KR20220168591A - Novel kinase for treatment and prevention of fungal infection and the use thereof - Google Patents

Abstract

The present invention relates to uses of kinases for treating and preventing fungal meningitis and encephalitis caused by Cryptococcus sp. pathogenic fungus. Specifically, the present invention relates to a method for screening an antifungal agent and an antifungal pharmaceutical composition including a protein kinase for regulating the pathogenicity of Cryptococcus neoformans or an inhibitor for a gene encoding the same, wherein the amount or activity of the protein kinase that regulates the pathogenicity of Cryptococcus neoformans or the amount of expression of the gene encoding the protein is measured. According to the present invention, the method for screening an antifungal agent is used to effectively screen an antifungal agent for treating meningitis, encephalitis, and the like. The antifungal pharmaceutical composition of the present invention is used to effectively treat meningitis, encephalitis, and the like, so that the composition can be widely utilized in an industrial field related to medicine and life science.

Description

Novel kinase protein for treatment and prevention of fungal infection and its use {NOVEL KINASE FOR TREATMENT AND PREVENTION OF FUNGAL INFECTION AND THE USE THEREOF}

The present invention relates to novel kinases and their use for the prevention and treatment of fungal infections caused by pathogenic fungi. In addition, the present invention is an antifungal agent screening method characterized by measuring the amount or activity of a pathogenicity-regulating kinase protein of Cryptococcus neoformans or the expression level of a gene encoding the protein; and an antifungal pharmaceutical composition comprising an inhibitor for a Cryptococcus neoformans pathogenicity-regulating kinase protein or a gene encoding the same.

Cryptococcus neoformans is a fungal pathogen that is distributed in various natural environments including soil, trees, and bird guano, has a variety of infectious agents, and uses a variety of hosts ranging from lower eukaryotic cells to aquatic and terrestrial animals (Lin, X. & Heitman, J. The biology of the Cryptococcus neoformans species complex. Annu. Rev. Microbiol. 60, 69-105, 2006). Cryptococcus neoformans is the leading cause of death from fungal meningitis, accounting for about one million new infections and about 600,000 deaths worldwide each year (Park, BJ et al. Estimation of the current global burden of cryptococcal meningitis among persons living with HIV/AIDS. AIDS 23, 525-530, doi:10.1097/QAD.0b013e328322ffac, 2009). However, only limited therapies are being used for the treatment of systemic Cryptococcus's (Perfect, JR et al. Clinical practice guidelines for the management of cryptococcal disease: 2010 update by the infectious diseases society of America. Clin Infect Dis 50, 291-322, doi:10.1086/649858, 2010). On the other hand, C. neoformans is considered an ideal fungal model system for basidiomycetes, which includes a fully sequenced and well-described genome database, a genetic precision analysis method through sexual differentiation, and an efficient reverse and forward genetics method. , and the availability of various heterologous host model systems (Idnurm, A. et al. Deciphering the model pathogenic fungus Cryptococcus neoformans. Nat. Rev. Microbiol. 3, 753-764, 2005).

To understand the pathogenic mechanism of C. neoformans, extensive research has been conducted over the past decades. In addition to efforts to analyze the function of individual genes/proteins, recent large-scale functional genetic analyzes have resulted in a greater understanding of the overall biological circuitry of C. neoformans. However, the signals and metabolic pathways governing the general biological characteristics and pathogenicity of C. neoformans have not yet been completely elucidated. The main reason for this is that the functions of kinases, which play an important role in signaling pathways and govern the activation or expression of transcription factors (TFs), have not been sufficiently characterized at the genome scale. In general, kinases affect about 30% of cellular proteins through phosphorylation and play key roles in growth, cell cycle regulation, differentiation, development, stress response and many other cellular functions (Cohen, P. The regulation of protein function by multisite phosphorylation - a 25 year update. Trends Biochem Sci 25, 596-601, 2000). In addition, since kinase activity can be easily inhibited by small molecules such as compounds or antibodies, it is considered a protein family that is a major target for drug development (Rask-Andersen, M., Masuram, S. & Schioth, HB The druggable genome: Evaluation of drug targets in clinical trials suggests major shifts in molecular class and indication.Annu Rev Pharmacol Toxicol 54, 9-26, doi:10.1146/annurev-pharmtox-011613-135943, 2014 Thus, systematic and functional profiling of fungal kinases in human fungal pathogens is needed more than ever to find virulence-associated kinases that can be developed as antifungal drugs.

Accordingly, the present inventors constructed a library of 226 high-quality marker gene deletion strains through homologous recombination for 114 putative kinases, and produced growth, differentiation, stress response, antifungal resistance, and virulence factors (capsule, melanin, and urease). We performed systematic functional profiling of kinome networks in C. neoformans as well as basidiomycetes by examining their phenotypes under 30 different in vitro growth conditions including . In addition, we investigated their potential pathogenicity and infectivity in insect and murine host models.

An object of the present invention relates to novel kinases and their use for the prevention and treatment of fungal infections by pathogenic fungi. In addition, the present invention provides screening for antifungal agents by measuring the amount or activity of a pathogenicity-regulating kinase protein of Cryptococcus neoformans or the expression level of a gene encoding the protein. In addition, the present invention provides an antifungal pharmaceutical composition comprising an inhibitor and/or an activator for the pathogenicity-regulating kinase protein of Cryptococcus neoformans or a gene encoding the same. In addition, the present invention is to provide a method for screening drug candidates for the treatment and prevention of cryptococcosis or meningitis. In addition, the present invention is to provide a pharmaceutical composition for the treatment and prevention of cryptococcosis or meningitis. The present invention also provides methods for diagnosing fungal infections.

In order to achieve the above object, the present invention provides a novel pathogenic regulatory kinase protein. Specifically, the novel pathogenicity-regulating kinases according to the present invention are Fpk1, Bck1, Gal83, Kic1, Vps15, Ipk1, Mec1, Urk1, Yak1, Pos5, Irk1, Hsl101, Irk2, Mps1, Sat4, Irk3, Cdc7, Irk4, Swe102 , Vrk1, Fbp26, Psk201, Ypk101, Pan3, Ssk2, Utr1, Pho85, Bud32, Tco6, Arg5,6, Ssn3, Irk6, Dak2, Rim15, Dak202a, Snf101, Mpk2, Cmk1, Irk7, Cbk1, Kic102, Mkk2, Cka1 , including, but not limited to, Bub1.

In addition, the present invention comprises the steps of (a) contacting a sample to be analyzed with cells containing a pathogenicity-regulating kinase protein; (b) measuring the amount or activity of the protein; and (c) determining that the sample is an antifungal agent when it is determined that the amount or activity of the protein is down or up regulated.

In addition, the present invention comprises the steps of (a) contacting a sample to be analyzed with a cell containing a gene encoding a pathogenic regulatory kinase protein; (b) measuring the expression level of the gene; and (c) determining that the sample is an antifungal agent when it is determined that the expression level of the gene is down or up regulated.

In the present invention, the cell used for the antifungal agent screening may be a fungus, for example, Cryptococcus neoformans.

In the present invention, the antifungal agent may be characterized in that it is for treating or preventing meningoencephalitis or cryptococcosis, but is not limited thereto.

In the present invention, the term "sample" refers to an unknown candidate substance used in screening to examine whether it affects the expression level of a gene or affects the amount or activity of a protein, chemical substance, nucleotide , antisense-RNA, small interference RNA (siRNA) and natural product extracts, but are not limited thereto.

In the present invention, the term “antifungal agent” inhibits the growth of bacteria and/or fungi, and includes inorganic antifungal agents, organic antifungal agents derived from natural products, organic aliphatic compound antifungal agents, and organic aromatic compound antifungal agents. As inorganic antifungal agents, chlorine compounds represented by sodium hypochlorite, peroxides represented by hydrogen peroxide, boric acid represented by sodium borate, copper compounds represented by copper sulfate, zinc compounds represented by zinc sulfate, zinc chloride, sulfur, polysulfuric acid Lime, sulfur compounds represented by hydrated sulfur, calcium compounds represented by calcium oxide, sodium thiosulfate, silver complex salts, silver compounds represented by silver nitrate, iodine, sodium silicofluoride, etc. , hinokitiol, maengjongjuk extract, creosote oil, etc., but are not limited thereto.

In the present invention, the measurement of the change in gene expression level can be performed through a variety of well-known methods. For example, RTPCR (Sambrook et al., Molecular Cloning. A Laboratory Manual, 3rd ed. Cold Spring Harbor Press, 2001), Northern blotting (Peter B. Kaufma et al., Molecular and Cellular Methods in Biology and Medicine, 102- 108, CRCpress), hybridization reaction using a cDNA microarray (Sambrook et al., Molecular Cloning. A Laboratory Manual, 3rd ed. Cold Spring Harbor Press, 2001) or in situ hybridization reaction (Sambrook et al., Molecular Cloning. A Laboratory Manual, 3rd ed. Cold Spring Harbor Press, 2001). In the case of performing according to the RT-PCR protocol, first, total RNA is isolated from the cells treated with the sample, and then single-stranded cDNA is prepared using an oligo dT primer and reverse transcriptase. Subsequently, a PCR reaction is performed using the single-stranded cDNA as a template and using a gene-specific primer set. Gene-specific primer sets used in the present invention are shown in Tables 2 and 3 below. Next, the PCR amplification product is subjected to electrophoresis, and a change in the expression level of the gene can be measured by analyzing the formed band.

In the present invention, changes in the amount or activity of proteins can be performed through various known immunoassay methods. Examples include, but are not limited to, radioimmunoassay, radioimmunoprecipitation, immunoprecipitation, enzyme-linked immunosorbentassay (ELISA), capture-ELISA, inhibition or competition assay, and sandwich assay. The immunoassay or immunostaining method is described in various literatures (Enzyme Immunoassay, E. T. Maggio, ed., CRC Press, Boca Raton, Florida, 1980; Gaastra, W., Enzymelinked immunosorbent assay (ELISA), in Methods in Molecular Biology, Vol. 1, Walker, J.M.ed., Humana Press, NJ, 1984; and Ed Harlow and David Lane, Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1999) For example, when using radioimmunoassay, protein-specific antibodies labeled with radioactive isotopes (eg, C14, I125, P32 and S35) can be used.

In the case of using ELISA in one embodiment of the present invention, (i) coating the sample-treated cell extract on the surface of a solid substrate, (ii) kinase itself as a primary antibody or a labeled protein-specific antibody and the cell extract, (iii) reacting the product of step (ii) with an enzyme-conjugated secondary antibody, and (iv) measuring the activity of the enzyme. Suitable solid substrates are hydrocarbon polymers (eg polystyrene and polypropylene), glass, metals or gels, most preferably microtiter plates. Enzymes bound to the secondary antibody include, but are not limited to, enzymes that catalyze a color reaction, fluorescence reaction, luminescence reaction or infrared reaction, for example, alkaline phosphatase, β-galactosidase , horseradish peroxidase, luciferase and cytochrome P450. When alkaline phosphatase is used as the enzyme binding to the secondary antibody, bromochloroindolylphosphate (BCIP), nitroblue tetrazolium (NBT), naphthol-ASB1-phosphate (naphthol-AS-B1 -phosphate) and ECF (enhanced chemifluorescence) can be used, and when horseradish peroxidase is used, chloronaphthol, aminoethylcarbazole, diaminobenzidine, D-luciferin, lucigenin (bis- N-methylacridinium nitrate), resorufin benzyl ether, luminol, amplex red reagent (10-acetyl-3,7-dihydroxyphenoxazine), TMB (3,3,5,5-tetramethylbenzidine), Substrates such as ABTS (2,2'-Azine-di[3-ethylbenzthiazoline sulfonate]) and o -phenylenediamine (OPD) can be used. In the ELISA method, the final enzyme activity measurement or signal measurement may be performed according to various generally known methods. The signal can be easily detected with streptavidin when biotin is used as a label, and with luciferin when luciferase is used as a label.

In addition, one embodiment of the present invention provides an antifungal pharmaceutical composition comprising an agent (inhibitor or activator) for a fungal pathogenicity-regulating kinase protein. In another embodiment, the fungus is Cryptococcus neoformans.

In addition, one embodiment of the present invention provides an antifungal pharmaceutical composition comprising an agent (inhibitor or activator) for a gene encoding a fungal pathogenicity-regulating kinase protein. In one embodiment the fungus is Cryptococcus neoformans.

In the present invention, the pharmaceutical composition may be characterized for treating meningoencephalitis or cryptococcosis, but is not limited thereto.

In the present invention, an agent may be an antibody. In one embodiment, the inhibitor may be an inhibitor that blocks signal transduction by binding to a protein and inhibiting the activity of the protein. For example, it may be a peptide or compound that binds to a protein, and these peptides or compounds may be selected by a screening method including protein structural analysis, etc., and may be designed as a generally known method. In the case of a polyclonal antibody or monoclonal antibody against a protein, it can be prepared using a generally known antibody production method.

As used herein, the term "antibody" refers to synthetic antibodies, monoclonal antibodies, polyclonal antibodies, recombinantly produced antibodies, intrabodies, multispecific antibodies (including bispecific antibodies), human antibodies, A humanized antibody, chimeric antibody, single-chain Fv (scFv) (including dual-specific scFv), BiTE molecule, single-chain antibody, Fab fragment, F(ab') fragment, disulfide-linked Fv (sdFv), or one of the foregoing may be an epitope-binding fragment of any of the In the present invention, an antibody may be any immunoglobulin molecule or an immunologically active portion of an immunoglobulin molecule, and may be of any isotype. In addition, the antibody in the present invention may be a full-length antibody comprising variable and constant regions, or a single chain antibody or an antigen-binding fragment thereof such as a Fab or Fab'2 fragment. Antibodies in the present invention may be conjugated or linked to therapeutic agents such as cytotoxins or radioactive isotopes.

In the present invention, the agent may be an anti-sense oligonucleotide for a gene, siRNA, shRNA, miRNA, or a vector containing them, but is not limited thereto.

In the present invention, the inhibitor may be an inhibitor that blocks signal transduction by inhibiting expression of a gene, interferes with transcription by binding to a gene, or interferes with translation of mRNA by binding to mRNA transcribed from a gene. In one embodiment, the inhibitor may be, for example, a peptide, nucleic acid, or compound that binds to a gene, may be selected through a method such as cell-based screening, or may be designed using a generally known method. For example, it may be an antisense oligonucleotide for a gene, siRNA, shRNA, miRNA, or a vector containing them, which can be prepared by a generally known method.

In the present invention, the term "antisense oligonucleotide" refers to DNA, RNA, or derivatives thereof having a nucleic acid sequence complementary to a specific mRNA sequence, and binds to a complementary sequence in mRNA to inhibit translation of mRNA into protein. It works. In one embodiment, the length of the antisense oligonucleotide is 6 to 100 bases, preferably 8 to 60 bases, and even more preferably 10 to 40 bases. In one embodiment of the invention, antisense oligonucleotides can be modified at one or more bases, sugars or backbone positions to enhance efficacy (De Mesmaeker et al., Curr Opin Struct Biol., 5(3 ):343-55, 1995). The nucleic acid backbone can be modified with phosphorothioates, phosphotriesters, methylphosphonates, short-chain alkyls, cycloalkyls, short-chain heteroatomic, heterocyclic intersugar linkages, and the like. In addition, antisense oligonucleotides may contain one or more substituted sugar moieties. Antisense oligonucleotides may contain modified bases. Modified bases include hypoxanthine, 6-methyladenine, 5-Me pyrimidine (especially 5-methylcytosine), 5-hydroxymethylcytosine (HMC), glycosyl HMC, gentobiosyl HMC, 2- Aminoadenine, 2-thiouracil, 2-thiothymine, 5-bromouracil, 5-hydroxymethyluracil, 8-azaguanine, 7-deazaguanine, N6(6-aminohexyl)adenine, 2,6- Diaminopurine, etc. In addition, the antisense oligonucleotide of the present invention can be chemically linked with one or more moieties or conjugates that enhance its activity and cell adhesion. In one embodiment of the invention, the moiety is a cholesterol moiety, cholesteryl moiety, cholic acid, thioether, thiocholesterol, fatty chain, phospholipid, polyamine, polyethylene glycol chain, adamantane acetic acid, palmityl moiety, It may be a fat-soluble moiety such as octadecylamine or a hexylamino-carbonyl-oxychol esterol moiety, but is not limited thereto. Oligonucleotides containing fat-soluble moieties and methods for their preparation are well known in the art (see US Pat. Nos. 5,138,045, 5,218,105 and 5,459,255). In one embodiment of the present invention, the modified nucleic acid may increase stability to nucleases and increase the binding affinity of the antisense nucleic acid to the target mRNA. In one embodiment, the antisense oligonucleotide may be synthesized in vitro by a generally well-known method and administered into a living body, or may be synthesized in a living body. One example of in vitro synthesis of antisense oligonucleotides is the use of RNA polymerase I. One example of synthesizing antisense RNA in vivo is to use a vector with the origin of the recognition site (MCS) in the opposite direction so that the antisense RNA is transcribed. It is preferable not to translate into sequence.

In the present invention, the term "siRNA" refers to a nucleic acid molecule capable of mediating RNA interference or gene silencing (see WO00/44895, WO 01/36646, WO 99/32619, WO 01/29058, WO 99/07409 and WO 00/44914). Since siRNA inhibits the expression of a target gene, it can be provided as an efficient gene knock-down method or gene therapy method. In the present invention, the siRNA molecule may have a structure in which a sense strand (sequence corresponding to mRNA sequence) and an antisense strand (sequence complementary to mRNA sequence) are positioned opposite each other to form a double strand. In the present invention, siRNA molecules may have a single-stranded structure with self-complementary sense and antisense strands. In one embodiment of the present invention, siRNA is not limited to complete pairing of double-stranded RNA portions paired with each other, but mismatches (corresponding bases are not complementary), bulges (one chain) There is no base corresponding to) and the like may include unpaired parts. In one embodiment of the present invention, the total length of siRNA may be 10 to 100 bases, preferably 15 to 80 bases, and more preferably 20 to 70 bases. In addition, in the present invention, the siRNA end structure can be either a blunt end or a cohesive end structure as long as it can inhibit gene expression, and the cohesive end structure is both a 3'-end protruding structure and a 5'-end protruding structure. It is possible. In the present invention, the siRNA molecule may have a form in which a short nucleotide sequence (eg, about 5 to 15 nucleotides) is inserted between the self-complementary sense and antisense strands, in which case the siRNA molecule formed by expression of the nucleotide sequence is a molecule A hairpin structure is formed by intra-hybridization, and a stem-and-loop structure is formed as a whole.

In the present invention, the term "shRNA" refers to synthesizing oligoDNA linking a 3 to 10 base linker between the sense of the target gene siRNA sequence and the complementary nonsense, and then in a plasmid vector. When cloned or shRNA is inserted into retroviruses such as lentivirus and adenovirus and expressed, shRNA (short hairpin RNA) with a looped hairpin structure is produced and converted into siRNA by Dicer in the cell to indicate the RNAi effect. The shRNA exhibits a relatively long-term RNAi effect compared to siRNA.

In the present invention, the term "miRNA (microRNA)" refers to a single-stranded RNA molecule of 18 to 25 nucleotides (nt), and is a regulator that controls gene expression in eukaryotes. miRNAs complementarily bind to target mRNAs, act as posttranscriptional gene suppressors, and are known to play a role in inducing translational suppression and mRNA destabilization.

In the present invention, the term "vector" refers to a genetic construct comprising an external DNA inserted into a genome encoding a polypeptide, and includes a DNA vector, a plasmid vector, a cosmid vector, a bacteriophage vector, a yeast vector, or a viral vector. includes

In one embodiment of the present invention, the pharmaceutical composition comprises at least one azole-based antifungal agent selected from the group consisting of fluconazole, itraconazole, voriconazole and ketoconazole; Or at least one selected from the group consisting of amphotericin B, natamycin, rimocidin, nystatin, flucytosine and fludioxonil It can be administered concomitantly with non-azole antifungal agents.

In the present invention, the pharmaceutical composition for antifungal may include pharmaceutically suitable and physiologically acceptable adjuvants in addition to active ingredients, and these adjuvants are excipients, disintegrants, sweeteners, binders, coating agents, expanding agents, lubricants, and glidants. Or it may be a solubilizing agent such as a flavoring agent.

The antifungal pharmaceutical composition of the present invention may include one or more pharmaceutically acceptable carriers in addition to the active ingredient. In one embodiment, the carrier used in the pharmaceutical composition formulated as a liquid solution is sterile and biocompatible, and is saline, sterile water, Ringer's solution, buffered saline, albumin injection solution, dextrose solution, maltodextrin solution, glycerol, ethanol. And one or more of these components may be mixed and used, and if necessary, other conventional additives such as antioxidants, buffers, or bacteriostatic agents may be added.

In addition, in one embodiment of the present invention, the antifungal pharmaceutical composition further comprises a diluent, a dispersing agent, a surfactant, a binder or a lubricant to be formulated into an injectable formulation such as an aqueous solution, suspension, emulsion, etc., pills, capsules, granules or tablets. can be formulated. Furthermore, using a method disclosed in the literature (Remington's Pharmaceutical Science, Mack Publishing Company, Easton PA) as an appropriate method in the relevant field, it can be preferably formulated according to each disease or component. In one embodiment of the present invention, the pharmaceutical formulation form of the pharmaceutical composition is granules, powders, coated tablets, tablets, capsules, suppositories, syrups, juices, suspensions, emulsions, drops or injectable solutions and sustained release of active compounds It can be a mold formulation and the like. The pharmaceutical composition of the present invention can be administered in a conventional manner via intravenous, intraarterial, intraperitoneal, intramuscular, intraarterial, intraperitoneal, intrasternal, transdermal, intranasal, inhalational, topical, rectal, oral, intraocular or intradermal routes. can be administered with

In the present invention, an effective amount of an active ingredient in a pharmaceutical composition means an amount required for preventing or treating a disease. Therefore, the type of disease, the severity of the disease, the type and amount of the active ingredient and other ingredients contained in the composition, the type of formulation and the patient's age, weight, general health condition, sex and diet, administration time, administration route and composition It can be controlled by various factors including secretion rate, duration of treatment, and drugs used concurrently.

Novel antifungal drug candidates can be effectively screened using the kinase according to the present invention. In addition, fungal infections can be effectively prevented, treated, and/or diagnosed using the antifungal pharmaceutical composition containing the kinase agonist (inhibitor or inhibitor) of the present invention.

In Figure 1, a shows the phylogenetic correlation between protein kinases in Cryptococcus neoformans, and b shows a comparison between major kinases in Cryptococcus neoformans, C. albicans and A. fumigatus. . 1a shows protein sequence-based alignment performed using ClustalX2 (University College Dublin). Alignment data was used and a phylogeny was created using Interactive Tree Of Life (http://itol.embl.de) (Letunic, I. & Bork, P. Interactive Tree Of Life v2: online annotation and display of phylogenetic trees made easy.Nucleic Acids Res 39, W475-478, doi:10.1093/nar/gkr201 (2011). From the 183 kinases of C. neoformans, we constructed 114 gene-deleted kinases and named them based on the gene naming of S. cerevisiae orthologs. Colored lines indicate kinase classes predicted by Kinomer1.0 (http://www.compbio.dundee.ac.uk/kinomer) (Martin, DM, Miranda-Saavedra, D. & Barton, GJ Kinomer v. 1.0: a database of systematically classified eukaryotic protein kinases. Nucleic Acids Res 37, D244-250, doi:10.1093/nar/gkn834 (2009)). Red text shows the 60 pathogenicity-related kinases, and the distribution of these kinases for total kinases and various classes. Figure 1b is a pie chart for kinase classes predicted by Kinomer1.0, showing the distribution of kinase classes in human infectious fungal pathogens C. neoformans, C. albicans, and A. fumigatus. .
Figure 2 shows the phenotypic clustering of protein kinases in C. neoformans. Phenotypes were scored on a scale of 7 (-3: strong susceptibility/reduction, -2: moderate susceptibility/reduction, -1: weak susceptibility/reduction, 0: similar to wild type, +1: weak tolerance/moderate, +2 : medium resistance/increase, +3: strong resistance/increase). Gene-E software (http://www.broadinstitute.org/cancer/software/GENE-E/) was loaded with an excel file containing phenotypic scores of each kinase variant, and kinase phenome clustering was performed using one-minus Pearson It can be derived using correlation (One minus Pearson correlation). The abbreviations used in Figure 2 have the following meanings: [T25: 25 °C, T30: 30 °C, T37: 37 °C, T39: 39 °C, CAP: capsule production, MEL: melanin production, URE: urease production, MAT: mating filamentation, HPX: hydrogen peroxide, TBH: tert-butyl hydroperoxide, MD: menadione, DIA: diamide ( diamide), MMS: methyl methanesulfonate, HU: hydroxyurea, 5FC: 5-flucytosine, AMB: amphotericin B, FCZ: fluconazole (fluconazole), FDX: fludioxonil, TM: tunicamycin, DTT: dithiothreitol, CDS: cadmium sulfate, SDS: sodium dodecyl sulfate dodecyl sulfate), CR: congo red, CFW: calcofluor white, KCR: YPD + KCl, NCR: YPD + NaCl, SBR: YPD + sorbitol, KCS: YP + KCl , NCS: YP + NaCl, SBS: YP + sorbitol]
Figure 3 is the result of observing the phenotypes of the gal83Δ mutant and the snf1Δ mutant. Figure 3a is a result of comparing the phenotypes between the wild-type strain, snf1Δ and gal83Δ variants under various stress conditions, and snf1Δ and gal83Δ mutants are more prevalent than the wild-type strain under 1 μg/ml fludioxonil (FDX) conditions. The sensitivity was increased, and in 0.65 mM quaternary-butyl hydroperoxide (tBOOH), the snf1Δ and gal83Δ variants showed increased resistance compared to the wild-type strain. Figure 3b is the result of comparing the carbon source usage ability of the wild-type strain, snf1Δ and gal83Δ variants. 2% glucose, 2% galactose, 3% glycerol, 3% ethanol, 2% maltose, 2% sucrose, 2% sodium acetate , 1% potassium acetate (potassium acetate) conditions were carried out the experiment, it was shown that the snf1Δ , gal83Δ variants are required to use ethanol, sodium acetate, potassium acetate as a carbon source.
4 shows that Fpk1 is C. These are experimental results to confirm whether neoformance Ypk1-dependent phenotypic characteristics are regulated. (a) It is an experimental view of making an overexpressing strain by substituting the FPK1 promoter with the histone H3 promoter. (b) FPK1 overexpressing strains were confirmed by Southern blot analysis, and YSB3986 and YSB3981 strains were generated by overexpressing FPK1 using the ypk1Δ mutant as a parent. (c) Overexpression of FPK1 was confirmed by northern blot quantification. rRNA amount was used as a control. (d) The wild-type H99S strain, the ypk1Δ (YSB1736) mutant, and the FPK1 overexpressing strains (YSB3986 and YSB3981) were cultured in YPD liquid medium for 16 hours, and then placed on a solid medium to observe the degree of growth at the indicated temperature. (e and f) 1.5 M NaCl and 0.04% sodium dodecyl sulphate, 1 μg/ml fludioxonil, 1 μg/ml amphotericin B, 3 mM hydrogen peroxide, 3 mg/ml YPD containing ml calcofluor white, 100 mM hydroxyurea, 2 mM diamide, 300 μg/ml flucytosine and 5 mg/ml fluconazole medium was tested. The cells were cultured for 3 more days and then photographed. (g) A regulatory model of Ypk1 and Fpk1 kinases of C. neoformans that can be predicted from the experimental results.
5 is a pathogenic kinase test result through an insect killing assay. Each mutant was cultured in YPD liquid medium for 16 hours, washed three times with PBS buffer, and then injected into G. mellonella larvae. At this time, 15 larvae are used for each mutant, and 4,000 mutant cells are injected per larva. Thereafter, while culturing the larvae at 37 ° C., survival was checked every day. Statistical analysis of the experimental results was performed using the log-rank Mantel-Cox test. Figure 5a shows the results of experiments performed using two independent mutants for each kinase. Figure 5b shows the results of two repeated experiments on the kinase made with only one variant.
Figure 6 shows the results of marker mutation (STM)-based mouse model infectivity test. The ste50Δ and hxl1Δ strains were used for pathogenicity and non-pathogenicity control for STM studies. As shown in Table 2, the STM quantification was quantified by analyzing the biological triplicate experiments through the qPCR method using STM number-specific primers labeled for the strain. (ad) All kinase variants were tested in four groups. Each set of genes was composed of variants of two independent strains, and two experiments were performed when one variant was present.
Figure 7 is a diagram organized for kinases involved in the pathogenicity of C. neoformans. STM scores were calculated by quantitative PCR method and distinguished using numbers and colors (Fig. 7a). Red letters are infectivity-related kinases that have been newly discovered in the present invention. Twenty-five kinases were identified jointly in the analysis of both insect and mouse models, and the gene names of these twenty-five kinases were written in the STM zero line. P values between control and mutant strains were calculated by one-way ANOVA in Bonferroni correlation using 3 mice per STM set. Each set was performed twice using each independent strain. For single strain variants, two independent experiments were repeated with each single strain. In the STM study, the role of a total of 54 kinases in the infectivity of C. neoformans was analyzed. Referring to Figures 4 and 5, six kinases were identified as pathogenicity-related kinases by the moth killing assay, although pathogenicity control functions were not confirmed in the mouse model infectivity test (Fig. 7b). For single variant strains of bub1 and kin4, two replicates were performed.
Figure 8 shows the phylogenetic relationship between C. neoformans and pathogenicity-related kinases in other eukaryotic protein kinases. Figure 8a shows a BLAST matrix using the CFGP (Comparative Fungal Genomics Platform, http://cfgp.riceblast.snu.ac.kr) database for 60 pathogenicity-related kinases, and the protein sequences of 60 pathogenicity-related kinases As a result of the query, orthologue proteins were matched in 35 genome databases. Figure 8b shows the correlation of pathogenicity-related kinases in fungal pathogens. To identify orthologous proteins, each protein sequence was subjected to BLAST using genome databases (CGD; Candida Genome Database for C. albicans; Broad Institute Database for F. graminearum and C. neoformans) and reverse- Analyzed by BLAST. 21 kinases were associated with pathogenicity in both F. graminearum and C. neoformans. Thirteen kinases have been implicated in the pathogenicity of C. neoformans and C. albicans. Of these, five kinases, including Sch9, Snf1, Pka1, Hog1 and Swe1, were involved in the virulence of all three fungal pathogens and are shown in red.
Figure 9 shows the pleiotropic role of Ipk1 in Cryptococcus neoformans. Various experiments were performed using WT (wild type) and ipk1Δ mutants (YSB2157 and YSB2158). In Fig. 9a, the ipk1Δ mutant showed reduced virulence in an insect-based in vivo virulence assay. Controls in this assay were injected with only WT and PBS. In Fig. 9b, the ipk1Δ mutant induced a capsule. Cells cultured overnight were placed on DME plates at 37°C for 2 days. 50 μl of 1.5 X 10 ⁸ cells were packed in each capillary tube and the packed cell volume was monitored daily. After 3 days when the cells were dropped by gravity, the packed cell volume was calculated from the total volume and normalized to WT. The P value of each strain was less than 0.05. (*) Error lines represent SEM. In Fig. 9c, the ipk1Δ mutant exhibits a melanin-deficient phenotype. Melanin production was confirmed after 3 days on a Niser seed plate containing 0.2% glucose. In Fig. 9d, the ipk1Δ deletion mutant was defective in urease production. Urease production was confirmed after 2 days in Christensen's agar medium at 30 °C. In Fig. 9e, the ipk1Δ mutant showed severe defects in hyphal growth. Mating analysis was confirmed after 9 days on a V8 medium (pH 5, 1L standard: V8 juice 50 ml (Campbell), KH2PO4 (Bioshop, PPM302) 0.5g, Agar (Bioshop, AGR001.500) 40g) plate. 9f and g are photomicrographs obtained from spot analysis at 10-fold dilution (10 ² to 10 ⁵ -fold dilution). Growth rates were measured under various growth conditions shown in the pictures. For chemosensitivity assays, the following chemicals were treated on YPD medium: HU; hydroxyurea 100 mM, TM as DNA damage reagent; As an ER stress (endoplasmic reticulum stress) inducing reagent, 0.3 μg/ml of tunicamycin, CFW; Calcofluor white 3 mg/ml, SDS as cell wall damage reagent; Sodium dodecyl sulfate 0.03%, CDS for membrane stability test; CdSO4 30 M, HPX as heavy metal stress reagent; Hydrogen peroxide 3 mM as an oxidant reagent, 1M NaCl for osmotic shock, and AmpB (amphoteracin B) 0.9 mg/ml, FCZ (fluconazole) 14 μg/ml, 5-FC ( flucytosine) 300 μg/ml, and FDX (fludioxonil) 1 μg/ml.
10 shows protein kinases involved in the growth and pathogenicity of Cryptococcus neoformans. Functional network analysis of 60 pathogenicity-regulating kinases of C. neoformans by previously reported CryptoNet (http://www.inetbio.org/cryptonet) (Kim, H. et al. Network-assisted genetic dissection of pathogenicity and drug resistance in the opportunistic human pathogenic fungus Cryptococcus neoformans . Scientific reports 5, 8767, doi: 10.1038/srep08767 (2015)). The network was built based on 100 candidate genes predicted by CryptoNet to be functionally related to 60 pathogenicity-regulating kinases. In this pathogenicity network, genes were classified according to predicted biological functions described in information of Gene Ontology (GO) term. In CryptoNet, six kinases (Arg5/6, Ipk1, Irk2, Irk4, Irk6 and vrk1) did not have functionally relevant genes.
11 shows experimental results using cdc7Δ , cbk1Δ and kic1Δ mutants. (ac) cdc7Δ mutants (YSB2911, YSB2912), met1Δ mutants (YSB3063, YSB3611), and cka1 (YSB3051, YSB3052) were grown overnight in YPD medium and serially diluted 10-fold in solid YPD medium and 100 mM hydroxyurea (HU), 0.06 YPD medium containing % methyl methanesulphonate (MMS), 1 ug/mL amphotericin B (AmpB), 1 ug/mL fludioxonil (FDX), 3 mM hydrogen peroxide (HPX), and 300 ug/mL flucytosine (5-FC) Spotted. Spotted cells were further incubated at 30 °C or the indicated temperature for 3 days and then photographed. (d) The wild type and the following mutants [ kic1Δ (YSB2915, YSB2916), cbk1Δ (YSB2941, YSB2942), cka1Δ (YSB3051, YSB3052)] were cultured in YPD medium for more than 16 hours and then in 10% paraformaldehyde for 15 minutes. It was fixed and washed twice with PBS solution. The fixed cells were stained with 10 μg/ml Hoechst solution (Hoechst 33342, Invitrogen) for 30 minutes and then observed under a fluorescence microscope (Nikon eclipse Ti microscope).
12 is an experimental result for the bud32Δ mutant. (a) Wild-type and bud32Δ mutants (YSB1968, YSB1969) were cultured overnight in YPD medium, serially diluted 10-fold, and then spotted on YPD medium containing the following chemicals to observe growth rates under various growth conditions. [1.5 M NaCl, 1.5 M KCl, 2 M Sorbitol, 1 μg/ml amphotericin B (AmpB), 14 μg/ml fluconazole (FCZ), 1 μg/ml fludioxonil (FDX), 300 μg/ml flucytosine, 100 mM hydroxyurea (HU), 0.04% methyl methanesulphonate (MMS), 3 mM hydrogen peroxide (HPX), 0.7 mM tert-butyl hydroperoxide (tBOOH), 2 mM diamide (DIA), 0.02 mM menadione (MD), 0.03% sodium dodecyl sulphate ( SDS)] Cells spotted on YPD medium containing these chemicals were further incubated at 30 °C and then photographed. (b) The melanin-producing ability of the wild-type and bud32Δ mutants was confirmed after culturing on Niser seed plates containing 0.1% glucose, and urease production in Christensen's agar medium at 30 °C. Cells cultured overnight were placed on a DME plate at 37° C. for 2 days to confirm the ability to form capsules. 50 μl of 1.5 X 10 ⁸ cells were injected into a capillary tube, and after 3 days the gravity packed cell volume was monitored daily to calculate the packed cell volume from the total volume and normalized to WT. The resulting value was calculated by one-way ANOVA in the Bonferroni correlation, and was repeated three times. (c) In order to compare mating efficacy between wild type and bud32Δ mutants, they were cultured in the dark for 9 days after spotting on V8 medium. (d) Wild-type and bud32Δ mutants were cultured at 30 °C until the logarithmic growth phase, and the culture medium was divided into two samples, one of which was treated with fluconazole (FCZ) for 90 minutes and the other was not treated. Total RNA was extracted from each sample and the expression level of ERG11 was confirmed through Northern analysis.
13 shows experimental results for the arg5,6Δ mutant and met3Δ . (a, b) Wild type (H99S), arg5,6Δ mutants (YSB2408, YSB2409, YSB2410), and met3Δ mutants (YSB3329, YSB3330) were cultured in YPD medium overnight and then washed with PBS. Washed cells were serially diluted 10-fold and spotted on solid synthetic complete medium. [SC; yeast nitrogen base without amino acids (Difco) supplemented with the indicated concentration of the following amino acids and nucleotides: 30 mg/l L-isoleucine, 0.15 g/l L-valine, 20 mg/l adenine sulphate, 20 mg/l L -histidine-HCl, 0.1 g/l L-leucine, 30 mg/l L-lysine, 50 mg/l L-phenylalanine, 20 mg/l L-tryptophan, 30 mg/l uracil, 0.4 g/l L-serine , 0.1 g/l glutamic acid, 0.2 g/l L-threonine, 0.1 g/l L-aspartate, 20 mg/l L-arginine, 20 mg/l L-cysteine, and 20 mg/l L-methionine]. SC-arg (a), SC-met and SC-met-cys (b) media indicate the SC medium lacking arginine, methionine and/or cysteine supplements. (b) A schematic diagram of the biosynthetic pathway of methionine and cysteine. (c) Wild type, arg5,6Δ mutant, and met3Δ mutant were cultured overnight in YPD medium, serially diluted 10-fold, and then spotted on YPD medium containing the following chemicals to observe growth rates under various growth conditions. [1 μg/ml amphotericin B (AmpB), 14 μg/ml fluconazole (FCZ), 1 μg/ml fludioxonil (FDX), 3 mM hydrogen peroxide (HPX)]. Spotted cells were photographed after 3 days of incubation at 30 °C or the indicated temperature.
Figure 14 shows retrograde vacuole trafficking that modulates the pathogenicity of Cryptococcus neoformans. Retrograde vacuolar transport regulates the pathogenicity of C. neoformans. Various experiments were performed using WT and vps15Δ mutants [YSB1500, YSB1501]. In Figure 14a, Vps15 is required for the virulence of C. neoformans. WT and PBS buffers were used as positive and negative controls, respectively. In FIG. 14 b , the vps15Δ variant exhibits increased vacuole production. The scale represents 10 μl. In FIG. 14 c , the vps15Δ mutant showed severe growth defects under ER stress. Cells cultured overnight were spotted on YPD medium containing 15 mM dithiothreitol (DTT) or 0.3 μg/ml tunicamycin (TM) and further cultured at 30° C. for 3 days After that, a picture was taken. In Fig. 14d, the vps15Δ mutant showed severe growth defects against high temperature, cell membrane stress and cell wall stress. Cells cultured overnight were spotted on YPD medium and further cultured at the indicated temperature, or spotted on YPD medium containing 0.03% SDS or 5 mg/mL Calcofluor White (CFW) and incubated at 30 °C. further cultured. Plates were photographed after 3 days. In Figure 14e, Vps15 was not involved in the calcineurin pathway in C. neoformans. For quantitative RT-RCR (qRT-PCR), RNAs were obtained from three replicates of WT and vps15Δ mutants. Expression levels of CNA1, CNB1, CRZ1, and UTR2 were normalized to the expression level of ACT1, a control group. Data were collected from three replicates. The error line represents the standard error of means (sem). In Fig. 14f, Vps15 negatively regulates Hxl1 splicing. For RT-PCR, RNAs were obtained from WT and vps15Δ mutants and cDNAs were synthesized. HXL1 and ACT1-specific primer pairs were used for RT-PCR (Table 3). The experiment was repeated twice, and one experiment is representatively shown.
15 shows experimental results for vrk1Δ mutants. Figure 15a shows WT and vrk1Δ strains on YPD medium and YPD containing 2.5 mM hydrogen peroxide (HPX), 600 μg/ml flucytosine (5-FC) or 1 μg/ml fludioxonil (FDX). Indicates spotting on the medium. The strain was cultured for 3 days at 30 °C and photographed. Figure 15b shows the result of relative quantification of the packed cell volume. Three independent measurements show significant differences between WT and vrk1Δ strains (***; 0.0004 and **; 0.0038, sem). Figure 15c shows the relative quantification of Vrk1-mediated phosphorylation. Peptide samples were analyzed on average 3 times in independent experiments, and peptides were obtained in 2 independent experiments. Results are the mean±sem of two independent experiments. Student's unpaired t-test was applied to examine statistical significance. ***P<0.001, **P<0.01, *P<0.05. PSMs represent peptide spectral matching.

