal manner. For example, AIDS patients and patients undergoing immunotherapy are immunocompromised subjects. Further, various other conditions, such as certain cancers, viral infections and autoimmune diseases may render the affected individuals immunocompromised. Individuals who have undergone stem cell replacement therapy, bone marrow transplant, chemotherapy, radiotherapy and the like are also typically immunocompromised subjects.
The present invention further provides kits for use within any of the above detection and diagnostic methods. As described herein after, such kits typically comprise two or more components necessary for performing a ( detection or diagnostic assay. Components may be compounds, reagents, containers and/or equipment. ' j
Accordingly, there is provided a kit for the detection of the presence or absence of a Candida biofilm, comprising: at least one antibody that specifically binds to a Candida Yak1 , Epa7 or Epa6 protein;
a reagent to detect polypeptide-antibody immune complex;
optionally a biological reference sample lacking Yak1 , Epa7 or Epa6 polypeptides; and
optionally a comparison sample comprising Yak1 , Epa7 or Epa6 polypeptides which specifically bind to said antibody;
wherein said antibody, reagent, biological reference sample, and comparison sample are present in an amount sufficient to perform said detection.
In a first preferred embodiment of the detection kit of the invention, the
Candida strain is Candida glahatra and the at least one antibody specifically recognises the Yak1 , Epa7 and/or Epa6 polypeptide. In a second preferred embodiment of the detection kit of the invention, the Candida strain is Candida albicans and the at least one antibody specifically recognises the Yak1 polypeptide.
There is also provided a kit for the early diagnostic of a Candida strain forming a biofilm, comprising:
1 - specific primers for Candida EPA6, EPA7 and/or YAK1 genes;
. ' - specific probes for Candida EPA6, EPA7 and/or YAK1 genes;
- reagents for detecting the mRNA level of EPA6, EPA7 and/or YAK1 genes;
: - a control sample of Candida cell culture at an early planktonic growth phase;
- optionally a biological reference sample lacking EPA6, EPA7 and/or ;YAK1 polynucleotides; and - optionally a comparison sample comprising EPA6, EPA7 and/or YAK1 polynucleotides which specifically hybridize with said primers or probes;
wherein said primers, probes, reagents, biological reference sample, and comparison sample are present in an amount sufficient to perform said determination.
Specific primers for Candida EPA6 and EPA7 genes used in accordance with the diagnostic kit of the invention are preferably the following :
For EPA6 gene :
RT-EPA6F 5'cgctgtttgatacattaccac 3' (SEQ ID NO: 12)
RT- EPA6-7R 5' gaaggagtactattggtgatcg 3' (SEQ ID NO: 13).
For EPA7 gene :
RT-EPA7F 5' ccgaattagatcatttaccgg 3' (SEQ ID NO: 14)
RT- EPA6-7R 5' gaaggagtactattggtgatcg 3' (SEQ ID NO: 13).
As used herein, "specific probes" for Candida EPA6, EPA7 or YAK1 gene encompass polynucleotides substantially identical to the nucleic acid sequences of Candida EPA6, EPA7 or YAK1 polynucleotides as mentionned above or fragments thereof that retain the 'capacity to specifically hybridize with Candida EPA6, EPA7 or YAK1 polynucleotides as mentionned above under stringent conditions commonly used by the skill in the art.
The present invention will be more readily understood by referring to the following examples. These examples are illustrative of the wide range of applicability of the present invention and is not intended to limit its scope.
Modifications and variations can be made therein without departing from the spirit and scope of the invention. Although any methods and materials similar or equivalent to those described herein can be used in the practice for testing of the present invention, preferred methods and materials are described hereinafter.
EXAMPLES
EXAMPLE 1
The yakip kinase controls expression of adhesins and biofilm formation in Candida glabrata in a sir4p dependent pathway
Biofilm is the predominant type of microbial development in natural environments, and potentially represents a major form of resistance or source of recurrence during host infection. Although a large number of studies have focussed on the genetics of bacterial biofilm formation, very little is known about the genes involved in this type of growth in fungi. A genetic screen for Candida glabrata Biofilm mutants was performed using a 96-well plate model of biofilm formation. This study of the isolated mutant strains allowed the identification of four genes involved in biofilm formation (RIF1, SIR4, EPA6 and YAK1). Epaδp is a newly identified adhesin required for biofilm formation in this pathogenic yeast. EPA6 and its close paralogue EPA7 are located in sub-telomeric regions and their transcription is regulated by Sir4p and Rifi p, two proteins involved in sub-telomeric silencing. Biofilm growth conditions induce the transcription of EPA6 and EPA7: this is dependent on the presence of an intact sub-telomeric silencing machinery and is independent of the Mpki p signalling pathway. Finally, the kinase Yak1 p is required for expression of both adhesin genes and acts through a sub-telomeric silencing machinery-dependent pathway.
The aim of this study was to identify C. glabrata genes involved in biofilm formation. To date, two different approaches have been used to study biofilm genetics. On one hand, the use of insertional mutant collections has been particularly effective in identifying genes required for the early steps in bacterial biofilm formation (O'Toole et al., 1999). On the other hand, global expression . analysis comparing cells growing under biofilm conditions to those in a planktonic state of growth has revealed new elements which are specifically regulated during biofilm maturation (Whiteley et al., 2001 ; Schembri et al., 2003; Beloin et al., 2004). Similarly, transcriptome analysis has confirmed the unique physiology of C. albicans cells during biofilm formation (Garcfa-Sanchez et al., 2004).
In this study, a genetic screening strategy was used to identify genes involved in biofilm formation in C. glabrata. The inventors identified a new protein (Epaθp) which is the principal adhesin involved in biofilm formation in this yeast. Finally, the inventors demonstrated that the expression of EPA6 is regulated both by the Yakip kinase and a biofilm signal which involve a pathway dependent on the sub-telomeric silencing machinery.
Results
C. glabrata strain BG2 forms biofilm
When incubated in a 24 well plate and in the presence of a plastic slide, C. glabrata grew as a thin biofilm on this plastic surface where C. glabrata formed tridimentional structures (Figure 1). Although the technique used to prepare the cells does not usually allow the observation of the exopolymeric matrix, residual polymeric structures are visible at the highest magnification. In contrast with C. albicans biofilms, usually composed of a mix of yeast and hyphae, C. glabrata biofilms are composed of budding yeasts only with no evidence of filamentation or pseudo filamentation on any media tested in this study. When C. glabrata strain BG2 was incubated in a microtiter plate, similar biofilm growth was observed on the surface of the wells. Less than 0.1% of the cells in the wells were in the planktonic state. Moreover, no cell accumulation at the bottom of the yvells due to sedimentation was visible. After washing out the less adherent cells, the number of cells strongly adherent to the plastic surface was estimated using a colorimetric assay based on XTT reduction (Ramage et al., 2001). By analyzing the relationship between the cells growth phase and their ability to adhere to the plastic surface and form biofilm, we showed that C.glabrata cells in the stationary phase had greater adherence than those in the logarithmic growth phase (Figure 2A).
Identification of C. glabrata mutant strains with altered ability to form biofilms An insertional mutant library (Cormack and Falkow, 1999) was used to isolate C. glabrata strains with increased ability to form biofilm (phenotype Biofilm++) or those which were partially or completely defective in terms of biofilm formation (phenotype Biofilm-). The inventors plated 5000 mutant cells on YPD, replicated them individually into 96-well microtiter plates and incubated the resulting cultures at 370C (see Experimental procedures). After elimination of the least adherent cells, we used the XTT assay to estimate the quantity of cells which adhered strongly to the plastic surface. So as to be able to identify Biofilm++ and Biofilm-strains, measurements were made after 1 hour of incubation with XTT - this is a time point at which XTT is not completely reduced by the wild type strain (Figure 2B). the inventors identified 72 Biofilm- mutants (chosen arbitrarily as having less than 30% of the number of adherent cells seen with the wild type strain) and 44 Biofilm++ mutants (chosen arbitrarily as having more than 200% of the number of adherent cells seen with the wild type strain). The eight mutants that yielded the lowest XTT reductase activity and the twelve that yielded the highest activity were selected for further analysis. The inventors confirmed that these Biofilm mutant strains had the same growth rate under planktonic conditions as the wild type strain (with, the same media and temperature used to grow biofilms). Moreover, as the enzyme reducing XTT in yeast is a mitochondrial dehydrogenase (Baillie and Douglas, 1999), the inventors checked that these Biofilm mutant strains were not affected in their mitochondrial metabolism by plating them on YPG (2% glycerol) medium. Figure 3A shows a typical example of the structures produced by Biofilm- and Biofilm++ strains in the thermanox slide model of biofilm formation. In synthetic medium, the original strain and the Biofilm- strain (CG129) produce small structures that differ by their size and density. In the other hand, the Biofilm++ strain (CG137) formed large tridimentional structures that nearly completely covered the surface of the plastic slide. In the 96-well plate model of biofilm formation, and after washing away the less adherent cells from the well surface, the original BG2 strain showed small colonies of between two cells and one hundred cells adhering to the plastic, whereas Biofilm- mutants were seen to be single cells or as colonies of less than ten cells (Figure 3B). However, the total number of cell clusters on the plastic surface did not seem to be affected in these two mutants, as compared to the wild type strain. In contrast, a confluent or near-confluent layer of cells was observed for Biofilm++ mutant strains.
