WO2006059125A2

WO2006059125A2 - Tumour suppressor genes

Info

Publication number: WO2006059125A2
Application number: PCT/GB2005/004630
Authority: WO
Inventors: Michael Sharrad
Original assignee: Procure Therapeutics Limited
Priority date: 2004-12-04
Filing date: 2005-12-02
Publication date: 2006-06-08
Also published as: GB0426701D0; WO2006059125A3

Abstract

We describe a screening method for agents modulating the activity of protein kinase b that utilises cell-lines comprising mutations in selected tumour suppressor genes pten and ship2 and diagnostic tests for cancer based on said genes.

Description

Tumour suppressor genes

The invention relates to a screening method that utilises cell-lines comprising mutations in selected tumour suppressor genes.

Tumour suppressor genes encode proteins that function to inhibit cell growth or division and are therefore important with respect to maintaining proliferation, growth and differentiation of normal cells. Mutations in tumour suppressor genes result in abnormal cell-cycle progression whereby the normal cell-cycle check points which arrest the cell-cycle, when, for example, DNA is damaged, are ignored and damaged cells divide uncontrollably. Tumour suppressor proteins function in all parts of the cell (e.g. cell surface, cytoplasm, nucleus) to prevent the passage of damaged cells through the cell- cycle (i.e. Gl, S, G2, M and cytokinesis). The PTEN tumour- suppressor gene is frequently inactivated in a wide variety of tumour types; it is characteristically lost in late-stage tumours and has been associated with the development of invasiveness and metastatic capacity. The PTEN gene product is a multiple-specificity phosphatase that can antagonise phosphoinositide lipid kinases (hereinafter PBK) by degrading phosphoinositde (PI) (3,4,5) P3 back to PI(4,5)P2 in addition to its ability to dephosphorylate a range of protein targets such as focal adhesion kinase (FAK).

Phosphoinositides have been implicated in a variety of cellular processes as diverse as vacuolar protein sorting, cytoskeletal remodelling and mediating intracellular signalling events through which growth factors, hormones and neurotransmitters exert their physiological effects on cellular activity, proliferation and differentiation.

A family of proteins has been cloned and characterised and shown to be enzymes catalysing the addition of phosphate to inositol. Eukaryotic cells contain a variety of inositol derivatives phosphorylated to different extents. PI (3) P is constitutively present in eukaryotic cells. PI (3,4) P₂ and PI (3,4,5) P₃ are virtually absent in resting cells but are rapidly induced upon stimulation with a variety of ligands. PB kinases are classified into three distinct groups being designated to an individual class by their in vitro substrate specificity, biochemical characteristics and, in examples where a definitive function has been assigned, the nature of the biochemical activity regulated by the specific kinase.

PI3 kinase class 1 polypeptides have a broad spectrum activity, phosphorylating inositol lipids, PI (4) P and PI (4, 5) P₂. Class I kinases are subdivided into Class IA and IB. Class IA polypeptides include pl lOα, pl lOβ and pl lOδ which interact physically with the adaptor sub-unit protein p85. Moreover, pi 10a and pi lOβ have a broad distribution in terms of expression pattern. pl lOδ expression seems to be restricted to white blood cells. Class IB includes pl lOγ which functions independently of p85.

Class π PD kinases have a restricted substrate specificity phosphorylating PI and PI (4) P but not PI (4,5) P₂. Each of the kinases of this class is characterised by a conserved C2 domain in the carboxyl terminal region of the protein. The presence of conserved motifs within the C2 domain indicates that this region may confer regulation via calcium and/or phospholipid. A comparison of the murine and Drosophila class II kinases mpl70 and PI3K_68D respectively reveals a high degree of homology in the kinase domain of these proteins. Significant divergence occurs at the amino terminal regions of these polypeptides suggesting that adaptor proteins interacting with these variable domains may regulate kinase activity. Class II PB kinases do not interact with p85.

Class EU PB kinase is related to the S.cerevisiae gene Vps34. This kinase was originally isolated as a gene involved in regulating vesicle mediated membrane- trafficking in yeast. The human homologue of Vps34 is complexed with a ser/thr kinase called Vpsl5p. Of the three classes of PB kinase this has the most restricted substrate specificity being strictly limited to PI. Many reports have implicated loss of PTEN activity as causal in the constitutive activation of phosphate kinase B (PKB) in tumour cells. However, more recently a second group of enzymes, the SHIP (SH2-containing inositolphosphatase) family, has been identified as being potentially important in regulating PKB through degradation of PI(3,4,5)P3 to PI(3,4)P2. Although SHIPl expression is largely confined to the haematopoietic system and sSHIP to stem cells, SHIP2 appears to be ubiquitously expressed and may act as an alternative or additional mechanism for antagonising PI3K both in the presence and the absence of PTEN.