Hereinafter, the present invention will be described in more detail through examples. These examples are only for explaining the present invention in more detail, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples.

Animal care and all experiments were performed in accordance with the ethical guidelines of the Institutional Animal Care and Use Committee (IACUC) of Yonsei University. Yonsei University IACUC approved all vertebrate animal studies.

Example

Example 1: Cryptococcus neoformans ( Cryptococcus neoformans ) Identification of my protein kinase

To select putative kinase genes in the genome of C. neoformans var. grubii ( C. neoformans var. grubii ; strain H99), two approaches were used. First, Kinomer v. 1.0 database (Kinome v. 1.0 database; www.compbio.dundee.ac.uk/kinomer/) was used, which is a highly sensitive and accurate hidden Markov model (HMM)-based method. (Martin, DM, Miranda-Saavedra, D. & Barton, GJ Kinomer v. 1.0: a database of systematically classified eukaryotic protein kinases. Nucleic Acids Res 37, D244- 250, doi:10.1093/nar/gkn834, 2009). With the kinomer database, 97 putative kinases were predicted in the genome of serotype D C. neoformans (strain JEC21). Next, each JEC21 kinase gene ID was mapped with the H99 strain based on the most recent genomic annotation (version 7), and 95 putative kinases were retrieved. However, these kinomer lists were found to be incomplete, failing to present all histidine kinases and some known kinases such as Hog1. Therefore, we further investigated the annotations made in the H99 genome database (www.broadinstitute.org/annotation/genome/cryptococcus_neoformans) provided by the Broad Institute and the JEC21 genome database of the National Center for Biotechnology Information (NCBI). approach was used. For each gene with a kinase-related annotation, Pfam (http://pfam.xfam.org/ ) was used to perform protein domain analysis. Through this analysis, an additional 88 putative kinase genes were retrieved. As a result, a total of 183 putative kinase genes were identified in C. neoformans. Their phylogenetic relationship is shown in Figure 1.

The eukaryotic protein kinase superfamily is divided into two main groups: six conventional protein kinase groups (ePKs) and three atypical groups (aPKs) (Miranda-Saavedra, D. & Barton, GJ Classification and functional annotation of eukaryotic protein kinases. Proteins 68, 893-914, doi:10.1002/prot.21444, 2007). ePKs are members of the AGC group (including cyclic nucleotide and calcium-phospholipid-dependent kinases, ribosomal S6-phosphorylated kinases, G protein-linked kinases and all similar homologs of these sets), CAMKs (calmodulin-regulated kinases) ; CK1 group (casein kinase 1, and similar homologues), CMGC group (including cyclin-dependent kinases, mitogen-activated protein kinases, glycogen synthase kinases and CDK-like kinases), RGC group (receptor guanylate cyclases) ), STEs (including many kinase functions in the MAP kinase cascade), TKs (tyrosine kinases) and TKLs (tyrosine kinase-like kinases) (Fig. 1). aPKs include a group of alpha-kinases, PIKK (phosphatidylinositol 3-kinase-related kinase), RIO and PHDK (pyruvate dehydrogenase kinase). To classify 183 C. neoformans kinases according to these criteria, their amino acid sequences were queried in a kinomer database. Several previously classified kinases (Martin, DM, Miranda-Saavedra, D. & Barton, GJ Kinomer v. 1.0: a database of systematically classified eukaryotic protein kinases. Nucleic Acids Res 37, D244-250, doi:10.1093/ nar/gkn834, 2009) were classified differently (14 out of 95) probably due to sequence differences between JEC21 and H99. Most of the other kinases identified by the annotation search did not correspond to the existing categories (82 out of 88), and we classified them as "others". Therefore, the C. neoformans kinome consists of 89 ePKs (18 AGC, 22 CAMK, 2 CK1, 24 CMGC, 2 PDHK, 18 STE, 3 TKL), 10 aPKs (2 PDHK, 6 PIKK, 2 RIO), and It was found to consist of 84 "Other" groups (Fig. 1). The other group includes 7 histidine kinases (FIG. 1). Superfamily (version 1.73) (Wilson, D. et al. SUPERFAMILY--sophisticated comparative genomics, data mining, visualization and phylogeny. Nucleic Acids Res 37, D380-386, doi:10.1093/nar/gkn762 (2009)) (Supplementary Based on predictions by HMMER sequence profiling in Data 2 and Fig. 1b), two human fungal pathogens, C. albicans and A. fumagatus, were confirmed to have 188 and 269 protein kinases, respectively. Among the pathogenic fungal kinases, CMGC (12-13%), CAMK (12-18%), STE (6-10%), and AGC (6-10%) appear to be the most common clades (FIG. 1).

Considering that most eukaryotic genomes are predicted to contain kinases at a rate of about 1–2% of the genome, the protein kinase rate of C. neoformans (~2.6%) was higher than expected. This indicates that C. neoformans has both saprobic and parasitic life cycles, in which the pathogenic yeast is in contact with a wider variety of environmental and host signals. Nonetheless, it remains to be elucidated whether all of these predicted kinases have biologically significant kinase activities. Phylogenetic comparison of 183 putative C. neoformans kinases with other fungi and higher eukaryotes suggests that kinases are conserved at much higher levels among fungi and other eukaryotes than transcription factors (TFs). In conclusion, kinome networks appear to be evolutionarily conserved, at least in terms of sequence similarity, among fungi, in stark contrast to the evolutionarily dispersed TF networks.

Example 2: C. Construction of a library of kinase gene-deletion variants in Neoformans

To understand the biological functions of the Cryptococcus kinome network and their complexity, gene-deletion variants for each kinase were constructed and functional properties were identified. Among the kinases analyzed, variants for 22 kinases ( TCO1, TCO2, TCO3, TCO4, TCO5, TCO7, SSK2, PBS2, HOG1, BCK1, MKK1/2, MPK1, STE11, STE7, CPK1, PKA1, PKA2, HRK1, PKP1, IRE1, SCH9, and YPK1 ) have already been partially characterized by the present inventors. (Bahn, YS, Geunes-Boyer, S. & Heitman, J. Ssk2 mitogen-activated protein kinase kinase kinase governs divergent patterns of the stress-activated Hog1 signaling pathway in Cryptococcus neoformans. Eukaryot. Cell 6, 2278-2289 (2007) Bahn, YS, Hicks, JK, Giles, SS, Cox, GM & Heitman, J. Adenylyl cyclase-associated protein Aca1 regulates virulence and differentiation of Cryptococcus neoformans via the cyclic AMP-protein kinase A cascade.Eukaryot.Cell 3, 1476 -1491 (2004);Bahn, YS, Kojima, K., Cox, GM & Heitman, J. Specialization of the HOG pathway and its impact on differentiation and virulence of Cryptococcus neoformans. Mol. Biol. Cell 16, 2285-2300 ( 2005);Bahn, YS, Kojima, K., Cox, GM & Heitman, J. A unique fungal two-component system regulates stress responses, drug sensitivity, sexual development, and virulence of Cryptococcus neoformans. Mol. Biol. Cell. 17 Network-assisted genetic dissection of pathogenicity and drug resistance in the opportunis, 3122-3135 (2006); tic human pathogenic fungus Cryptococcus neoformans. Scientific reports 5, 8767, doi:10.1038/srep08767 (2015); Kim, MS, Kim, SY, Yoon, JK, Lee, YW & Bahn, YS An efficient gene-disruption method in Cryptococcus neoformans by double-joint PCR with NAT-split markers. Biochem. Biophys. Res. Commun. 390, 983-988, doi:S0006-291X(09)02080-4 [pii] 10.1016/j.bbrc.2009.10.089 (2009); Kim, S.Y. et al. Hrk1 plays both Hog1-dependent and -independent roles in controlling stress response and antifungal drug resistance in Cryptococcus neoformans. PLoS One 6, e18769, doi:doi:10.1371/journal.pone.0018769 (2011); Kojima, K., Bahn, YS & Heitman, J. Calcineurin, Mpk1 and Hog1 MAPK pathways independently control fludioxonil antifungal sensitivity in Cryptococcus neoformans. Microbiology 152, 591-604 (2006); Maeng, S. et al. Comparative transcriptome analysis reveals novel roles of the Ras and cyclic AMP signaling pathways in environmental stress response and antifungal drug sensitivity in Cryptococcus neoformans. Eukaryot. Cell 9, 360-378, doi:EC.00309-09 [pii]; 10.1128/EC.00309-09 (2010); Cheon, SA et al. Unique evolution of the UPR pathway with a novel bZIP transcription factor, Hxl1, for controlling pathogenicity of Cryptococcus neoformans. PLoS Pathog. 7, e1002177, doi:10.1371/journal.ppat.1002177 (2011)).

For the other 161 kinases, large-scale homologous recombination and in vitro and in vivo phenotypic analysis were used to construct gene-deletion variants and deposit them (accession number: KCCM 51297). A dominant norseothricin resistance marker (NAT) containing a series of distinct oligonucleotide sequence signature tags (Table 1) was used to perform a large-scale infectivity test in a mouse host. did To demonstrate the correct gene deletion and the absence of ectopic integration of each gene-disrupting cassette, Southern blot analysis was performed.

26 kinase gene deletion strains CNAG_Num. gene name Experiment serial number (YSB #) genotype CNAG_00047 PKP1 558, 608 MAT α pkp1 Δ ::NAT-STM#224 CNAG_00106 TCO5 286, 287 MAT α tco5 Δ ::NAT-STM#125 CNAG_00130 HRK1 270, 271 MAT α hrk1 Δ ::NAT-STM#58 CNAG_00363 TCO6 2469, 2554 MAT α tco6 Δ ::NAT-STM#58 CNAG_00396 PKA1 188, 189 MAT α pka1 Δ ::NAT-STM#191 CNAG_00405 KIC1 2915, 2916 MAT α kic1 Δ ::NAT-STM#201 CNAG_00415 CDC2801 2370, 3699 MAT α cdc2801 Δ ::NAT-STM#191 CNAG_00636 CDC7 2911, 2912 MAT α cdc7 Δ ::NAT-STM#213 CNAG_00745 HRK1/NPH1 1438, 1439 MAT α hrk1/mph1 Δ ::NAT-STM#210 CNAG_00769 PBS2 123, 124 MAT α pbs2 Δ ::NAT-STM#213 CNAG_00782 SPS1 3229, 3325 MAT α sps1Δ ::NAT-STM#288 CNAG_00826 DAK2 1912, 1913 MAT α dak2 Δ ::NAT-STM#282 CNAG_01062 PSK201 1989, 1990 MAT α psk201 Δ ::NAT-STM#191 CNAG_01155 GUT1 1241, 2761 MAT α gut1 Δ ::NAT-STM#242 CNAG_01162 MAK322 3824, 3825 MAT α mak322 Δ ::NAT-STM#159 CNAG_01165 LCB5 3789, 3790 MAT α lcb5 Δ ::NAT-STM#213 CNAG_01209 FAB1 3172 MAT α fab1 Δ ::NAT-STM#169 CNAG_01294 IPK1 2157, 2158 MAT α ipk1 Δ ::NAT-STM#184 CNAG_01333 ALK1 1571, 1573 MAT α alk1 Δ ::NAT-STM#122 CNAG_01523 HOG1 64, 65 MAT α hog1 Δ ::NAT-STM#177 CNAG_01612 PSK202 3922, 3924 MAT α psk202 Δ ::NAT-STM#208 CNAG_01704 IRK6 3830, 3831 MAT α irk6 Δ ::NAT-STM#5 CNAG_01730 STE7 342, 343 MAT α ste7 Δ ::NAT-STM#225 CNAG_01850 TCO1 278, 279 MAT α yco1 Δ ::NAT-STM#102 CNAG_01905 KSP1 1807, 1808, 1809 MAT α ksp1 Δ ::NAT-STM#159 CNAG_01938 KIN1 3930, 3931 MAT α kin1 Δ ::NAT-STM#6 CNAG_01988 TCO3 284, 285 MAT α tco3 Δ ::NAT-STM#119 CNAG_02233 MEC1 3063, 3611 MAT α mec1 Δ ::NAT-STM#204 CNAG_02296 RBK1 1510, 1511 MAT α rbk1 Δ ::NAT-STM#219 CNAG_02357 MKK2 330, 331 MAT α mkk2 Δ ::NAT-STM#224 CNAG_02389 YPK101 1885, 1886 MAT α ypk101 Δ ::NAT-STM#242 CNAG_02511 CPK1 127, 128 MAT α cpk1 Δ ::NAT-STM#184 CNAG_02531 CPK2 373, 374 MAT α cpk2 Δ ::NAT-STM#122 CNAG_02542 IRK2 1904, 1905 MAT α irk2 Δ ::NAT-STM#232 CNAG_02551 DAK3 1940, 1941 MAT α dak3Δ ::NAT-STM#295 CNAG_02675 HSL101 1800, 1801 MAT α hsl101 Δ ::NAT-STM#146 CNAG_02680 VPS15 1500, 1501 MAT α vps15 Δ ::NAT-STM#123 CNAG_02712 BUD32 1968, 1969 MAT α bud32Δ ::NAT-STM#295 CNAG_02799 DAK202A 2487, 2489 MAT α dak202a Δ ::NAT-STM#119 CNAG_02802 ARG2 1503, 1504 MAT α arg2 Δ ::NAT-STM#125 CNAG_02820 PKH201 1234, 1235, 1236 MAT α pkh201 Δ ::NAT-STM#219 CNAG_02859 POS5 3714, 3715 MAT α pos5 Δ ::NAT-STM#58 CNAG_02947 SCY1 2793, 2794 MAT α scy1 Δ ::NAT-STM#150 CNAG_03024 RIM15 1216, 1217 MAT α rim15 Δ ::NAT-STM#191 CNAG_03048 IRK3 1486, 1487 MAT α irk3 Δ ::NAT-STM#273 CNAG_03167 CHK1 1825, 1828 MAT α chk1 Δ ::NAT-STM#205 CNAG_03184 BUB1 3398 MAT α bub1 Δ ::NAT-STM#201 CNAG_03216 SNF101 1575, 1576 MAT α snf101 Δ ::NAT-STM#146 CNAG_03258 TPK202A 2443, 2444 MAT α psk202a Δ ::NAT-STM#208 CNAG_03290 KIC102 3211, 3212 MAT α kic102 Δ ::NAT-STM#201 CNAG_03355 TCO4 417, 418 MAT α tco4 Δ ::NAT-STM#123 CNAG_03367 URK1 1266, 1267 MAT α urk1 Δ ::NAT-STM#43 CNAG_03369 SWE102 1564, 1565 MAT α swe102 Δ ::NAT-STM#169 CNAG_03567 CBK1 2941, 2942 MAT α cbk1 Δ ::NAT-STM#232 CNAG_03592 THI20 3219, 3220 MAT α THI20 Δ ::NAT-STM#231 CNAG_03670 IRE1 552, 554 MAT α ire1 Δ ::NAT-STM#224 CNAG_03811 IRK5 2952, 2953 MAT α irk5 Δ ::NAT-STM#213 CNAG_03843 ARK1 1725, 1726 MAT α ark1 Δ ::NAT-STM#43 CNAG_03946 GAL302 2852, 2853 MAT α gal302 Δ ::NAT-STM#218 CNAG_04040 FPK1 2948, 2949 MAT α fpk1 Δ ::NAT-STM#211

CNAG_04108 PKP2 2439, 2440 MAT α pkp2Δ ::NAT-STM#295 CNAG_04162 PKA2 194, 195 MAT α pka2 Δ ::NAT-STM#205 CNAG_04197 YAK1 2040, 2096, 4139 MAT α yak1 Δ ::NAT-STM#184 CNAG_04215 MET3 3329, 3330 MAT α met3 Δ ::NAT-STM#205 CNAG_04221 FBP26 3669 MAT α fbp26 Δ ::NAT-STM#146 CNAG_04230 THI6 1468, 1469 MAT α thi6Δ ::NAT-STM#290 CNAG_04282 MPK2 3236, 3238 MAT α mpk2 Δ ::NAT-STM#102 CNAG_04316 UTR1 2892, 2893 MAT α utr1 Δ ::NAT-STM#5 CNAG_04408 CKI1 1804, 1805 MAT α cki1 Δ ::NAT-STM#218 CNAG_04433 YAK103 3736, 3737 MAT α YAK103 Δ ::NAT-STM#231 CNAG_04514 MPK1 3814, 3816 MAT α mpk1 Δ ::NAT-STM#240 CNAG_04631 RIK1 1579, 1580 MAT α CNAG_04631 Δ ::NAT-STM#150 CNAG_04678 YPK1 1736, 1737 MAT α ypk1 Δ ::NAT-STM#58 CNAG_04755 BCK1 273, 274 MAT α bck1 Δ ::NAT-STM#43 CNAG_04821 PAN3 2809, 2810 MAT α pan3 Δ ::NAT-STM#204 CNAG_04927 YFH702 2826, 3716 MAT α yfh702 Δ ::NAT-STM#220 CNAG_05005 ATG1 1935, 1936 MAT α atg1Δ ::NAT-STM#288 CNAG_05063 SSK2 264, 265 MAT α ssk2 Δ ::NAT-STM#210 CNAG_05097 CKY1 1245, 1246 MAT α CNAG_05097 Δ ::NAT-STM#282 CNAG_05216 RAD53 3785, 3786 MAT α rad53 Δ ::NAT-STM#184 CNAG_05220 TLK1 3153, 3188 MAT α tlk1 Δ ::NAT-STM#116 CNAG_05243 XKS1 2851 MAT α xks1 Δ ::NAT-STM#125 CNAG_05439 CMK1 1883, 1901, 1902 MAT α cmk1 Δ ::NAT-STM#227 CNAG_05558 KIN4 2955 MAT α kin4 Δ ::NAT-STM#225 CNAG_05590 TCO2 281, 282 MAT α tco2 Δ ::NAT-STM#116 CNAG_05600 IGI1 1514, 1515 MAT α CNAG_05600 Δ ::NAT-STM#230 CNAG_05694 CKA1 3051, 3052, 3053 MAT α cka1 Δ ::NAT-STM#6 CNAG_05753 ARG5,6 2408, 2409, 2410 MAT α arg5/6 Δ ::NAT-STM#220 CNAG_05771 TEL1 3844, 3845 MAT α tel1 Δ ::NAT-STM#225 CNAG_05965 IRK4 2806, 2808 MAT α irk4 Δ ::NAT-STM#211 CNAG_06033 MAK32 3240, 3241 MAT α mak32 Δ ::NAT-STM#169 CNAG_06051 GAL1 2829, 2830 MAT α gal1 Δ ::NAT-STM#224 CNAG_06086 SSN3 3038, 3039 MAT α ssn3 Δ ::NAT-STM#219 CNAG_06161 VRK1 2216, 2217 MAT α vrk1 Δ ::NAT-STM#123 CNAG_06193 CRK1 1709, 1710 MAT α crk1 Δ ::NAT-STM#43 CNAG_06278 TCO7 348 MAT α tco7 Δ ::NAT-STM#209 CNAG_06301 SCH9 619, 620 MAT α sch9 Δ ::NAT-STM#169 CNAG_06310 IRK7 2136, 2137 MAT α irk7 Δ ::NAT-STM#208 CNAG_06366 HRR2502 2053 MAT α hrr2502 Δ ::NAT-STM#125 CNAG_06552 SNF1 2372, 2373 MAT α snf1 Δ ::NAT-STM#204 CNAG_06553 GAL83 2415, 2416 MAT α gal83Δ ::NAT-STM#288 CNAG_06568 SKS1 1410, 1411 MAT α sks1 Δ ::NAT-STM#211 CNAG_06632 ABC1 2072, 2797 MAT α CNAG_06632 Δ ::NAT-STM#119 CNAG_06671 YKL1 3926, 3927 MAT α CNAG_06671 Δ ::NAT-STM#122 CNAG_06697 MPS1 3632, 3633 MAT α mps1 Δ ::NAT-STM#116 CNAG_06730 GSK3 2038, 2039 MAT α gsk3 Δ ::NAT-STM#123 CNAG_06809 IKS1 1310, 2119 MAT α iks1 Δ ::NAT-STM#116 CNAG_06980 STE11 313, 314 MAT α ste11 Δ ::NAT-STM#242 CNAG_07359 IRK1 1950, 1951 MAT α irk1 Δ ::NAT-STM#5 CNAG_07580 TRM7 3056, 3057 MAT α trm7 Δ ::NAT-STM#102 CNAG_07667 SAT4 3612 MAT α sat4 Δ ::NAT-STM#212 CNAG_07744 PIK1 1493, 1494 MAT α pik 1 Δ ::NAT-STM#227 CNAG_07779 TDA10 2663, 3223 MAT α tda10 Δ ::NAT-STM#102 CNAG_08022 PHO85 3702, 3703 MAT α pho85 Δ ::NAT-STM#218

*CNAG: An abbreviation of Cryptococcus neoformans serotype A genome database, which is the H99 genome database gene number provided by the Broad Institute. For gene deletion through homologous recombination, norseothricin-resistance (NAT; A gene-disruption cassette containing a nourseothricin acetyl transferase) marker was prepared by conventional overlap PCR or NAT split marker/double-joint (DJ) PCR method (Davidson, RC et al. A PCR- based strategy to generate integrative targeting alleles with large regions of homology.Microbiology 148, 2607-2615 (2002);Kim, MS, Kim, SY, Jung, KW & Bahn, YS Targeted gene disruption in Cryptococcus neoformans using double-joint PCR with split dominant selectable markers.Methods Mol Biol 845, 67-84, doi:10.1007/978-1-61779-539-8_5 (2012) (Table 1 above). To evaluate variant phenotypes and exclude irrelevant variant effects , More than two independent deletion strains were prepared for each kinase variant (see Table 1.) When two independent kinase variants showed different phenotypes (inter-isolate inconsistency), three or more variants were constructed. As a result, 220 gene deletion variants corresponding to 114 kinases (with those reported previously) were successfully prepared (Table 1 above).At least two independent variants were prepared for 106 kinases. Some kinases that have been identified in vitro ( To perform in vitro and in vivo phenotypic analysis, unique markers were independently deleted as markers. If two independent kinase variants showed discordant phenotypes (known as inter-isolation mismatches), three or more variants were prepared. For the remaining 69 kinases, despite repeated attempts by the present inventors, no variants were found. couldn't make it either. Of these, it was observed that in many cases no viable transformants could be obtained at all, or that the wild-type allele was retained in addition to the disrupting allele. The ratio of constructing variants for kinases (114 out of 183 [62%]) was lower than that of previously reported TFs (155 out of 178 [87%]) (Jung, KW et al. Systematic functional profiling of transcription factor networks in Cryptococcus neoformans. Nat Comms 6, 6757, doi:10.1038/ncomms7757, 2015). This may be because, in general, kinases are much more evolutionarily conserved among fungi than TFs, and a greater number of essential genes exist. Indeed, 24 (35%) of the kinases are orthologous to kinases essential for the growth of S. cerevisiae. In particular, 8 of them (RAD53, CDC28, CDC7, CBK1, UTR1, MPS1, PIK1, and TOR2) for which deletion mutants could be made in C. neoformans are known to be essential in S. cerevisiae, which It suggests that there is functional differentiation in several protein kinases between fungi and basidiomycete fungi. In the first round of PCR, the 5'- and 3'-flanking regions for the target kinase gene were amplified with primer pairs L1/L2 and R1/R2, respectively, using H99S genomic DNA as a template. For overlap PCR, primers M13Fe (extended forward M13) and M13Re were used as plasmids pNATSTM (obtained from the laboratory of Joeseph Heitman, Duke University, USA) containing the NAT gene with each unique marker sequence for the entire NAT marker. (extended reverse M13). For split marker/DJ-PCR, split 5'- and 3'-regions of the NAT marker were amplified with pNATS™ using primer pairs M13Fe/NSL and M13Re/NSR, respectively. In the second round of PCR for overlap PCR, the kinase gene-disruption cassette was amplified with primers L1 and R2 using the combined first round PCR product as a template. In the second round of PCR for the cleavage marker/DJ-PCR, the NAT-split gene-disruption cassette was used as a template with the combined corresponding 1st round PCR product, and the 5'- and 3'- and 3 of the kinase gene and NAT marker were used. The '-region was amplified with primer pairs L1/NSL and R2/NSR2, respectively. For transformation, strain H99S (obtained from the laboratory of Joeseph Heitman, Duke University, USA) was used in 30 to 50 ml of yeast extract-peptone-dextrose (YPD) medium [Yeast extract (Becton, Dickison and company #212750), Peptone (Becton, Dickison and company #211677), Glucose (Duchefa, #G0802)], pelleted by overnight incubation and resuspended in 5 ml of distilled water. About 200 μl of the cell suspension was spread on YPD solid medium containing 1 M sorbitol and further cultured at 30 °C for 3 hours. PCR-amplified gene disruption cassettes were coated onto 600 μg of 0.6 μm gold microcarrier beads (PDS-100, BioRad) and biologically injected into cells with a particle delivery system (PDS-100, BioRad). Transformed cells were incubated at 30°C for restoration of cell membrane integrity and scraped after 3 hours. The scraped cells were transferred to a selective medium (YPD solid plate containing 100 μg/ml norseothricin; YPD+NAT). Stable norseothricin-resistant (NATr) transformants were selected through two or more passages on YPD+NAT plates. All NAT ^r strains were confirmed by PCR using each of the screening primers listed in Table 2, and the correct genotype was finally confirmed by Southern blot analysis (Jung, KW, Kim, SY, Okagaki, LH, Nielsen, K. & Bahn , YS Ste50 adapter protein governs sexual differentiation of Cryptococcus neoformans via the pheromone-response MAPK signaling pathway.Fungal Genet.Biol.48, 154-165, doi:S1087-1845(10)00191-X [pii] 10.1016/j.fgb 2010.10.006 (2011).