Of the 20 mutants studied, the inventors were able to identify 15 insertion sites for the plasmid used for insertiona! mutagenesis. For the five remaining strains, the inventors were unable to recover any plasmid: it is likely that these plasmids had undergone too many alterations and that the insertion site could not be sequenced. The sequences obtained were compared by blast analysis with the genome sequence of C. glahrata strain ATCC2001 (Dujon et al., 2004). A high proportion of insertion sites were intergenic (7 out of 15). This result is in good agreement with a previous analysis of the mutant library used in this study, which showed that insertion sites for many of these strains were located in intergenic regions (Cormack and Falkow, 1999). The present example will focus on a detailed analysis of four mutant strains (two Biofilm++ and two Biofilm-).
Epaβp is a newly identified adhesin involved in biofilm formation
In the CG122 strain (Biofilm-), the l/Ry43-cassette was inserted 1019 bp upstream of a 2145-nucleotide open reading frame (CDS1045.1) encoding a protein 35% identical to the previously identified Epaip adhesin (Cormack et al., 1999). This newly identified EPA gene was designated EPA6. Epa6p shares all the features of an Epa protein, i.e. a peptide signal, a C-terminal putative transmembrane domain, numerous putative N- glycosylation sites and a serine- /threonine-rich domain of 295 amino acids respectively (Frieman et al., 2002). In the ATCC2001 strain, the EPA6 gene is located within one of the two subtelomeric regions of chromosome 3. A 10 kb sequence 98% identical to the EPA6 DNA sequence was identified at the other sub-telomeric end of this chromosome (Dujon et al., 2004). The inventors reasoned that this EPA6 paralogue could be present in the BG2 genome as well. The inventors therefore amplified the complete EPA6 ORF from BG2: restriction analysis of the amplified PCR product indeed revealed the presence of another EP>46-related gene, which was named EPA7 (Figure 4A). These two EPA genes encode proteins of 715 and 714 amino acids respectively and share 95% percent identity at the nucleotide level. We deleted EPA6 by replacing a large part of the open reading frame by the URA3 marker (see Figures 4A and 4B). One should note that the disruption cassette used to delete EPA6 could also theoretically disrupt EPA7. However, none of the 60 screened transformants carried mutations in the EPA7 gene, whereas 6 independent epaβ .::URA3 strains were obtained.
The inventors next tested the respective contributions of the Epa adhesins to C. glabrata biofilm formation. Whereas the quintuple epa1Δ-epa5Δ mutant strain was very slightly affected in terms of biofilm formation (75 ± 14%) as compared to the original strain (Figure 5A), the epaβΔ strains displayed a clear Biofilm- phenotype, with 30 ± 5% adherent cells as compared to the parent strain (Figure 5A). The characteristics of this biofilm defect match those observed in the originally isolated epa6-1 mutant, indicating that Epaβp is the main adhesin involved in biofilm formation in C. glabrata.
EPA6 and EPA7 expression is induced in biofilm
An EPA6-EPA7 sequence comparison allowed the inventors to identify specific primers for each gene that could be used to study their respective transcription under planktonic and biofilm culture conditions through RT-PCR analysis. The specificity of the EPA6 primers was confirmed using genomic DNA from the epaβΔ strain, with genomic DNA from BG2 as a positive control. The results of the RT-PCR experiments are presented in Figure 5B and demonstrated an increase (2.4 ± 0.3 fold) in EPA6 transcript levels in biofilm, compared to planktonic cultures. The inventors did not observe PCR amplification products from RNAs of epaβΔ mutant strains, thereby confirming the specificity of the EPA6 primers. The study of the expression of EPA6 at different stages of growth in pianktonic condition (Figure 5C) demonstrated that EPA6 gene is transcribed at the highest level during the late stationary growth phase, consistent with the increased ability of stationary phase cells to form a biofilm and the role of Epaδp in this process. This contrasts with other EPA genes previously identified, which are either expressed during exponential growth (EPA1) or not at all (EPA2-EPA5) (Cormack et ai, 1999; De las Penas et ai, 2003). Very low levels of the EPA 7 transcript were detected in pianktonic cultures, while (as with EPA6) increased levels were observed in biofilm (Figure 5B). Similarly, EPA1 to EP/45 were not expressed in pianktonic cultures. These results demonstrate that the expression of EPA6 and EPAl is induced in biofilm, and show the existence of a response to the biofilm lifestyle.
EPA6 and EPA7 transcription is controlled by ΥAK1
Further analysis of the Biofilm- mutant strains revealed that in two cases the plasmid had inserted within an ORF encoding a protein with 58% similarity at the amino acid level to the S. cerevisiae Yaki p protein. Originally isolated as a suppressor of a ras1 temperaturesensitive mutant, YAK1 deletion conferred growth on a tpk1 tpk2 tpk3 triple mutant strain in S. cerevisiae (Garret and Broach, 1989). Yaki p participates in a pathway parallel to that of the cAMP- dependent protein kinase (PKA): it has overlapping targets but antagonistic effects, and seems to be involved in mediating the starvation signal (Wemer- Whashburne et ai, 1991 ). The inventors transformed the BG14 strain (lira-) using an EcoRI digested plasmid containing the URA3 gene and the sequences surrounding the insertion site from the original yak1 mutant strain: 90% of the transformants displayed the same Biofilm- phenotype as the original mutant. As assayed by XTT analysis, the transformants had 30 ± 18% adherent cells, compared to the wild type strain (Figure 5A). As the numbers of adherent cells for the yak1 (CG129) and the epaβΔ (CG164) mutant strains we're nearly identical (see Figure 2), the inventors studied transcription levels for EPA6 and EPA 7 in the yak1 mutant strains. As shown in Figure 5B, YAK1 is required for the transcription of EPA6 and EPA7 under both pianktonic and biofilm conditions. EPA6 transcription is regulated by sub-telomeric silencing
When the inventors studied the growth of the epaβΔ strain (CG 164) on SD and FOA media, they noticed that it was able to grow on both media (Figure 6). This result indicated that some of the epaβΔ cells expressed the URA3 gene (allowing strains to grow on SD) whereas the remainder had a silent URA3 gene (allowing them to grow on FOA). In S. cerevisiae, epigenetic gene silencing has been shown to occur at the silent mating-type loci HML and HMR or within sub-telomeric regions and the tandem rDNA array (Sherman and Pillus, 1997; Lustig, 1998). At subtelomeric loci, silencing is mediated by a multiprotein complex within which the Sir2/3/4 silent information regulator proteins play critical roles (Huang, 2002). The telomeres contain multiple Rap1 p-binding sites that recruit the Sir complex: the Sir-Rap1 interaction is then competed by two Rapi p interacting factors (Riflp and Rif2p) (Huang, 2002). In the ATCC2001 strain, EPA6 is located in a sub-telomeric region of chromosome 3. Moreover, in two Biofilm++ mutants, insertion sites were located just upstream of genes encoding proteins involved in sub-telomeric silencing. Thus, the CG137 and CG140 strains had the plasmid insertion site 925 bp and 430 bp upstream of the SIR4 homologue (CDS0129.1 ) and RIF1 homologue (CDS0069.1 ) of C. glabrata, respectively. CgSir4p and CgRifl p show 17.8% and 24.8% amino acid identity with their respective S. cerevisiae orthologues. When SIR4 was deleted in an epaβ .::URA3 mutant strain, the variegation of URA3 gene expression was abolished and the epaβΔ sir4Δ double mutant strain (CG170) was not able to grow on FOA medium (Figure 6). As expected, sir4Δ (CG160) and rif1Δ (CG149) strains displayed a Biofilm++ phenotype, thus confirming that sub-telomeric silencing regulates biofilm formation in C. glabrata (Figure 7A). Accordingly, rap1-21 and sir3 . strains (De las Penas et al., 2003) , were also Biofilm++ (Figure 7A).
Measurements of EPA6 expression in these strains showed that the Biofilm++ phenotype was associated with significant overexpression of the EPA6 gene (Figure 7B). However, the epaβΔ. sir4Δ double mutant strain (CG170) displayed the same level of biofilm formation as the single sir4Δ mutant strains: this shows that in a sir4Δ background, the EPA6 gene is not necessary for the expression of a Biofilm++ phenotype (Figure 7B). One should note that in the sir4Δ and to a lower extent in the rif1Δ. strains, EPA7 and EPA1-EPA5 were also overexpressed suggesting that other Epa proteins could be subject to sub-telomeric silencing in this context (Figure 7B).
The biofilm signal and Yakip act through a sub-telomeric silencing -dependent Mpkip independent pathway
In order to determine whether or not Yaki p regulation of EPAQ transcription was dependent on the sub-telomeric silencing machinery, the inventors constructed a yak1 sir4Δ double mutant strain. As shown in Figure 8A, a yak1 mutation in a sir4Δ context did not affect cell adherence, and yak1 sir4Δ strains were Biofilm++. Moreover, EPA6 and EPA7 transcription levels were still higher than in the original strain. These results show that Yaki p regulates the transcription of C. glabrata adhesins via a sub-telomeric silencing- dependent mechanism.