Loss of PTEN has been widely implicated in the progression to metastasis of prostate cancer, with approximately 50% of late-stage prostate tumours showing inactivation of the gene. In a first description of PTEN, two of the model cell lines for metastatic prostate disease, LNCaP and PC3, were shown to lack expression of PTEN. LNCaP has a defective gene that has a two-base pair deletion in codon 6, while PC3 cells have a deletion at the 3' end of the gene (Li et al, 1997; Sharrard and Maitland, 2000).

We disclose that both PTEN and SHIP2 play a part in regulating the PI3K-PKB pathway in prostatic epithelial cell lines and that the widely-used models for PTEN- null metastatic prostate cancer LNCaP and PC3 show important differences in their mechanisms for maintaining high activation levels of PKB.

According to an aspect of the invention there is provided a screening method for the detection of agents that modulate the activity of protein kinase B comprising, providing: a) a first cell preparation comprising cells that express a first nucleic acid molecule that encodes a polypeptide as represented by the nucleic acid sequence in Figure 7, or a nucleic acid molecule that hybridizes under stringent hybridisation conditions to the sequence in Figure 7, wherein said polypeptide is a phosphatase and a second nucleic acid molecule that encodes a polypeptide, as represented by the nucleic acid sequence in Figure 8, or a nucleic acid molecule that hybridizes under stringent hybridisation conditions to the sequence in Figure 8, wherein said polypeptide is a second phosphatase; b) a second cell preparation wherein said cells express said first nucleic acid molecule but have reduced expression of said second nucleic acid molecule; c) a third cell preparation wherein said cells have reduced expression of said first nucleic acid molecule and express said second nucleic acid molecule; and d) a forth cell preparation wherein said cells have reduced expression of both said first and second nucleic acid molecules;

i) contacting the cell preparations in (a), (b), (c) and (d) with an agent to be tested; ii) determining the activity of said agent with respect to the activity of protein kinase B in each of (a), (b), (c) and (d).

hi a preferred method of the invention said screening method includes the steps of: collating the activity data in (ii) above; converting the collated data into a data analysable form; and optionally providing an output for the analysed data.

hi a preferred method of the invention said cells do not express a detectable first phosphatase.

In an alternative preferred method of the invention said cells do not express a detectable second phosphatase.

Hybridization of a nucleic acid molecule occurs when two complementary nucleic acid molecules undergo an amount of hydrogen bonding to each other. The stringency of hybridization can vary according to the environmental conditions surrounding the nucleic acids, the nature of the hybridization method, and the composition and length of the nucleic acid molecules used. Calculations regarding hybridization conditions required for attaining particular degrees of stringency are discussed in Sambrook et al., Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 2001); and Tijssen, Laboratory Techniques in Biochemistry and Molecular Biology — Hybridization with Nucleic Acid Probes Part I, Chapter 2 (Elsevier, New York, 1993). The T_m is the temperature at which 50% of a given strand of a nucleic acid molecule is hybridized to its complementary strand. The following is an exemplary set of hybridization conditions and is not limiting:

Very High Stringency (allows sequences that share at least 90% identity to hybridize) Hybridization: 5x SSC at 65°C for 16 hours Wash twice: 2x SSC at room temperature (RT) for 15 minutes each

Wash twice: 0.5x SSC at 65°C for 20 minutes each

High Stringency (allows sequences that share at least 80% identity to hybridize) Hybridization: 5x-6x SSC at 65°C-70°C for 16-20 hours Wash twice: 2x SSC at RT for 5-20 minutes each

Wash twice: Ix SSC at 55°C-70°C for 30 minutes each

Low Stringency (allows sequences that share at least 50% identity to hybridize) Hybridization: 6x SSC at RT to 55⁰C for 16-20 hours Wash at least twice: 2x-3x SSC at RT to 55°C for 20-30 minutes each.

In a yet further preferred method of the invention said polypeptides are represented by the amino acid sequences as shown in Figures 9 or 10, or a variant polypeptide wherein said variant polypeptide is modified by addition, deletion or substitution of at least one amino acid residue which varies with respect to the amino acid sequences shown in Figure 9 or 10. Preferably said variant polypeptide retains the activity of said polypeptide or has enhanced activity.