List of primers used to construct the Aze variant library No. H99 locus tag (Broad ID) Cn gene name Primer name Primer description Primer sequence (5'-3') One CNAG_00047 PKP1 L1 CNAG_00047 5' flanking region primer 1 AATGAAGTTCCTGCGACAG L2 CNAG_00047 5' flanking region primer 2 GCTCACTGGCCGTCGTTTTACAATGGGATGAGAACGCAC R1 CNAG_00047 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGAGCATTTTCCAGCATCAGC R2 CNAG_00047 3' flanking region primer 2 GGTGTGGAACATCTTTTGAG SO CNAG_00047 diagnostic screening primer, pairing with B79 CCCTGACAGCCACATACTG PO1 CNAG_00047 Southern blot probe primer 1 CTGGTTCATCTTGGGTGTC PO2 CNAG_00047 Southern blot probe primer 2 TCTGAGCATACCACTCCTTTAC STM NAT#224 STM primer AACCTTAAATGGGTAGAG STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 2 CNAG_00106 TCO5 L1 CNAG_00106 5' flanking region primer 1 TACACGAGATTGGCTGGCAACC L2 CNAG_00106 5' flanking region primer 2 CTGGCCGTCGTTTTACAAGTGAACGCCACACCGATGAG R1 CNAG_00106 3' flanking region primer 1 GTCATAGCTGTTTCCTGTCTCCCGAGGATGTCTTAG R2 CNAG_00106 3' flanking region primer 2 TGCCAAAGCGTGTAAGTG SO CNAG_00106 diagnostic screening primer, pairing with B79 ATGGGAAAGGTCAGTAGCACCG PO1 CNAG_00106 Southern blot probe primer 1 TCGTCTTTTCTTGGTCCAG PO2 CNAG_00106 Southern blot probe primer 2 TGAGGGCGTAGTTGATAATG STM NAT#125 STM primer CGCTACAGCCAGCGCGCGCAAGCG STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 3 CNAG_00130 HRK1 L1 CNAG_00130 5' flanking region primer 1 TTCCAGTCAACCGAGTAGC L2 CNAG_00130 5' flanking region primer 2 CTGGCCGTCGTTTTACCTGTATTCATCATTGCGGC R1 CNAG_00130 3' flanking region primer 1 GTCATAGCTGTTTCCTGCGTCAAATCCAAGAACATCGTG R2 CNAG_00130 3' flanking region primer 2 GCCTTCATCGTCGTTAGAC SO CNAG_00130 diagnostic screening primer, pairing with B79 AAGACGACCACATCTCAGAG PO1 CNAG_00130 Southern blot probe primer 1 AGGACTCTGCTCCATCAAG PO2 CNAG_00130 Southern blot probe primer 2 GAAAGAGCCTCAGAAAAGTAGG STM NAT#58 STM primer CGCAAAATCACTAGCCCTATAGCG STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 4 CNAG_00266 L1 CNAG_00266 5' flanking region primer 1 GGTCGTATCTCTCTTTCAAGC L2 CNAG_00266 5' flanking region primer 2 TCACTGGCCGTCGTTTTACTTGACGAGTTGTTCAGGGG R1 CNAG_00266 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGTGATGTGGATGAGAAGGTAGC R2 CNAG_00266 3' flanking region primer 2 GTGCCGACGAGAAGATAAC SO CNAG_00266 diagnostic screening primer, pairing with B79 AAGGGATAATGGATGACCAC PO CNAG_00266 Southern blot probe primer TCAGTGAGATTCAAGGATGC STM NAT#213 STM primer CTGGGGATTTTGATGTGTCTATGT STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 5 CNAG_00363 TCO6 L1 CNAG_00363 5' flanking region primer 1 GAGAGAATAACAAAAGGGCG L2 CNAG_00363 5' flanking region primer 2 TCACTGGCCGTCGTTTTACACACGAGGGTTAGAGTTGG R1 CNAG_00363 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGAAGCGTCTTTGTAACCCG R2 CNAG_00363 3' flanking region primer 2 GCAGGTATCTTACACTCCGTTG SO CNAG_00363 diagnostic screening primer, pairing with B79 ATTAGACACACGACCTGGG PO CNAG_00363 Southern blot probe primer TGAGGATACTGGTTGACGC STM NAT#58 STM primer CGCAAAATCACTAGCCCTATAGCG STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 6 CNAG_00388 L1 CNAG_00388 5' flanking region primer 1 TTTTGAGCGGGGAAACAC L2 CNAG_00388 5' flanking region primer 2 TCACTGGCCGTCGTTTTACGGGTCTCGTCTGTATTTTCG R1 CNAG_00388 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGGATACCCAGGATCCACTG R2 CNAG_00388 3' flanking region primer 2 ACCATTATCGTCGCCTTCG SO CNAG_00388 diagnostic screening primer, pairing with B79 CAATCCCAATGGCTTTCAG PO CNAG_00388 Southern blot probe primer CGGGTCAAGATGAAAATGTTCGTC STM NAT#208 STM primer TGGTCGCGGGAGATCGTGGTTT STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 7 CNAG_00396 PKA1 L1 CNAG_00396 5' flanking region primer 1 AAACGACTGTGTAATGCGAG L2 CNAG_00396 5' flanking region primer 2 CTGGCCGTCGTTTTACGGAGCCAGAATAAAGGAGTTG R1 CNAG_00396 3' flanking region primer 1 GTCATAGCTGTTTCCTGGCACTAAATGGGTGAGCAC R2 CNAG_00396 3' flanking region primer 2 CGATTTGTCACAGTGATTCAGTGAC SO CNAG_00396 diagnostic screening primer, pairing with B79 GTTGGAAGTAGCAGTGTCTTG PO CNAG_00396 Southern blot probe primer TGTCGGAGGAGAATGAACG STM NAT#191 STM primer ATATGGATGTTTTTAGCGAG STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 8 CNAG_00405 KIC1 L1 CNAG_00405 5' flanking region primer 1 AAGATGAGCGTTGCGAAG L2 CNAG_00405 5' flanking region primer 2 TCACTGGCCGTCGTTTTACGCGTGGTGCTAAGAACAAC R1 CNAG_00405 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGGAGGTAGACTCCCAGAATGC R2 CNAG_00405 3' flanking region primer 2 TAATGTGTCAACTGCCGC SO CNAG_00405 diagnostic screening primer, pairing with B79 TTGGTTTCAAGGGGGAAC PO CNAG_00405 Southern blot probe primer AAAGTGGACCGTTTGGAG STM NAT#201 STM primer CACCCTCTATCTCGAGAAAGCTCC STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 9 CNAG_00415 CDC2801 L1 CNAG_00415 5' flanking region primer 1 CGCATTCTGGACAAAAGC L2 CNAG_00415 5' flanking region primer 2 TCACTGGCCGTCGTTTTACTTTGCCGTATCTTCCTGG R1 CNAG_00415 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGTGATGTATCTAATCCCTCCG R2 CNAG_00415 3' flanking region primer 2 AGATTCGGTGCTTTGTGTC SO CNAG_00415 diagnostic screening primer, pairing with B79 TTGGTCTGGGAACCTTTAC PO CNAG_00415 Southern blot probe primer AATGTGCTACTGCCGACAG STM NAT#191 STM primer ATATGGATGTTTTTAGCGAG STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 10 CNAG_00556 L1 CNAG_00556 5' flanking region primer 1 GAACCGAAAAGGGCATTC L2 CNAG_00556 5' flanking region primer 2 TCACTGGCCGTCGTTTTACTGGAGCAGGTGGTTCTAAG R1 CNAG_00556 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGCCAGGAGAGAGGAATGAAAC R2 CNAG_00556 3' flanking region primer 2 CCACCGTCCATTACTTACTG SO CNAG_00556 diagnostic screening primer, pairing with B79 TGTCAACCCGCTCAAACAC PO CNAG_00556 Southern blot probe primer AGAGAAGTCCTGCGATTG STM NAT#290 STM primer ACCGACAGCTCGAACAAGCAAGAG STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 11 CNAG_00636 CDC7 L1 CNAG_00636 5' flanking region primer 1 GCTGGAAGCGTGATGATAC L2 CNAG_00636 5' flanking region primer 2 TCACTGGCCGTCGTTTTACTGTTGTAGGAGGGGAGATGAG R1 CNAG_00636 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGAAGGACATCCACCAGAGAGG R2 CNAG_00636 3' flanking region primer 2 CAAATGGGTGTCTCAGAGC SO CNAG_00636 diagnostic screening primer, pairing with B79 TGAGTGATGCCTTACGCTG PO CNAG_00636 Southern blot probe primer CCCTGTAGACTTACCTTCCC

STM NAT#213 STM primer CTGGGGATTTTGATGTGTCTATGT STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 12 CNAG_00683 L1 CNAG_00683 5' flanking region primer 1 GAAAACGAGTCCTGGATAGTTC L2 CNAG_00683 5' flanking region primer 2 TCACTGGCCGTCGTTTTACATGGTTGGATGGGTAGGAG R1 CNAG_00683 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGCCTGCCAACAGACATCAAC R2 CNAG_00683 3' flanking region primer 2 AGAAAAACTCGGACACCTG SO CNAG_00683 diagnostic screening primer, pairing with B79 TGTAAAAAACAGAGGAGCCC PO CNAG_00683 Southern blot probe primer TTCAGAGTCATCCCACGGTG STM NAT#273 STM primer GAGATCTTTCGGGAGGTCTGGATT STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 13 CNAG_00745 HRK1/NPH1 L1 CNAG_00745 5' flanking region primer 1 GCAAAAATGGGGAAGATAGG L2 CNAG_00745 5' flanking region primer 2 TCACTGGCCGTCGTTTTACTTCCCCAAAATCACTCCC R1 CNAG_00745 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGTGGAGATGAGTGGGTGAAG R2 CNAG_00745 3' flanking region primer 2 TGTGTCAGACCTGTTATCGTTC SO CNAG_00745 diagnostic screening primer, pairing with CTCAACCACTCTCTTACGGA PO CNAG_00745 Southern blot probe primer CGAGGTTAGGAGGAAAGGTC STM NAT#210 STM primer CTAGAGCCCGCCACAACGCT STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 14 CNAG_00769 PBS2 L1 CNAG_00769 5' flanking region primer 1 AGGAAGGTGGAGTGTTGTG L2 CNAG_00769 5' flanking region primer 2 CTGGCCGTCGTTTTACATGCGAGGAAGAAAGGTCG R1 CNAG_00769 3' flanking region primer 1 GTCATAGCTGTTTCCTGAACCGACGACCGACTTATGC R2 CNAG_00769 3' flanking region primer 2 GTAAGGTAGTCGCAACAACG SO CNAG_00769 diagnostic screening primer, pairing with B79 CGATACCCTTCTTGCCTGTAG PO1 CNAG_00769 Southern blot probe primer 1 AACACGACAGGAAATCCG PO2 CNAG_00769 Southern blot probe primer 2 TGGAAGGTTACAAGCCGAC STM NAT#213 STM primer CTGGGGATTTTGATGTGTCTATGT STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 15 CNAG_00782 SPS1 L1 CNAG_00782 5' flanking region primer 1 CCCGATGAAAGTAATGGC L2 CNAG_00782 5' flanking region primer 2 TCACTGGCCGTCGTTTTACAATGTCCTCTCTTCTGCTCTC R1 CNAG_00782 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGATGACTGCGAAGAAAGGC R2 CNAG_00782 3' flanking region primer 2 CTTACATCCAGACATCCCAC SO CNAG_00782 diagnostic screening primer, pairing with B79 GGGTGAGCAACAAGAAATG PO CNAG_00782 Southern blot probe primer CTCCTCCTTTCTTTTATGCC STM NAT#288 STM primer CTATCCAACTAGACCTCTAGCTAC STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 16 CNAG_00826 DAK2 L1 CNAG_00826 5' flanking region primer 1 AGTTTGAATGAAGGGGCG L2 CNAG_00826 5' flanking region primer 2 TCACTGGCCGTCGTTTTACGGAAGATGTGTCGGTCTGTC R1 CNAG_00826 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGCGGAAGGTATTCTCAAGGC R2 CNAG_00826 3' flanking region primer 2 GCTGTTCAGTTTCCTCTCTATG SO CNAG_00826 diagnostic screening primer, pairing with B79 ACAGCGATGTGGGGATAAG PO CNAG_00826 Southern blot probe primer CATACTTTCCTCGGGATTTC STM NAT#282 STM primer TCTCTATAGCAAAACCAATC STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 17 CNAG_00877 L1 CNAG_00877 5' flanking region primer 1 TCCACACACGAATGGTATC L2 CNAG_00877 5' flanking region primer 2 TCACTGGCCGTCGTTTTACTTGTCAGCAAGGGAATGGGCAGTG R1 CNAG_00877 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGCGGATGATTTGAGGGATAG R2 CNAG_00877 3' flanking region primer 2 ATTGAAACTACCAGTGGCACCCCG SO CNAG_00877 diagnostic screening primer, pairing with B79 CCAATACGGTGCTTATGTGAC PO CNAG_00877 Southern blot probe primer CGCAGAGTAGGTTGTGTTG STM NAT#204 STM primer GATCTCTCGCGCTTGGGGGA STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 18 CNAG_01061 L1 CNAG_01061 5' flanking region primer 1 AAAAGGGTGGGTCAAAG L2 CNAG_01061 5' flanking region primer 2 TCACTGGCCGTCGTTTTACGGGTATTGGGTTTCCTCTG R1 CNAG_01061 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGGCCATTAGCATTCGGAGAG R2 CNAG_01061 3' flanking region primer 2 GAAGTATCAGAGGAGTCCCG SO CNAG_01061 diagnostic screening primer, pairing with B79 CGTGGTCACTTATGTCCTTC PO CNAG_01061 Southern blot probe primer AAAAGTGCGAAGGGAGGTC STM NAT#220 STM primer CAGATCTCGAACGATACCCA STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 19 CNAG_01062 PSK201 L1 CNAG_01062 5' flanking region primer 1 GTCCACTTTATTTTTTCGGGC L2 CNAG_01062 5' flanking region primer 2 TCACTGGCCGTCGTTTTACGAGGAGTAATGACCGTGACC R1 CNAG_01062 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGTGGTAAAAAGGGGTGGGTC R2 CNAG_01062 3' flanking region primer 2 GGTATTGGGTTTCCTCTGTG SO CNAG_01062 diagnostic screening primer, pairing with B79 GATTAGTATTCCCTGTGCCACC PO CNAG_01062 Southern blot probe primer GGAAATGTAGGGGGTAGACG STM NAT#191 STM primer ATATGGATGTTTTTAGCGAG STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 20 CNAG_01155 GUT1 L1 CNAG_01155 5' flanking region primer 1 AATCGTTCCCTTCCTAAGC L2 CNAG_01155 5' flanking region primer 2 TCACTGGCCGTCGTTTTACAAACCGAGACCTCTGAAGG R1 CNAG_01155 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGGGAGAAAGCCAGACTGAAG R2 CNAG_01155 3' flanking region primer 2 ATGGTAGTTTTGCGGGTG SO CNAG_01155 diagnostic screening primer, pairing with B79 CAGAGAAGTTGACTGGGATG PO CNAG_01155 Southern blot probe primer GTTCATCGCTTCAACCAG STM NAT#242 STM primer GTAGCGATAGGGGTGTCGCTTTAG STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 21 CNAG_01162 MAK322 L1 CNAG_01162 5' flanking region primer 1 GACCGCAGTAGAACTTACACC L2 CNAG_01162 5' flanking region primer 2 TCACTGGCCGTCGTTTTACGAGGAAATGTTGAAGGTGTG R1 CNAG_01162 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGCGGAAGGAAAGAGTTTAGACG R2 CNAG_01162 3' flanking region primer 2 ATCAGGCAACCGCATAAC SO CNAG_01162 diagnostic screening primer, pairing with B79 ATGCTGCCAGAACACTTG PO CNAG_01162 Southern blot probe primer TCCTCCCAAATAAGTGCC STM NAT#159 STM primer ACGCACCAGACACACAACCAG STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 22 CNAG_01165 LCB5 L1 CNAG_01165 5' flanking region primer 1 CCCAAATCTCGTTCGTTG L2 CNAG_01165 5' flanking region primer 2 TCACTGGCCGTCGTTTTACTTGTGTGGCTGTAGAGGTG R1 CNAG_01165 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGGCCATCGCACATAACTTTC R2 CNAG_01165 3' flanking region primer 2 ATTCTGAAGGCGTAAGTCG SO CNAG_01165 diagnostic screening primer, pairing with B79 AAAAGGGTCGTAAGATGGG PO CNAG_01165 Southern blot probe primer ACGCCGAATAGGTTTGTG STM NAT#213 STM primer CTGGGGATTTTGATGTGTCTATGT STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 23 CNAG_01209 FAB1 L1 CNAG_01209 5' flanking region primer 1 TTTCTGATGGGAGGGAGTG

L2 CNAG_01209 5' flanking region primer 2 TCACTGGCCGTCGTTTTACGCGTGGTATGGATAGACAAG R1 CNAG_01209 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGAAAAGATTTGGGGGCTGG R2 CNAG_01209 3' flanking region primer 2 GCTGAAGGTGAGCGATAAG SO CNAG_01209 diagnostic screening primer, pairing with B79 AGTCAGTGTCCAAACTTCTGTC PO CNAG_01209 Southern blot probe primer AAAGGGAATCCAGGAACG STM NAT#169 STM primer ACATCTATATCACTATCCCGAACC STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 24 CNAG_01250 L1 CNAG_01250 5' flanking region primer 1 GCTTTTTCGTTGGAGGTG L2 CNAG_01250 5' flanking region primer 2 TCACTGGCCGTCGTTTTACTGCTCTGTCATCTTCCAGC R1 CNAG_01250 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGATAGCGTGTTACCACAGGC R2 CNAG_01250 3' flanking region primer 2 CGTCCTCAAATACAACTCG SO CNAG_01250 diagnostic screening primer, pairing with B79 TGGTAAATCCTCGTGCTG PO CNAG_01250 Southern blot probe primer GCGAAAGTAACCCAGATGC STM NAT#227 STM primer TCGTGGTTTAGAGGGAGCGC STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 25 CNAG_01285 L1 CNAG_01285 5' flanking region primer 1 CAATAACCCATTACCACTGC L2 CNAG_01285 5' flanking region primer 2 TCACTGGCCGTCGTTTTACTTGTTGGCAAGACCACTG R1 CNAG_01285 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGGTTTCTCCTGAAGCCACTG R2 CNAG_01285 3' flanking region primer 2 TTAGAGGCGGTAGTTACGG SO CNAG_01282 diagnostic screening primer, pairing with B79 TTACGATACTTGGCTGAAGC PO CNAG_01285 Southern blot probe primer AGCATTTTGGCTGTAGGC STM NAT#240 STM primer GGTGTTGGATCGGGGTGGAT STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 26 CNAG_01294 IPK1 L1 CNAG_01294 5' flanking region primer 1 GGAAAAGAGAAGAGCACGG L2 CNAG_01294 5' flanking region primer 2 TCACTGGCCGTCGTTTTACCATCAACCATAGCAAGCAAC R1 CNAG_01294 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGGGCTGGTCAAAGAATGGAC R2 CNAG_01294 3' flanking region primer 2 TGGTAGGATGTGTTGTGGAG SO CNAG_01294 diagnostic screening primer, pairing with B79 TTTGCTCTCTTCGCCAAC PO CNAG_01294 Southern blot probe primer CGCATTCTCATCTTATCCC STM NAT#184 STM primer ATATATGGCTCGAGCTAGATAGAG STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 27 CNAG_01333 ALK1 L1 CNAG_01333 5' flanking region primer 1 GCATTTTTCATTGCTGGTCAC L2 CNAG_01333 5' flanking region primer 2 TCACTGGCCGTCGTTTTACACGGAAGGAGGAGATAACTAAC R1 CNAG_01333 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGGAGTTGTATGGCGAGGATG R2 CNAG_01333 3' flanking region primer 2 GTCCTGTGAATCGGGAGAT SO CNAG_01333 diagnostic screening primer, pairing with B79 TGTTTCACCAGAGTCAGCC PO CNAG_01333 Southern blot probe primer ACGGGAGTTGTTGTATGAGC STM NAT#122 STM primer ACAGCTCCAAACCTCGCTAAACAG STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 28 CNAG_01364 L1 CNAG_01364 5' flanking region primer 1 TCGCTCGCCTTGATTTGAC L2 CNAG_01364 5' flanking region primer 2 TCACTGGCCGTCGTTTTACAAGTGGCTGTTGTGGAGGTCTG R1 CNAG_01364 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGTTGCGGTGATACCTTGCCAG R2 CNAG_01364 3' flanking region primer 2 TCCCCCGTTACCTTTATG SO CNAG_01364 diagnostic screening primer, pairing with B79 CAGCCAATCTTTTCCCTG PO CNAG_01364 Southern blot probe primer TTTTCGCCAGCCACCTTCAG STM NAT#5 STM primer TGCTAGAGGGCGGGAGAGTT STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 29 CNAG_01523 HOG1 L1 CNAG_01523 5' flanking region primer 1 TGTGGTAGGTGCGTTATCG L2 CNAG_01523 5' flanking region primer 2 CTGGCCGTCGTTTTACAGAAAGCCCATCCATCAG R1 CNAG_01523 3' flanking region primer 1 GTCATAGCTGTTTCCTGTCTTGGTAAGTCTCTGTGCC R2 CNAG_01523 3' flanking region primer 2 TACTCAACCCCATACTCACTCCCG SO CNAG_01523 diagnostic screening primer, pairing with B79 TGAAGACAAAAAGGCGTGGG PO1 CNAG_01523 Southern blot probe primer 1 TCACAGAGCGTTGATTACG PO2 CNAG_01523 Southern blot probe primer 2 CAGGCTCATCGGTAGGATCA STM NAT#177 STM primer CACCAACTCCCCATCTCCAT STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 30 CNAG_01612 PSK202 L1 CNAG_01612 5' flanking region primer 1 ACGCTTGTTTCTTCGTCC L2 CNAG_01612 5' flanking region primer 2 TCACTGGCCGTCGTTTTACTCGGGATGATAAAGTGAGG R1 CNAG_01612 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGTCTTCCCCTTTCTGATGG R2 CNAG_01612 3' flanking region primer 2 CCGACCAAAAACAGGTTC SO CNAG_01612 diagnostic screening primer, pairing with B79 AACTGGCATTGAAGGTGTC PO CNAG_01612 Southern blot probe primer GACAAGCATTGGGAAACC STM NAT#208 STM primer TGGTCGCGGGAGATCGTGGTTT STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 31 CNAG_01664 L1 CNAG_01664 5' flanking region primer 1 CCTACATCCAGGACAAACG L2 CNAG_01664 5' flanking region primer 2 TCACTGGCCGTCGTTTTACCACCTTCTCCGACCTTTTC R1 CNAG_01664 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGGCCGCATAAAGAAAAGCC R2 CNAG_01664 3' flanking region primer 2 AAAGCGAGGTTGAAGAGGG SO CNAG_01664 diagnostic screening primer, pairing with B79 CGTCGTAGTGGGTGTAGATG PO CNAG_01664 Southern blot probe primer AGGACAACAAGTCTGGATAGC STM NAT#218 STM primer CTCCACATCCATCGCTCCAA STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 32 CNAG_01687 L1 CNAG_01687 5' flanking region primer 1 GCTCCTAAATACCTGCCACTC L2 CNAG_01687 5' flanking region primer 2 TCACTGGCCGTCGTTTTACCTCATCCGCAGAAATGTATC R1 CNAG_01687 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGTGTTCGCTTATGGTCTATGG R2 CNAG_01687 3' flanking region primer 2 TTGCGACCTTTTTCTCGG SO CNAG_01687 diagnostic screening primer, pairing with B79 TGTTAGAAAAGCCTGTGACG PO CNAG_01687 Southern blot probe primer CCCAAGATAGTCTCGTTTGC STM NAT#290 STM primer ACCGACAGCTCGAACAAGCAAGAG STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 33 CNAG_01704 IRK6 L1 CNAG_01704 5' flanking region primer 1 GGTCAACTTTCCCTTGTCG L2 CNAG_01704 5' flanking region primer 2 TCACTGGCCGTCGTTTTACTTGAGAGAGCGTGATAAAGC R1 CNAG_01704 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGGCACATTGACCTTCCTGTAAC R2 CNAG_01704 3' flanking region primer 2 GCCCTAAACAAACTAACTCTGTCC SO CNAG_01704 diagnostic screening primer, pairing with B79 AGCCTCCTCTTTCCTTACAG PO CNAG_01704 Southern blot probe primer GCTGGTGCCTCTTTGATTC STM NAT#5 STM primer TGCTAGAGGGCGGGAGAGTT STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG

34 CNAG_01730 STE7 L1 CNAG_01730 5' flanking region primer 1 TTGTAAGGCTCTCATTCGC L2 CNAG_01730 5' flanking region primer 2 CTGGCCGTCGTTTTACTGAAGGCAAAACTGGTGC R1 CNAG_01730 3' flanking region primer 1 GTCATAGCTGTTTCCTGCCTTACCGTGCTTTTCTGC R2 CNAG_01730 3' flanking region primer 2 TTACTTCCGCCCAACGACAC SO CNAG_01730 diagnostic screening primer, pairing with B79 TCCTCGCTCACAAATGGGC PO1 CNAG_01730 Southern blot probe primer 1 CCAATAGACATCAAGCCGTC PO2 CNAG_01730 Southern blot probe primer 2 AAACAGAGAAGAGAAGGGACC STM NAT#225 STM primer CCATGAACTAGCTAAAGCA STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 35 CNAG_01820 L1 CNAG_01820 5' flanking region primer 1 TCAGAAGCAGACAAGGCGTC L2 CNAG_01820 5' flanking region primer 2 TCACTGGCCGTCGTTTTACTTTTGGGGAGGAAGTGCTGAGG R1 CNAG_01820 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGGTTGGTCATTTGTGCGAC R2 CNAG_01820 3' flanking region primer 2 GGCATTATGAGCAAATCGG SO CNAG_01820 diagnostic screening primer, pairing with B79 TAGCAGAAGGAGAGGACGGTTC PO CNAG_01820 Southern blot probe primer CCTTGACGATGTTGGTCTG STM NAT#6 STM primer ATAGCTACCACACGATAGCT STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 36 CNAG_01845 L1 CNAG_01845 5' flanking region primer 1 GAATAATCAGCAGCGGTG L2 CNAG_01845 5' flanking region primer 2 TCACTGGCCGTCGTTTTACGTTCGTTGTTGGTTGTCG R1 CNAG_01845 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGGGGAGCCAATAATGTGGAG R2 CNAG_01845 3' flanking region primer 2 TCTTCATCCTTCCCTGC SO CNAG_01845 diagnostic screening primer, pairing with B79 TAAGGGCAAAAGGGTCAG PO CNAG_01845 Southern blot probe primer TTTTTAGCGTCCGTCTCG STM NAT#205 STM primer TATCCCCCTCTCCGCTCTCTAGCA STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 37 CNAG_01850 TCO1 L1 CNAG_01850 5' flanking region primer 1 GTTTCTGCTTCCACCTCAC L2 CNAG_01850 5' flanking region primer 2 CTGGCCGTCGTTTTACTTTACACACACGGGCGATGTCCTG R1 CNAG_01850 3' flanking region primer 1 GTCATAGCTGTTTCCTGACTGAGCAAATCGGCGTAGG R2 CNAG_01850 3' flanking region primer 2 AAGTGAGGGGCATTACAGG SO CNAG_01850 diagnostic screening primer, pairing with B79 CGACACAATACTCTAACTGCG PO1 CNAG_01850 Southern blot probe primer 1 CTTTCGTCTTTGCCACAC PO2 CNAG_01850 Southern blot probe primer 2 AATCACCCTTTGCTACGG STM NAT#102 STM primer CCATGCGATATCTACCCCAATCT STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 38 CNAG_01905 KSP1 L1 CNAG_01905 5' flanking region primer 1 CGATTTTGTCTGGGCTCTC L2 CNAG_01905 5' flanking region primer 2 TCACTGGCCGTCGTTTTACAAGATGATTCGGGCACAG R1 CNAG_01905 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGCCCTCTTTCTCAATCATCG R2 CNAG_01905 3' flanking region primer 2 ACAACATCTTCGCCAACG SO CNAG_01905 diagnostic screening primer, pairing with B79 TACCGACTCGCAATACACC PO CNAG_01905 Southern blot probe primer ATACCTTTGTGGCTTCGC STM NAT#159 STM primer ACGCACCAGACACACAACCAG STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 39 CNAG_01907 L1 CNAG_01907 5' flanking region primer 1 GCATTCTCTCAACTCGCTC L2 CNAG_01907 5' flanking region primer 2 TCACTGGCCGTCGTTTTACTCGTAGCCTCTGTCTCTATCCC R1 CNAG_01907 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGAGTTTCAGCCAATACCAGG R2 CNAG_01907 3' flanking region primer 2 TGAACCCCTTTGACCCATCC SO CNAG_01907 diagnostic screening primer, pairing with B79 CCTCTTCTGTATGCTGCGAG PO CNAG_01907 Southern blot probe primer TCTGGAATGGAGGCTTTC STM NAT#282 STM primer TCTCTATAGCAAAACCAATC STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 40 CNAG_01938 KIN1 L1 CNAG_01938 5' flanking region primer 1 AGAGACAAAGGTGAGGTCG L2 CNAG_01938 5' flanking region primer 2 TCACTGGCCGTCGTTTTACCACGGGATAATGTTGACG R1 CNAG_01938 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGGCAGTATCAAATGCTGGC R2 CNAG_01938 3' flanking region primer 2 AGATAATAAGGGTGCGGC SO CNAG_01938 diagnostic screening primer, pairing with B79 TGAGGTGGAGGCTTGTCTAC PO CNAG_01938 Southern blot probe primer GGACTTCTTTGGTTGGGAG STM NAT#6 STM primer ATAGCTACCACACGATAGCT STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 41 CNAG_01988 TCO3 L1 CNAG_01988 5' flanking region primer 1 CCCAGAAAAGAAGGTTGG L2 CNAG_01988 5' flanking region primer 2 CTGGCCGTCGTTTTACTTGTGGTTTTGTGGGTAGCGTGG R1 CNAG_01988 3' flanking region primer 1 GTCATAGCTGTTTCCTGGGCATCATTGCTCATTCTTGTG R2 CNAG_01988 3' flanking region primer 2 AAAAGGTGAAATAGGGGCGGCG SO CNAG_01988 diagnostic screening primer, pairing with B79 TGTTCCTCAATGAAGTGTCC PO CNAG_01988 Southern blot probe primer 1 ATGGGGAGGTCTATGCGTTAGC PO2 CNAG_01988 Southern blot probe primer 2 TAAAGTCTCTTCCCCACCCG STM NAT#119 STM primer CTCCCCACATAAAGAGAGCTAAAC STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 42 CNAG_02007 L1 CNAG_02007 5' flanking region primer 1 GAGCAGCGAAATAACCAAG L2 CNAG_02007 5' flanking region primer 2 TCACTGGCCGTCGTTTTACCAGTAGCGAGGTGACAGATG R1 CNAG_02007 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGGCGATTGGACACTTACCAC R2 CNAG_02007 3' flanking region primer 2 AGCCCGAGTTCTTTTTAGAC SO CNAG_02007 diagnostic screening primer, pairing with B79 AGAAATAGCGTTGCCACC PO CNAG_02007 Southern blot probe primer GCTTGTTTGGTAGATAGTCAGC STM NAT#232 STM primer CTTTAAAGGTGGTTTGTG STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 43 CNAG_02028 L1 CNAG_02028 5' flanking region primer 1 AAATCCGCAGGGGAAAAC L2 CNAG_02028 5' flanking region primer 2 TCACTGGCCGTCGTTTTACTGGGAAAAGGATGGACAGG R1 CNAG_02028 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGCCTCCGTCCTCAAAGAAAAATACC R2 CNAG_02028 3' flanking region primer 2 TTCCGTTCCAATCGCAAG SO CNAG_02028 diagnostic screening primer, pairing with B79 TTTTGCCCTTGCCCTGTTG PO CNAG_02028 Southern blot probe primer ATCTTGCTCATACCGAACC STM NAT#225 STM primer CCATGAACTAGCTAAAGCA STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 44 CNAG_02194 L1 CNAG_02194 5' flanking region primer 1 TTGGTCCTCTGCGAAAAC L2 CNAG_02194 5' flanking region primer 2 TCACTGGCCGTCGTTTTACGCTGTTGCTGAGAGTTTGTG R1 CNAG_02194 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGTCAAACCCGAAGGTGAAG R2 CNAG_02194 3' flanking region primer 2 ACGACTTATTCCCCATCCC SO CNAG_02194 diagnostic screening primer, pairing with B79 CACCTCGTTTGATGAATGC PO CNAG_02194 Southern blot probe primer CTCTCTCCTTCTCGTATCTGG STM NAT#273 STM primer GAGATCTTTCGGGAGGTCTGGATT STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 45 CNAG_02202 L1 CNAG_02202 5' flanking region primer 1 AACAACCGAAACCAGCGAC L2 CNAG_02202 5' flanking region primer 2 TCACTGGCCGTCGTTTTACGGAAGGTGATGTTTGTGGC R1 CNAG_02202 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGCGCCGACAATGGTCTTATC

R2 CNAG_02202 3' flanking region primer 2 TCCTGGTCATCGTGCTAACC SO CNAG_02202 diagnostic screening primer, pairing with B79 CTTATGCCACTCCTAACCG PO CNAG_02202 Southern blot probe primer GCCGAGATACCTGTAAAGTCC STM NAT#6 STM primer ATAGCTACCACACGATAGCT STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 46 CNAG_02233 MEC1 L1 CNAG_02233 5' flanking region primer 1 TTCCTCATCCACGATACTTC L2 CNAG_02233 5' flanking region primer 2 TCACTGGCCGTCGTTTTACGACAGAGGTTTTGAGGATGC R1 CNAG_02233 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGTTTTGTCCACGACCCTCTC R2 CNAG_02233 3' flanking region primer 2 TCATTGCCACCTCCACCAAG SO CNAG_02233 diagnostic screening primer, pairing with B79 CTGATTGAAGGAACTTACCTCG PO CNAG_02233 Southern blot probe primer GGAGAAGTTCACGAAGGTCTG STM NAT#204 STM primer GATCTCTCGCGCTTGGGGGA STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 47 CNAG_02285 L1 CNAG_02285 5' flanking region primer 1 TCCTCTGTTCTTGTCGTGG L2 CNAG_02285 5' flanking region primer 2 TCACTGGCCGTCGTTTTACCTGCTCAGTGGTAGACATTTTG R1 CNAG_02285 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGTTCTCAGGCTTGGCTCTAC R2 CNAG_02285 3' flanking region primer 2 CGCCCTGTGATGATAATAACCTTC SO CNAG_02285 diagnostic screening primer, pairing with B79 TGGACAAAGGGACACTTACC PO CNAG_02285 Southern blot probe primer TGACAACACCAACGATGG STM NAT#150 STM primer ACATACACCCCCATCCCCCC STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 48 CNAG_02296 RBK1 L1 CNAG_02296 5' flanking region primer 1 TCACTCATCACCAGGTAACG L2 CNAG_02296 5' flanking region primer 2 TCACTGGCCGTCGTTTTACAGAAACTGGAAAGCAGACG R1 CNAG_02296 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGCTTGCTTAGGAAAATCACCC R2 CNAG_02296 3' flanking region primer 2 GCACAAGAAAACCAGTCCAG SO CNAG_02296 diagnostic screening primer, pairing with B79 GCTCGGTATGTTTATCACCTG PO CNAG_02296 Southern blot probe primer GAGTGTGGAAGAGAGAGGAAC STM NAT#219 STM primer CCCTAAAACCCTACAGCAAT STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 49 CNAG_02357 MKK2 L1 CNAG_02357 5' flanking region primer 1 GCGTCATTTCCCAATCAC L2 CNAG_02357 5' flanking region primer 2 CTGGCCGTCGTTTTACTCGGTGTCTTCAGTTCAGAG R1 CNAG_02357 3' flanking region primer 1 GTCATAGCTGTTTCCTGACCCTACCCTTGGCAACTAC R2 CNAG_02357 3' flanking region primer 2 CCCTTTGTTTGTTGCTGAC SO CNAG_02357 diagnostic screening primer, pairing with B79 TTTTGCCCACTCCCCCTTTTACCAC PO1 CNAG_02357 Southern blot probe primer 1 GCAAAGTCACATACACGGC PO2 CNAG_02357 Southern blot probe primer 2 GATGTCCGAGTGATAACCTG STM NAT#224 STM primer AACCTTAAATGGGTAGAG STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 50 CNAG_02389 YPK101 L1 CNAG_02389 5' flanking region primer 1 TACCTGCCGACAAATGAC L2 CNAG_02389 5' flanking region primer 2 TCACTGGCCGTCGTTTTACACATAGCGGCTGCTTTTTC R1 CNAG_02389 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGTGGGGGTTCTAAAAGACG R2 CNAG_02389 3' flanking region primer 2 ACCATCATCTCTGCGTTG SO CNAG_02389 diagnostic screening primer, pairing with B79 AACCGCAAGTAGGGCATAC PO CNAG_02389 Southern blot probe primer TGAGCAAAAAAGGCGAGC STM NAT#242 STM primer GTAGCGATAGGGGTGTCGCTTTAG STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 51 CNAG_02459 L1 CNAG_02459 5' flanking region primer 1 TCTCGGGGTCTTCAATCTC L2 CNAG_02459 5' flanking region primer 2 TCACTGGCCGTCGTTTTACGTGCGGATTCGTTATTTGG R1 CNAG_02459 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGAAAGAGGGTTAGGTTTGGC R2 CNAG_02459 3' flanking region primer 2 GCCACTTCCGTATCAAAAG SO CNAG_02459 diagnostic screening primer, pairing with B79 GCACTGCTGCTTGAAATC PO CNAG_02459 Southern blot probe primer ATAGATTCTGATGCGGCG STM NAT#122 STM primer ACAGCTCCAAACCTCGCTAAACAG STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 52 CNAG_02511 CPK1 L1 CNAG_02511 5' flanking region primer 1 CTGTAGAAGATGTGAGTTTGGG L2 CNAG_02511 5' flanking region primer 2 CTGGCCGTCGTTTTACTGATTGATGAGAGATACGGG R1 CNAG_02511 3' flanking region primer 1 GTCATAGCTGTTTTCCTGGGCGGAGAAATAGAGGTTG R2 CNAG_02511 3' flanking region primer 2 CGCACAAGAAGTAAGAGGGTG SO CNAG_02511 diagnostic screening primer, pairing with B79 GGCTATGGACCGTATTCAC PO1 CNAG_02511 Southern blot probe primer 1 TATCTCACAAGCCACTCCC PO2 CNAG_02511 Southern blot probe primer 2 ATGCTGCTCACCGTTAGTC STM NAT#184 STM primer ATATATGGCTCGAGCTAGATAGAG STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 53 CNAG_02531 CPK2 L1 CNAG_02531 5' flanking region primer 1 ATGTGCTTGGTTTGCCCCGAG L2 CNAG_02531 5' flanking region primer 2 CTGGCCGTCGTTTTACAACCTGACTTTGCGAGGAGC R1 CNAG_02531 3' flanking region primer 1 GTCATAGCTGTTTCCTGGGAAGAGTTGAAGAGGCTG R2 CNAG_02531 3' flanking region primer 2 ACTGTGGCTGTTGTTCAGGC SO CNAG_02531 diagnostic screening primer, pairing with B79 CCAAGGGAAGTCTACCAATAC PO1 CNAG_02531 Southern blot probe primer1 GGGGAAAGATTAGTGCGTC PO2 CNAG_02531 Southern blot probe primer2 GTGCGTAGATGAACGAGTG STM NAT#122 STM primer ACAGCTCCAAACCTCGCTAAACAG STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 54 CNAG_02542 IRK2 L1 CNAG_02542 5' flanking region primer 1 TGTGCTGGTATCTGATGAGC L2 CNAG_02542 5' flanking region primer 2 TCACTGGCCGTCGTTTTACGTGAGCGGCTTTGAAAATG R1 CNAG_02542 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGGCGGCTATCTTTGTGTATGC R2 CNAG_02542 3' flanking region primer 2 CCCTTTGCTCACTTTCATACC SO CNAG_02542 diagnostic screening primer, pairing with B79 TTTTTCGGGTCTGACGAC PO CNAG_02542 Southern blot probe primer CTGTTCACCAAGTTCCCTAATC STM NAT#232 STM primer CTTTAAAGGTGGTTTGTG STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 55 CNAG_02551 DAK3 L1 CNAG_02551 5' flanking region primer 1 ATCTAATCCTCCCTGTCCAC L2 CNAG_02551 5' flanking region primer 2 TCACTGGCCGTCGTTTTACGCGTGATTTCAGGTTCAG R1 CNAG_02551 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGAAGCGTGGTTTCCTGTAAG

R2 CNAG_02551 3' flanking region primer 2 GGTCATAACTCAGAGGGGTC SO CNAG_02551 diagnostic screening primer, pairing with B79 GAGAGCGAAGCAATAGGAAG PO CNAG_02551 Southern blot probe primer AAGCAATCTCCAGACTCCC STM NAT#295 STM primer ACACCTACATCAAACCCTCCC STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 56 CNAG_02675 HSL101 L1 CNAG_02675 5' flanking region primer 1 CAATGCCGTCATCATCAAAC L2 CNAG_02675 5' flanking region primer 2 TCACTGGCCGTCGTTTTACAAGGGCGAACAGGATAATAC R1 CNAG_02675 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGCCTAATGTGAGAGCAGCAATAC R2 CNAG_02675 3' flanking region primer 2 TATGTGCAGAAACCGTG SO CNAG_02675 diagnostic screening primer, pairing with B79 GCTGTCTTGTTTGCGTTG PO CNAG_02675 Southern blot probe primer AGGAGTAGTTATCACTTCGGG STM NAT#146 STM primer ACTAGCCCCCCCTCACCACCT STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 57 CNAG_02680 VPS15 L1 CNAG_02680 5' flanking region primer 1 AGGACCTTCATCAGGACGAC L2 CNAG_02680 5' flanking region primer 2 TCACTGGCCGTCGTTTTACAAACTACCTCCCCCGTTAC R1 CNAG_02680 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGCCAAATGTATGGATTCGCC R2 CNAG_02680 3' flanking region primer 2 CTGCGAATCTCGTCTAAGG SO CNAG_02680 diagnostic screening primer, pairing with B79 TTGAAAGGTCCCACCAGAC PO CNAG_02680 Southern blot probe primer GGGAGGAAGTGAGGAGTATG STM NAT#123 STM primer CTATCGACCAACCAACACAG STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 58 CNAG_02686 L1 CNAG_02686 5' flanking region primer 1 CACACTTTGCTCTTGTCTGAG L2 CNAG_02686 5' flanking region primer 2 TCACTGGCCGTCGTTTTACATGGAGATGCGATAAGCG R1 CNAG_02686 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGTGAATCCTCCCTCAACGAG R2 CNAG_02686 3' flanking region primer 2 AAAGACGACGCCTACTCTGC SO CNAG_02686 diagnostic screening primer, pairing with B79 TGTTCCTCTTCCCTGACAG PO CNAG_02686 Southern blot probe primer CACAATCAAAGCGTTAGGG STM NAT#191 STM primer ATATGGATGTTTTTAGCGAG STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 59 CNAG_02712 BUD32 L1 CNAG_02712 5' flanking region primer 1 ATAGGGGATGACCTTGGAG L2 CNAG_02712 5' flanking region primer 2 TCACTGGCCGTCGTTTTACTGATGCCAAAGACCAGTG R1 CNAG_02712 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGGAGAAGAGGAAGGAAGAGAGAC R2 CNAG_02712 3' flanking region primer 2 GAGCGATAATAGCCACCAC SO CNAG_02712 diagnostic screening primer, pairing with B79 GGGCAATCTTTCTTCGTC PO CNAG_02712 Southern blot probe primer CTCGTTCTCTGGTTCTTCTG STM NAT#296 STM primer CGCCCGCCCTCACTATCCAC STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 60 CNAG_02787 L1 CNAG_02787 5' flanking region primer 1 AACCCCTTGTGTCCCCAAAC L2 CNAG_02787 5' flanking region primer 2 TCACTGGCCGTCGTTTTACTGAGCAGGCGGATACGATAC R1 CNAG_02787 3' flanking region primer 1 ATGGTCATAGCTGTTTCCTGGCAAAAAAGGACAGAAGAAGAGG R2 CNAG_02787 3' flanking region primer 2 TTCTCCCATTTCTCCACCC SO CNAG_02787 diagnostic screening primer, pairing with B79 AGCAGAGCCAGATGGTAGAG PO CNAG_02787 Southern blot probe primer TTCCACTTGGCAACTGTCC STM NAT#227 STM primer TCGTGGTTTAGAGGGAGCGC STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 61 CNAG_02799 DAK202A L1 CNAG_02799 5' flanking region primer 1 TTGATACTTTGGGTCTGGG L2 CNAG_02799 5' flanking region primer 2 TCACTGGCCGTCGTTTTACCGGGAGCCATTATTGGTAAG R1 CNAG_02799 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGTTTTGGATGGCTTGCGAGGG R2 CNAG_02799 3' flanking region primer 2 CCATACAATGACCTGGGAC SO CNAG_02799 diagnostic screening primer, pairing with B79 AACCATCAACTGCCCTCAC PO CNAG_02799 Southern blot probe primer GGTAGTATCGGTGATTTGAGTGAG STM NAT#119 STM primer CTCCCCACATAAAGAGAGCTAAAC STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 62 CNAG_02802 ARG2 L1 CNAG_02802 5' flanking region primer 1 CCAGCAGTTAGGGATTCAG L2 CNAG_02802 5' flanking region primer 2 TCACTGGCCGTCGTTTTACCATCGTAGAGTCGTTATTACCG R1 CNAG_02802 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGATTTGGAGTCCTATCGCC R2 CNAG_02802 3' flanking region primer 2 ATGTCAATGGTAGCCCACC SO CNAG_02802 diagnostic screening primer, pairing with B79 TTTGTTGTTGCCTGACCC PO CNAG_02802 Southern blot probe primer GTCGCTCAAAGTGTCTTTCTC STM NAT#125 STM primer CGCTACAGCCAGCGCGCGCAAGCG STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 63 CNAG_02820 PKH201 L1 CNAG_02820 5' flanking region primer 1 CCCTCGCCAGAATCAATAC L2 CNAG_02820 5' flanking region primer 2 TCACTGGCCGTCGTTTTACGAGAGGATGTTGAGGTTGC R1 CNAG_02820 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGTTGGGATTAGGGCGTATC R2 CNAG_02820 3' flanking region primer 2 TCTGCCTCTACAAACCACTG SO CNAG_02820 diagnostic screening primer, pairing with B79 GGAGAGACAGGGGATAAAGC PO CNAG_02820 Southern blot probe primer ATACCTCCCTTCTCCCAAC STM NAT#219 STM primer CCCTAAAACCCTACAGCAAT STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 64 CNAG_02847 L1 CNAG_02847 5' flanking region primer 1 AGACCGATAAAAACAGGACC L2 CNAG_02847 5' flanking region primer 2 TCACTGGCCGTCGTTTTACAACAATGAAGGCACCTCG R1 CNAG_02847 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGGGAACATTCAAACGGAGAC R2 CNAG_02847 3' flanking region primer 2 ACCAGTTGACAAAGGTATCG SO CNAG_02847 diagnostic screening primer, pairing with B79 AAGAATACTCCAGAAGGGACC PO CNAG_02847 Southern blot probe primer GCTTCTGGGGATAAGGTGAG STM NAT#296 STM primer CGCCCGCCCTCACTATCCAC STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 65 CNAG_02859 POS5 L1 CNAG_02859 5' flanking region primer 1 TACACGACAGTAACTCCCTCCG L2 CNAG_02859 5' flanking region primer 2 TCACTGGCCGTCGTTTTACGAAATAACACACACGCTGC R1 CNAG_02859 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGTGAAAGTGGCTGGGTGAAG R2 CNAG_02859 3' flanking region primer 2 AAAGAACTTGAGAAGACCCG SO CNAG_02859 diagnostic screening primer, pairing with B79 AGCAACGAGTCCACATACC PO CNAG_02859 Southern blot probe primer TACACACCTCCAGTTTGACCTCGC STM NAT#58 STM primer CGCAAAATCACTAGCCCTATAGCG STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 66 CNAG_02866 L1 CNAG_02866 5' flanking region primer 1 GAAGATAGTCAATCCGCAAG L2 CNAG_02866 5' flanking region primer 2 TCACTGGCCGTCGTTTTACATCTACCACTATTCTCCTGGC R1 CNAG_02866 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGGCTGATTGTTCTTGACATTCCG R2 CNAG_02866 3' flanking region primer 2 AAGGAGGATGAAGGAAGGC SO CNAG_02866 diagnostic screening primer, pairing with B79 ACAGGAACCTCCGTAACAG PO CNAG_02866 Southern blot probe primer ATTGGTGAAGGTCTGGGCAGTTCG STM NAT#102 STM primer CCATGCGATATCTACCCCAATCT STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 67 CNAG_02897 L1 CNAG_02897 5' flanking region primer 1 GATGTAGCGGATTGTTTGAC L2 CNAG_02897 5' flanking region primer 2 TCACTGGCCGTCGTTTTACTCCTTCTGCCCTGGGTGTTTC R1 CNAG_02897 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGGATTTGGTGTTTGCTAACGG R2 CNAG_02897 3' flanking region primer 2 CTCCATCCAGCAACTCTATG SO CNAG_02897 diagnostic screening primer, pairing with B79 AGGAAGCAACGCTGACTGTC PO CNAG_02897 Southern blot probe primer TGTTGTAATGGCACCGTC

STM NAT#122 STM primer ACAGCTCCAAACCTCGCTAAACAG STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 68 CNAG_02915 PKH202 L1 CNAG_02915 5' flanking region primer 1 TGGTGGAAATGGACTGTG L2 CNAG_02915 5' flanking region primer 2 TCACTGGCCGTCGTTTTACCAGCCTCGGGTTTTTTTG R1 CNAG_02915 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGAGCACGAAAAGCACGAAG R2 CNAG_02915 3' flanking region primer 2 TCCTTGGACAACTGGTAGC SO CNAG_02915 diagnostic screening primer, pairing with B79 AGGTGGGATTGCTCAAAC PO CNAG_02915 Southern blot probe primer TGAAGGCGTGCTCAAATG STM NAT#177 STM primer CACCAACTCCCCATCTCCAT STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 69 CNAG_02947 SCY1 L1 CNAG_02947 5' flanking region primer 1 CGTCACCAACAAGTCACAG L2 CNAG_02947 5' flanking region primer 2 TCACTGGCCGTCGTTTTACGAGAAGAGGTTTGAGGCTG R1 CNAG_02947 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGAACCTGTCTGGGAGAAGAGC R2 CNAG_02947 3' flanking region primer 2 TTCCAAGACTTCCCCAAC SO CNAG_02947 diagnostic screening primer, pairing with B79 CCATTACCTTTATGTCCCCAC PO CNAG_02947 Southern blot probe primer TTGCCCATTCCTGTCTTAG STM NAT#150 STM primer ACATACACCCCCATCCCCCC STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 70 CNAG_02962 L1 CNAG_02962 5' flanking region primer 1 CAAGGCGTTCTTCTTTGG L2 CNAG_02962 5' flanking region primer 2 TCACTGGCCGTCGTTTTACGTCGTGATAATGGCGTTTG R1 CNAG_02962 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGGCTAAAAGATTGACTCCGAGG R2 CNAG_02962 3' flanking region primer 2 GAATAGGTCGTGAATGGATGTC SO CNAG_02962 diagnostic screening primer, pairing with B79 CTGATAAAAGAGCAGAGAGGG PO CNAG_02962 Southern blot probe primer GGTGGCTATCAAAGTTGTTAGG STM NAT#242 STM primer GTAGCGATAGGGGTGTCGCTTTAG STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 71 CNAG_02976 L1 CNAG_02976 5' flanking region primer 1 GCAAAGTGAAGAAGGCGAG L2 CNAG_02976 5' flanking region primer 2 TCACTGGCCGTCGTTTTACTTGGTGACGGTCCCTTCAAG R1 CNAG_02976 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGAAATCCTTGCTGGGGGAAGC R2 CNAG_02976 3' flanking region primer 2 CGATTCATCTCCATAACCAGTG SO CNAG_02976 diagnostic screening primer, pairing with B79 GGCATAATGAAACCAGGG PO CNAG_02976 Southern blot probe primer CGCAAAAACTCGTCATAGG STM NAT#169 STM primer ACATCTATATCACTATCCCGAACC STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 72 CNAG_03024 RIM15 L1 CNAG_03024 5' flanking region primer 1 CTGAGTGCGATGATTGTTTG L2 CNAG_03024 5' flanking region primer 2 GCTCACTGGCCGTCGTTTTACTTTCCTGACTTTGGGTGC R1 CNAG_03024 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGTTGAGGACAGATTCTATGGC R2 CNAG_03024 3' flanking region primer 2 CAGAGAATAAGGTCCCCTCC SO CNAG_03024 diagnostic screening primer, pairing with B79 TCAAGGGATAGAAGTTCGC PO CNAG_03024 Southern blot probe primer GAGATAAACAGAGCCAAACG STM NAT#191 STM primer ATATGGATGTTTTTAGCGAG STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 73 CNAG_03048 IRK3 L1 CNAG_03048 5' flanking region primer 1 GATTGAGTTTCGGTTGGG L2 CNAG_03048 5' flanking region primer 2 TCACTGGCCGTCGTTTTACCTAAAAACGGAGCGGAAG R1 CNAG_03048 3' flanking region primer 1 ATGGTCATAGCTGTTTCCTGCGAACTTCTCAAGCAAACG R2 CNAG_03048 3' flanking region primer 2 ATACAACCCCCATACTCCC SO CNAG_03048 diagnostic screening primer, pairing with B79 AAAGGGATTCGGGCTTAC PO CNAG_03048 Southern blot probe primer CCAGGGGTTGATGTCATAC STM NAT#273 STM primer GAGATCTTTCGGGAGGTCTGGATT STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 74 CNAG_03137 L1 CNAG_03137 5' flanking region primer 1 CAAGGAGGTCAACCCTACAG L2 CNAG_03137 5' flanking region primer 2 TCACTGGCCGTCGTTTTACAGGCGTCTTCTGTCCATAG R1 CNAG_03137 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGAGTCGTCCTCTTTTTGGC R2 CNAG_03137 3' flanking region primer 2 AGGACTTGTCGGTCTTCAG SO CNAG_03137 diagnostic screening primer, pairing with B79 GGTAAGTTGCTTTATCCCCC PO CNAG_03137 Southern blot probe primer GCTGTGAGCAGTTGATACG STM NAT#211 STM primer GCGGTCGCTTTAGCGATT STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 75 CNAG_03167 CHK1 L1 CNAG_03167 5' flanking region primer 1 GTATCTCCATCCCACACATC L2 CNAG_03167 5' flanking region primer 2 TCACTGGCCGTCGTTTTACTTGACAGAGAGGGGCTTAC R1 CNAG_03167 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGTTACATTGGAGGGCGTTG R2 CNAG_03167 3' flanking region primer 2 CTGACAACAAGCAGCCTATC SO CNAG_03167 diagnostic screening primer, pairing with B79 ATACCACCACAAACGCCTC PO CNAG_03167 Southern blot probe primer GGACTACTTTCCGAAGGTTC STM NAT#205 STM primer TATCCCCCTCTCCGCTCTCTAGCA STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 76 CNAG_03171 L1 CNAG_03171 5' flanking region primer 1 CGTCCAACCATCAATCAC L2 CNAG_03171 5' flanking region primer 2 TCACTGGCCGTCGTTTTACACCTTGGTAGGAGTGTGGAG R1 CNAG_03171 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGTAGTTGCGATTCTGTGGG R2 CNAG_03171 3' flanking region primer 2 TAGGGACGAGTATCAGGAGCAG SO CNAG_03171 diagnostic screening primer, pairing with B79 TCCTCTGTTCTTGTCGTGG PO CNAG_03171 Southern blot probe primer TAAGCCTCGTAGAGCCAAG STM NAT#159 STM primer ACGCACCAGACACACAACCAG STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 77 CNAG_03184 BUB1 L1 CNAG_03184 5' flanking region primer 1 CAACGCCATTGAGGAAAG L2 CNAG_03184 5' flanking region primer 2 TCACTGGCCGTCGTTTTACGCCTGATGTTTCTCTTTCTGAG R1 CNAG_03184 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGAAGCGACTTTGAGGGATGGC R2 CNAG_03184 3' flanking region primer 2 ATCCCAGAACAGTGGCAGAC SO CNAG_03184 diagnostic screening primer, pairing with B79 GGAGGATACATCAGGTGAGC PO CNAG_03184 Southern blot probe primer AACAGCACTTTGGGGTAAC