In order to determine whether the biofilm signal responsible for the increase of EPA6 expression in biofilm as compared to planktonic growth conditions was acting via regulation of sub-telomeric silencing, the inventors compared EPA6 and EPA7 expression in a sir4Δ strain under both circumstances. As shown in Figure 8B, no apparent further increase of the EPA6 and EPA 7 transcription levels were detectable in biofilms (compared to planktonic growth conditions) in any of the, sub-telomeric silencing mutant strains. Thus, a mutation in any of the proteins involved in sub-telomeric silencing seems to suppress the inducibility of C. glabrata adhesin encoding genes in response to biofilm growth conditions. This shows that the biofilm signal regulates sub-telomeric silencing.
In S. cerevisiae, regulation of sub-teloπSeric silencing by stress (but not by nitrogen starvation) acts via Sir3p phosphorylation by the Mpkip kinase (Ai et a/., 2002), i.e. part of the cell wall integrity pathway. We reasoned that Mpk1 p could be also a key kinase for the regulation of sub-telomeric silencing in response to biofilm growth conditions. We identified the MPK1 gene in the C. glabrata genome. It encodes a protein showing 76 % identity with the S. cerevisiae homologous protein. Even though the deletion of Mpki p increased EPAQ and EPA 7 transcript levels during planktonic growth, it did not abolish its biofilm dependent inducibility (Figure 8). The biofilm signalling pathway therefore appears to be Mpk1 pindependent.
Discussion
EPA6 encodes the main adhesin for biofilm formation in C. glabrata In this study, the inventors demonstrated that Epaδp represents the main adhesin involved in biofilm formation in C. glabrata. Indeed, epaQΔ strains are Biofilm-, and EPAQ transcription is induced by biofilm growth conditions. Epa7p does not seem to play a major role in biofilm formation, since yak1 strains which do not express EPAQ and EPA7 had a Biofilm phenotype comparable to that of epaQΔ strains. However, epaQΔ strains do not seem to be impaired in terms of adherence to a plastic surface per se. As shown in Figure 3B, it is the size of the colonies adhering to the plastic surface that is affected in epaQ . strains, not their number. This result suggests that Epaδp is not involved in adherence to the plastic surface as such but rather in cell-cell adherence within the biofilm. The fact that the closest homologue of Epa proteins in S. cerevisiae is FIo11 p (a protein known to be involved in cell flocculation and in biofilm formation) supports this hypothesis (Reynolds and Fink, 2001 ; Halme et al., 2004).
Theoretically, the adhesin candidate responsible for adherence to a plastic surface should be expressed under planktonic and biofilm growth conditions but should not be subject to Yakip regulation since YAK1 deletion does not prevent adherence to the plastic (see below). In a recent report, De Ia Penas and colleagues estimated that they may be at least 16 different EPA genes in the C. glabrata ATCC2001 genome (De las Penas et al., 2003). It is not yet known whether one or more of the other Epa proteins or other types of adhesin (i.e. glucan- or protein-based) are responsible for adherence to plastic in C. glabrata. Yakip acts through a sub-telomeric silencing machinery dependent pathway in C. glabrata
The inventors demonstrate here that Yak1 p is necessary for EPA6 and EPAl expression. Moreover, these phenotypes are bypassed by a mutation in one of the genes encoding proteins necessary for sub-telomeric silencing. These results show that Yakip acts through a sub-telomeric silencing- dependent mechanism. It remains to be found whether Yaki p is itself regulated by biofilm growth conditions. In S. cerevisiae, Yaki p has been shown to be regulated at three levels: firstly, its specific activity is regulated by nitrogen starvation and stationary phase status (Garret et al., 1991 ). Secondly, the same signals also regulate the level of expression of its encoding gene. Thirdly and finally, nuclear localization is induced by glucose starvation or rapamycin treatment (Schmelzle et al., 2004; Moriya et al., 2001 ). In response to glucose removal, Yaki p associates with Bmh1p-Bmh2p, enters the nucleus and phosphorylates Pop2p, a component of a multiprotein complex that regulates gene expression both positively and negatively (Moriya et al., 2001). Yakip regulates also the nucleocytoplasmic localization of the PKA regulatory subunit Bcyi p (Griffioen et al., 2001). The action of Yakip thus appears to be very complex and multifactorial. Furthermore, in Dictyostelium discoideum, YakA is necessary for starvation-induced growth arrest and the starvation-induced induction of genes necessary for development (Mendes Souza et al., 1998). In C. glabrata, YAK1 transcription level was not affected by biofilm growth conditions, although this kinase seems to be necessary for shifting from planktonic growth to growth under biofilm conditions. The present working model for the regulation of sub-telomeric silencing by biofilm growth in Candida glabrata is presented in Figure 9. In this model, expression of the Epa adhesins is controlled by subtelomeric silencing which in turn is regulated by a biofilm signal acting through or independently of Yak1 p.
Modulation of sub-telomeric silencing by Rifip and MpMp in C. glabrata
The results presented here show that C. glabrata adhesins are regulated by a biofilm signal and Yakip via a sub-telomeric silencing machinery- dependent mechanism. In yeast, Sir3p is the limiting factor for propagation of silencing in sub-telomeric regions (Stone and Pillus, 1998) and the only kinase identified to date as being involved in Sir3p phosphorylation (and subsequently in the regulation of sub-telomeric silencing) is Mpki p (Ai et al., 2002). In response to stress (but not to nitrogen starvation), Mpki p is activated and phosphorylates Sir3p, thus repressing sub-telomeric silencing. This leads to expression of the PAU genes located in the sub-telomeric region encoding cell wall proteins (Ai et al., 2002). Additional factors (such as starvation, heat shock or the presence of mating pheromone) can affect Sir3p phosphorylation and sub-telomeric silencing (Stone and Pillus, 1996; Ai et al., 2002). In this study, the inventors demonstrated that biofilm-induced regulation of sub-telomeric silencing was not dependent on Mpki p. However, the function of Mpki p in C. glabrata seems to differ slightly from that of its S. cerevisiae counterpart. Indeed, deletion of MPK1 in C. glabrata increases EPA6 transcription, most probably due to modulation of sub-telomeric silencing, whereas in S. cerevisiae deletion of the same gene does not modify the constitutive level of sub- telomeric silencing (Ai eif al., 2002). The function of Riflp seems also to be different in C. glabrata when compared to S. cerevisiae. Indeed, in the latter organism, Rifl p acts as a negative regulator of telomeric silencing and length (Moretti et al., 1994), whereas deletion of RIF1 in C. glabrata derepresses the expression of the EPA genes located within sub-telomeric regions. These results suggest that the overall mechanisms of sub-telomeric silencing are not conserved between these two hemiascomycetous yeasts, even though the same constitutive elements are present.
Variegation of EPA6 expression suggests phenotypic heterogeneity of the cell surface in C. glabrata
The inventors demonstrated that in a epa6Δ::URA3 cell population, some cells were Ura+ and others were lira-. This result shows that in a BG2 cell population, some cells express the EPA6 gene at the cell surface whilst others do not. Similar results were obtained with the other EPA genes identified to date (De las Penas et al., 2003). Moreover, previous studies in S. cerevisiae have shown that the degree of silencing within sub-telomeric regions differed from one chromosome end to another (Pryde and Louis, 1999). One can thus imagine that the Epa organization at the cell surface of a clonal C. glahrata cell population is highly heterogeneous.
Experimental procedures
Strains and media
Candida glabrata strains used in this study are listed in Table 1 : all strains were isogenic to the BG2 strain (Fidel et at., 1996). The SC and -Ura DO synthetic media and the YPD rich medium were prepared as previously described (Sherman, 1992). When needed, 5-fluoroorotic acid (FOA) was added to SC medium at 1g/l. The bacterial strain Escherichia co// XL1 -blue (Stratagene, La JoIIa, CA) was used for propagation of all plasmids. All procedures for manipulating DNA were performed as previously described (Sambrook et a/., 1989).
' Biofilm formation
' C. glabrata strains were grown to stationary phase with agitation in SC medium at 37°C. Cells were then harvested by centrifugation, washed in sterile water and resuspended in SC or YPD medium at a cell density adjusted to OD600 = , 1. For the plastic slide model of biofilm formation, these cell suspensions were distributed into prestelirized polystyrene 24-well plates (TPP) in which a round plastic slide was added (Thermanox, Nunc). After 24h of growth at 37°C, the culture medium was eliminated firstly by inverting the plates and secondly by
' careful pipetting. Biofilm were then examined by scanning electronic microscopy
(SEM) as previously described (Prigent-Combaret et ah, 2000). Briefly, biofilm i samples were fixed for 1 h in 0.07 M sodium cacodylate buffer (pH 7.3) containing 1.2% glutaraldehyde and 0.05% ruthenium red. The samples were then washed in the same buffer containing 0.05% ruthenium red and postfixed
, in 1 % osmium tetroxide in cacodylate buffer, treated by the critical point drying
1 method, and observed on a Gemini DSM 982 scanning electron microscope. Transmission and scanning electron microscopy were performed by Brigitte Arbeille and Claude Lebos at the Laboratoire de Biologie Cellulaire et Microscopie Electronique, UFR Medecine, Tours, France. For the microtiter plate model of biofilm formation, the cell suspension in SC medium were distributed (100 μl per well) into presterilized, polystyrene 96-well microtiter plates (TPP, round bottom) and incubated overnight at 37°C. Following biofilm formation, less adherent cells were removed by washing the plates three times in water and once in PBS buffer. Strongly adherent cells were quantified by using the previously described metabolic 2,3-bis(2-methoxy-4-nitro-5- sulfophenyl)-2/-/-tetrazolium-5-carboxanilide (XTT, Sigma) reduction assay (Ramage et ai, 2001 ). Briefly, XTT solution was prepared at 0.5 mg/ml in PBS, filter-sterilized and stored at -200C. Prior to each assay, an aliquot of stock XTT was thawed and methadione (1 μM final) was added. A 100 μl aliquot of the XTT-methadione solution was added to each well. The microtiter plates were then incubated for 1 hour at 37°C. A colorimetric change was measured at 492 nm using a microtiter plate reader (Labsystems Multiskan RS).