STM NAT#201 STM primer CACCCTCTATCTCGAGAAAGCTCC STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 78 CNAG_03216 SNF101 L1 CNAG_03216 5' flanking region primer 1 GGAGATGAAGGGAATGAGTC L2 CNAG_03216 5' flanking region primer 2 TCACTGGCCGTCGTTTTACCGACGCAAGAGGATAACAAC R1 CNAG_03216 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGTGGCAGGAGATGAGGGATAG R2 CNAG_03216 3' flanking region primer 2 CTGCTCTTGTTTAGCCACC SO CNAG_03216 diagnostic screening primer, pairing with B79 TCCGACTCTGATAACGACTG PO CNAG_03216 Southern blot probe primer AAAGCCTCCTCTTCCAACC STM NAT#146 STM primer ACTAGCCCCCCCTCACCACCT STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 79 CNAG_03258 TPK202A L1 CNAG_03258 5' flanking region primer 1 AGGGACTGAATCCAAAGGG L2 CNAG_03258 5' flanking region primer 2 TCACTGGCCGTCGTTTTACTTCTCGTCTTCGGCAAGGCAAGTG R1 CNAG_03258 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGAAGGACAAGGGCTAATGG R2 CNAG_03258 3' flanking region primer 2 AAGGCTGGACTTTGTTGGGGAC SO CNAG_03258 diagnostic screening primer, pairing with B79 GATTGCGAAGATGTGAACTC PO CNAG_03258 Southern blot probe primer TTTCCCTGTTGCCATCTC STM NAT#208 STM primer TGGTCGCGGGAGATCGTGGTTT STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 80 CNAG_03290 KIC102 L1 CNAG_03290 5' flanking region primer 1 CGCTGACTTGGAGTATTGG L2 CNAG_03290 5' flanking region primer 2 TCACTGGCCGTCGTTTTACAAGTCTGCGGAAAGGTTC R1 CNAG_03290 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGTCACCTCTGCTTTTGTCTTG R2 CNAG_03290 3' flanking region primer 2 CCGACAAGGATGAAACAAAGATGG SO CNAG_03290 diagnostic screening primer, pairing with B79 TGGATGTCTTAGAAGGGAGC PO CNAG_03290 Southern blot probe primer GGAAGACAAGAACAAACGG STM NAT#201 STM primer CACCCTCTATCTCGAGAAAGCTCC STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 81 CNAG_03355 TCO4 L1 CNAG_03355 5' flanking region primer 1 AATGCCATAGGACACCTCTGACCC L2 CNAG_03355 5' flanking region primer 2 CTGGCCGTCGTTTTACTGTGACTATGGTAAGCACCG R1 CNAG_03355 3' flanking region primer 1 GTCATAGCTGTTTCCTGAATGCCATAGGACACCTCTGACCC R2 CNAG_03355 3' flanking region primer 2 TGTGACTATGGTAAGCACCG SO CNAG_03355 diagnostic screening primer, pairing with B79 GTTGCTTGGTTTTTCTTCGG PO1 CNAG_03355 Southern blot probe primer 1 AAACGGCAGCATTGACTAC PO2 CNAG_03355 Southern blot probe primer 2 TATGTAAGCAGCCTGTTCG STM NAT#123 STM primer CTATCGACCAACCAACACAG STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 82 CNAG_03358 L1 CNAG_03358 5' flanking region primer 1 GCAGAATCGTGAAACATTACCC L2 CNAG_03358 5' flanking region primer 2 TCACTGGCCGTCGTTTTACTCATTGAGGAGGTAGGGAGG R1 CNAG_03358 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGTGAAAGGTGTCGGGGATAG R2 CNAG_03358 3' flanking region primer 2 ACGGAGAAGCAGGAACATC SO CNAG_03358 diagnostic screening primer, pairing with B79 CAGACAATCGCAGAGTGAG PO CNAG_03358 Southern blot probe primer CTCTCGGAACTTCTTGACG STM NAT#230 STM primer ATGTAGGTAGGGTGATAGGT STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 83 CNAG_03367 URK1 L1 CNAG_03367 5' flanking region primer 1 ACCCTTCTTTTTGGTCCC L2 CNAG_03367 5' flanking region primer 2 TCACTGGCCGTCGTTTTACTTGGTTTTTGCTCTGCGGC R1 CNAG_03367 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGGTTTGCTGTTGGATTCGC R2 CNAG_03367 3' flanking region primer 2 ATTTCCCCGCATTTGCCAC SO CNAG_03367 diagnostic screening primer, pairing with B79 TCGCACATTCTTGTCAGAG PO CNAG_03367 Southern blot probe primer GATGATGGAAAGAGTAGACCG STM NAT#43 STM primer CCAGCTACCAATCACGCTAC STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 84 CNAG_03369 SWE102 L1 CNAG_03369 5' flanking region primer 1 TGCTACGCTAAGACTGGACTAC L2 CNAG_03369 5' flanking region primer 2 TCACTGGCCGTCGTTTTACGGAGCGTGGTTGAAAGAAC R1 CNAG_03369 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGACGAACTTGTGCTCTCTGC R2 CNAG_03369 3' flanking region primer 2 ACAGTTTCCTGACGAGAATG SO CNAG_03369 diagnostic screening primer, pairing with B79 GCCGATACATTTTGGGTAG PO CNAG_03369 Southern blot probe primer TGGATGGTGAGGAGTTGAG STM NAT#169 STM primer ACATCTATATCACTATCCCGAACC STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 85 CNAG_03567 CBK1 L1 CNAG_03567 5' flanking region primer 1 CAACCGATTTGCCAAGAG L2 CNAG_03567 5' flanking region primer 2 TCACTGGCCGTCGTTTTACTTGTTGTCCCTGGATTGG R1 CNAG_03567 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGTAAGGAGTGCGATGGATG R2 CNAG_03567 3' flanking region primer 2 CGTTTTTCATCCTGCGAG SO CNAG_03567 diagnostic screening primer, pairing with B79 TCATTCCCACCATTCACG PO CNAG_03567 Southern blot probe primer TCTGACTTCACCGAATGC STM NAT#232 STM primer CTTTAAAGGTGGTTTGTG STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 86 CNAG_03592 THI20 L1 CNAG_03592 5' flanking region primer 1 TTGTGAGCAGGTTTCCGTG L2 CNAG_03592 5' flanking region primer 2 TCACTGGCCGTCGTTTTACTACCTGAATACCAGCACCACCG R1 CNAG_03592 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGAGATAGTGGCAGGACCTTGC R2 CNAG_03592 3' flanking region primer 2 TTACATCGCCGCTGTTTCC SO CNAG_03592 diagnostic screening primer, pairing with B79 TGTCCTGGTGTCTGGTTG PO CNAG_03592 Southern blot probe primer GAAAGCAGTAGCGATAGCAG STM NAT#231 STM primer GAGAGATCCCAACATCACGC STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 87 CNAG_03670 IRE1 L1 CNAG_03670 5' flanking region primer 1 GCCCCATCATCATAATCAC L2 CNAG_03670 5' flanking region primer 2 GCTCACTGGCCGTCGTTTTACACTATGTGTCCATCTGAGGC R1 CNAG_03670 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGAGTGAGTTGAGGGAGGAAAG R2 CNAG_03670 3' flanking region primer 2 GAAGAAGAGCGTCAAGAAGG SO CNAG_03670 diagnostic screening primer, pairing with B79 AGGAATACGAGGTTTATCGG PO CNAG_03670 Southern blot probe primer AGCATTAGGGGTGTAGGTG STM NAT#224 STM primer AACCTTAAATGGGTAGAG STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 88 CNAG_03701 L1 CNAG_03701 5' flanking region primer 1 AGCGTATTCTTCAGGGCTC L2 CNAG_03701 5' flanking region primer 2 TCACTGGCCGTCGTTTTACAAGAAGGGAGAGTGGTTGTGACGG R1 CNAG_03701 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGTGAAGTGTTTTCCCGTCCC R2 CNAG_03701 3' flanking region primer 2 TAAAGGAGTGTTGGACCCC SO CNAG_03701 diagnostic screening primer, pairing with B79 ACAAACCTCACTGTGCCTC PO CNAG_03701 Southern blot probe primer CAATACCGACTGAGACACACTC STM NAT#125 STM primer CGCTACAGCCAGCGCGCGCAAGCG STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 89 CNAG_03791 L1 CNAG_03791 5' flanking region primer 1 GAAGCATCCTCAAAGGG L2 CNAG_03791 5' flanking region primer 2 TCACTGGCCGTCGTTTTACTGGCTGGAGATTTGAAAGAG R1 CNAG_03791 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGCTTTTGGAAGTAAACGGGG R2 CNAG_03791 3' flanking region primer 2 GCAACTCGTCAAAGACCTG SO CNAG_03791 diagnostic screening primer, pairing with B79 CGACTTCTTCAGCAATGG PO CNAG_03791 Southern blot probe primer TATTCCAGTCCGAGTAGCG STM NAT#210 STM primer CTAGAGCCCGCCACAACGCT STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 90 CNAG_03796 L1 CNAG_03796 5' flanking region primer 1 AGGTCGGAAGATTTTGCG L2 CNAG_03796 5' flanking region primer 2 TCACTGGCCGTCGTTTTACTAGGGTCGTTTGTGTTATCC R1 CNAG_03796 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGCTTTTGGCTTTGGGTCAG R2 CNAG_03796 3' flanking region primer 2 TGAGCAGTAGTGTATTGGGTG SO CNAG_03796 diagnostic screening primer, pairing with B79 AATCTCCTCTTGGGCTCAG PO CNAG_03796 Southern blot probe primer ATACCACAGCACCCACAAG STM NAT#240 STM primer GGTGTTGGATCGGGGTGGAT STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 91 CNAG_03811 IRK5 L1 CNAG_03811 5' flanking region primer 1 TCTTTAGCGTTTGACCCTG L2 CNAG_03811 5' flanking region primer 2 TCACTGGCCGTCGTTTTACTTCCAACACTCCGTAGCAG R1 CNAG_03811 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGCTGATGGAAGATGTTGAAGC R2 CNAG_03811 3' flanking region primer 2 GTCGCATCTTTTTGCTGG

SO CNAG_03811 diagnostic screening primer, pairing with B79 TCACAATCATTCTGACCAGG PO CNAG_03811 Southern blot probe primer CCGCAAAGGTAAAGTCG STM NAT#213 STM primer CTGGGGATTTTGATGTGTCTATGT STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 92 CNAG_03821 L1 CNAG_03821 5' flanking region primer 1 GGGTCATTTTCACCGAATC L2 CNAG_03821 5' flanking region primer 2 TCACTGGCCGTCGTTTTACCTTTGTGTGCCGTTCTAAAC R1 CNAG_03821 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGGCCAGATGGTCATTTCTTC R2 CNAG_03821 3' flanking region primer 2 GGAAATAGAAACAGCGGTG SO CNAG_03821 diagnostic screening primer, pairing with B79 ACCAGGTCTTCCTCCATTG PO CNAG_03821 Southern blot probe primer TGAGAGATTCTTGTTCCGAG STM NAT#177 STM primer CACCAACTCCCCATCTCCAT STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 93 CNAG_03843 ARK1 L1 CNAG_03843 5' flanking region primer 1 CAATAGGCGTGAACAAGC L2 CNAG_03843 5' flanking region primer 2 TCACTGGCCGTCGTTTTACGGGATACTGGTGTTTTTGG R1 CNAG_03843 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGAGGTCAACAATGCGTCAG R2 CNAG_03843 3' flanking region primer 2 GAAAGGAAGGAGCGAAAG SO CNAG_03843 diagnostic screening primer, pairing with B79 ATAGAGCGGGAGGAAATG PO CNAG_03843 Southern blot probe primer TGGGTGGGAGTGATTTCTG STM NAT#43 STM primer CCAGCTACCAATCACGCTAC STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 94 CNAG_03946 GAL302 L1 CNAG_03946 5' flanking region primer 1 AAAACTCACATCCGCTGC L2 CNAG_03946 5' flanking region primer 2 TCACTGGCCGTCGTTTTACGCAGAGAGTTGAAGACGGTG R1 CNAG_03946 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGGCTGGAGGTGAGTTCTGTAATC R2 CNAG_03946 3' flanking region primer 2 CCCTATTCCTTTCCTTGTTC SO CNAG_03946 diagnostic screening primer, pairing with B79 AGACCAATGTAGACCCTATGTG PO CNAG_03946 Southern blot probe primer ACAAGCACATCCATTCCTAC STM NAT#218 STM primer CTCCACATCCATCGCTCCAA STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 95 CNAG_04040 FPK1 L1 CNAG_04040 5' flanking region primer 1 ATCGTCTCAGCCTCAACAG L2 CNAG_04040 5' flanking region primer 2 TCACTGGCCGTCGTTTTACTCTTCCACTTTGACGGTG R1 CNAG_04040 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGTCCGTTTGGGGAGTTTAG R2 CNAG_04040 3' flanking region primer 2 GGCTATCTTCTTGGCTTGC SO CNAG_04040 diagnostic screening primer, pairing with B79 CCTTTGGGTTTTTGGGAC PO CNAG_04040 Southern blot probe primer ATTAGTCTGCCCAAACGG STM NAT#211 STM primer GCGGTCGCTTTAGCGATT STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG OEL2 CNAG_04040 5' flaking region for overexpression construction CACTCGAATCCTGCATGCGGGATGTTTGTGTGACTGAG OER1 CNAG_04040 5' coding region for overexpression construction CCACAACACATCTATCACATGTCGTCTCTCGCGTCACC NP1 CNAG_04040 Northern blot probe primer TTCAAACTCGGGAGGACAG 96 CNAG_04083 L1 CNAG_04083 5' flanking region primer 1 TTCCTCCATCTTCGCATC L2 CNAG_04083 5' flanking region primer 2 TCACTGGCCGTCGTTTTACTCGTGCCCTTTTTGGTAG R1 CNAG_04083 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGAAAGAAAGAACACCCCTCC R2 CNAG_04083 3' flanking region primer 2 AACAGGTTGCGATTGTGC SO CNAG_04083 diagnostic screening primer, pairing with B79 GCCGTTATGGGTGAAAGAG PO CNAG_04083 Southern blot probe primer GAAAGGGAGAAGAGTGAAGG STM NAT#210 STM primer CTAGAGCCCGCCACAACGCT STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 97 CNAG_04108 PKP2 L1 CNAG_04108 5' flanking region primer 1 AAAAGAGGAGGGAGAAGGG L2 CNAG_04108 5' flanking region primer 2 TCACTGGCCGTCGTTTTACTGAAGTATCCACACACCCC R1 CNAG_04108 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGCGTCTTTGAGTTAGGTGCTG R2 CNAG_04108 3' flanking region primer 2 TGATTGGGGAAGCGTTAG SO CNAG_04108 diagnostic screening primer, pairing with B79 TGTCGGTTTTGTGGTTCC PO CNAG_04108 Southern blot probe primer TTAGCCTCTTGCCAACTCC STM NAT#295 STM primer ACACCTACATCAAACCCTCCC STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 98 CNAG_04118 L1 CNAG_04118 5' flanking region primer 1 TCAGCGAGATGATAGGTCG L2 CNAG_04118 5' flanking region primer 2 TCACTGGCCGTCGTTTTACCCGCTATCTCTATCTCTGTCC R1 CNAG_04118 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGGACAAGATAAAGATTGGCGG R2 CNAG_04118 3' flanking region primer 2 CGCCATCTCCTTTCTATCG SO CNAG_04118 diagnostic screening primer, pairing with B79 CAAAAGAGAATCCTGGAGACC PO CNAG_04118 Southern blot probe primer GGAGAATGAGTCAAAATGCTG STM NAT#212 STM primer AGAGCGATCGCGTTATAGAT STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 99 CNAG_04148 L1 CNAG_04148 5' flanking region primer 1 GAAGCCCTTGGTATTTTCC L2 CNAG_04148 5' flanking region primer 2 TCACTGGCCGTCGTTTTACCCTCGTAGCCCAAGAAATG R1 CNAG_04148 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGTCGTATTGGGTGAATGGC R2 CNAG_04148 3' flanking region primer 2 TGCTGATACCCTGTTTCG SO CNAG_04148 diagnostic screening primer, pairing with B79 CGATGATAGGTCCGAAATC

PO CNAG_04148 Southern blot probe primer AGACCAAACATCCCAAGC STM NAT#224 STM primer AACCTTAAATGGGTAGAG STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 100 CNAG_04156 L1 CNAG_04156 5' flanking region primer 1 TTCTCCTCCTTCTTTATGCC L2 CNAG_04156 5' flanking region primer 2 TCACTGGCCGTCGTTTTACAGACAAGAGGGTTTACCTGC R1 CNAG_04156 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGATTACTGAGGCTGCGTTCC R2 CNAG_04156 3' flanking region primer 2 GCGGATAGAAGCACTGAAAC SO CNAG_04156 diagnostic screening primer, pairing with B79 GTCCATCGGTAACAAGTCC PO CNAG_04156 Southern blot probe primer GTGGTAAGCACGGCTAATC STM NAT#177 STM primer CACCAACTCCCCATCTCCAT STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 101 CNAG_04162 PKA2 L1 CNAG_04162 5' flanking region primer 1 AATAACACACCAGCCGCTCTGACC L2 CNAG_04162 5' flanking region primer 2 CTGGCCGTCGTTTTACTGATGGTGATGGATGTGC R1 CNAG_04162 3' flanking region primer 1 GTCATAGCTGTTTTCCTGCGGCAGTAGAGATAGCACAG R2 CNAG_04162 3' flanking region primer 2 GGAGTGGTGGAGAATGTTC SO CNAG_04162 diagnostic screening primer, pairing with B79 TACCTGCTGCTATGACCCTACG PO CNAG_04162 Southern blot probe primer CCACTTGCTTCAACCTCAC STM NAT#205 STM primer TATCCCCCTCTCCGCTCTCTAGCA STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 102 CNAG_04191 L1 CNAG_04191 5' flanking region primer 1 CAAGTGGTGTCGCATTTC L2 CNAG_04191 5' flanking region primer 2 TCACTGGCCGTCGTTTTACCGCAACCTGTTTAGTCAGAC R1 CNAG_04191 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGGCAAAAGAAGAGCAAGGC R2 CNAG_04191 3' flanking region primer 2 GGGCTAAGAAGTTTGATGTTCC SO CNAG_04191 diagnostic screening primer, pairing with B79 ATGAGGGTTTTCAGCACC PO CNAG_04191 Southern blot probe primer GGGAAGGAGTGACAAAGATAG STM NAT#159 STM primer ACGCACCAGACACACAACCAG STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 103 CNAG_04197 YAK1 L1 CNAG_04197 5' flanking region primer 1 GTGTGTCATTGGGTTTTGC L2 CNAG_04197 5' flanking region primer 2 TCACTGGCCGTCGTTTTACAATGAATCTGCGGGAGTC R1 CNAG_04197 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGAGAAGTTGACTCGGCATCG R2 CNAG_04197 3' flanking region primer 2 GCTTCGTCATCAAACAGTTC SO CNAG_04197 diagnostic screening primer, pairing with GGTGATTTTTCATCGCCC PO CNAG_04197 Southern blot probe primer CAGCAGATGGCTCCTCTATC STM NAT#184 STM primer ATATATGGCTCGAGCTAGATAGAG STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 104 CNAG_04215 MET3 L1 CNAG_04215 5' flanking region primer 1 CTCACAAATGAAAGCAGCAG L2 CNAG_04215 5' flanking region primer 2 TCACTGGCCGTCGTTTTACGAGAAGAGAATCGTGAAGAGC R1 CNAG_04215 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGGCTTGTAGCGTTGTAGATGG R2 CNAG_04215 3' flanking region primer 2 GCGTTGTTTATTCACAGGAG SO CNAG_04215 diagnostic screening primer, pairing with B79 CTGTTCTTTGTGTCTTTGCG PO CNAG_04215 Southern blot probe primer TCTTTCGGATAACGGCGTG STM NAT#205 STM primer TATCCCCCTCTCCGCTCTCTAGCA STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 105 CNAG_04221 FBP26 L1 CNAG_04221 5' flanking region primer 1 TGGAGGTCAGTAATCGGTCG L2 CNAG_04221 5' flanking region primer 2 TCACTGGCCGTCGTTTTACGGATTGGATGGATGTGAAC R1 CNAG_04221 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGTCCGATGTATGCTCTGGTC R2 CNAG_04221 3' flanking region primer 2 TGTTTCTCCCCTTGTCACC SO CNAG_04221 diagnostic screening primer, pairing with B79 TGGAAATGAGTTCTCTTGGG PO CNAG_04221 Southern blot probe primer TCCTAAAATCCCGCTCTGC STM NAT#146 STM primer ACTAGCCCCCCCTCACCACCT STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 106 CNAG_04230 THI6 L1 CNAG_04230 5' flanking region primer 1 TCATCACCAGTAACGAAAGG L2 CNAG_04230 5' flanking region primer 2 TCACTGGCCGTCGTTTTACAGGCTCAACAAAACCGAG R1 CNAG_04230 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGAAGACTCGGACCCATTCAG R2 CNAG_04230 3' flanking region primer 2 TGGTGAGTCTTTGCGAAG SO CNAG_04230 diagnostic screening primer, pairing with B79 TGACCGAGGTAGAGAATC PO CNAG_04230 Southern blot probe primer ATCAAGAATCTCGCCCAC STM NAT#290 STM primer ACCGACAGCTCGAACAAGCAAGAG STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 107 CNAG_04272 L1 CNAG_04272 5' flanking region primer 1 GCCTGAAAAGAAGGAAACC L2 CNAG_04272 5' flanking region primer 2 TCACTGGCCGTCGTTTTACCCTTCCTAATGTCTTTCCAGTC R1 CNAG_04272 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGAAGGAAGTGGAAGCGTTC R2 CNAG_04272 3' flanking region primer 2 TCGTCTTCGCCAAACTCTGC SO CNAG_04272 diagnostic screening primer, pairing with B79 GAACGCCGAAACAAAACC PO CNAG_04272 Southern blot probe primer CTTGGGAGGAAAATCAGC STM NAT#212 STM primer AGAGCGATCGCGTTATAGAT STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 108 CNAG_04282 MPK2 L1 CNAG_04282 5' flanking region primer 1 ATGGCAGCAAGCGTAACTC L2 CNAG_04282 5' flanking region primer 2 TCACTGGCCGTCGTTTTACGTTTTATGCCCGTTGTGTTG R1 CNAG_04282 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGCCCAAAGTCAGTCTGGTAACC R2 CNAG_04282 3' flanking region primer 2 ATACATCTTCGTAGCCCCG SO CNAG_04282 diagnostic screening primer, pairing with B79 TCCAAATAGACCAAGCCC PO CNAG_04282 Southern blot probe primer CGTTGAGTGTTTGGTAGCC STM NAT#102 STM primer CCATGCGATATCTACCCCAATCT STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 109 CNAG_04314 L1 CNAG_04314 5' flanking region primer 1 CCATTCGTAGCCCTTATCTG L2 CNAG_04314 5' flanking region primer 2 TCACTGGCCGTCGTTTTACACGGAGTCTGGTTTTCAGG R1 CNAG_04314 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGTTTGATGGAAGGAGTCGC R2 CNAG_04314 3' flanking region primer 2 AAGAGGGCATCACTAAGGC SO CNAG_04314 diagnostic screening primer, pairing with B79 ATTGGACTGGACCATAGCC PO CNAG_04314 Southern blot probe primer GATAAAGACAGAACTCAGCACC STM NAT#231 STM primer GAGAGATCCCAACATCACGC STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 110 CNAG_04316 UTR1 L1 CNAG_04316 5' flanking region primer 1 GGTGATTGCCTGTTGTTG L2 CNAG_04316 5' flanking region primer 2 TCACTGGCCGTCGTTTTACAGACGAAGGAGGAGGAGTAG R1 CNAG_04316 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGGCAGTGGTTCAGAGGAATAAG R2 CNAG_04316 3' flanking region primer 2 ACTTGCCCATACTGGAGGTC SO CNAG_04316 diagnostic screening primer, pairing with B79 CAGGATGTAGTGGAGACTGC PO CNAG_04316 Southern blot probe primer CCAGTAACCCATCACCTATTAG STM NAT#5 STM primer TGCTAGAGGGCGGGAGAGTT STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 111 CNAG_04335 L1 CNAG_04335 5' flanking region primer 1 CGATAGAGTAGTAGTTTTTAGGGGG L2 CNAG_04335 5' flanking region primer 2 TCACTGGCCGTCGTTTTACCTTACGAGTCCATCTTCGC R1 CNAG_04335 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGAACCGATTCCAGTTACAGC R2 CNAG_04335 3' flanking region primer 2 AGATGGACGAGGTGGTGATG SO CNAG_04335 diagnostic screening primer, pairing with B79 TGATGTGCTACTGGAAGCC PO CNAG_04335 Southern blot probe primer TCATCAATGTCAGGCTGGG STM NAT#146 STM primer ACTAGCCCCCCCTCACCACCT STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 112 CNAG_04347 L1 CNAG_04347 5' flanking region primer 1 GAGTTTGAGCGGTCATTG L2 CNAG_04347 5' flanking region primer 2 TCACTGGCCGTCGTTTTACAGGTCCTCAAGGTATGGAGC R1 CNAG_04347 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGGCCCTCAATGTTATCCACG R2 CNAG_04347 3' flanking region primer 2 GTAGCGAGAGCGATTCATC

SO CNAG_04347 diagnostic screening primer, pairing with B79 TCCAGGGAACAGTGAGTAAC PO CNAG_04347 Southern blot probe primer TTCAATGATGCCCGAGCAG STM NAT#210 STM primer CTAGAGCCCGCCACAACGCT STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 113 CNAG_04408 CKI1 L1 CNAG_04408 5' flanking region primer 1 CGTCATTTCTTGGGATAGACTG L2 CNAG_04408 5' flanking region primer 2 TCACTGGCCGTCGTTTTACTCCTTCTATGCCTGGGTAGC R1 CNAG_04408 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGAAACGCAAGGATGTCCCAGCAG R2 CNAG_04408 3' flanking region primer 2 TGCTTTGTAGGCAATGGCTGG SO CNAG_04408 diagnostic screening primer, pairing with B79 GATTTCATCCGCCTGTTG PO CNAG_04408 Southern blot probe primer ATCTTCCGCTGCTTCAGAC STM NAT#218 STM primer CTCCACATCCATCGCTCCAA STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 114 CNAG_04433 YAK103 L1 CNAG_04433 5' flanking region primer 1 AGCCTGTGAGTTGTGCGTTG L2 CNAG_04433 5' flanking region primer 2 TCACTGGCCGTCGTTTTACGGTTTTCCTGCTATCACGC R1 CNAG_04433 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGGACCTCAAAACTCAGCATTG R2 CNAG_04433 3' flanking region primer 2 AAGAAACCTCTCCATTCCC SO CNAG_04433 diagnostic screening primer, pairing with B79 AATACCTTGTTGGCGAGAC PO CNAG_04433 Southern blot probe primer CATCAGGAGGTTTACCACC STM NAT#231 STM primer GAGAGATCCCAACATCACGC STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 115 CNAG_04514 MPK1 L1 CNAG_04514 5' flanking region primer 1 TTTGCTTGCTCCTCTTCTC L2 CNAG_04514 5' flanking region primer 2 TCACTGGCCGTCGTTTTACGAGAAGTAGAGGCAGTGACG R1 CNAG_04514 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGTTGGAGAAACAGTTGGAGAG R2 CNAG_04514 3' flanking region primer 2 TTCAGCAGGTCAATCAGG SO CNAG_04514 diagnostic screening primer, pairing with B79 CGACTCACGATGTAACTTCC PO CNAG_04514 Southern blot probe primer ACCTCAACTCTCTCAGACACC STM NAT#240 STM primer GGTGTTGGATCGGGGTGGAT STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 116 CNAG_04577 L1 CNAG_04577 5' flanking region primer 1 AGGTTTGAGCCATCTGAAC L2 CNAG_04577 5' flanking region primer 2 TCACTGGCCGTCGTTTTACAAAGGGCATAACCAGTGAC R1 CNAG_04577 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGGTTGGAGTATGGGAGATGC R2 CNAG_04577 3' flanking region primer 2 GTCTTTTCTTTCCCACTTGG SO CNAG_04577 diagnostic screening primer, pairing with B79 GAGATGGGTAATGGTGATGAG PO CNAG_04577 Southern blot probe primer GCTTGTAACCACGCTCTATC STM NAT#282 STM primer TCTCTATAGCAAAACCAATC STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 117 CNAG_04631 RIK1 L1 CNAG_04631 5' flanking region primer 1 TCATCAGTTTCGTCCAGC L2 CNAG_04631 5' flanking region primer 2 TCACTGGCCGTCGTTTTACATAACGGGATTGGGGTTG R1 CNAG_04631 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGTTGCTGATGAGGTCAAGG R2 CNAG_04631 3' flanking region primer 2 ATCTCACTGCCCTATTCCC SO CNAG_04631 diagnostic screening primer, pairing with B79 TTCCACTCCTTCTTCCCTCTG PO CNAG_04631 Southern blot probe primer CAGGAAGGCTAAAACCACAG STM NAT#150 STM primer ACATACACCCCCATCCCCCC STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 118 CNAG_04678 YPK1 L1 CNAG_04678 5' flanking region primer 1 CGACTATGGGTTCGTTACTGG L2 CNAG_04678 5' flanking region primer 2 TCACTGGCCGTCGTTTTACTGTCTATGCGTTTTCCGAC R1 CNAG_04678 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGTGGTGTAGAATGGCAGAGC R2 CNAG_04678 3' flanking region primer 2 GCACCGTGGAGGTAGTAATG SO CNAG_04678 diagnostic screening primer, pairing with B79 TACCCATCATTCCCTGGCTC PO CNAG_04678 Southern blot probe primer ACACCGTATCAGCACAAGC STM NAT#58 STM primer CGCAAAATCACTAGCCCTATAGCG STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 119 CNAG_04755 BCK1 L1 CNAG_04755 5' flanking region primer 1 GCTGTTGGTTCTCTCTTGC L2 CNAG_04755 5' flanking region primer 2 CTGGCCGTCGTTTTACGGTTTGCGATGAATAGTCC R1 CNAG_04755 3' flanking region primer 1 GTCATAGCTGTTTCCTGTTCCGAACGCTCATACTCC R2 CNAG_04755 3' flanking region primer 2 TTCCTTCGTTTGTCCGTCG SO CNAG_04755 diagnostic screening primer, pairing with B79 CAGGCTTTTTTTCTGGCTAC PO1 CNAG_04755 Southern blot probe primer 1 TACCTCCTTCATTCCTGCCGTC PO2 CNAG_04755 Southern blot probe primer 2 GCTTCGTTATCAGTCGTCAC STM NAT#43 STM primer CCAGCTACCAATCACGCTAC STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 120 CNAG_04821 PAN3 L1 CNAG_04821 5' flanking region primer 1 CTCTTACAGACGGTTCTTTAGG L2 CNAG_04821 5' flanking region primer 2 TCACTGGCCGTCGTTTTACTCTCCTTTGCCTTCTCCGAG R1 CNAG_04821 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGAGAATGCGGGCAATAACC R2 CNAG_04821 3' flanking region primer 2 GCCAAAAAGCAAAAAAGTGGAGC SO CNAG_04821 diagnostic screening primer, pairing with B79 GCAGGAAGAACAAGGTGTC PO CNAG_04821 Southern blot probe primer GGAACGAGAGAGTGATACACG STM NAT#204 STM primer GATCTCTCGCGCTTGGGGGA STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 121 CNAG_04843 L1 CNAG_04843 5' flanking region primer 1 CAATCAAACAAGCGACCTC L2 CNAG_04843 5' flanking region primer 2 TCACTGGCCGTCGTTTTACGAAGATTTCTCAACAAGCGG R1 CNAG_04843 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGGACAGCATAGAGAGGGTGTG R2 CNAG_04843 3' flanking region primer 2 TCCTCACCATTTCAGACG SO CNAG_04843 diagnostic screening primer, pairing with B79 GGGGAGCAAACTCTTGAAC PO CNAG_04843 Southern blot probe primer CATCTCATCCGTTCTCTGC STM NAT#116 STM primer GCACCCAAGAGCTCCATCTC STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 122 CNAG_04927 YFH702 L1 CNAG_04927 5' flanking region primer 1 GGCATAACTTTCAACGGC L2 CNAG_04927 5' flanking region primer 2 TCACTGGCCGTCGTTTTACAGTCTCCACGACATCTTCTG R1 CNAG_04927 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGTATGCCAGTGGTCAGGTTC R2 CNAG_04927 3' flanking region primer 2 TCGTATTTGACTTCCCTGG SO CNAG_04927 diagnostic screening primer, pairing with B79 TGTTTTGAGAGTCCTTCGG PO CNAG_04927 Southern blot probe primer TGTCTTTGTGCGTTATGGG STM NAT#220 STM primer CAGATCTCGAACGATACCCA

STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 123 CNAG_05005 ATG1 L1 CNAG_05005 5' flanking region primer 1 CGCAGAACAGTCCTACACAAC L2 CNAG_05005 5' flanking region primer 2 TCACTGGCCGTCGTTTTACCTCCTTGCGAGTTTGAGTC R1 CNAG_05005 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGCCCTGAGAAAAAAGTTGGC R2 CNAG_05005 3' flanking region primer 2 CGGGAGGAAAACTTGTTC SO CNAG_05005 diagnostic screening primer, pairing with B79 GATTCACACAAGAGAGCGG PO CNAG_05005 Southern blot probe primer TTCCCCTCCTCATTTGTC STM NAT#288 STM primer CTATCCAACTAGACCTCTAGCTAC STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 124 CNAG_05063 SSK2 L1 CNAG_05063 5' flanking region primer 1 CCTATCTTATTTTTGCGGGG L2 CNAG_05063 5' flanking region primer 2 CTGGCCGTCGTTTTACTCCTCTTTGTGCCGTATTC R1 CNAG_05063 5' flanking region primer 2 GTCATAGCTGTTTCCTGATGTTGGAGCAGATGGTG R2 CNAG_05063 3' flanking region primer 2 CGACTCGTCAACCAAGTTAC SO CNAG_5063 diagnostic screening primer, pairing with B79 CTAAGGATAGGATGTGGAAGG PO1 CNAG_05063 Southern blot probe primer 1 AAGGACGACGAGAGTGAGTAG PO2 CNAG_05063 Southern blot probe primer 2 TCCAAACGAACCTTGACAG STM NAT#210 STM primer CTAGAGCCCGCCACAACGCT STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 125 CNAG_05097 CKY1 L1 CNAG_05097 5' flanking region primer 1 TGTTCTTCCTTGATGCTCTC L2 CNAG_05097 5' flanking region primer 2 TCACTGGCCGTCGTTTTACGCAGATACGGAGAAGTCAGAC R1 CNAG_05097 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGAGAACATCCCTGTCCTTGC R2 CNAG_05097 3' flanking region primer 2 ATTATGGGAGAGGCGATG SO CNAG_05097 diagnostic screening primer, pairing with B79 ATCTTTGTCGGTGTCAGCC PO CNAG_05097 Southern blot probe primer AGTCCATCACTACCTTCGG STM NAT#282 STM primer TCTCTATAGCAAAACCAATC STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 126 CNAG_05104 L1 CNAG_05104 5' flanking region primer 1 GCTTTTTGACGAGACAACTG L2 CNAG_05104 5' flanking region primer 2 TCACTGGCCGTCGTTTTACGATAAAACCCGAGGACATTC R1 CNAG_05104 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGCGTTGCTTCCGTATCTGTTG R2 CNAG_05104 3' flanking region primer 2 AGCAAGTGAAAGAAGGGC SO CNAG_05104 diagnostic screening primer, pairing with B79 TATCAGGGCTTGGGTGTAG PO CNAG_05104 Southern blot probe primer TCTGATAGGGAGCCATACG STM NAT#208 STM primer TGGTCGCGGGAGATCGTGGTTT STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 127 CNAG_05125 L1 CNAG_05125 5' flanking region primer 1 TGGTTTTGGCTGCTTCTG L2 CNAG_05125 5' flanking region primer 2 TCACTGGCCGTCGTTTTACGTGAGCAGGTGTTAGAGTGC R1 CNAG_05125 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGGAGGACAGTTTATTGGGGG R2 CNAG_05125 3' flanking region primer 2 CACCCAGTAAATACCATCCTG SO CNAG_05125 diagnostic screening primer, pairing with B79 AGGTTCAAGCGTGATGTG PO CNAG_05125 Southern blot probe primer CGCTGACAACACAGATAAGAG STM NAT#219 STM primer CCCTAAAACCCTACAGCAAT STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 128 CNAG_05200 L1 CNAG_05200 5' flanking region primer 1 TCCGACAACGAGATTGAAC L2 CNAG_05200 5' flanking region primer 2 TCACTGGCCGTCGTTTTACTCTCCATCTTGACACATTCC R1 CNAG_05200 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGTGTTTACACCTTACCTCCCAC R2 CNAG_05200 3' flanking region primer 2 GGAATGGGCAAATGCTAC SO CNAG_05200 diagnostic screening primer, pairing with B79 TATCCCCACCAAGAAGTCC PO CNAG_05200 Southern blot probe primer ACAGACCCGTTCCAATGTC STM NAT#224 STM primer AACCTTAAATGGGTAGAG STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 129 CNAG_05216 RAD53 L1 CNAG_05216 5' flanking region primer 1 CCTTGGCTGACACTTTACC L2 CNAG_05216 5' flanking region primer 2 TCACTGGCCGTCGTTTTACCTGTGTGTTTTGGGTTTGG R1 CNAG_05216 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGTCCATTATGAAGGAGTCGG R2 CNAG_05216 3' flanking region primer 2 GTAGACCCTCTTCTTCCTCG SO CNAG_05216 diagnostic screening primer, pairing with B79 TAGGAGCGATTGCTGAAG PO CNAG_05216 Southern blot probe primer ACCAATCAATCAGCCGAC STM NAT#184 STM primer ATATATGGCTCGAGCTAGATAGAG STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 130 CNAG_05220 TLK1 L1 CNAG_05220 5' flanking region primer 1 ATCGCTTCTCGTTTGACC L2 CNAG_05220 5' flanking region primer 2 TCACTGGCCGTCGTTTTACATCAACGACCATCTGGGAC R1 CNAG_05220 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGTGGCTACTGCTGTGTATTGC R2 CNAG_05220 3' flanking region primer 2 GCGGTAAAGGTGGAAAGTC SO CNAG_05220 diagnostic screening primer, pairing with B79 CTTTGAAACCGACCATAGG PO CNAG_05220 Southern blot probe primer GGACCGAGACACTACTCACAAC STM NAT#116 STM primer GCACCCAAGAGCTCCATCTC STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 131 CNAG_05243 XKS1 L1 CNAG_05243 5' flanking region primer 1 GCACGAATAAATGCCTGC L2 CNAG_05243 5' flanking region primer 2 TCACTGGCCGTCGTTTTACCTGAGCAAAGGACTTACCTG R1 CNAG_05243 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGCGGATTGGAATGCCTGTAG R2 CNAG_05243 3' flanking region primer 2 GGAGAGTGTTGGAATACGGTAG SO CNAG_05243 diagnostic screening primer, pairing with B79 AGCCGAAGCCATTTTGAG PO CNAG_05243 Southern blot probe primer CATCATCACCAGCGATTG STM NAT#125 STM primer CGCTACAGCCAGCGCGCGCAAGCG STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 132 CNAG_05274 L1 CNAG_05274 5' flanking region primer 1 ATGCTGTTTTGTGGGGGTAGGC L2 CNAG_05274 5' flanking region primer 2 TCACTGGCCGTCGTTTTACGCTTCTCCGTTTGTTTCG R1 CNAG_05274 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGTATCACAGGGCTTGACGGACTGAG R2 CNAG_05274 3' flanking region primer 2 CACTTTTCTTTCTGTCCCTCC SO CNAG_05274 diagnostic screening primer, pairing with B79 CAACAACGCCAAGAAGC PO CNAG_05274 Southern blot probe primer TTGGCGGAACGGATGAATCG

STM NAT#58 STM primer CGCAAAATCACTAGCCCTATAGCG STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 133 CNAG_05386 L1 CNAG_05386 5' flanking region primer 1 TTGCGGAATAAGAAGGGG L2 CNAG_05386 5' flanking region primer 2 TCACTGGCCGTCGTTTTACGTGCTTTATGTGGATTTGGG R1 CNAG_05386 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGCCAATCCAAATGAGTGACG R2 CNAG_05386 3' flanking region primer 2 ACAGGAAGAACAGCAGGAG SO CNAG_05386 diagnostic screening primer, pairing with B79 GCTATGGGAGTTTTTCCG PO CNAG_05386 Southern blot probe primer GCAAATGGGCGTTATTCC STM NAT#177 STM primer CACCAACTCCCCATCTCCAT STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 134 CNAG_05439 CMK1 L1 CNAG_05439 5' flanking region primer 1 GGATTGTTAGGTAGGTAGGGG L2 CNAG_05439 5' flanking region primer 2 TCACTGGCCGTCGTTTTACAAGAAGGCGGCTGGATAAG R1 CNAG_05439 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGGAAGCCCACAATCAAAGTC R2 CNAG_05439 3' flanking region primer 2 GTGTCATCGTAGGGGTTTC SO CNAG_05439 diagnostic screening primer, pairing with B79 ATTGCCTATCTGCCTGTGC PO CNAG_05439 Southern blot probe primer TCAATGAAACGGGGTGTG STM NAT#227 STM primer TCGTGGTTTAGAGGGAGCGC STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 135 CNAG_05484 L1 CNAG_05484 5' flanking region primer 1 CCAACACCGCCTATTTATC L2 CNAG_05484 5' flanking region primer 2 TCACTGGCCGTCGTTTTACGTGAGTGCCGAGAAAAATG R1 CNAG_05484 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGGCTGTGTTGTATGGGACGAG R2 CNAG_05484 3' flanking region primer 2 TCTCACTCATCTCAAAACGC SO CNAG_05484 diagnostic screening primer, pairing with B79 TGCTGTTTTAGCCCTTGC PO CNAG_05484 Southern blot probe primer AGAGATTGGTGATGGAGCC STM NAT#205 STM primer TATCCCCCTCTCCGCTCTCTAGCA STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 136 CNAG_05549 L1 CNAG_05549 5' flanking region primer 1 GGAAGCAGAGGAAGTCTTTAG L2 CNAG_05549 5' flanking region primer 2 TCACTGGCCGTCGTTTTACAGGGTTTTTCCAGACAGC R1 CNAG_05549 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGAAGAGACCTCCTTCCGACAG R2 CNAG_05549 3' flanking region primer 2 GATTCGTCCACAACAAAGAC SO CNAG_05549 diagnostic screening primer, pairing with B79 GACGGCATCAAGGAAAATG PO CNAG_05549 Southern blot probe primer GAGGTGGTGATGTAGAAATAGG STM NAT#230 STM primer ATGTAGGTAGGGTGATAGGT STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 137 CNAG_05558 KIN4 L1 CNAG_05558 5' flanking region primer 1 ATTCAATGGAGCGGGAGTG L2 CNAG_05558 5' flanking region primer 2 TCACTGGCCGTCGTTTTACCGAATAAGAATGATGGTGAGCG R1 CNAG_05558 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGATTGAGTAAGTTCCGCCCC R2 CNAG_05558 3' flanking region primer 2 AAGGCTGAGGACTGCTACTAC SO CNAG_05558 diagnostic screening primer, pairing with B79 ATTCTGGTATGAAGCCTCGCAGCC PO CNAG_05558 Southern blot probe primer TTCCAACTTCAGGTCACG STM NAT#225 STM primer CCATGAACTAGCTAAAGCA STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 138 CNAG_05590 TCO2 L1 CNAG_05590 5' flanking region primer 1 CAAAACTGGAAGAAGCGAAG L2 CNAG_05590 5' flanking region primer 2 CTGGCCGTCGTTTTACTTGCCAGATGAAGAGTCACGCC R1 CNAG_05590 3' flanking region primer 1 GTCATAGCTGTTTTCCTGTCCCATCCTCTGTGATTCCC R2 CNAG_05590 3' flanking region primer 2 ATTGTGGAGTGGTGGAGTGGAC SO CNAG_05590 diagnostic screening primer, pairing with B79 TGAGGAGGAAAGTTTTAGCG PO1 CNAG_05590 Southern blot probe primer 1 GTTACCGATTCTGGACCTG PO2 CNAG_05590 Southern blot probe primer 2 TGCTTCACCCTTTCAGTCTC STM NAT#116 STM primer GCACCCAAGAGCTCCATCTC STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 139 CNAG_05600 IGI1 L1 CNAG_05600 5' flanking region primer 1 TTCTTCTCCTCTATCCCCG L2 CNAG_05600 5' flanking region primer 2 TCACTGGCCGTCGTTTTACGATGATAGCGATGGTAGCC R1 CNAG_05600 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGGGAAGAAGTTTGGGTTCG R2 CNAG_05600 3' flanking region primer 2 TGGGGAAGAACCAGAAGTAG SO CNAG_05600 diagnostic screening primer, pairing with B79 TCCCTGTAAGATTCGCCAG PO CNAG_05600 Southern blot probe primer TTCTCCATAGGTAGCCACG STM NAT#230 STM primer ATGTAGGTAGGGTGATAGGT STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 140 CNAG_05694 CKA1 L1 CNAG_05694 5' flanking region primer 1 TGTCAAAAGCACACTCAGG L2 CNAG_05694 5' flanking region primer 2 TCACTGGCCGTCGTTTTACTGCGAATAGTTGCTGCTC R1 CNAG_05694 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGTTGACCTGCCGTGTATTTAG R2 CNAG_05694 3' flanking region primer 2 AAACATCACTCACCGTTCC SO CNAG_05694 diagnostic screening primer, pairing with B79 CGACAAGTTGCTGAAGTTTC PO CNAG_05694 Southern blot probe primer ACATTTGGAGTCGGTTGG STM NAT#6 STM primer ATAGCTACCACACGATAGCT STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 141 CNAG_05753 ARG5,6 L1 CNAG_05753 5' flanking region primer 1 ATTTTCCAGTCGTCCGTC L2 CNAG_05753 5' flanking region primer 2 TCACTGGCCGTCGTTTTACTAATACTGAGGGCAGAGCG R1 CNAG_05753 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGATCCTTTGACCATCCAGGG R2 CNAG_05753 3' flanking region primer 2 TTGATGTTTCGCAGCACC SO CNAG_05753 diagnostic screening primer, pairing with JOHE12579 ACCAGTCAGCAACGAAACG PO CNAG_05753 Southern blot probe primer CGACAGCAAGGGTTTTTG STM NAT#220 STM primer CAGATCTCGAACGATACCCA STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 142 CNAG_05771 TEL1 L1 CNAG_05771 5' flanking region primer 1 ACCTCCATACATCCTTCC L2 CNAG_05771 5' flanking region primer 2 TCACTGGCCGTCGTTTTACGGCTATCGTTTCGGTAAGG R1 CNAG_05771 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGCAGTATGGATGGGGAGTAATAG R2 CNAG_05771 3' flanking region primer 2 AACTCCCAAAGATGAGCC SO CNAG_05771 diagnostic screening primer, pairing with B79 TAGCAGCAAAAGTGAGGCG PO CNAG_05771 Southern blot probe primer GAAATCGTCAAACTCGTTCC STM NAT#225 STM primer CCATGAACTAGCTAAAGCA STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 143 CNAG_05935 L1 CNAG_05935 5' flanking region primer 1 GGTCAATCCAGATGCTATCAG L2 CNAG_05935 5' flanking region primer 2 TCACTGGCCGTCGTTTTACTTTGGGTTTTGGGTTTGGGCAGC R1 CNAG_05935 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGCCCGTGTTGTTCTTTCGTAG R2 CNAG_05935 3' flanking region primer 2 CAAGGGTGTTGGTATCTACG SO CNAG_05935 diagnostic screening primer, pairing with B79 CGGAAGATTACATCCTGGG PO CNAG_05935 Southern blot probe primer TTACTCATACGCAGGACCC STM NAT#220 STM primer CAGATCTCGAACGATACCCA STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 144 CNAG_05965 IRK4 L1 CNAG_05965 5' flanking region primer 1 TCATAGACGATGTTGCCG L2 CNAG_05965 5' flanking region primer 2 TCACTGGCCGTCGTTTTACCAAGATGGAAGCCAGACTTAC R1 CNAG_05965 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGCCATCTTCCTTCTCCGAAC R2 CNAG_05965 3' flanking region primer 2 TTTCGGGAGAGTTTTTGCG SO CNAG_05965 diagnostic screening primer, pairing with B79 GCTGTTGTTTCTCACTGTAACC PO CNAG_05965 Southern blot probe primer GATGTATCTGGCAAAGGGTC

STM NAT#211 STM primer GCGGTCGCTTTAGCGATT STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 145 CNAG_05970 L1 CNAG_05970 5' flanking region primer 1 TGAAGCGTGAGTGTAAACG L2 CNAG_05970 5' flanking region primer 2 TCACTGGCCGTCGTTTTACGGGCAAAGGAATGTGATG R1 CNAG_05970 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGCTCATTCTTGGATTTCCCTG R2 CNAG_05970 3' flanking region primer 2 ACAGAAAGGGGTGAAACG SO CNAG_09570 diagnostic screening primer, pairing with B79 AGACTTGCCCGATTTTGG PO CNAG_05970 Southern blot probe primer TGGCGGTTTATCCTTTCC STM NAT#212 STM primer AGAGCGATCGCGTTATAGAT STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 146 CNAG_06001 L1 CNAG_06001 5' flanking region primer 1 ATCTCCACCTCTTCGCCAACTTCC L2 CNAG_06001 5' flanking region primer 2 TCACTGGCCGTCGTTTTACCGTCATTTTTTTGGGATACGCC R1 CNAG_06001 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGAAGAAGAAGTTGCGGAAGTC R2 CNAG_06001 3' flanking region primer 2 GGAAGAAAGCGATTTACGG SO CNAG_06001 diagnostic screening primer, pairing with B79 TTCCTTGCCCTTCCAATCC PO CNAG_06001 Southern blot probe primer GGATAAAAGCCTGTCAGTCG STM NAT#119 STM primer CTCCCCACATAAAGAGAGCTAAAC STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 147 CNAG_06033 MAK32 L1 CNAG_06033 5' flanking region primer 1 CAAACAACAGATTCCGCC L2 CNAG_06033 5' flanking region primer 2 TCACTGGCCGTCGTTTTACTTCGGATGGACGGATGTAG R1 CNAG_06033 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGGGACATTTCTCTGCCATCC R2 CNAG_06033 3' flanking region primer 2 AACGCTGGGAAAACTACC SO CNAG_06033 diagnostic screening primer, pairing with B79 CAGCGTGAAAGTAGCATTG PO CNAG_06033 Southern blot probe primer GCTCTTGTCATTCTCGTTCC STM NAT#169 STM primer ACATCTATATCACTATCCCGAACC STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 148 CNAG_06051 GAL1 L1 CNAG_06051 5' flanking region primer 1 GCGGTTGAGTTGTGTTATTG L2 CNAG_06051 5' flanking region primer 2 TCACTGGCCGTCGTTTTACGCTCCCCTAACACATTGACTC R1 CNAG_06051 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGGTCCTGACGCTCTGATACTG R2 CNAG_06051 3' flanking region primer 2 GCTATGGGTATGAATCGCC SO CNAG_06051 diagnostic screening primer, pairing with B79 AGAGACCAGAAGTGAGAGGAC PO CNAG_06051 Southern blot probe primer GACGCTGACAACAAAAGC STM NAT#224 STM primer AACCTTAAATGGGTAGAG STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 149 CNAG_06086 SSN3 L1 CNAG_06086 5' flanking region primer 1 CGGAGTCTACATTGCTCAGAG L2 CNAG_06086 5' flanking region primer 2 TCACTGGCCGTCGTTTTACAGTAATCGGTTATCCCACG R1 CNAG_06086 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGGAGGATAACGGTGATGCTAAG R2 CNAG_06086 3' flanking region primer 2 CCACTTGTTTTGCTTGTGC SO CNAG_06086 diagnostic screening primer, pairing with B79 AGGCACGGGGATTTTTAG PO CNAG_06086 Southern blot probe primer ATTTGAACCCACCGACAG STM NAT#219 STM primer CCCTAAAACCCTACAGCAAT STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 150 CNAG_06161 VRK1 L1 CNAG_06161 5' flanking region primer 1 TATCGGCAGCGACTCTACTC L2 CNAG_06161 5' flanking region primer 2 TCACTGGCCGTCGTTTTACCGCAACCATCAACCTAAGC R1 CNAG_06161 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGATAGACGCCAAACGCATC R2 CNAG_06161 3' flanking region primer 2 CCAACCCAACTACTACATACTGC SO CNAG_06161 diagnostic screening primer, pairing with B79 GAAGAACTGGAAGCATTGG PO CNAG_06161 Southern blot probe primer CGAGAAGAGTGAGAAATGGG STM NAT#123 STM primer CTATCGACCAACCAACACAG STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 151 CNAG_06174 L1 CNAG_06174 5' flanking region primer 1 GCTCACATCGTAACGGTTG L2 CNAG_06174 5' flanking region primer 2 TCACTGGCCGTCGTTTTACAATGAGCCGAGAACTTACG R1 CNAG_06174 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGTTGGAGGGCTTTGTTAGC R2 CNAG_06174 3' flanking region primer 2 GCTCAACAACAACAGCAAGAG SO CNAG_06174 diagnostic screening primer, pairing with B79 TCCGATGCTCACGAATAC PO CNAG_06174 Southern blot probe primer GTCTCGCACTGTATCAATAAGC STM NAT#119 STM primer CTCCCCACATAAAGAGAGCTAAAC STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 152 CNAG_06193 CRK1 L1 CNAG_06193 5' flanking region primer 1 TCCCCTGCTGTATTCATTG L2 CNAG_06193 5' flanking region primer 2 TCACTGGCCGTCGTTTTACCTTGTGCTAATGTTGTCACG R1 CNAG_06193 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGTAACCAGTCTCATCCTCCAC R2 CNAG_06193 3' flanking region primer 2 TATTCCAGAGGTAGCGGCGTCAAG SO CNAG_06193 diagnostic screening primer, pairing with B79 ATAAGGGGGAAAGACCGAG PO CNAG_06193 Southern blot probe primer GGTTGCCTTCCATACACTC STM NAT#43 STM primer CCAGCTACCAATCACGCTAC STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 153 CNAG_06278 TCO7 L1 CNAG_06278 5' flanking region primer 1 CCACCTTTCTCATTCGTATG L2 CNAG_06278 5' flanking region primer 2 CTGGCCGTCGTTTTACTCTTCTTCAGATGGTTCCC R1 CNAG_06278 3' flanking region primer 1 GTCATAGCTGTTTCCTGCACACTCACTCAACGCATC R2 CNAG_06278 3' flanking region primer 2 CTCCATTTGTTCCATTAGCC SO CNAG_06278 diagnostic screening primer, pairing with B79 TAAGCCCTCGGAAACACTC PO CNAG_06278 Southern blot probe primer CCTTTCTCATTCGTATGGTGTG STM NAT#209 STM primer AGCACAATCTCGCTCTACCCATAA STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 154 CNAG_06301 SCH9 L1 CNAG_06301 5' flanking region primer 1 TTCTTCGTGCTGAGAGGAG L2 CNAG_06301 5' flanking region primer 2 GCTCACTGGCCGTCGTTTTACAGATGTGGCGTAGTCAGCAC R1 CNAG_06301 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGAATGAGAATGCGGTGGAC R2 CNAG_06301 3' flanking region primer 2 GGATGGATGGATGCTCAT SO CNAG_06301 diagnostic screening primer, pairing with B79 TTCTTCGTGCTGAGAGGAG PO CNAG_06301 Southern blot probe primer AACCGAAACCCTCAGAACC STM NAT#169 STM primer ACATCTATATCACTATCCCGAACC STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 155 CNAG_06310 IRK7 L1 CNAG_06310 5' flanking region primer 1 GGTGCTAAAGGATGGTATGG L2 CNAG_06310 5' flanking region primer 2 TCACTGGCCGTCGTTTTACGTTGCTGTTGTTTCTGTAGGTC R1 CNAG_06310 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGTTGGTTATCCGCTTACGAC R2 CNAG_06310 3' flanking region primer 2 GTATGGCTATCAACCTGCTG SO CNAG_06310 diagnostic screening primer, pairing with B79 CCGACCAAGATGAAAAGC PO CNAG_06310 Southern blot probe primer GATAGCAACTTTACCCCCCC STM NAT#208 STM primer TGGTCGCGGGAGATCGTGGTTT STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 156 CNAG_06366 HRR2502 L1 CNAG_06366 5' flanking region primer 1 TTCTCGTCTTCGCTTTCG L2 CNAG_06366 5' flanking region primer 2 TCACTGGCCGTCGTTTTACGGAGAAGGCATTGCTAAAC R1 CNAG_06366 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGATTGTGCCCTCGTAATGG R2 CNAG_06366 3' flanking region primer 2 TTCGCTGACTTGCTTGAG SO CNAG_06366 diagnostic screening primer, pairing with B79 TTCCTCGCTTTCAACTCC PO CNAG_06366 Southern blot probe primer GTTTCCTTCTTCACCCTACC STM NAT#125 STM primer CGCTACAGCCAGCGCGCGCAAGCG STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 157 CNAG_06432 L1 CNAG_06432 5' flanking region primer 1 CGTCACACAACACTGCTACAG L2 CNAG_06432 5' flanking region primer 2 TCACTGGCCGTCGTTTTACTTGATTGACGAGGAACCG R1 CNAG_06432 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGCGAACTTAGTGGGTCTTGACG R2 CNAG_06432 3' flanking region primer 2 GCGGTGATGGGTTGTTATC SO CNAG_06432 diagnostic screening primer, pairing with B79 ACTTGGCGGTAGTCTGAAG PO CNAG_06432 Southern blot probe primer ATACCTGGCGGCTAATCAG STM NAT#224 STM primer AACCTTAAATGGGTAGAG STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 158 CNAG_06445 L1 CNAG_06445 5' flanking region primer 1 GCGATAGGTCAGTAGATTGGG L2 CNAG_06445 5' flanking region primer 2 TCACTGGCCGTCGTTTTACGCTTACATCTGTTGGCACG R1 CNAG_06445 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGCGCCTCACAAGAGTCAAAG R2 CNAG_06445 3' flanking region primer 2 CAATCAGGACAATCATACGC SO CNAG_06445 diagnostic screening primer, pairing with B79 GAAGAGGAAATGTCAGGGTC PO CNAG_06445 Southern blot probe primer CAGAAAGGAACTCACAGGC STM NAT#122 STM primer ACAGCTCCAAACCTCGCTAAACAG STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 159 CNAG_06454 L1 CNAG_06454 5' flanking region primer 1 AACAAAACCGCTGGCAACACCC L2 CNAG_06454 5' flanking region primer 2 TCACTGGCCGTCGTTTTACTCCAGAGTCTTCTTCAGGCG R1 CNAG_06454 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGGACCAAGATGCCAAAAGC R2 CNAG_06454 3' flanking region primer 2 AATGGTTGACAAGCGTGCC SO CNAG_06454 diagnostic screening primer, pairing with B79 ACCCCTTACTGGCGAAAAC PO CNAG_06454 Southern blot probe primer GGCAAAACTTACACCTCGC STM NAT#232 STM primer CTTTAAAGGTGGTTTGTG STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 160 CNAG_06489 L1 CNAG_06489 5' flanking region primer 1 TTCTGGAGACCCATCGTCAG L2 CNAG_06489 5' flanking region primer 2 TCACTGGCCGTCGTTTTACCAACGCCCTGTTATTTCTTC R1 CNAG_06489 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGTTGGTCAGATGTGTGTCGG R2 CNAG_06489 3' flanking region primer 2 CTACTTTGCCGAGTCTCAAG SO CNAG_06489 diagnostic screening primer, pairing with B79 CAGGACTTGCGTAGCCTATC PO CNAG_06489 Southern blot probe primer TGGGTGATGACGATGAGAC STM NAT#125 STM primer CGCTACAGCCAGCGCGCGCAAGCG STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 161 CNAG_06490 L1 CNAG_06490 5' flanking region primer 1 GGAGGGTGTTTTTGAGGTC L2 CNAG_06490 5' flanking region primer 2 TCACTGGCCGTCGTTTTACGGGGACTTTTTTGATGGC R1 CNAG_06490 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGGAAGAGGAAGAGGAAGATGAAG R2 CNAG_06490 3' flanking region primer 2 TCGTCTGGTTGTCTGCTC SO CNAG_06490 diagnostic screening primer, pairing with B79 GGTGAGAAAAGTAGCCTTCG PO CNAG_06490 Southern blot probe primer CAGGACTTGCGTAGCCTATC STM NAT#231 STM primer GAGAGATCCCAACATCACGC STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 162 CNAG_06500 L1 CNAG_06500 5' flanking region primer 1 GATACAGCGGGCAAAAAG L2 CNAG_06500 5' flanking region primer 2 TCACTGGCCGTCGTTTTACAGAATGGGATGTGGTCGTC R1 CNAG_06500 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGTGAACGGGGTTGTGTTTG R2 CNAG_06500 3' flanking region primer 2 ATACAGACACTCCGATGCG SO CNAG_06500 diagnostic screening primer, pairing with B79 ATAAAGAGGGTTTGGGGC PO CNAG_06500 Southern blot probe primer ATCGCATTTCAAGGGTGG STM NAT#225 STM primer CCATGAACTAGCTAAAGCA STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 163 CNAG_06552 SNF1 L1 CNAG_06552 5' flanking region primer 1 CCATCATCCTTCGGTTTTTC L2 CNAG_06552 5' flanking region primer 2 TCACTGGCCGTCGTTTTACAGTTGTTATTGCCAGCGG R1 CNAG_06552 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGCTTTTTGGAGATGGCTTGC R2 CNAG_06552 3' flanking region primer 2 ATACCACGGAAAGGCGTTC SO CNAG_06552 diagnostic screening primer, pairing with B79 GGATTGTGGTGTTGAAGTCG

PO CNAG_06552 Southern blot probe primer ATGCTTGCCTTTCTGGAC STM NAT#204 STM primer GATCTCTCGCGCTTGGGGGA STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 164 CNAG_06553 GAL83 L1 CNAG_06553 5' flanking region primer 1 TGAGCACTTTGAGGTATTGG L2 CNAG_06553 5' flanking region primer 2 TCACTGGCCGTCGTTTTACGTGTGATGTATGGGTGTGTG R1 CNAG_06553 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGCATCTGCTGTGAAACATTGG R2 CNAG_06553 3' flanking region primer 2 GGAAAGGGGTGAAAATGG SO CNAG_06553 diagnostic screening primer, pairing with B79 ATGCTTGCCTTTCTGGAC PO CNAG_06553 Southern blot probe primer TATTGACCAGGAGGAAGGC STM NAT#288 STM primer CTATCCAACTAGACCTCTAGCTAC STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 165 CNAG_06568 SKS1 L1 CNAG_06568 5' flanking region primer 1 AATAAGGTCTCCAGCCTCG L2 CNAG_06568 5' flanking region primer 2 TCACTGGCCGTCGTTTTACCCACCATCAATGAACTGC R1 CNAG_06568 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGAACGACCTGTTGATGACG R2 CNAG_06568 3' flanking region primer 2 CAAGTTGAATGCTGGGAG SO CNAG_06568 diagnostic screening primer, pairing with B79 AGCAAGTGGGCAAAGAAGC

PO CNAG_06568 Southern blot probe primer AACCGAAGTCACAGATGCG STM NAT#211 STM primer GCGGTCGCTTTAGCGATT STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 166 CNAG_06632 ABC1 L1 CNAG_06632 5' flanking region primer 1 ACGACCTGGTAAAGAGTGTG L2 CNAG_06632 5' flanking region primer 2 TCACTGGCCGTCGTTTTACAGATGGGCGAAATGTCTC R1 CNAG_06632 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGCACCTCTTATCACCTCAATGAC R2 CNAG_06632 3' flanking region primer 2 ACCTTCACGACCAAGTGTC SO CNAG_06632 diagnostic screening primer, pairing with B79 CTATCGCAGAAGAGGATGAG PO CNAG_06632 Southern blot probe primer AATACCCCTACAACCTCGTC STM NAT#119 STM primer CTCCCCACATAAAGAGAGCTAAAC STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 167 CNAG_06642 L1 CNAG_06642 5' flanking region primer 1 CCTTTTCCTTTTACCTGGC L2 CNAG_06642 5' flanking region primer 2 TCACTGGCCGTCGTTTTACCGCTGAAAGATGTTGTCG R1 CNAG_06642 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGTGGATTGACTGGACGAAAC R2 CNAG_06642 3' flanking region primer 2 CTGGTATGCGTAAAGACTTGAC SO CNAG_06642 diagnostic screening primer, pairing with B79 CCTGCTGAACGGATGATAG PO CNAG_06642 Southern blot probe primer GAAGGTTAGTTCGCAAATGG STM NAT#43 STM primer CCAGCTACCAATCACGCTAC STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 168 CNAG_06671 YKL1 L1 CNAG_06671 5' flanking region primer 1 CCGACCTACTGATTCGTCTAC L2 CNAG_06671 5' flanking region primer 2 TCACTGGCCGTCGTTTTACCTCGCCCCTTTTCATAATG R1 CNAG_06671 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGGTCCAATCAACAACAGCG R2 CNAG_06671 3' flanking region primer 2 TGCGGAGGAGATTACCATAC SO CNAG_06671 diagnostic screening primer, pairing with B79 TTCGCCTTTGAAGTTCCC PO CNAG_06671 Southern blot probe primer GGAAAGTGTAGATTGTCGGC STM NAT#123 STM primer CTATCGACCAACCAACACAG STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 169 CNAG_06697 MPS1 L1 CNAG_06697 5' flanking region primer 1 GCGATAACTTTTCATCCCC L2 CNAG_06697 5' flanking region primer 2 TCACTGGCCGTCGTTTTACGGTTTTTCCTTTCTCCAGTC R1 CNAG_06697 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGCGGAACTGTCAGATGGTAATC R2 CNAG_06697 3' flanking region primer 2 CCTTCTCACCCTACTCTGG SO CNAG_06697 diagnostic screening primer, pairing with B79 CCAATCTCGCATTTACACC PO CNAG_06697 Southern blot probe primer TCCTTAGTTATCCTATCCCAGC STM NAT#116 STM primer GCACCCAAGAGCTCCATCTC STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 170 CNAG_06730 GSK3 L1 CNAG_06730 5' flanking region primer 1 GTGAGTCTATCCTTCGTTTCTGTC L2 CNAG_06730 5' flanking region primer 2 TCACTGGCCGTCGTTTTACCGGCTTCCAAAAAAGTCAG R1 CNAG_06730 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGCTGAACAACTGCGTGTCAC R2 CNAG_06730 3' flanking region primer 2 CTTGAAAGATGACGCTCG SO CNAG_06730 diagnostic screening primer, pairing with B79 ACATCCTTTGTCTCCCCCAC PO1 CNAG_06730 Southern blot probe primer 1 CGGAAGACTTTGGTGAAGG STM NAT#123 STM primer CTATCGACCAACCAACACAG STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 171 CNAG_06809 IKS1 L1 CNAG_06809 5' flanking region primer 1 TGGAAGAGGATGAAAGACC L2 CNAG_06809 5' flanking region primer 2 TCACTGGCCGTCGTTTTACACAACTAAAGGCACAAGGG R1 CNAG_06809 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGATGAGCGAGCAATGACCTGC R2 CNAG_06809 3' flanking region primer 2 CAGAACGGTCTTTTGCTCTC SO CNAG_06809 diagnostic screening primer, pairing with B79 TACAGTATCGCTGGTTGCC PO CNAG_06809 Southern blot probe primer AGCGAGACTGGAATGTGGAG STM NAT#116 STM primer GCACCCAAGAGCTCCATCTC STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 172 CNAG_06845 L1 CNAG_06845 5' flanking region primer 1 GTTATTTGGATGCCAGAGC L2 CNAG_06845 5' flanking region primer 2 TCACTGGCCGTCGTTTTACATGCGGTTACCTCATTCG R1 CNAG_06845 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGAGGGAGAAGTAGTTTTCGGG R2 CNAG_06845 3' flanking region primer 2 TGGAGGTTTCGGGTATCAC SO CNAG_06845 diagnostic screening primer, pairing with B79 GCAAAAACCGAGACTGTG PO CNAG_06845 Southern blot probe primer TTGAGGGGTTATGCCTTC STM NAT#201 STM primer CACCCTCTATCTCGAGAAAGCTCC STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 173 CNAG_06980 STE11 L1 CNAG_06980 5' flanking region primer 1 TCTCAGCCACATCAGTTAGC L2 CNAG_06980 5' flanking region primer 2 CTGGCCGTCGTTTTACGGGTGCTCTAAATCTCCTTG R1 CNAG_06980 3' flanking region primer 1 GTCATAGCTGTTTTCCTGCCATTTTCCGAGTCAGTAGG R2 CNAG_06980 3' flanking region primer 2 ATCCTGATGCCAGATTCG SO CNAG_06980 diagnostic screening primer, pairing with B79 TCATCTGTCTCACCAACTGC PO1 CNAG_06980 Southern blot probe primer 1 GGACGCACAGTCTGGTTTAC PO2 CNAG_06980 Southern blot probe primer 2 TGGGTCAAGTTTAGGGATG STM NAT#242 STM primer GTAGCGATAGGGGTGTCGCTTTAG STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 174 CNAG_07359 IRK1 L1 CNAG_07359 5' flanking region primer 1 CGCATTTGGTGTATGATGAC L2 CNAG_07359 5' flanking region primer 2 TCACTGGCCGTCGTTTTACGGAGGAAGAAGGAGATGAAG R1 CNAG_07359 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGTGCTTCGCCTTGATTGTC R2 CNAG_07359 3' flanking region primer 2 TGCTGAAGATTTCGGAGG SO CNAG_07359 diagnostic screening primer, pairing with B79 TGATGGTAGAAATGGCGG PO1 CNAG_07359 Southern blot probe primer 1 GCATTCGGAGGTAGTTGAAG STM NAT#5 STM primer TGCTAGAGGGCGGGAGAGTT STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 175 CNAG_07372 L1 CNAG_07372 5' flanking region primer 1 CCAAACGGTGTGAAAAGG L2 CNAG_07372 5' flanking region primer 2 TCACTGGCCGTCGTTTTACTGTAGTCGCCGATGGAGTAG R1 CNAG_07372 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGGGCAAGACGAGAAGTAGAGC R2 CNAG_07372 3' flanking region primer 2 GAACCTGAACCTGAACCAG SO CNAG_07372 diagnostic screening primer, pairing with B79 TTTGTAGTTGGGTGTGGTG PO CNAG_07372 Southern blot probe primer CTTCGCCTTTTGCCTTTC STM NAT#295 STM primer ACACCTACATCAAACCCTCCC STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 176 CNAG_07377 L1 CNAG_07377 5' flanking region primer 1 CGATAACGCAACTTACGG L2 CNAG_07377 5' flanking region primer 2 TCACTGGCCGTCGTTTTACTTTGGCTTGATTCTCCGC R1 CNAG_07377 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGCTCTCAATCTCGCTCAAATG R2 CNAG_07377 3' flanking region primer 2 CTGAGCCGATAGAGTTCAAC SO CNAG_07377 diagnostic screening primer, pairing with B79 ACCAACGCACATCTACCTC PO CNAG_07377 Southern blot probe primer TTATCTACCGAAGTTGGCTG STM NAT#296 STM primer CGCCCGCCCTCACTATCCAC STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 177 CNAG_07408 L1 CNAG_07408 5' flanking region primer 1 GCTGGCATAAAACCGTTC L2 CNAG_07408 5' flanking region primer 2 TCACTGGCCGTCGTTTTACCTCTTACTCCACATAAATGCCC R1 CNAG_07408 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGTTGAAGTCACCCGAGAAAC R2 CNAG_07408 3' flanking region primer 2 ACACTGCGGATTACGAAGC SO CNAG_07408 diagnostic screening primer, pairing with B79 TGTGGCTGAGATGAGGTAGG PO CNAG_07408 Southern blot probe primer TCTGGGCTGAAGTCTACTAAAC STM NAT#6 STM primer ATAGCTACCACACGATAGCT STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 178 CNAG_07427 CCK2 L1 CNAG_07427 5' flanking region primer 1 AGATTCACTCGTCATCGCC L2 CNAG_07427 5' flanking region primer 2 TCACTGGCCGTCGTTTTACTAAGATGCGATAGGTGGGCG R1 CNAG_07427 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGCAGACTAAAGCCAGGGACAC R2 CNAG_07427 3' flanking region primer 2 GGAAGGTCAAGCCATTAGC SO CNAG_07427 diagnostic screening primer, pairing with B79 TCAAGGCTTTCATCCCGAC PO CNAG_07427 Southern blot probe primer CGAGACCAGTTATGTTTGAGAG STM NAT#230 STM primer ATGTAGGTAGGGTGATAGGT STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 179 CNAG_07580 TRM7 L1 CNAG_07580 5' flanking region primer 1 GGTGGAGAGATGTTATGGC L2 CNAG_07580 5' flanking region primer 2 TCACTGGCCGTCGTTTTACATAGAGGACTTGGAGGTGGG R1 CNAG_07580 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGGCAATGCTGTGAATCTTTGTG R2 CNAG_07580 3' flanking region primer 2 AGAGTAGGGCTGAGCAAGAC SO CNAG_07580 diagnostic screening primer, pairing with B79 TGGAAAGACCTGTTGCGAC PO CNAG_07580 Southern blot probe primer TCTTCGGGAAATGGACTG STM NAT#102 STM primer CCATGCGATATCTACCCCAATCT STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 180 CNAG_07667 SAT4 L1 CNAG_07667 5' flanking region primer 1 GATTTTGTGGCTGTTGTGC L2 CNAG_07667 5' flanking region primer 2 TCACTGGCCGTCGTTTTACTGCTTCAAAACCTGGGCTCC R1 CNAG_07667 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGGTGTAGATTGTTCAGGATGACG R2 CNAG_07667 3' flanking region primer 2 AGATAGGCGTGCTACCGATG SO CNAG_07667 diagnostic screening primer, pairing with ATCGGCTTACCATTCTGG PO CNAG_07667 Southern blot probe primer TCGGTCCCATAATAGACGG STM NAT#212 STM primer AGAGCGATCGCGTTATAGAT STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 181 CNAG_07744 PIK1 L1 CNAG_07744 5' flanking region primer 1 TGGTAGTATGCCAAGAGGTG L2 CNAG_07744 5' flanking region primer 2 TCACTGGCCGTCGTTTTACTGGGATACTCTCTCTCTCTGAG R1 CNAG_07744 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGAAAAGGGCAAAGGCAGAAG R2 CNAG_07744 3' flanking region primer 2 GGAGATGAAGTCAAGATGCG SO CNAG_07744 diagnostic screening primer, pairing with B79 TCATCTTCATTGTCCTCCC PO CNAG_07744 Southern blot probe primer TAAAGAGCGGTAAGGCGAG STM NAT#227 STM primer TCGTGGTTTAGAGGGAGCGC STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 182 CNAG_07779 TDA10 L1 CNAG_07779 5' flanking region primer 1 TGGGAAGCGTTACTTATGC L2 CNAG_07779 5' flanking region primer 2 TCACTGGCCGTCGTTTTACCTGTAGCAGTCATAATGGCTTG R1 CNAG_07779 3' flanking region primer 1 CATGGTCATAGCTGTTTCCTGTGAGCAGGTCCGACATTTC R2 CNAG_07779 3' flanking region primer 2 CATCGCTCTTTCCTACTCG SO CNAG_07779 diagnostic screening primer, pairing with B79 TTTGGAGCCAGTTTAGGG PO CNAG_07779 Southern blot probe primer AAAACGAAGCCCTTTGCCCC STM NAT#102 STM primer CCATGCGATATCTACCCCAATCT STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG 183 CNAG_08022 PHO85 L1 CNAG_08022 5' flanking region primer 1 CCTTGCTTTTGAGCGAG L2 CNAG_08022 5' flanking region primer 2 CTGGCCGTCGTTTTACCCTTCACCAAGTTTCTCAAG R1 CNAG_08022 3' flanking region primer 1 GTCATAGCTGTTTCCTGCAAATGGCTCAACAAGGG R2 CNAG_08022 3' flanking region primer 2 CCACAGTGCGTCTTTTTATC SO CNAG_08022 diagnostic screening primer, pairing with B79 ATAGGGGTGATTATCGGGC PO CNAG_08022 Southern blot probe primer TCGGCATTATCTCTTCCTC STM NAT#218 STM primer CTCCACATCCATCGCTCCAA STM common STM common primer GCATGCCCTGCCCCTAAGAATTCG

Primers used for construction and functional characterization of Nase variant libraries Primer name Primer description Primer sequence (5'-3') B1026 M13 Forward extended GTAAACGACGGCCAGTGAGC B1027 M13 Reverse extended CAGGAAACAGCTATGACCATG B1454 NAT split marker primer (NSR) AAGGTGTTCCCCGACGACGAATCG B1455 NAT split marker primer (NSL) AACTCCGTCGCGAGCCCCATCAAC B1886 NEO split marker primer (GSR) TGGAAGAGATGGATGTGC B1887 NEO split marker primer (GSL) ATTGTCTGTTGTGCCCAG B4017 Primer 1 for overexpression promoter with NEO marker GCATGCAGGATTCGAGTG B4018 Primer 2 for overexpression promoter with NEO marker GTGATAGATGTGTTGTGGTG B678 Northern probe primer 1 for ERG11 TTCAGGGAACTTGGGAACAGC B1598 Northern probe primer2 for ERG11 CAGGAGCAGAAACAAAGC B3294 Northern probe primer1 for ACT1 GCACCATACCTTCTACAATGAG B3295 Northern probe primer2 for ACT1 ACTTTCGGTGGACGATTG B5251 RT-PCR primer for HXL1 of H99 CACTCCATTCCTTTCTGC B5252 RT-PCR primer for HXL1 of H99 CGTAACTCCACTGTGTCC B7030 qRT-PCR primers for CNA1 of H99 AGACTGTTTACAATGCCTGC B7031 qRT-PCR primers for CNA1 of H99 TCTGGCGACAAGCCACCATG B7032 qRT-PCR primers for CNB1 of H99 AAGATGGAAGTGGAACGG B7033 qRT-PCR primers for CNB1 of H99 TTGAAAGCGAATCTCAGCTT B7034 qRT-PCR primers for CRZ1 of H99 ACCACGGACATTATCTTCAG B7035 qRT-PCR primers for CRZ1 of H99 AGCCCAGCCTTGCTGTTCGT B7036 qRT-PCR primer for UTR2 of H99 TTTCTATGCCCATCTACAGC B7037 qRT-PCR primer for UTR2 of H99 CTTCGTGGGAGTACAGTGGC B679 qRT-PCR primer for ACT1 of H99 CGCCCTTGCTCCTTCTTCTATG B680 qRT-PCR primer for ACT1 of H99 GACTCGTCGTATTCGCTCTTCG

Example 3: Systematic phenotypic profiling and clustering of Cryptococcus kinome networks

With the library of kinase variants constructed in the above example, a series of in vitro phenotypic analyzes (total of 30 phenotypes) were performed on the following six major phenotypic classes: growth, differentiation, stress response and adaptation, antifungal drug resistance, and virulence factor generation. and generated more than 6,600 phenotypic data. Such comprehensive kinase phenome data can be retrieved from the C. neoformans kinome database (http://kinase.cryptococcus.org). In order to reveal connectivity between functions and regulation between kinases, kinases were grouped by phenotypic analysis through Pearson Correlation analysis (see FIG. 2). The rationale for this analysis is that groups of kinases within any signaling pathway tend to cluster together according to shared phenotypic traits. For example, variants of the three-step mitogen-activated protein kinase (MAPK) cascade should be clustered together because they exhibit nearly identical phenotypes. Indeed, cell wall integrity MAPKs ( bck1Δ, mkk1Δ, mpk1Δ ) and high osmolarity glycerol reactive (HOG) MAPKs ( ssk2Δ, pbs2Δ, hog1Δ ), and pheromone-responsive MAPKs ( ste11Δ, ste7Δ, Three stages of kinases in the cpk1Δ ) pathway were clustered together, respectively, based on their shared functions (FIG. 2). Therefore, a group of kinases clustered together by this assay are very likely to function in the same or related signaling cascades. The present inventors have identified several novel, unknown kinases that are functionally related to known signaling pathways. CNAG_06553 encoding a protein orthologous to the yeast Gal83, one of the three possible β-subunits of the Snf1 kinase complex in S. cerevisiae, was identified. The yeast Snf1 kinase complex consists of Snf1, a catalytic α-subunit, Snf4, a regulatory γ subunit, and one of three possible β subunits Gal83, Sip1 or Sip2, and regulates transcriptional changes under glucose depression. (Jiang, R. & Carlson, M. The Snf1 protein kinase and its activating subunit, Snf4, interact with distinct domains of the Sip1/Sip2/Gal83 component in the kinase complex. Mol Cell Biol 17, 2099-2106, 1997; Schuller , HJ Transcriptional control of nonfermentative metabolism in the yeast Saccharomyces cerevisiae. Curr Genet 43, 139-160, doi:10.1007/s00294-003-0381-8, 2003). The function of Snf1 in C. neoformans has already been reported (Hu, G., Cheng, PY, Sham, A., Perfect, JR & Kronstad, JW Metabolic adaptation in Cryptococcus neoformans during early murine pulmonary infection. Molecular microbiology 69, 1456-1475, doi:10.1111/j.1365-2958.2008.06374.x, 2008). Some experimental evidence demonstrated that Gal83 functions in association with Snf1 in C. neoformans. First, the in vitro (ex vivo) phenotype of the gal83Δ mutant is almost identical to that of the snf1Δ mutant (FIG. 3). Both the gal83Δ and snf1Δ variants showed increased sensitivity to fludioxonil and increased resistance to organic peroxide (tert-butyl hydroperoxide). Second, growth defects of the snf1Δ mutant on other carbon sources (e.g., potassium acetate, sodium acetate, ethanol) were also observed in the gal83Δ mutant (Fig. 3). Thus, Gal83 could be one of the possible β-subunit complexes of the Snf1 kinase complex in C. neoformans.

In addition, we have identified several kinases with potential functions upstream or downstream of the TOR kinase complex. Although we could not disrupt Tor1 kinase because it is essential for C. neoformans, three kinases (Ipk1, Ypk1, and Gsk3) found clustered in most eukaryotes, a Tor1-dependent signaling cascade It was found that id can be clustered in C. neoformans. Recently, Lev et al. proposed that it may be involved in the production of inositol hexaphosphate (IP6) based on limited sequence homology to S. cerevisiae Ipk1 (Lev, S. et al. Fungal Inositol Pyrophosphate IP7 Is Crucial MBio 6, e00531-00515, doi:10.1128/mBio.00531-15 (2015)). IPMK (inositol polyphosphate multikinase), identified as Arg82 in yeast, inhibits IP6, a precursor of 5-IP7, and Akt activity in mammals, thereby reducing mTORC1-mediated protein translation, GSK3-mediated glucose homeostasis, Increases adipogenesis and behavior (Chakraborty, A., Kim, S. & Snyder, SH Inositol pyrophosphates as mammalian cell signals. Sci Signal 4, re1, doi:10.1126/scisignal.2001958 (2011)) let it In S. cerevisiae , Ypk1 was reported to be a direct target of TORC2 by promoting autophagy during amino acid deprivation (Vlahakis, A. & Powers, T. A role for TOR complex 2 signaling in promoting autophagy. Autophagy 10, 2085 -2086, doi:10.4161/auto.36262 (2014)). In C. neoformans, Ypk1, a potential downstream target of Tor1 , is involved in sphingolipid synthesis, and deletion of YPK1 results in a significant reduction in virulence (Lee, H., Khanal Lamichhane, A., Garraffo , HM, Kwon-Chung, KJ & Chang, YC Involvement of PDK1, PKC and TOR signaling pathways in basal fluconazole tolerance in Cryptococcus neoformans.Mol.Microbiol.84, 130-146, doi:10.1111/j.1365-2958.2012.08016 .x (2012)). Reflecting the essential role of Tor1, all ipk1Δ, ypk1Δ , and gsk3Δ mutants showed growth factor deficiency, especially at high temperatures.

There are two major limitations to this phenotypic clustering analysis. First, kinases that are oppositely regulated in the same pathway cannot be clustered. Second, kinases that regulate a subset of phenotypes regulated in signaling pathways cannot cluster with kinases upstream of them. Examples include Hrk1 (CNAG_00130; Hog1-regulated kinase 1). Although we have demonstrated that Hrk1 is regulated by Hog1, Hrk1 and Hog1 cannot be clustered together as Hrk1 regulates only a subset of Hog1-dependent phenotypes. Fpk1, a phospholipid flippase kinase, is another example. In S. cerevisiae, the activity of Fpk1 is inhibited by direct phosphorylation by Ypk136. As expected, Fpk1 and Ypk1 clustered together. To confirm whether Fpk1 modulates C. neoformans Ypk1-dependent phenotypic characteristics, we performed epistatic analyzes to construct and analyze FPK1 overexpressing strains constructed from ypk1Δ and wild-type strain backgrounds. . As expected, overexpression of FPK1 partially restored normal growth, stress (osmotic pressure, oxidation, genotoxicity, and cell wall/membrane stress) resistance and antifungal drug (amphotericin B) resistance in ypk1 mutants (FIG. 4) . However, the azole sensitivity of the ypk1Δ mutant could not be restored by FPK1 overexpression (see Fig. 4). These results suggest that Fpk1 can be one of the downstream targets of Ypk1 and can be positively regulated by Ypk1.

Example 4: C. Pathogenic kinome networks in Neoformans

To identify kinases that regulate pathogenicity, governed by both infectivity and virulence, we performed two large-scale in vivo animal experiments: a virulence assay and an STM-based mouse infectivity assay. In both assays, two independent variants for each kinase were monitored, except for some kinases with single variants. As a result, 31 virulence-regulating kinases were found in the insect killing assay (Figs. 5a and b) and 54 infectivity-regulating kinases in the STM-based mouse infectivity assay (Figs. 6a, b, c and d). Of these, 25 kinases were commonly identified in both assays (Fig. 7a), indicating that virulence in insect hosts and infectivity in mouse hosts are closely related as previously reported ( Jung, KW et al. Systematic functional profiling of transcription factor networks in Cryptococcus neoformans. Nat Comms 6, 6757, doi:10.1038/ncomms7757, 2015). Only 6 kinase variants were found by the insect killing assay (Fig. 7b). We found a total of 60 kinase variants associated with the pathogenicity of C. neoformans.

Additionally, a large number of known virulence-regulating kinases (15 kinases in total) were reconfirmed in the present invention (kinases shown in black in Fig. 7a). These include Mpk1 MAPK (Gerik, KJ, Bhimireddy, SR, Ryerse, JS, Specht, CA & Lodge, JK PKC1 is essential for protection against both oxidative and nitrosative stresses, cell integrity, and normal manifestation of virulence factors in the pathogenic fungus Cryptococcus neoformans Eukaryot.Cell 7, 1685-1698, 2008;Kraus, PR, Fox, DS, Cox, GM & Heitman, J. The Cryptococcus neoformans MAP kinase Mpk1 regulates cell integrity in response to antifungal drugs and loss of calcineurin function.Mol. Microbiol.48, 1377-1387, 2003); Ssk2 within the high osmolarity glycerol response (HOG) pathway (Bahn, YS, Geunes-Boyer, S. & Heitman, J. Ssk2 mitogen-activated protein kinase kinase kinase governs divergent patterns of the stress-activated Hog1 signaling pathway in Cryptococcus neoformans Eukaryot. Cell 6, 2278-2289, 2007), the main catalytic subunit of protein kinase A (Pka1) in the cAMP pathway (D'Souza, CA et al. Cyclic AMP-dependent protein kinase controls virulence of the fungal pathogen Cryptococcus neoformans Mol. Cell. Biol. 21, 3179-3191, 2001); Ire1 kinase/endoribonuclease in the unfolded protein response (UPR) pathway (Cheon, SA et al. Unique evolution of the UPR pathway with a novel bZIP transcription factor, Hxl1, for controlling pathogenicity of Cryptococcus neoformans. PLoS Pathog. 7 , e1002177, doi:10.1371/journal.ppat.1002177, 2011); Ypk1 (Kim, H. et al. Network-assisted genetic dissection of pathogenicity and drug resistance in the opportunistic human pathogenic fungus Cryptococcus neoformans. Scientific reports 5, 8767, doi:10.1038/srep08767, 2015; Lee, H., Khanal Lamichhane, A., Garraffo, HM, Kwon-Chung, KJ & Chang, YC Involvement of PDK1, PKC and TOR signaling pathways in basal fluconazole tolerance in Cryptococcus neoformans.Mol.Microbiol.84, 130-146, doi:10.1111/j.1365 -2958.2012.08016.x, 2012); and Snf1 (Hu, G., Cheng, PY, Sham, A., Perfect, JR & Kronstad, JW Metabolic adaptation in Cryptococcus neoformans during early murine pulmonary infection. Molecular microbiology 69, 1456-1475, doi:10.1111/j.1365 -2958.2008.06374.x, 2008). Investigating the function of Gsk3 in serotype D (B3501A), it has been demonstrated that Gsk3 is required for C. neoformans to survive at low oxygen partial pressure (1%) and to be virulent in a mouse model system (Chang, YC, Ingavale, SS, Bien, C., Espenshade, P. & Kwon-Chung, KJ Conservation of the sterol regulatory element-binding protein pathway and its pathobiological importance in Cryptococcus neoformans.Eukaryot Cell 8, 1770-1779, doi:10.1128 /EC.00207-09, 2009). We found that Gsk3 is also required in serotype A C. neoformans (H99S). Although not previously reported, it has also been found that deletion variants of kinases functionally related to known virulence-regulating kinases attenuate virulence or infectivity. In the present invention, the bck1Δ and mkk1/ 2Δ mutants (related to Mpk1) and the gal83Δ mutant (related to Snf1) are included. In particular, for 44 of these kinases, a role for fungal pathogenicity was identified for the first time.

We analyzed the phenotypic relevance of 60 pathogenicity-associated kinases in C. neoformans to their possible orthologs in fungal species and other eukaryotic kingdoms, animals and plants ( Fig. 8 a). For broad inhibition of fungal pathogens, it is ideal to target kinases that are required by many fungal pathogens, preferably not present in humans (broad-spectrum antifungal targets). These large-scale virulence data in C. neoformans were compared with other fungal pathogens. In the wheat scab plant pathogenic fungus Fusarium graminearum, a large-scale kinome analysis was performed to find 42 protein kinases involved in virulence (Wang, C. et al. Functional analysis of the kinome of the wheat scab fungus Fusarium graminearum.PLoS Pathog 7, e1002460, doi:10.1371/journal.ppat.1002460, 2011). Twenty-one of these were implicated in the pathogenicity of both fungi and were considered broad-spectrum antifungal targets: BUD32 (Fg10037), ATG1 (Fg05547), CDC28 (Fg08468), KIC1 (Fg05734), MEC1 (Fg13318), KIN4 ( Fg11812), MKK1/2 (Fg07295), BCK1 (Fb06326), SNF1 (Fg09897), SSK2 (Fg00408), PKA1 (Fg07251), GSK3 (Fg07329), CBK1 (Fg01188), KIN1 (Fg09274), SCH9 (Fg00472) RIM15 (Fg01312), HOG1 (Fg09612), and YAK1 (Fg05418). For the other human fungal pathogen Candida albicans, no large-scale pathogenicity kinome analysis has been performed. According to information obtained from the constructed Candida genome database (http://www.candidagenome.org/), 33 kinases are known to be involved in the pathogenicity of Candida albicans. Thirteen of them were found to be related to the pathogenicity of C. neoformans and C. Candida (Fig. 8b). In particular, five kinases (Sch9, Snf1, Pka1, Hog1, and Swe1) were found to be important pathogenic kinases involved in all three fungal virulence.

Conversely, to selectively inhibit C. neoformans, it is ideal to target pathogenicity-associated kinases present in C. neoformans but not in other fungi or humans (narrow-spectrum anticryptococcus proof target). Among them, there is limited orthologous homology to inositol 1,3,4,5,6-pentakisphosphate 2-kinase present in plants, but ascomycetes and CNAG_01294 (named IPK1 ), which encodes a protein not present or distantly related to humans, was considered an excellent anti-cryptococosis target. The ipk1Δ mutant showed a lack of virulence and a pleiotropic phenotype (FIG. 9). Deletion of IPK1 slightly increased capsule formation (Fig. 8b), but prevented melanin and urease production (Fig. 8c and d), made the differentiation defective (Fig. 8e) and cell made highly sensitive to high temperature (Fig. 8f) and various stresses (Fig. 8g). In particular, since deletion of Ipk1 significantly increases susceptibility to various types of antifungal drugs, it can be a useful target for combination therapy (Fig. 8g). Thus, the present inventors have revealed a narrow- and broad-spectrum of anticryptococcal and antifungal drug targets by analysis of the pathogenicity kinome of C. neoformans.

Example 5: C. Biological functions of kinases governing neoformans pathogenicity

To further clarify the functional network of kinases associated with pathogenicity, we recently constructed a genome-scale co-functional network for C. neoformans, CryptoNet (www.inetbio.org/cryptonet). (Kim, H. et al. Network-assisted genetic dissection of pathogenicity and drug resistance in the opportunistic human pathogenic fungus Cryptococcus neoformans. Scientific reports 5, 8767, doi: 10.1038/srep08767 (2015)). By searching for any protein that is functionally linked to a pathogenicity-related kinase, previously reported information in C. neoformans and the Gene Ontology (GO) terms of the corresponding kinase orthologs and S. Proteins that interact with cerevisiae and other fungi were searched (FIG. 10). These analyzes reveal that the biological functions of pathogenicity-related kinases include cell cycle regulation, metabolic processes, cell wall biogenesis and organization, DNA damage repair, histone modification, including transmembrane transport and vacuole trafficking, tRNA processing, cytoskeleton organization, stress response and signal transduction, protein folding, mRNA processing, and transcriptional regulation was found, suggesting that a variety of different biological and physiological functions influence the virulence of C. neoformans (FIG. 10). Among the pathogenicity-related kinases, kinases involved in cell cycle and growth regulation have been identified most frequently. These include CDC7, SSN3, CKA1, and MEC1 . In particular, in S. cerevisiae, Cdc7 is an essential catalytic subunit of Dbf4-dependent protein kinase, and Cdc7-Dbf4 is essential for replicative operation through S phase in S. cerevisiae (Diffley, JF , Cocker, JH, Dowell, SJ, Harwood, J. & Rowley, A. Stepwise assembly of initiation complexes at budding yeast replication origins during the cell cycle. J Cell Sci Suppl 19, 67-72, 1995). Although dispensable at ambient temperature, the cdc7Δ mutant exhibits severe growth defects at elevated temperatures (Fig. 11a), which is likely to affect the virulence of C. neoformans. The high sensitivity of the cdc7Δ variant in C. neoformans to genotoxic substances such as methylmethanesulfonate (MMS) and hydroxyurea (HU) suggests that Cdc7 may be responsible for DNA replication and repair (Fig. 11 a). Mec1 is required for cell cycle checkpoint, telomere maintenance and silencing, and DNA damage repair in S. cerevisiae (Mills, KD, Sinclair, DA & Guarente, L. MEC1-dependent redistribution of the Sir3 silencing protein from telomeres to DNA double-strand breaks. Cell 97, 609-620, 1999). Reflecting this role, deletion of MEC1 increased cellular susceptibility to genotoxic agents in C. neoformans (Fig. 11b), suggesting preservation of Mec1's role in maintenance of chromosome integrity. indicates that it can Similar to the case of C. neoformans, deletion of MEC1 did not cause any lethality or growth defects in C. albicans (Legrand, M., Chan, CL, Jauert, PA & Kirkpatrick, DT The contribution of the S-phase checkpoint genes MEC1 and SGS1 to genome stability maintenance in Candida albicans. Fungal Genet Biol 48, 823-830, doi:10.1016/j.fgb.2011.04.005, 2011). Cka1 and Cka2 are the catalytic α-subunits of the protein kinase CK2, which are essential for the growth and reproduction of S. cerevisiae, and deletion of both kinases causes lethality (Padmanabha, R., Chen-Wu, JL, Hanna , DE & Glover, CV Isolation, sequencing, and disruption of the yeast CKA2 gene: casein kinase II is essential for viability in Saccharomyces cerevisiae. Mol Cell Biol 10, 4089-4099, 1990). Interestingly, C. neoformans has been shown to contain a single protein (CKA1) orthologous to both Cka1 and Cka2. Deletion of CKA1, although not essential, was found to severely affect growth in C. neoformans (Fig. 11c). In particular, the cka1Δ variant showed an elongated and deformed cell morphology (Fig. 11 d), which is comparable to the two kinase variants ( cbk1Δ and kic1Δ ) in the RAM pathway. Cbk1 and Kic1 are known to regulate cell polarity and morphology in C. neoformans, but their relevance to virulence is unknown (Walton, FJ, Heitman, J. & Idnurm, A. Conserved Elements of the RAM Signaling Pathway Establish Cell Polarity in the Basidiomycete Cryptococcus neoformans in a Divergent Fashion from Other Fungi. Mol. Biol. Cell, 2006). The present inventors found that cell polarity and morphology are related to virulence in C. neoformans.

Bud32 is also considered potentially essential for growth by participating in tRNA modification. Bud32 belongs to the piD261 family of atypical protein kinases conserved in bacteria, archaea and eukaryotes, and recognizes acidic substances unlike other eukaryotic protein kinases that recognize basic substances (Stocchetto, S., Marin, O. , Carignani, G. & Pinna, LA Biochemical evidence that Saccharomyces cerevisiae YGR262c gene, required for normal growth, encodes a novel Ser/Thr-specific protein kinase (FEBS Lett 414, 171-175, 1997). In S. cerevisiae, Bud32 is EKC (Endopeptidase-like and Kinase-associated to transcribed chromatin)/KEOPS (kinase, putative endopeptidase and other proteins of small size) It is a component of the kinase, putative endopetidase and other proteins of small size) complex. This complex is required for N-6-threonylcarbamoyladenosine (t6A) tRNA modification, which is important for maintaining codon-anticodon interactions for all tRNAs. Therefore, cells damaged in the EKC/KEOPS complex tend to have an increased rate of frameshift mutations and a lower growth rate (Srinivasan, M. et al. The highly conserved KEOPS/EKC complex is essential for a universal tRNA modification). , t6 A. EMBO J 30, 873-881, doi:10.1038/emboj.2010.343, 2011). As expected, these defects in tRNA modification have been shown to have dramatic effects on various biological aspects of C. neoformans, which in turn affect virulence. The bud32Δ mutant not only showed highly defective growth under both normal and most stress conditions (Fig. 12a), but also produced much lower amounts of capsule, melanin and urease (Fig. 12b). In addition, the bud32 mutant showed a major defect in sexual fertility (Fig. 12(c)). One exception was fluconazole resistance (FIG. 12 a). Interestingly, we confirmed that BUD32 deletion impaired ERG11 induction that occurs upon sterol deletion by fluconazole treatment (Fig. 12d), suggesting that Bud32 in C. neoformans is involved in ergosterol gene expression and sterol biosynthesis. suggests a potential role.