Characterization of the URA3-cassette insertion site in the Biofilm mutant strains The mutant library used for screening for Biofilm mutant strains has been previously described (Cormack etai., 1999). In order to determine the sequence of the L/Ry43-cassette insertion site, the genomic DNA was extracted (Philippsen et al., 1991) and digested by EcoRI. After ligation and amplification in E. coli, a plasmid containing the l/ft43-cassette and the genomic flanking regions was recovered. The sequence of the insertion site was then determined using M13-40 and M13-REV48 as sequencing primers.
Gene disruption ' I
The disruption cassette was constructed by PCR fusion using a similar strategy to that used by Kuwayama and colleagues (Kuwayama et al., 2002). For EPA6, upstream and downstream gene fragments and the URA3 marker were PCR- amplified using the HFPCR kit from Clontech (Palo Alto, CA). The primers used for these amplifications are listed in Table A (supplementary material), and their positions are shown in Figure 4. EPA6-3'5 and EPA6-5'3 contain the reverse complements of MKRfEPAδ and MKRrEPAδ, respectively. In addition, 5 ng of each of the three gel-purified, amplified fragments were used as substrates for PCR fusion with the primers EPA6-5'5 and EPA6-3'3 and the following programme: 94°C for 30s, followed by 35 cycles of 94°C for 15s and 68°C for 4 min. The final PCR fragment represented the epaβ .::URA3 cassette. The BG14 (ura3) strain was transformed with the deletion cassette as previously described (Cormack and Falkow, 1999), and Ura+ transformants were then selected on - URA DO plates. Proper integration of the cassette was determined by PCR using a primer that annealed to a region outside the disruption cassette (EPAβex) and a primer that annealed to a sequence within the marker (URA3F) (Figure 4A, Table A). The inventors screened 55 colonies and identified 6 putative, homologous integrants. A second pair of primers was used to check for correct integration of the cassette (EPA6ex2-URA3R) (Figure 4A, Table A). PCR amplifications of the EPAβex - EPA6ex2 region were used to verify the knock-out of the wild-type gene in each putative deletion strain (Figure, 4A, Table A). Furthermore, Southern blot analysis was used to confirm gene deletion. A similar strategy was used to disrupt SIR4, RIF1 and MPK1. Concerning YAK1, the plasmid recovered from the original yak1::URA3 strains was used to transform the strain BG14 after EcoRI restriction. Primers for both outer regions of the cassette in the C. glabrata genome were used to scree'n for transformants having integrated the cassette in the YAK1 locus. Southern, blot analysis was performed to confirm gene deletion. So as to construct a double mutant sir4Δ epaβΔ and sir4Δ yak1 strain, a spontaneous Ura- derivative of a sir4Δ::URA3 strain was isolated on FOA medium. The stability of the Ura- phenotype was tested by growing the cells on YPD medium and plating them on FOA and SD media. The inventors'; also checked that the Biofilm++ phenotype was not affected by this mutation. This sir4Δ::ura3 strain was then used as a recipient strain for constructing the sir4Δ epaβΔ and sir4Δ yak1 double mutants, using the same strategy as with the corresponding single mutant strains. RNA preparation and RT-PCR
Cells were grown to stationary phase on SC medium, under agitation for planktonic growth conditions or in microtiter plates for biofilm growth conditions. Total RNA from 106 cells was prepared as previously described (Schmitt et a/., 1990). The purified RNA was treated with DNase to eliminate any trace of DNA, and was then used to isolate the mRNA using the oligotex mRNA kit (Qiagen). RT-PCR was performed by using the Access RT-PCR system kit (Promega) and an lcycler (Biorad) thermocycler. After RNA denaturation (68°C for 5min), the reverse transcription step was performed at 48°C for 45 min followed by 2min at 94°C. PCR amplifications were carried out as follows: 2 min at 940C (one cycle) 94°C for 30 sec, 580C for 1 min, 68°C for 1 min (30 cycles) and 68°C for 7 min (one cycle). The primers used for the RT-PCR are listed in Table A (supplementary material). ACT1 was used as the control. For each preparation and each couple of primers, PCRs without the reverse transcription step were performed to check that preparations were free of DNA. Three independent RNA preparations were prepared from each strain and growth condition. In order to compare the expression of EPAQ in each strain and each growth condition, serial dilutions of the PCR products (ACT1 and EPA6) obtained with the BG2 strain under planktonic growth conditions were deposited in an agarose gel, and curves of the ratio of the fluorescence of the bands and the dilutions' were drawn. The fluorescence of each electro p ho retic band was measured using a VersaDoc Imaging System (Biorad) apparatus and Quantity One 4.3.1 software (Biorad). For each sample, appropriate dilutions of the PCR products were deposited on agarose gels and their fluorescence was compared to the standard curves. EXAMPLE 2
The mechanism of action of YAKI on biofilm formation in C. albicans is different from the one previously identified in C. glabrata
YAK1 is necessary for biofilm formation in Candida glabrata. A strain in which YAK1 has been deleted produced only 30% of biofilm as compared to the original strain. We identified the target of YAK1 regulation in C. glabrata. Thus, the gene EPA6 which encodes an adhesin necessary for biofilm formation is not expressed in a yak1Δ strain. EPA6 as all the other members of this adhesins family identified to date is located within a sub-telomeric region of the C. glabrata genome and its transcription is regulated by the sub-telomeric silencing machinery. The present results show that YAK1 regulates the expression of EPA6 and consequently biofilm formation through the regulation of sub- telomeric silencing level. In Candida albicans, none adhesin has been shown to be individually necessary for biofilm formation. This development state in C. albicans seems to be under the control of multiple factors. Moreover, no sub-telomeric localization of the C. albicans adhesin genes has been demonstrated. YAK1 in C. albicans, seems to act on biofilm formation through a mechanism completely different from the one we have identified in C. glabrata.
Inactivation of the CaYAKI gene was conducted in C. albicans strain RM1000 (ura3Δ::λimm434/ ura3Δ::λimm434 his1Δ::hisG/ his1k:hisG; Alonso- Monge et al., 2003) according to the procedures of Enloe et al. (2000) and GoIa et al (2003). Briefly the URA3 and HIS1 markers of pFA-Ura and pFA-His, respectively (GoIa et al., 2003), were amplified using the following oligonucleotides and standard conditions for amplification :
Yak1-5p 5'-
CAAACAAAACGCAAGAGATCACATACCATTAATAATATATAAGACCAACCAT TGTAACCACACAAAGTATCACAGTATCACCGACAAATTTATACATAGAAGCT TCGTACGCTGCAGGTC-3' Yak1-3p 3'-
TAAACAAAATTAATTAAAAAGTATCATTAAAGAGTATAAAACTTAATACTGGT CAACCTCCCCCTCCCTCCACATTGTTATTCTTATTCTTATTCTTCTGATATCA TCGATGAATTCGAG
with the underlined regions corresponding to the pFA plasmids and the non- underlined regions corresponding to regions of the caYAKI gene (YAK1 of C. albicans) located 5' or 3' of the open reading frame: The resulting PCR products were used to transform C. albicans RIM1000 cells prepared according to Walther and Wendland (2003). Ura3+ or HIS1 + transformants were selected on appropriate media and the replacement of one copy of the CaYAKI gene in these transformants was confirmed by PCR using standard procedures. Ura3+ or His+ transformants were subsequently transformed by the PCR-amplified HIS1 or URA3 markers, respectively, using the same technique. Transformants were selected for prototrophy and replacement of the second caYAKI allele was confirmed by PCR.
The resulting C. albicans ura3/ura3 his1/his1 yak1 A ::URA3/yak1 A ::HIS1 strains were tested for their ability to form biofilms in two model of biofilm formation on a plastic surface. The first model is based on the use of a micro- fermentor containing a Thermanox™ slide which has been previously described (Garcia-Sanchez et a/., 2004). In the second model, Thermanox™ slides are incubated at 37°C in minimal medium in a glass tube under continuous rotation for 2-48h. In both models the C. albicans yak1Δ/yak1A strains were unable to develop a biofilm of significant biomass. Yet, observation of the Thermanox™ slide obtained using the second biofilm model revealed that the mutant strain was able to form microcolonies on the plastic surface. These micro-colonies consisted mostly of yeast cells with some hyphal or pseudo-hyphal forms (figure 10). The resulting C. albicans ura3/ura3 his1/his1 yak1A ::URA3/yak1A ::HIS1 strains were tested for their ability to produce hyphae in Lee's medium (Lee et ah, 1975) which triggers the yeast-to-hypha transition in C. albicans. As shown in the figure 10, in contrast to wild-type C. albicans which readily forms hyphae after a few hours of incubation in Lee's medium, no true hypha was visible with the mutant strain and only pseudo-hyphae were observed.
Taken all together, these data show that the Yak1 kinase is necessary for the switch from yeast-to-hypha growth and for the switch from planktonic to biofilm growth in C. albicans.
EXAMPLE 3
Role of YAK1 on biofilm formation in C. albicans
Experimental procedures
Biofilm and cultures.
An inoculum was prepared from an early-stationary-phase culture grown in flasks at 300C in an orbital shaker and diluted to an optical density at 600 nm (OD6Oo) of 1. Biofilms were produced in microfermentors (Ghigo J. M., 2001 ). These consist of a glass vessel with a 40-ml incubation chamber where two glass tubes are inserted to drive the entry of medium and air. Used medium is evacuated through a third tube. Medium flow is controlled by a recirculation pump (Ismatec) and pushed by the pressured air. Plastic slides (Thermanox; Nunc) glued to a glass spatula were immersed in the inoculum for 30 min at room temperature. After this adhesion period, the spatula was transferred to the chamber and incubated at 370C, with the medium flow set to 0.6 ml/min and air supplied at 105 Pa; under these conditions, the growth of the planktonic phase is minimized and most of the cells remain on the spatula. For biofilm formation C. albicans strains were grown in 0.67% yeast nitrogen base (YNB; Difco) with 0.4 % glucose. uridine 80 mg/liter, arginine 100 mg/liter, histidine 100 mg/liter, methionine '200 mg/liteπ. After 40 hours, spatula was removed from microfermentors, biomass is scrapped from the thermanox, and then filtered on a 0, 22mm membrane, then dry at 700C for 3 days. Amount of biomass is then quantified by dry weight. ' Germ tube formations.
Germ tubes formation was determined in Lee (Lee et al., 1975) media at 370C after 3 hours of induction, in the presence or absence of 4-Amino-1-tert- butyl-3-(1 '-naphthyimethyl)pyrazolo[3,4-d]pyrimidine (NMMP1 ) (1mM). (Toronto Research Chemicals Inc. Canada) (Bishop et al., 1999).
Engineered YAK1 protein kinase
Engineered of protein kinases that contain an unique binding pockets that are not present in any wild-type protein kinase have been described by Bishop et al., 2000. Substitution of one amino acid in the ATP-binding sites conferred unique inhibitor-sensitivity to NMPP1 , ah ATP analogue. By sequence comparison with other protein kinases, we proposed that the conserved Phe at position 507 was part of the ATP-binding sites. A mutation of Phe (507) to Alanine was introduced using PCR techniques. In this example, the inventors show that the Yak1 protein plays an important role in the formation of biofilm in C. albicans. Indeed, and as illustrated in figure 11 , the inventors have restored the capacity of a double mutant ΔyakU Ayaki of C. albicans to form biofilm by reintroducing in such a strain the wild-type gene of YAK1. Secondly, the inventors have introduced an allele of the YAK1 gene sensitive to N-MPP1 in a double ΔyakH Ayaki of C. albicans strain. As shown in figures 11 , 12 and 13, in absence of N-MPP1 , the mutated kinase is active and the double mutated strains containing the allele of the YAK1 gene sensitive to N-MPP1 have the capacity of forming normal filament when the filamentation is induced in LEE medium. Whereas and as shown in figures 12 and 13, in presence of low concentration of N-MPP1 , the capacity of the mutated kinase is specifically inhibited and the strains have thus lost their capacity of forming filaments.
The inventors have further noted from assays with preformed filaments, that these filaments did not further develop but rather returned to their planktonic stage when the activity of the mutated kinase was inhibited by N- MPP1. EXAMPLE 4
Identification of in vivo inhibitors ofbiofilm formation in Candida
The kinase focused collection (ChemDiv, Inc) will be screened to select inhibitors of biofilm formation in a Yakip-dependent or -independent way. The 96-wells plate model of C. glabrata biofilm will be used in this procedure. In order to identify antibiofilm compounds acting through the inhibition of the Yak1 signalling pathway, two concomitant screens will be conducted. A first assay on the wild-type strain will identify molecules able to inhibit biofilm formation. A second assay will be conducted using a sir4 mutant strain since deletion of the sir4 gene suppresses the biofilm-deficient phenotype of a yak1 mutant strain. Molecules inhibiting biofilm formation through the inhibition of Yak1 should theoretically inhibit biofilm formation in a wild-type background but not in a sir4 background. Molecules identified though these assays will then be tested on C. albicans.
EXAMPLE 5
Identification of in vitro inhibitors of Yak1
Production of recombinant C. albicans Yak1 will be attempted using two different hosts (Escherichia coli and Pichia pastoris) and various constructs, depending on the type and position of the affinity tag fused to the Yak1 polypeptide. The C. albicans Yak1 is a large protein (809 aa) and contains, in its N-terminal part, 5 CTG codons which are coding for serine instead of leucine in this yeast. In order to avoid this problem, the N-terminal part of the gene will be synthesised in vitro using a codon usage optimal for the expression of the protein in E. coli and P. pastoris. The C-terminal part containing the kinase active site will be directly PCR-amplified and the complete gene sequence will be constructed. Culture protocols will be optimized and the best system will be selected for the production of the full-length polypeptide as a soluble, active protein. Purification will be carried out using the affinity tag (His6 or GST) fused to the polypeptide. The activity of the protein will be tested using a kinase assay as previously used for the S. cerevisiae orthologue. The active full-length recombinant protein will be then used for the in vitro inhibitor screen.
A Fluorescent/Luminescent Kinase Assay adapted for screening in 96 well-plate format will first be set up. Following up, the activity of Yak1 will be tested in the presence of known serine/threonine kinase inhibitors. A collection of 3000 molecules of the kinase focused library will be selected (ChemDiv, Inc) and tested for their inhibitory potency on the Yak1 activity. The results obtained on the assay on the recombinant protein will be compared to the in vivo tests on C. albicans and C. glabrata
Table 1. Strains used in this wort
Strain name Genotype Reference
BG2 Clinical isolate (Fidel etal, 1996)
BG14 ura3A::Tn903NeoR (Cormack and Falkσw, 1999)
BG573 URΛ3 (hyrl epal epa2 epa3 epa4 epa5)Λ (De las Penas et al, 2003).
BG592 wa3Δ::Tn903 G41SR rapl-21 (De las Penas et al, 2003).
BG676 wv3A::Tn903 G41SRsir3Δ (De las Penas etal, 2003).
CG122 epa6-] this work
CG129 yakl;:URA3 this work
CG137 sir4-l this work ,
CG140 rifl-1 this work'
CG145 sir4Δ::URA3 this work
CG149 riflΔ::URΛ3 this work
CG160 sir4Δ::υra3 this work
CG164 epa6Δ:URA3 this work
CGl 70 sir4Δ::tιra3 epa6A::URA3 this work
CGl 72 sir4Δ::ιtra3 yάkl::URA3 this work
CGl 74 mpklΔ::URA3 this work
Table A. Sequence of primers used in this study.
Primer name Primer sequence (5" ->3' )
SIR4—ex TTTTTGGTCAAAGCTCACCCC SIR4-5'5 TAGTACAGGCATEAGTTSGCACGTCG 3IR4-5 '3 GGGTGTCGGGGCTGGCTTAACTAGAATCCTGGGTTATGCTCGTG MKRfSIR4 CACGAGCATAACCCAGGATTCTAGTTAAGCCAGCCCCGACACCC MKRrSIR4 CGAGAGACAGTTTGGCTGGTGTAAAAAATAGGCGTATCACGAGGCC SIR4-3'5 GGCCTCGTGATACGCCTATTTTTTACACCAGCCAAACTGTCTCTCG SIR4-3'3 AAGTACCTACCGTATCCGTCCTGC
SIR4ex2 TCGACTCCAATGTTCTCTACCCC RIFlex TTCAAAAAATGGTGAAGTACGCC
RIFl-5'5 CACGTTCAGTAAACGTCCAGTCTG
RIFl-5'3 GGGTGTCGGGGCTGGCTTAACTAGTGGGATGCAAATCAGGTCTG
MKRfRlFl CAGACCTGATTTGCATCCCACTAGTTAAGCCAGCCCCGACACCC
MKRrRIFl CCGGTTCACTGGCAATAGAAGAAAAAATAGGCGTATCACGAGGCC
RIFl-3 '5 GGCCTCGTGATACGCCTATTTTTTCTTCTATTGCCAGTGAACCGG
RIFl-3'3 TTTCTTCTGCAGATAACTGGCCC
RIFlex2 AAAGCTCAATTCTCAAATTGCGC
EPA6ex GAACTAACATTCATGAACAGG
EPA6-5 "5 TCAGGTCTAGAACACCCTTGTTGG
EPA6-5 '3 GGGTGTCGGGGCTGGCTTAACTCCAAGAGGAAATTCAGTAGGGTCC
MKRfEPA6 GGACCCTACTGAATTTCCTCTTGGAGTTAAGCCAGCCCCGACACCC
MKRrEPA6 CCTGAAGCACTCCCACTGCTAGAAAAATAGGCGTATCACGAGGCC
EPAS-3'5 GGCCTCGTGJ-TACGCCTATTTTTCTAGCAGTGGGAGTGCTTCAGG
EPA6-3 '3 GGAACCCTGATCTCCATTAGCC
EPA6-ex2 CGCCAGGCATTATAATACCGC
MPKlex GGTTAGCAGAGTAATTGCTCGGC MPKl-5'5 CTGACATAGCCAGCAGTGAGAG MPKl-5' 3 GTCATAGCTGTTTCCTGACTGTAGTCTCCTCGCTTGCCTC MKRrMPKl GAGGCAAGCGAGGAGACTACAGTCAGGAAACAGCTATGAC MPKl-3'5 TACAACGTCGTGACTGGGACATTCTGGCATCACCTATGGG MKRfMPK1 CCCATAGGTGATGCCAGAATGTCCCAGTCACGACGTTGTA MPKl-3'3 GACCAGCAATGATGACACCTGA MPKlex2 TGGTTTCCTTGTATTGGAACCG URA3F TTTAGCGGCTTAACTGTGCCC URA3R GGAAGGGATGCTAAGGTAGAG EPASF TTGTGAAGCGATTGAGCAGTGG
EPA6R AGTGTGTGATAATCGTTAAGGC RT -ACTlF GGCTTTCGATTTCTCACC RT-ACTIR GTGGCAACGGTTTGATGC RT-EPA6F CGCTGTTTGATACATTACCAC RT-EPA7F CCGAATTAGATCATTTACCGG RT-EPA6-7R GAAGGAGTACTATTGGTGATCG REFERENCES
Ai, W., Bertram, P.G., Tsang, C.K., Chan, T.F., and Zheng, X.F.S. (2002) Regulation of subtelomeric silencing during stress reponse. Molecular Cell 10: 1295-1305.
Alonso-Monge R, Navarro-Garcia F, Roman E, Negredo Al, Eisman B, Nombela C, PIa J. (2003) The Hog1 mitogen-activated protein kinase is essential in the oxidative stress response and chlamydospore formation in Candida albicans. Eukaryot Cell.2(2):351-61.
Baillie, G. S., and Douglas, L.J. (1999) Candida biofilm and their suceptibility to antifungal agent. Methods Enzymol 310: 644-656.
Becker, P., Hufnagle, W., Peters, G., and Herrmann, M. (2001 ) Detection of different gene expression in biofilm-forming versus planktonic population of
Staphylococcus aureus using micro-representational-difference analysis. Appl
Environ Microbiol 67: 2958-2965.
Beloin, C, VaIIe, J., Latour-Lambert, P., Faure, P., Kzreminski, M., Balestrino,
D.,
Haagensen, J.A.J. , Molin, S., Prensier, G., Arbeille, B., and Ghigo, J. M. (2004)
Global impact of mature biofilm lifstyle on Escherichia coli K-12 gene expression. MoI Microbiol 51: 659-674.
Bishop, AC, Chi-yun Kung, Kavita Shah, Laurie Witucki, Kevan M. Shokat, and Yi Liu. Generation of Monospecific Nanomolar Tyrosine Kinase Inhibitors via a Chemical Genetic Approach. J. Am. Chem. Soc, 1999 ; 121 (4), 627 -631.
Bishop AC, Ubersax JA, Petsch DT, Matheos DP, Gray NS, Blethrow J, Shimizu E, Tsien JZ, Schultz PG, Rose MD, Wood JL,' Morgan DO, Shokat KM. A chemical switch for inhibitor-sensitive alleles of any protein kinase. Nature. 2000 Sep 21 ; 407(6802):395-401
Bowen, W. H., Schilling, K., Giertsen, E., Pearson, S., Lee, S. F., Bleiweis, A., and Beeman, D. (1991) Role of a cell surface-associeted protein in adherence and dental caries. Infect lmmun 59: 4604-4609. Castano, I., Pan, SJ. , Zupancic, M., Hennequin, C, Dujon, B., and Cormack, B. P. (2004) Telomere lenght control and transcriptional regulation of subtelomeric adhesins in Candida glabrata. MoI Microbiol: this issue.