Kinases involved in nutrient metabolism are also involved in the pathogenicity of C. neoformans. In S. cerevisiae, Arg5,6p is synthesized as a single protein and then processed within the mitochondrial matrix into two separate enzymes, acetylglutamate kinase and N -acetyl-γ-glutamyl-phosphate reductase (Boonchird, C., Messenguy, F. & Dubois, E. Determination of amino acid sequences involved in the processing of the ARG5/ARG6 precursor in Saccharomyces cerevisiae. Eur J Biochem 199, 325-335, 1991). These enzymes catalyze ornithine biosynthesis, an intermediate in arginine biosynthesis. As supporting this, the inventors confirmed that the arg5,6pΔ mutant was arginine-auxotrophic (Fig. 13 a). In S. cerevisiae, MET3, which encodes the ATP sulfurylase, catalyzes the initial step of the sulfur assimilation pathway to produce hydrogen sulfide, a precursor for the biosynthesis of homocysteine, cysteine and methionine (Cherest, H., Nguyen, N. T. & Surdin-Kerjan, Y. Transcriptional regulation of the MET3 gene of Saccharomyces cerevisiae. Gene 34, 269-281, 1985; Ullrich, T. C., Blaesse, M. & Huber, R. Crystal structure of ATP sulfurylase from Saccharomyces cerevisiae, a key enzyme in sulfate activation. EMBO J 20, 316-329, doi:10.1093/emboj/20.3.316, 2001). Indeed, the met3Δ variant was found to be auxotrophic for both methionine and cysteine ( FIG. 13 b ). In particular, both arg5,6pΔ and met3Δ mutants did not show any growth defects in nutrient-rich medium (YPD), but showed severe growth defects under various stress conditions (FIG. 13 c), which indicates that arg5,6pΔ and met3 may be collectively responsible for the virulence defects observed in the △ variants.

Example 6: C. Retrograde vacuolar transport governs the pathogenicity of neoformans

A notable biological function not known to account for the pathogenicity of C. neoformans is retrograde vacuolar transport. In C. neoformans, it has been previously reported that the ESCRT complex-mediated unusual vacuolar sorting process is involved in the virulence process because several virulence factors, capsule and melanin, must be secreted extracellularly. (Godinho, RM et al. The vacuolar-sorting protein Snf7 is required for export of virulence determinants in members of the Cryptococcus neoformans complex. Scientific reports 4, 6198, doi:10.1038/srep06198, 2014; Hu, G. et al. Cryptococcus neoformans requires the ESCRT protein Vps23 for iron acquisition from heme, for capsule formation, and for virulence. Infect Immun 81, 292-302, doi:10.1128/IAI.01037-12, 2013). Nevertheless, the role of endosome-to-Golgi retrograde transport in the virulence of C. neoformans remains unknown. In the present invention, we found that deletion of CNAG_02680, which encodes the VPS15 ortholog involved in the vacuole sorting process, significantly reduced virulence (Fig. 14a). These results are consistent with the finding that mutations in VPS15 inhibit the virulence of C. albicans (Liu, Y. et al. Role of retrograde trafficking in stress response, host cell interactions, and virulence of Candida albicans. Eukaryot Cell 13, 279-287, doi:10.1128/EC.00295-13, 2014), strongly suggesting that the role of Vps15 in fungal virulence is evolutionarily conserved. In S. cerevisiae, Vps15 constitutes the vacuolar protein sorting complex (Vps15/30/34/38) that mediates endosomal-to-Golgi retrograde protein transport (Stack, JH, Horazdovsky, B. & Emr, SD). Receptor-mediated protein sorting to the vacuole in yeast: roles for a protein kinase, a lipid kinase and GTP-binding proteins.Annu Rev Cell Dev Biol 11, 1-33, doi:10.1146/annurev.cb.11.110195.000245, 1995 ).

To confirm the role of Vps15 in vacuolar sorting and retrograde protein transport, the vacuole morphology of the vps15Δ mutant was investigated compared to the wild-type strain. Similar to the vps15Δ null mutant of C. albicans, the C. neoformans vps15Δ mutant also showed a highly expanded vacuole (Fig. 14b). Defects in retrograde vacuolar transport are known to cause extracellular secretion of the ER-intrinsic chaperone protein, Kar2 (Liu, Y. et al. Role of retrograde trafficking in stress response, host cell interactions, and virulence of Candida albicans. Eukaryot Cell 13, 279-287, doi:10.1128/EC.00295-13 (2014)). As supporting this, the present inventors confirmed that the vps15Δ mutant is very sensitive to ER stress agents, such as dithiothreitol (DTT) and tunicamycin (TM) (Fig. 14 c ). The main reason for the greatly attenuated virulence of the vps15Δ mutant was their growth defect at 37 °C (Fig. 14(d)). This may be due to increased cell wall and cell membrane instability in the vps15Δ mutant. In C. albicans, impaired retrograde transport in the vps15Δ variant causes cell wall stress, which transcriptionally upregulates CRZ1, CHR1 and UTR2 to activate the calcineurin signaling pathway (Liu, Y. et al. Role of retrograde trafficking in stress response, host cell interactions, and virulence of Candida albicans.Eukaryot Cell 13, 279-287, doi:10.1128/EC.00295-13, 2014). However, in C. neoformans, we did not observe activation of the calcineurin pathway in these vps15Δ mutants (Fig. 14e). The expression levels of CRZ1, CHR1 and UTR2 in the vps15Δ mutant were comparable to those of the wild-type strain. In C. neoformans, cell wall integrity is also controlled by the unfolded protein response (UPR) pathway (Cheon, SA et al. Unique evolution of the UPR pathway with a novel bZIP transcription factor, Hxl1, for controlling pathogenicity of Cryptococcus neoformans PLoS Pathog.7, e1002177, doi:10.1371/journal.ppat.1002177 (2011)). In previous studies, the present inventors have shown that activation of the UPR pathway through Ire1 kinase results in unusual splicing in HXL1 mRNA, thereby inducing an ER stress response (Cheon, SA et al. Unique evolution of the UPR pathway with a novel bZIP transcription factor, Hxl1, for controlling pathogenicity of Cryptococcus neoformans. PLoS Pathog. 7, e1002177 (2011)). Indeed, we found that cells in which VPS15 was deleted contained more spliced HXL1 mRNA (HXL1s) than the wild-type strain under basal conditions, indicating that retrovacuoles in C. neoformans It suggests that the UPR pathway can be activated instead of the calcineurin pathway if transport is perturbed.

Example 7: C. Novel virulence and infectivity regulatory kinases involved in neoformans

Of the 60 pathogenicity-related kinases, 8 did not appear to have clear orthologs in the model yeast, and were therefore named virulence-regulating kinase (Vrk1) or infectivity-regulating kinase 1-7 (irk1-7). In particular, since deletion of Vrk1 (CNAG_06161) reduced the virulence of C. neoformans in an insect host model (FIG. 5) and attenuated infectivity in a mouse host model (FIG. 6), Vrk1 was noted (FIG. 15). . Its closest yeast ortholog is Fab1 (score: 140.9, e-value: 3.2E-34), but its closest Fab1 ortholog in C. neoformans is CNAG_01209 (score: 349.7, e-value: 0.0). . Interestingly, VRK1 deletion increases cellular resistance to hydrogen peroxide and capsule formation (Fig. 15 a and b). In addition, cell resistance to 5-flucytosine was increased and sensitivity to fludioxonil was increased (FIG. 15 a). Based on our kinase variant phenotypic clusters (Fig. 2), Vrk1 was not clearly grouped with other kinases. To further understand the regulatory mechanism of Vrk1, the present inventors performed comparative phosphoproteomics analysis on wild type and vrk1Δ to identify Vrk1-specific phospho-target proteins. TiO ₂ -enrichment based phosphoproteomics analysis revealed eight potential Vrk1 substrates: CNAG_04190 ( TOP1 , topoisomerase I), CNAG_01744 ( GPP2 , a DL-glycerol-3-phosphate phosphatase), CNAG_05661 (POB3 , heterodimeric FACT complex subunit), CNAG_01972, CNAG_07381, CNAG_00055, CNAG_02943 ( SLM1 , a phosphatidylinositol-4,5-bisphosphate binding protein), and CNAG_07878 ( NOC2 , nucleolus a nucleolar complex associated protein). CNAG_01972, 07381 and 00055 had no clear fungal orthologs. Although it is not clear whether the candidate proteins are directly or indirectly phosphorylated by Vrk1, we found that five candidate proteins (TOP1, GPP2, POB3, CNAG_01972 and CNAG_07381) were damaged in the vrk1Δ mutant (Fig. suggest that it can be directly phosphorylated by To further understand the Vrk1-dependent functional network, the present inventors searched for Vrk1-regulated target proteins and any proteins functionally linked to Vrk1 itself using CryptoNet, and were able to construct their functional networks. CNAG_01972 and 00055 did not have significant relevance to any known protein. Among the various potential biological functions associated with Vrk1 and its substrates, rRNA processing occurred most abundantly, suggesting that Vrk1 may be directly or indirectly involved in ribosome biogenesis and transport (Fig. 15d).

Example 8: C. Analysis of kinases involved in antifungal drug resistance in Neoformans

Based on the antifungal drug analysis of the kinase variant library, a total of 43, 38 and 42 kinases, respectively, were identified as antifungal drugs in clinical use: amphotericin B (a polyene), fluconazole (an azole) and Increased or decreased sensitivity to flucytosine (a nucleotide analog) was shown (Table 4). For kinases with deletions that increased sensitivity to these drugs, we identified 39 (for amphotericin B), 24 (for fluconazole), and 28 (for flucytosine) kinases. confirmed, and this could be developed as a target for concurrent treatment for each drug.

Kinases involved in antifungal drug resistance in Opomans Antifungal agents Kinase mutants showing
increased resistance Kinase mutants showing
increased susceptibility Polyene
(Amphotericin B) HRK1/NPH1, SPS1, SWE102 , TCO4 YPK1, VPS15, CBK1, HOG1, SSK2 , PBS2, ARG5,6, GAL83, SNF1, MKK2, MPK1, BUD32, CKA1, IPK1, IRE1, CDC7, KIC1, PKA1 , CRK1, BCK1 , TCO2, IRK5 , IGI1, GSK3, UTR1, MEC1, MET3, PAN3, MPS1 , PKH201, PIK1 , HRK1, KIC102 , ALK1, TLK1, ARK1, IRK3, KIN1, POS5 Azole
(Fluconazole) GAL83, PAN3 , ALK1, TCO1, STE11, TCO2, SCH9, SSK2 , PBS2, HOG1 , BUD32, PKA1 , CHK1, YAK1 YPK1, VPS15, CBK1, MKK2, MPK1, IPK1, IRE1, BCK1 , IGI1, GSK3, UTR1, PIK1 , HRK1/NPH1, CDC7 , HRK1, PSK201, MPK2 , RAD53, ARG5,6, KIC1, KIC102 , SPS1, IRK6 , MAK322 5-flucyotosine BCK1, PSK201, ARG5,6, GAL83 , TCO2, SNF1, IRK5 , PKH201, VRK1 , CKI1, TCO5, STE7, IGI1 , URK1 YPK1, VPS15, GSK3, UTR1 , HRK1/NPH1, SCH9, BUD32, CKA1, MEC1, FBP26, CBK1 , HOG1, IPK1, IRE1, SSK2, PBS2; MET3 , CDC7, KIC1, PAN3 , TCO1, PKA1 , CHK1, CRK1, MPS1, CDC2801, TCO6, BUB1

* Underlined kinases were first identified in the present invention.

Example 9: Growth and chemical susceptibility testing

To analyze the growth and chemosensitivity of the library of kinase variants, C. neoformans cells grown overnight at 30 °C were serially diluted 10-fold (from 0 to 10 ⁴ ) and spotted on YPD medium containing the following chemical reagents. were tested: 2 M sorbitol for osmotic stress and 1 to 1.5 M NaCl and KCl for cation/salt stress, under glucose-rich (YPD) or glucose-starved (dextrose-free YPD; YP) conditions; Hydrogen peroxide (H ₂ O ₂ ), tert-butyl hydroperoxide (tan organic peroxide), menadione (superoxide anion generator), diamide (thiol-specific oxidizing agent) for oxidative stress ; CdSO ₄ for toxic heavy metal stress; methyl methanesulfonate and hydroxyurea for genotoxic stress; sodium dodecyl sulfate (SDS) for membrane destabilizing stress; calcofluor-white and Congo red for cell wall destabilizing stress; tunicamycin and dithiothreitol (DTT) for ER stress and stress reduction; Fludioxonil, fluconazole, amphotericin B, flucytosine for antifungal drug susceptibility. Cells were cultured at 30° C. and photographed after 2 to 5 days of treatment. To test the growth rate of each variant at different temperatures, YPD plates on which serially diluted cells were spotted were incubated at 25 °C, 30 °C, 37 °C and 39 °C, and photographs were taken after 2-4 days.

Example 10: mating analysis

In order to analyze the mating phenotype of each kinase mutant, the MATα kinase mutant of Table 1 was co-cultured with the mating partner, serotype A MATa wild-type KN99a strain. Each kinase variant MATα strain and MATa WT KN99a strain (obtained from the laboratory of Joeseph Heitman, Duke University, USA) were cultured in YPD medium for 30 and 16 hours, pelleted, washed, and resuspended in distilled water. The resuspended α and a cells were mixed at the same concentration (10 ⁷ cells/ml), and 5 μl of them were spotted on V8 mating medium (pH 5). After culturing the mated plates at room temperature for 7 to 14 days in the dark, they were observed every week.

Example 11: In vitro virulence-factor production assay

As a virulence-factor assay, capsule, melanin and urease production were investigated for each kinase variant. Capsule formation was qualitatively analyzed by India ink staining (Bahn, YS, Hicks, JK, Giles, SS, Cox, GM & Heitman, J. Adenylyl cyclase-associated protein Aca1 regulates virulence and differentiation of Cryptococcus neoformans via the cyclic AMP-protein Kinase A cascade. Eukaryot. Cell 3, 1476-1491 (2004), Cryptocrit was quantitatively analyzed as follows: Each kinase variant was grown overnight at 30 ° C. in YPD medium, and DME (Dulbecco's Modified After spotting on Eagle's) solid medium, cultured for 2 days at 37° C. for capsule induction Cells were scraped off, washed with PBS, fixed with 10% formalin solution and washed again with PBS, respectively. For the variants of , the cell concentration was adjusted to 3 X 10 ⁸ cells/ml, and 50 μl of these were repeatedly injected 3 times into microhaematocrit capillaries (Kimble Chase), all capillaries vertically for 3 days. The packed cell volume ratio was determined by calculating the ratio of the length of the packed cell phase to the total phase (cell phase and liquid phase). Calculated by normalization to packed cell volume for Statistical differences in relative packed cell volume ratios were confirmed by one-way ANOVA analysis in Bonferroni correction using Prism 6 (GraphPad software).

To test melanogenesis, each kinase variant was grown overnight at 30 °C in YPD medium and 5 μl of each culture was spotted onto Niger seed medium containing 0.1% or 0.2% glucose. Negerseed plates were incubated at 37° C. and photographed after 3-4 days. For kinase variants showing growth defects at 37 °C, melanin and capsule formation were evaluated at 30 °C. To test urease production, each kinase variant was grown overnight at 30° C. in YPD medium, washed with distilled water, and then an equal number of cells (5×10 ⁴ ) were spotted on Christensen's agar medium. Plates were incubated at 30°C for 2-3 days and photographed.

Example 12: Insect-based in vivo virulence assay

For each C. neoformans strain tested, 15 Galleria mellonella larvae weighing 200 to 300 mg in the final instar larval stage were randomly selected as one group. These larvae used larvae that arrived within 7 days of transport (Vanderhorst Inc. St Marys, OH, USA). Each C. neoformans strain was grown overnight at 30° C. in YPD broth, washed three times and then resuspended in PBS at the same concentration (10 ⁶ cells/ml). A total of 4,000 C. neoformans cells per 4 μl volume of larvae were inoculated through the second to last anterior chamber using a 100 μl Hamilton syringe equipped with a 10 μl-sized needle and a continuous dispenser (PB600-1, Hamilton). . An equal volume (4 μl) of PBS was used as a non-infected control. Infected larvae were placed in a petri dish in a humidified chamber and observed daily while incubating at 37 °C. Larvae that did not show movement upon contact were considered dead. Larvae that pupated during the experiment were examined for statistical analysis. Survival curves were plotted using Prism 6 (GraphPad). The log-rank (Mantel-Cox) test was used for statistical analysis. Two independent variant strains were tested for each kinase variant. For kinase variants with a single strain, the experiment was repeated twice.

Example 13: Marker mutagenesis-based mouse infectivity assay

For a high-through murine infectivity assay, groups of kinase variants with NAT selection markers containing 45 different markers were pooled (4 groups in total). The ste50Δ and hxl1Δ mutants were used as virulent and non-virulent control strains, respectively (Cheon, SA et al. Unique evolution of the UPR pathway with a novel bZIP transcription factor, Hxl1, for controlling pathogenicity of Cryptococcus neoformans. PLoS Pathog. 7 , e1002177, doi:10.1371/journal.ppat.1002177 (2011), Jung, KW, Kim, SY, Okagaki, LH, Nielsen, K. & Bahn, YS Ste50 adapter protein governs sexual differentiation of Cryptococcus neoformans via the pheromone-response MAPK signaling pathway.Fungal Genet.Biol.48, 154-165, doi:S1087-1845(10)00191-X [pii]10.1016/j.fgb.2010.10.006 (2011)). The kinase variant libraries of each group were separated and grown in YPD medium at 30° C. for 16 hours, and washed three times with PBS buffer. The concentration of each variant was adjusted to 10 ⁷ cells/ml, and 50 μl of each sample was placed in a tube. For preparation of the input genomic DNA of each kinase variant pool, 200 μl of the variant pool was spread on a YPD plate, incubated at 30° C. for 2 days, and scraped off. For preparation of output genomic DNA samples, 7-week-old female A/J mice (Jackson Laboratory) were infected with 50 μl of the mutant pool (5×10 ⁵ cells per mouse) via intranasal inhalation. After 15 days of infection, infected lungs were obtained from mice sacrificed by Avertin overdose, homogenized in 4 ml PBS, spread on YPD plates containing 100 μg/ml chloramphenicol, and 30 ° C. were incubated for 2 days and then scraped off. Whole genomic DNA was extracted from input and production cells by the CTAB method (Jung, KW, Kim, SY, Okagaki, LH, Nielsen, K. & Bahn, YS Ste50 adapter protein governs sexual differentiation of Cryptococcus neoformans via the pheromone-response MAPK signaling pathway.Fungal Genet.Biol.48, 154-165, doi:S1087-1845(10)00191-X [pii]10.1016/j.fgb.2010.10.006 (2011)). Quantitative PCR was performed with the MyiQ2 real-time PCR detection system (BioRad) using the tag-specific primers listed in Tables 2 and 3. STM scores were calculated (Jung, KW et al. Systematic functional profiling of transcription factor networks in Cryptococcus neoformans. Nat Comms 6, 6757, doi:10.1038/ncomms7757 (2015)). To confirm the STM score, the relative change in the amount of genomic DNA was measured using the 2 ^- ΔΔCT method (Choi, J. et al. CFGP 2.0: a versatile web-based platform for supporting comparative and evolutionary genomics of fungi and Oomycetes. Nucleic Acids Res 41, D714-719, doi:10.1093/nar/gks1163 (2013)). The average fold change of the input versus production samples was calculated as a log score (Log ₂ 2 ^{-(Ct,Target - Ct,Actin)output - (Ct,Target - Ct,Actin)input} ).

Example 14: Vacuole staining

To visualize the vacuole morphology, the wild-type H99S strain and the vsp15Δ strains (YSB1500 and YSB1501) (obtained from the laboratory of Joeseph Heitman, Duke University, USA) were cultured in liquid YPD medium at 30°C for 16 hours. FM4-64 dye (Life Technologies) was added to each culture at a final concentration of 10 μM and incubated at 30° C. for 30 minutes. Cells were pelleted by centrifugation and resuspended in fresh liquid YPD medium, followed by further incubation at 30 °C for 30 minutes. Cells were pelleted again, washed three times with PBS buffer, and then resuspended in 1 ml of PBS. 10 ml of cells and 10 ml of mounting solution (Biomeda) were mixed and spotted on a slide glass. The slide glass was observed under a confocal microscope (Olympus BX51 microscope).

Example 15: TiO ₂ -Enrichment-based phosphoproteomics

To confirm the phosphorylated target of Vrk1 on a genomic scale, the H99S and vrk1Δ mutant strains were cultured in YPD broth at 30 °C for 16 hours, subcultured into 1 liter of fresh YPD broth, and 600 nm (OD ₆₀₀ ) and further incubated at 30 °C until reaching an OD of approximately 0.9. Each of the whole cell lysates was prepared with 50 mM Tris-Cl (pH 7.5), 1% sodium deoxycholate, 5 mM sodium pyrophosphate, 0.2 mM sodium orthovanadate, 50 mM Prepared with lysis buffer (Calbiochem) containing NaF, 0.1% SDS, 1% Triton X-100, 0.5 mM phenylmethylsulfonyl fluoride (PMSF) and 2.5x protease inhibitor cocktail solution (Merck Millipore) . The protein concentration of each cell lysate was measured using the Pierce BCA protein kit (Life Technology). Sulfhydryl bonds between cysteine residues in the protein lysate were reduced by incubating 10 mg of total protein lysate with 10 mM DTT for 1 hour at room temperature, followed by alkyl incubation with 50 mM iodoacetamide for 1 hour at room temperature in the dark. rated. These samples were re-treated with 40 mM DTT for 30 min at room temperature, then digested with trypsin (Sequencing grade trypsin, Promega) overnight at 37° C. at a substrate ratio of 1:50 (w/w). Next, the trypsin-digested protein lysate was purified using a Sep-Pak C18 column (Waters corporation, Milford, MA), and then lyophilized and stored at -80 °C. Phosphopeptides were incubated with TiO2MagSepharose beads (GE Healthcare) and lyophilized for LC-MS/MS analysis. Q Exactive Hybrid Dionex U 3000 RSLC nano HPLC system, equipped with a nano-electrospray ionization source, and a Quadrupole-Orbitrap mass spectrometer (Thermo Scientific, MA, USA) fitted with fused silica emitter tips (New Objective, Wobum, MA). Mass spectrometry was performed using All phosphopeptide samples were reconstituted in solution A (water/acetonitrile (98:2, v/v), 0.1% formic acid) and injected into the LC-nano ESI-MS/MS system. Samples were first trapped on an Acclaim PepMap 100 trap column (100 μm id x 2 cm, nanoViper C18, 5 μm particle size, 100 Å pore size, Thermo Scientific), 98% flow rate of 4 μl/min for 6 min. After washing with Solution A, separation was performed on an Acclaim PepMap 100 capillary column (75 μm id x 15 cm, nanoViper C18, 3 μm particle size, 100 Å pore size, Thermo Scientific) at a flow rate of 400 nl/min. Peptides were prepared in 2% to 35% solution B (water/acetonitrile (2:98, v/v), 0.1% formic acid) gradient for 90 min, 35% to 90% gradient. After 10 minutes of analysis, 90% for 5 minutes, and finally 5% for 15 minutes. The resulting peptide was electrosprayed with a coated silica tip (PicoTip emitter, New Objective, MA, USA) at an ion spray voltage of 2,000 eV. To assign peptides, MS/MS spectra were obtained from C. neoformans var. grubii H99 protein database (www.uniprot.org). The following search parameters were used: cysteine carbamidomethylation as fixed modification, methionine oxidation and serine/threonine/tyrosine phosphorylation as variable modification. Peptide identification was possible by two miss cleavages. Peptide identification was filtered with a 1% FDR cutoff. The relative excess of wild-type and mutant phosphopeptides was predicted by spectral counts. To evaluate differences between samples, Student's t-test was used.

Example 16: ER stress assay

To monitor ER stress-mediated UPR induction, H99S and vps15Δ mutant strains were cultured in YPD at 30 °C for 16 h, subcultured with fresh YPD broth, and then reached early exponential growth phase (OD600 = 0.6). It was further incubated at 30 °C until Cells were treated with 0.3 μg/ml tunicamycin (TM) for 1 hour. The cell pellet was immediately frozen in liquid nitrogen and lyophilized. Total RNAs were extracted with easy-BLUE (total RNA extraction kit, iNtRON Biotechnology), and cDNA was synthesized with MMLV reverse transcriptase (Invitrogen). The HXL1 splicing patterns (the UPR-induced spliced form of HXL1 [ HXL1S ] and the unspliced form of HXL1 [ HXL1U ]) were analyzed by PCR using cDNA samples of each strain and primers (B5251 and B5252). analyzed (Table 3).

Example 17: Expression analysis

For the expression analysis of ERG11 , the H99S strain and the bud32Δ mutant were cultured in YPD at 30 °C in liquid YPD medium for 16 hours, and then subcultured with fresh liquid YPD. When the cells reached the early logarithmic growth phase (OD ₆₀₀ = 0.6), the cultures were split into two samples: one treated with fluconazole (FCZ) for 90 min and the other untreated. Cell pellets were immediately frozen in liquid nitrogen and lyophilized. Total RNA was extracted, and Northern analysis was performed on each total RNA sample for each strain as previously reported (Jung, KW, Kim, SY, Okagaki, LH, Nielsen, K. & Bahn, YS Ste50 adapter protein governs sexual differentiation of Cryptococcus neoformans via the pheromone-response MAPK signaling pathway. Fungal Genet. Biol. 48, 154-165, doi:S1087-1845(10)00191-X [pii]10.1016/j.fgb.2010.10.006 ( 2011)). For quantitative reverse transcription-PCR (qRT-PCR) analysis of genes involved in the calcineurin pathway, the H99S strain and the vps15Δ mutant were cultured in liquid YPD at 30 °C for 16 hours and grown in fresh liquid YPD medium during the early logarithmic phase (OD ₆₀₀ = 0.8) was cultured for the second time. Next, the cells were pelleted by centrifugation, immediately frozen in liquid nitrogen, and lyophilized. After extracting total RNAs, cDNA was synthesized using RTase (Thermo Scientific). CNA1, CNB1, CRZ1, UTR2 and ACT1 -specific primer pairs (B7030 and B7031, B7032 and B7033, B7034 and B7035, B7036 and B7037, B679 and B680, respectively) (Table 3) were used for qRT-PCR.

Example 18: Construction of FPK1 overexpressing strain

To construct an FPK1 overexpressing strain, the FPK1 promoter was replaced with the histone H3 promoter using the amplified homologous recombination cassette (Fig. 4a). In the first round PCR, primer pair L1/ OEL2 for the 5'-flanking region of FPK1 and primer pair OER1/PO for the 5'-coding region of FPK1 were used. The NEO-H3 promoter was amplified with the primer pair B4017/B4018. P _H3 : For the 2nd round PCR of the 5' or 3' region of the FPK1 cassette, the 1st round result was overlaid by DJ-PCR with the primer pair L1/GSL or GSR/PO (primers in Tables 2 and 3). was made to wrap. Next, the PH3:FPK1 cassette was introduced into the wild-type strain H99S (obtained from the laboratory of Joeseph Heitman, Duke University, USA) and the ypk1Δ mutant strain (YSB1736) by biolistic transformation. Stable transformants were selected on YPD medium containing G418 and screened by diagnostic PCR using a primer pair (SO/B79). The correct genotype was confirmed by Southern blot using a specific probe amplified by PCR using primers L1/PO. Overexpression of FPK1 was confirmed by specific northern blot probes amplified by PCR using primers NP1 and PO (Fig. 4 b, c).

Example 19: Kinase phenome clustering

The in vitro phenotypic characteristics of each kinase variant were scored on the following quantitative criteria: -3 (strong susceptibility or defective), -2 (moderate susceptibility or defective), -1 (weak susceptibility or defective), 0 (wild type-like). , +1 (weak resistance or enhancement), +2 (medium resistance or enhancement), and +3 (strong resistance or enhancement). Excel files containing phenotypic scores for each variant were uploaded to Gene-E software (http://www.broadinstitute.org/cancer/software/GENE-E/), and kinase phenom clustering was performed using one minus Pearson correlation ( One minus Pearson correlation).

Example 20: Cryptococcus kinome web-database

For public access to the phenome and genome data of the C. neoformans kinase variant library constructed by the present inventors, a cryptococcus kinase database was developed (http://kinase.cryptococcus.org/). C. neoformans var. The genome sequence of grubii H99 was downloaded from the Broad Institute (https://www.broadinstitute.org/annotation/genome/cryptococcus_neoformans/MultiHome.html), and the Comparative Fungal Genomics Platform (CFGP) 2.0; http://cfgp.snu.ac.kr/) (Choi, J. et al. CFGP 2.0: a versatile web-based platform for supporting comparative and evolutionary genomics of fungi and Oomycetes Nucleic Acids Res 41, D714-719, doi:10.1093/nar/gks1163 (2013). Protein kinase classification was performed using the HMMER sequence profile of SUPERFAMILY (version 1.73) (Wilson, D. et al. SUPERFAMILY--sophisticated comparative genomics, data mining, visualization and phylogeny. Nucleic Acids Res 37, D380-386, doi :10.1093/nar/gkn762 (2009)). A total of 64 families belonging to 38 superfamilies were used for potential kinase prediction. Also, Kinomer (version 1.0) (Martin, DM, Miranda-Saavedra, D. & Barton, GJ Kinomer v. 1.0: a database of systematically classified eukaryotic protein kinases. Nucleic Acids Res 37, D244-250, doi:10.1093/nar /gkn834 (2009); Miranda-Saavedra, D. & Barton, GJ Classification and functional annotation of eukaryotic protein kinases. Proteins 68, 893-914, doi:10.1002/prot.21444 (2007) , N., Taylor, SS, Zhai, Y., Venter, JC & Manning, G. Structural and functional diversity of the microbial kinome. PLoS Biol 5, e17, doi:10.1371/journal.pbio.0050017 (2007)). was used to complement the kinase prediction. C. neoformans var. The information from grubii H99 and the genome annotation of the protein domains was adopted to find the maximum range of possible kinase-encoding genes. For each gene, results from eight bioinformatics programs were provided to provide clues to gene annotation. In addition, results from SUPERFAMILY, Kinomer and Microbial Kinome are presented to support the robustness of the predictions. The gene is C. neoformans var. For cases with orthologs in neoformans JEC21, a link to the KEGG database was also provided. Seoul National University Genome Browser (SNUGB; http://genomebrowser.snu.ac.kr/) (Jung, K. et al. SNUGB: a versatile genome browser supporting comparative and functional fungal genomics. BMC Genomics 9, 586, doi:10.1186/1471-2164-9-586 (2008) is provided in the Cryptococcus Kinase Phenome Database. In the Kinase Browser, a direct link to the SNUGB module is provided for each gene. The Cryptococcus kinase phenom database is provided with MySQL 5.0.81 (source code distribution) for database management and PHP 5.2.6 for web interface. The web-based user interface is provided through an Apache 2.2.9 web server.

Korea Center for Microbial Conservation (KCCM) KCCM51297 20151106

Claims (3)

An antifungal agent screening method comprising the following steps:
(a) Contacting a sample to be analyzed with Cryptococcus neoformans containing IRK4, YAK1, MEC1, VPS15 or VRK1 as a temperature-dependent pathogenicity-regulating serine/threonine protein kinase step of doing;
(b) measuring the amount or activity of the protein; and
(c) determining that the sample is an antifungal agent when it is determined that the amount or activity of the protein is down-regulated.
An antifungal agent screening method comprising the following steps:
(a) contacting the sample to be analyzed with Cryptococcus neoformans containing a gene encoding IRK4, YAK1, MEC1, VPS15 or VRK1 as a temperature-dependent pathogenicity-regulating serine/threonine protein kinase;
(b) measuring the expression level of the gene; and
(c) determining that the sample is an antifungal agent when it is determined that the expression level of the gene is down-regulated.
The antifungal agent screening method according to claim 1 or 2, wherein the antifungal agent is for treating meningoencephalitis or cryptococcosis.

Images