Chandra, J., Kuhn, D. M., Mukherjee, P. K., Hoyer, L. L., McCormick, T., and Ghannoum, M.A. (2001 ) Biofilm formation by the fungal pathogen Candida albicans: Development, architecture, and drug resistance. J Bacteήol 183: 5384-5394.
Cormack, B. P., and Falkow, S. (1999) Efficient homologous and illegitimate recombination in the opportunistic yeast pathogen Candida glabrata. Genetics 151 : 979-987.
Cormack, B. P., Ghori, N., and Falkow, S. (1999) An adhesin of the yeast pathogen Candida glabrata mediating adherence to human epithelial cells. Science 285: 578-582.
De las Penas, A., Pan, SJ. , Castano, I., Alder, J., Cregg, R., and Cormack, B. P. (2003) Virulence-related surface glycoproteins in the yeast pathogen Candida glabrata are encoded in subtelomeric clusters and subject to RAP1- and S/f?-dependent transcriptional silencing. Genes Dev 17: 2245-2258.
Donlan, R.M., and Costerton, J.W. (2002) Biofilms: survival mechanisms of clinical relevant microorganisms. Clin Microbiol Rev Λ5: 167-193. Dujon, B., Sherman, D., Fisher, G., Durrens, P., Casaregola, S., Lafontaine, I., De Montigny, J., Marck, C, Neuveglise, C, TaIIa, E., Goffard, N., Frangeul, L., Aigle, M., Anthouard, V., Babour, A., Barbe, V.B., S., Blanchin, S., Beckerich, J. M., Beyne E, Bleykasten, C, Boisrame, A., Boyer, J., Cattolico, L., Confanioleri, F., De Daruvar, A., Despons, L., Fabre, E., Fairhead, C, Ferry- Dumazet, H., Groppi, A., Hantraye, F., Hennequin, C, Jauniaux, N., Joyet, P., Kachouri, R., Kerrest, A., Koszul, R., Lemaire, M., Lesur, I., Ma, L., Muller, H., Nicaud, J. M., Nikolski, M., Oztas, S., Ozier-Kalogeropoulos, O., Pellenz, S.,
Potier, S., Richard, G. F., Straub, M. L., Suleau, A., Swennen, D., Tekaia, F., Wesolowski-Louvel, M., Westhof, E., Wirth, B., Zeniou-Meyer, M., Zivanovic, I., Bolotin-Fukuhara, M., Thierry, A., Bouchier, C, Caudron, B., Scarpelli, C, Gaillardin, C, Weissenbach, J., Wincker, P., and Souciet, J. L. (2004) Genome evolution in yeasts. Nature 430: 35-44.
Enloe, B., A. Diamond, and A. P. Mitchell. 2000. A single-transformation gene function test in diploid Candida albicans. J Bacteriol 182:5730-6.
Fidel, P.L., Cutright, J.L., Tait, L., and Sobel, J. D. (1996) A murine model of Candida glabrata vaginitis. J Infect Dis 173: 425-431. Frieman, M. B., McCaffery, J. M., and Cormack, B. P. (2002) Modular domain structure of the Candida glabrata adhesin Epalp, a §1 ,6 glucan-cross-linked, cell wall protein. MoI Microbiol 2: 479-492.
Froeliger, E. H., and Pives-Taylor, P. (2001) Streptococcus parasanguis f\mbήa- associated adhesin Fap1 is required for biofilm formation. Infect lmmun 69: 2512-2519. Garcfa-Sanchez, S., Aubert, S., Iraqui, I., Janbon, G., Ghigo, J. M., and d'Enfert, C. (2004) Transcriptome invariance in biofilm populations of Candida albicans. Eukaryot Cell 3: 536-545. Garret, S., and Broach, J. (1989) Loss of Ras activity in Saccharomyces cerevisiae is suppressed by disruptions of a new kinase gene, YAK1, whose product may act downstream of the cAMP-dependent protein kinase. Genes Dev3: 1336-1348. Garret, S., Menold, M. M., and Broach, J. (1991 ) The Saccharomyces cerevisiae YAK1 gene encodes a protein kinase that is induced by arrest early in the cell cycle. MoI Cell Biol 11: 4045-4052.
Ghigo, J. M. Natural conjugative plasmids induce bacterial biofilm development. Nature. 2001 ; 412:442-445
Green, C. B., Cheng, G., Chandra, J., Mukherjee, P., Ghannoum, M.A., and Hoyer, L. L. (2004) RT-PCR detection of Candida albicans ALS gene expression in the reconstituted human epithelium (RHE) model of oral candidiasis and in model biofilms. Microbiology 150: 267-275.
GoIa S, Martin R, Walther A, Dunkler A, Wendland J. (2003) New modules for PCR-based gene targeting in Candida albicans: rapid and efficient gene targeting using 100 bp of flanking homology region. Yeast. 20(16):1339-47.
Griffioen, G., Branduardi, P., Ballarini, A., Anghileri, P., Norbeck, J., Baroni, M. D., and Ruis, H. (2001 ) Nucleocytoplasmic distribution of budding yeast protein kinase A regulatory subunit Bcy1 requires Zds1 and its regulated by Yak1-depedent phosphorylation of its targeting domain. MoI Cell Biol 21 : 511- 523.
Halme, A., Bumgamer, S., Styles, C, and Fink, G. R. (2004) Genetic and epigenetic regulation of the FLO gene family generates cell-surface variation in yeast. Ce// 116: 405-415.
Hazlett, K.R., Mazurkiewicz, J. E., and Banas, J.A. (1999) Inactivation of the gbpA gene of Steptomyces mutans alters strcutural and functional aspects of plaque biofilm which are compensated by recombination of the gtfB and gtfC genes. Infect lmmun 67: 3909T3914.
Huang, Y. (2002) Transcriptional silencing in Saccharomyces cerevisiae and Schizosaccharomyces pombel Nucleic Acids Res 30: 1465-1482.
Kumamoto, CA. (2002) Candida biofilms. Curr Opinion Microbiol 5: 608-611.
Kuwayama, H., Obara, S., Mono, T., Katoh, M., Urushibara, H., and Tanaka, Y. (2002) PCRmediated generation of a gene disruption construct without the use of DNA ligase and plasmid vectors. Nucleic Acids Res 30: e2. LΘΘ KL, Buckley HR, Campbell CC. (1975) An amino acid liquid synthetic medium for the development of mycelial and yeast forms of Candida Albicans. Sabouraudia.13(2):148-53. Lee K.L., Buckley H. R., Campbell CC. An amino acid liquid synthetic medium for the development of mycelial and yeast forms of Candida albicans. Sabouraudia, 1975; 13 (2) : 148-153
Lustig, A.J. (1998) Mechanisms of silencing in Saccharomyces cerevisiae. Curr Opinion Gen Dev 8: 233-239.
Mendes Souza, G., Lu, S., and Kuspa, A. (1998) YakA, a protein kinase required for the transition from growth to development in Dictyostellium. Development 125: 2291-2302.
Moretti, P., Freeman, K., Coodly, L., and Shore, D. (1994) Evidence that a complex of SIR proteins interacts with the silencer and telomere-binding protein RAP1. Genes Dev 8: 2257-2269. Moriya, H., Shimizu-Yoshida, Y., Omori, A., Iwashita, S., Katoh, M., and Sakai, A. (2001) Yakip, a DYRK family kinase, translocates to the nucleus and phosphorylates yeast Pop2p in response to a glucose signal. Genes Dev 15: 1227-1228. Nikawa, H., Nishimura, H., Hamada, T., Kumagai, H., and Samaranayake, L.P. (1997) Effects of dietary sugars and, saliva and serum on Candida biofilm formation on acrylic surfaces. Mycopathologia 139: 87-91. ,
O'Toole, GA, Pratt, L.A., Watnick, Pl1 Newman, D.K., Weaver, V.B., and Kolter, R. (1999) Genetics approaches to study biofilms. Methods Enzymol 310: 91-109. 31
Pfaller, M.A., Messer, S.A., Hollis, RJ. , Jones, R.N., Doern, G.V., Brandt, M. E., and Hajjeh, R.A. (1999) Trends in species distribution and susceptibity to fluconasole among blood stream isolates of Candida species in the United states . Diagn Micriobiol Infect Dis 33 : 217-222.
Philippsen, P., Stotz, A., and Scherf, C. (1991) DNA of Saccharomyces cerevisiae. Methods Enzymol 194: 169-182.
Prigent-Combaret, C1 Prensier, G., Le Thi, T.T., Vidal, O., Lejeuhe, P., and Dorel, C. (2000) Development pathway fro biofilm formation in curli-producing Escherichia coli strains: role of flagella, curli, and colanic acid. Environ. Microbiol. 2: 450-464.
Pryde, F. E., and Louis, E.J. (1999) Limitation of silencing at native yeast telomeres. EMBO J 18: 2538-2550. Ramage, G., Wickes, B. L., and Lopez-Ribot, J. L. (2001 ) Biofilms of Candida albicans and their associated resistance to antifungal agent. Am Clin Lab 20: 42-44.
Reynolds, T.B., and Fink, G. R. (2001) Baker's yeast, a model for fungal biofilm formation. Science 291: 878-881.
Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular cloning. A Laboratory manual. Cold Spring Harbor: Cold Spring Harbor Laboratory Press.
Schembri, M.A., Kjaergaard, K., and Klemm, P. (2003) Global gene expression in
Escherichia coli biofilms. MoI Microbiol 48: 253-267.
Schmelzle, T., Beck, T., Martin, D.E., and Hall, M.N. (2004) Activation of the RAS/Cyclic AMP Pathway supresses a TOR deficiency in yeast. Eukaryot Cell 24: 338-351. Schmitt, M. E., Brown, T.A., and Trumpower, B. L. (1990) A rapid and simple method for preparation of RNA from Saccharomyces cerevisiae. Nucleic Acids Res 18: 3091-3092.
Sherman, F. (1992) Getting started with yeast. In Guide to Yeast Genetics and Molecular Biology. Vol. 194. Guthrie, C. and Fink, G. R. (eds). San Diego,: Academic Press, pp. 3-21.
Sherman, F., and Pillus, L. (1997) An uncertain silence. Trends Genet 13: 308- 313. Shin, J.H., Kee, S.J., Shin, M.G., Kim, S.H., Shin, D.H., Lee, S.K., Suh, S. P., and Ryang, D.W. (2002) Biofilm production by isolates of Candida species recovered from nonneutrpenic patients: Comparison of bloodstream isolates with isolates from other sources. J Clin Microbiol 40: 1244-1248.
Stone, E. M., and Pillus, L. (1996) Activation of an MAP kinase cascade leads to Sir3p hyperphosphorylation and strengthens transcriptional silencing. J Cell Biol 135: 571-583.
Stone,- E.M., and Pillus, L. (1998) Silent chromatin in yeast: an orchestrated medley featuring Sir3p. BioEssays 20: 30-40.
Sundstrom, P. (1999) Adhesins in Candida albicans. Curr Opinion Microbiol 2: 353-357.
Vazquez, J.A., Sobel, J. D., Peng, G., Steele-Moore, L., Schuman, P., Holloway, W., and Neaton, J. D. (1999) Evolution of vaginal Candida species recovered from .human immunodeficient virus-infected women receiving fluconazole prophylaxis: the emergence of Candida glabrata? Clin Infect Dis 28: 1025-1031. Walther A, Wendland J. (2003) An improved transformation protocol for the human fungal pathogen Candida albicans. Curr Genet. 42(6):339-43.
Wemer-Whashbume, M., Brown, D., and Braun, E. (1991) Bcy1 , the regulatory subunit of the cAMP-dependent protein kinase in yeast, is differentially modified in reponse to the physiological status of the cell. J Biol Chem 266: 19704- 19709.
Whiteley, M., Bangera, M. G., Bumgarner, R.E., Parsek, M. R., Teitzel, G. M., Lory, S., and Greenberg, E.P. (2001 ) Gene expression in Pseudomonas aeruginosa biofilms. Nature 413: 860-864.
Although preferred embodiments of the present invention have been described in detail herein arid illustrated in the accompanying drawings, it is to be understood that the invention is not limited to these precise embodiments and that various changes and modifications may be effected therein without departing from the scope or spirit of the present invention.

Claims

CLAIMS:
1. A method of screening for a compound that affects expression of a gene involved in biofilm formation of a Candida strain, said gene being selected from the group consisting of EPA6, EPA7 and YAK1 , the method comprising the steps of:
- providing a Candida biofilm with an initial expression level for said gene;
- contacting said biofilm with at least one compound to be tested;
- evaluating expression of the gene; and
- identifying the compound that inhibits the initial expression level of said gene in the biofilm.
2. The method of claim 1 , wherein the compound inhibits expression of gene EPA6, EPA7 and/or YAK1 by down-regulating the transcription of the gene EPA6, EPA7 and/or YAK1 , or by down-regulating the translation of mRNA in a protein encoded by the gene EPA6, EPA7 and/or YAK1.
3. The method of claim 2, wherein the down-regulation of transcription is evaluated by measuring the mRNA level.
4. The method of claim 2, wherein the down-regulation of translation is evaluated by measuring the protein level.
5. The method of any one of claims 1 to 4, wherein the Candida strain consists of Candida glabrata or Candida albicans.
6. The method of any one of claims 1 to 5, wherein the Candida strain consists of Candida glabatra and the gene whose expression is evaluated is EPA6.
7. The method of any one of claims 1 to 5, wherein the Candida strain consists of Candida glabatra and the gene whose expression is evaluated is EPA7.
8. The method of any one of claims 1 to 5, wherein the Candida strain consists of Candida glabatra and the gene whose expression is evaluated is
YAK1.
9. The method of any one of claims 1 to 5, wherein the Candida strain consists of Candida albicans and the gene whose expression is evaluated is YAK1.
10. The method of any one of claims 1 to 9, further comprising a step of evaluating inhibition of biofilm formation by the compound.
11. A compound that affects biofilm formation of a Candida strain obtained by the method as defined in any one of claims 1 to 10.
12. The compound as defined in claim 11 , for use as an anti-fungal agent.
13. A compositioin for preventing and/or treating candidiasis, comprising a compound as defined in claims 11 or 12, and an acceptable carrier.
14. A method for an early diagnostic of a Candida strain forming a biofilm, comprising the step's of:
a) obtaining a cell sample of said Candida strain;
b) measuring the mRNA level of EPA6, EPA7 and/or YAK1 genes in said cell sample; and ,
,c) measuring the mRNA level of said gene in a control Candida cell culture at early planktonic growth,
wherein overexpression of EPA6, EPA7 and/or YAK1 genes in said cell sample compared to the control cell culture, is indicative of the presence of a Candida strain forming a biofilm.
15. The method of claim 14, wherein the mRNA level is quantified by RT- PCR.
16. The method of claim 14, wherein the Candida strain consists of Candida glabatra and the gene whose mRNA level is measured is EPA6, EPA7 and YAK1.
17. The methof of claim 14, wherein the Candida strain consists of Candida albicans and the gene whose mRNA level is measured is YAK1.
18. A method for detecting the presence or absence of a Candida biofilm in a sample, comprising the steps of:
a) contacting the sample with at least one molecule that specifically recognizes a Candida Yak1 , Epa7 or Epa6 polypeptide for a time and under conditions sufficient to form a complex; and
b) detecting the presence or absence of the complex formed in a).
19. The method of claim 18, wherein the molecule , is an antibody that specifically binds to said Yak1 , Epa7 or Epa6 polypeptide, or functional derivative thereof.
20. The method of claim 18 or 19, wherein the Yak1 polypeptide comprises an amino acid sequence substantially identical to SEQ ID NO: 1 or functional derivative thereof.
21. The method of claim 20, wherein the functional derivative of said Yak1 polypeptide comprises an amino acid sequence substantially identical to SEQ ID NO:4.
22. The method of claim 18 or 19, wherein 'the Epa6 polypeptide comprises an amino acid sequence substantially identical to SEQ ID NO: 2.
23. The method of claim 18 or 19, wherein the Epa7 polypeptide comprises an amino acid sequence substantially identical to SEQ ID NO: 3.
24. The method of claim 18 or 19, wherein the Candida strain is Candida glabatra and the at least one molecule specifically recognises the Yak1 , Epa7 and/or Epa6 polypeptide.
25. The method of claim 18 or 19, wherein the Candida strain is Candida albicans and the at least one molecule specifically recognises the Yak1 polypeptide.
26. A method for preventing and/or treating candidiasis in an animal, the method comprising the step of administering to the animal a therapeutically effective amount of a composition as defined in claim 13.
27. The method of claim 26, wherein said animal is a human.
28. The method of claim 26 or 27, wherein said human is an immunocompromised human.
29. Use of the compound of claim 11 in the preparation of a medicament for preventing or treating candidiasis.
i 30. Use of at least one Candida protein selected from the group consisting of Epaδ, Epa7, Sir4, Rifl and Yak1 or at least one gene encoding said protein as a target for identifying a compound capable of impairing biofilm formation of a Candida strain.
31. Use according to claim 30, wherein said Candida strain consists of Candida glabrata or Candida albicans.
32. Use according to claim 30, wherein the Candida protein consists of Epaδ protein of Candida glabrata.
J 33. Use according to claim 30, wherein the Candida protein consists of Epa7 protein of Candida glabrata.
,
34. Use according to claim 30, wherein the Candida protein consists of Sir4 protein of Candida glabrata.
35. Use according to claim 30, wherein the Candida protein consists of Rifi protein of Candida glabrata.
36. Use according to claim 30, wherein the Candida protein consists of Yak1 protein of Candida glabrata.
37. Use according to claim 30, wherein the Candida protein consists of Yak1 protein of Candida albicans.
38. A kit for the detection of the presence or absence of a Candida biofilm, comprising:
at least one antibody that specifically binds to a Candida Yak1 , Epa7 or Epa6 protein;
a reagent to detect polypeptide-antibody immune complex;
optionally a biological reference sample lacking Yak1 , Epa7 or Epa6 polypeptides; and
optionally a comparison sample comprising Yak1 , Epa7 or Epa6 polypeptides which specifically bind to said antibody;
wherein said antibody, reagent, biological reference sample, and comparison sample are present in an amount sufficient to perform said detection.
39. The kit of claim 38, wherein the Candida strain is Candida glabatra and the at least one antibody specifically recognises the Yak1 , Epa7 and/or Epa6 polypeptide.
40. The kit of claim 38, wherein the Candida strain is Candida albicans and the at least one antibody specifically recognises the Yak1 polypeptide.
41. A kit for the early diagnostic of a Candida strain forming a biofilm, comprising:
- specific primers for Candida EPA6, EPA7 and/or YAK1 genes; - specific probes for Candida EPA6, EPA7 and/or YAK1 genes;
- reagents for detecting the mRNA level of EPA6, EPA7 and/or YAK1 genes;
- a control sample of Candida cell culture at an early planktonic growth phase;
- optionally a biological reference sample lacking Epa6, Epa7 and/or Yak1 polynucleotides; and
- optionally a comparison sample comprising EPA6, EPA7 and/or YAK1 polynucleotides which specifically hybridize with said primers or probes;
wherein said primers, probes, reagents, biological reference sample, and comparison sample are present in an amount sufficient to perform said determination.
42. A method for selecting a biofilm formation inhibitor of a Candida strain acting through a Yak1 dependent pathway, comprising the following steps:
a) contacting a compound with a biofilm of a wild type Candida strain and determining if it inhibits biofilm formation of said Candida strain;
b) contacting the compound selected in a) with a biofilm of a sir4, mutant Candida strain and determining if it inhibits biofilm formation of said Candida strain;
c) selecting the compound identified in a) if said compound inhibits the formation of biofilm of the wild-type Candida strain and does not inhibit the formation of biofilm of the sirf mutant Candida strain. I
43. The method of claim 42, wherein said wild type and sir4 mutant Candida strains consist of Candida glabrata strains.
44. The method of claim 43, wherein the sir4 mutant Candida strain consist of Candida glabrata strain filed at the C. N. CM. on November 30, 2005 under the reference number I-3532.
45. A compound obtained by the method of any one of the claim 42 to 44, said compound having the capacity of affecting biofilm formation of a Candida strain.
46. An in vitro screening method for an inhibitor of the activity of a Yak1 polypeptide of Candida, comprising the steps of :
a) contacting a purified or isolated Yak1 recombinant polypeptide or a fragment thereof retaining the kinase activity with a candidate compound;
b) measuring the capacity of said candidate compound to inhibit the kinase activity of the Yak1 polypeptide or fragment thereof, said kinase activity being measured by a fluorescent and/or luminescent kinase assay.
47. The method of claim 46, wherein the Yak1 recombinant polypeptide has an amino acid sequence substantially identical to SEQ ID NO: 1.
- I
48. The method of claim 46, wherein the Yak1 recombinant polypeptide has an amino acid sequence substantially identical to SEQ ID NO: 4.
49. The method of claim 46, wherein the Yak1 recombinant polypeptide has an amino acid sequence substantially identical to SEQ ID NO: 10.
50. A compound obtained by the method of any one of claims 46 to 49, said compound having the capacity of affecting biofilm formation of a Candida strain
51. A method for selecting a biofilm formation inhibitor of a Candida strain acting through a Yak1 dependent pathway, comprising the implementation of the method of claim 42 and the method of claim 46 whatever the order the two methods are implemented.
52. A purified or isolated polypeptide involved in Candida biofilm formation comprising an amino acid sequence substantially identical to SEQ ID NO: 1.
53. A purified or isolated polynucleotide encoding the purified polypeptide of claim 52.
54. The polynucleotide of claim 53 comprising the nucleic acid sequence SEQ
ID NO: 5.
55. A purified or isolated polypeptide having a kinase activity sensitive to N-
MPP1 comprising the amino acid sequence SEQ ID NO: 9.
56. A sir4 mutant Candida strain filed at the C.N.C.M. on November 30, 2005 under the reference number I-3532.
PCT/IB2005/003941 2004-12-03 2005-12-02 Polypeptides involved in candida biofilm formation and uses thereof Ceased WO2006059228A2 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CA002489194A CA2489194A1 (en) 2004-12-03 2004-12-03 Polypeptides involved in candida biofilm formation and uses thereof
CA2,489,194 2004-12-03

Publications (2)

Publication Number Publication Date
WO2006059228A2 true WO2006059228A2 (en) 2006-06-08
WO2006059228A3 WO2006059228A3 (en) 2007-02-22

Family

ID=36284001

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB2005/003941 Ceased WO2006059228A2 (en) 2004-12-03 2005-12-02 Polypeptides involved in candida biofilm formation and uses thereof

Country Status (2)

Country Link
CA (1) CA2489194A1 (en)
WO (1) WO2006059228A2 (en)

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010107292A1 (en) * 2009-03-18 2010-09-23 Instituto Potosino De Investigacion Cientifica Y Tecnologica, A.C. In vitro method for the detection of candida glabrata, diagnostic kit and use thereof
US10130691B2 (en) 2013-03-15 2018-11-20 Los Angeles Biomedical Research Institute At Harbor-Ucla Medical Center Compositions and methods for treating fungal and bacterial pathogens
US10300120B2 (en) 2002-09-13 2019-05-28 Los Angeles Biomedical Research Institute At Harbor-Ucla Medical Center Pharmaceutical compositions and methods to vaccinate against disseminated candidiasis and other infectious agents
WO2019199279A1 (en) * 2018-04-10 2019-10-17 Los Angeles Biomedical Research Institute At Harbor-Ucla Medical Center Methods of treatment for candida auris infections
EP3375885A4 (en) * 2015-11-09 2019-11-20 Amtixbio Co., Ltd. NOVEL KINASE FOR THE TREATMENT AND PREVENTION OF FUNGAL INFECTIONS AND USE THEREOF
US10653757B2 (en) 2011-07-22 2020-05-19 Novadigm Therapeutics, Inc. Methods and compositions for vaccinating against Staphylococcus aureus
US10857216B2 (en) 2016-03-09 2020-12-08 Novadigm Therapeutics, Inc. Methods and kits for use in preventing and treating vulvovaginal candidiasis
KR20220168591A (en) * 2017-05-22 2022-12-23 (주)앰틱스바이오 Novel kinase for treatment and prevention of fungal infection and the use thereof

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2959220A1 (en) * 2014-09-01 2016-03-10 Vib Vzw Mutant csgg pores

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2001285287A1 (en) * 2000-08-25 2002-03-04 Microbia, Inc. Use of sublethal concentrations of anti-invasin compounds to therapeutically or prophylactically treat fungal infections
DE10142743B4 (en) * 2001-08-24 2006-01-26 Fraunhofer-Gesellschaft zur Förderung der angewandten Forschung e.V. Biochips with dimorphism-specific factors from Candida albicans

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10300120B2 (en) 2002-09-13 2019-05-28 Los Angeles Biomedical Research Institute At Harbor-Ucla Medical Center Pharmaceutical compositions and methods to vaccinate against disseminated candidiasis and other infectious agents
WO2010107292A1 (en) * 2009-03-18 2010-09-23 Instituto Potosino De Investigacion Cientifica Y Tecnologica, A.C. In vitro method for the detection of candida glabrata, diagnostic kit and use thereof
US10653757B2 (en) 2011-07-22 2020-05-19 Novadigm Therapeutics, Inc. Methods and compositions for vaccinating against Staphylococcus aureus
US10130691B2 (en) 2013-03-15 2018-11-20 Los Angeles Biomedical Research Institute At Harbor-Ucla Medical Center Compositions and methods for treating fungal and bacterial pathogens
EP3375885A4 (en) * 2015-11-09 2019-11-20 Amtixbio Co., Ltd. NOVEL KINASE FOR THE TREATMENT AND PREVENTION OF FUNGAL INFECTIONS AND USE THEREOF
US10857216B2 (en) 2016-03-09 2020-12-08 Novadigm Therapeutics, Inc. Methods and kits for use in preventing and treating vulvovaginal candidiasis
KR20220168591A (en) * 2017-05-22 2022-12-23 (주)앰틱스바이오 Novel kinase for treatment and prevention of fungal infection and the use thereof
KR102670084B1 (en) * 2017-05-22 2024-05-30 (주)앰틱스바이오 Novel kinase for treatment and prevention of fungal infection and the use thereof
WO2019199279A1 (en) * 2018-04-10 2019-10-17 Los Angeles Biomedical Research Institute At Harbor-Ucla Medical Center Methods of treatment for candida auris infections
CN112203684A (en) * 2018-04-10 2021-01-08 海港医学中心洛杉矶生物医学研究所 Treatment of Candida auris infection
US12324830B2 (en) 2018-04-10 2025-06-10 Los Angeles Biomedical Research Institute At Harbor-Ucla Medical Center Methods of treatment for Candida auris infections

Also Published As

Publication number Publication date
CA2489194A1 (en) 2006-06-03
WO2006059228A3 (en) 2007-02-22

Similar Documents

Publication Publication Date Title
Pammer et al. DIT101 (CSD2, CAL1), a cell cycle‐regulated yeast gene required for synthesis of chitin in cell walls and chitosan in spore walls
Iraqui et al. The Yak1p kinase controls expression of adhesins and biofilm formation in Candida glabrata in a Sir4p‐dependent pathway
Caracuel et al. Fusarium oxysporum gas1 encodes a putative β-1, 3-glucanosyltransferase required for virulence on tomato plants
CN107904250B (en) Aspergillus flavus pathogenic gene rgfC and application thereof
HUP0201743A2 (en) Regulation of fungal gene expression
Lamarre et al. Expression cloning of the Candida albicans CSA1 gene encoding a mycelial surface antigen by sorting of Saccharomyces cerevisiae transformants with monoclonal antibody‐coated magnetic beads
WO2006059228A2 (en) Polypeptides involved in candida biofilm formation and uses thereof
Krueger et al. Deletion of the NOT4 gene impairs hyphal development and pathogenicity in Candida albicans
Song et al. RAM2: an essential gene in the prenylation pathway of Candida albicans
Sudoh et al. The Candida albicans CHS4 gene complements a Saccharomyces cerevisiae skt5/chs4 mutation and is involved in chitin biosynthesis
Rhodes et al. Identification of genes of Aspergillus fumigatus up-regulated during growth on endothelial cells
US5863762A (en) Nucleic acids encoding TFIIB transcription factor from candida albicans
CA2526272A1 (en) Polypeptides involved in candida biofilm formation and uses thereof
EP1157112B1 (en) Nucleic acid and amino acid sequences of hemoglobin-response genes in candida albicans and the use of reagents derived from these sequences in the diagnosis of disseminated candida albicans infection
HUP0103974A2 (en) Essential genes from c. albicans and a method for screening antimycotic substances using said genes
US20030166886A1 (en) Candida albicans proteins associated with virulence and hyphal formation and uses thereof
WO2003025218A2 (en) Methods and yeast strains for screening antifungal agents
JP4456887B2 (en) Method for determining drug sensitivity of cells
Reedy Sexual reproduction and signal transduction in the Candida species complex
FC Morphological change in Candida albicans
Rastghalam Entitled: Mating MAPK pathway in Candida albicans
Cottier Roles of Msb2p and other putative sensors in environmental responses of Candida albicans
US20040106173A1 (en) Bot1: target for antifungal agents
Selvaggini Molecular biology of chitin synthesis in Candida albicans
WO2005021789A1 (en) Polypeptides involved in fungal biofilm formation and polynucleotides encoding same and uses thereof

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KM KN KP KR KZ LC LK LR LS LT LU LV LY MA MD MG MK MN MW MX MZ NA NG NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SM SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU LV MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 05820472

Country of ref document: EP

Kind code of ref document: A2