A variant polypeptide may differ in amino acid sequence by one or more substitutions, additions, deletions, truncations which may be present in any combination. Among preferred variants are those that vary from a reference polypeptide by conservative amino acid substitutions. Such substitutions are those that substitute a given amino acid by another amino acid of like characteristics. The following non-limiting list of amino acids are considered conservative replacements (similar): a) alanine, serine, and threonine; b) glutamic acid and asparatic acid; c) asparagine and glutamine d) arginine and lysine; e) isoleucine, leucine, methionine and valine and f) phenylalanine, tyrosine and tryptophan.

In addition, the invention features polypeptide sequences having at least 75% identity with the polypeptide sequences as hereindisclosed, or fragments and functionally equivalent polypeptides thereof. In one embodiment, the polypeptides have at least 85% identity, more preferably at least 90% identity, even more preferably at least 95% identity, still more preferably at least 97% identity, and most preferably at least 99% identity with the amino acid sequence illustrated herein.

In a preferred method of the invention said cells are tumour cells. Preferably said tumour cells are metastatic tumour cells.

hi a preferred method of the invention said tumour cells are prostate tumour cells, preferably prostate epithelial cells.

In a further preferred method of the invention said cells are transfected with a further nucleic acid molecule wherein said nucleic acid molecule encodes a reporter molecule.

Reporter molecules are well known in the art and are a means by which the activity of a polypeptide can be indirectly monitored. For example, green fluorescent protein (GFP). Fluorescent proteins can be used to measure activity in a cell without the need for lysing the cell. Fluorescence emission spectrum shifted derivatives of GFP may ^• include blue fluorescent protein (BFP) and yellow fluorescent protein (YFP). Other derivatives include enhanced cyan yellow protein (ECYP), EYFP, EGFP. An advantage of using GFP, or derivatives thereof, is that two or more reporter proteins expressed in the same cell can be assayed using the same assay technique e.g. assaying for a particular fluorescence emission. Alternatively, the detectable marker is an enzyme, for example, glucuronidase, luciferase. Other reporter proteins may include lac Z, and CAT. Protein molecules may also be detected via antibody detection, for example the use of proteins that are "tagged" with an epitope that is recognised by an antibody, typically a monoclonal antibody.

A number of methods are known which image fluorescent cells and extract information concerning the spatial and temporal changes occurring in cells expressing fluorescent proteins, (see Taylor et al Am. Scientist 80: 322-335, 1992), which is incorporated by reference. Moreover, US5, 989,835 and US09/031,271, both of which are incorporated by reference, disclose optical systems for determining the distribution or activity of fluorescent reporter molecules in cells for screening large numbers of agents for biological activity. The systems disclosed in the above patents also describe a computerised method for processing, storing and displaying the data generated.

In a preferred method of the invention said agent is an antagonist.

In a preferred method of the invention said antagonist is a molecule that directly inhibits the activity of protein kinase B.

In an alternative preferred method of the invention said antagonist is a molecule that directly inhibits the activity of phosphatidylinositol-dependent kinase 1.

In a further alternative preferred method of the invention said antagonist is a molecule that directly inhibits the activity of a phosphatidylinositol 3-kinase.

In a preferred method of the invention said phosphatidylinositol 3-kinase is a Class I phosphatidylinositol 3-kinase. In a further preferred method of the invention said phosphatidylinositol 3-kinase is a Class II phosphatidylinositol 3-kinase.

In a yet further preferred method of the invention said phosphatidylinositol 3-kinase is a Class IE phosphatidylinositol 3-kinase.

According to a further aspect of the invention there is provided an assay device comprising: a) a first cell preparation comprising cells that express a first nucleic acid molecule that encodes a polypeptide as represented by the nucleic acid sequence in

Figure 7, or a nucleic acid molecule that hybridizes under stringent hybridisation conditions to the sequence in Figure 7, wherein said polypeptide is a phosphatase and a second nucleic acid molecule that encodes a polypeptide, as represented by the nucleic acid sequence in Figure 8, or a nucleic acid molecule that hybridizes under stringent hybridisation conditions to the sequence in Figure 8, wherein said polypeptide is a second phosphatase; b) a second cell preparation wherein said cells express said first nucleic acid molecule but have reduced expression of said second nucleic acid molecule; c) a third cell preparation wherein said cells have reduced expression of said first nucleic acid molecule and express said second nucleic acid molecule; and d) a fourth cell preparation wherein said cells have reduced expression of both said first and second nucleic acid molecules.

The screening of large numbers of agents requires preparing arrays of cells for the handling of cells and the administration of agents. Assay devices, for example and not by way of limitation, include standard multiwell microtitre plates with formats such as 6, 12, 48, 96 and 384 wells which are typically used for compatibility with automated loading and robotic handling systems. Typically high throughput screens use homogeneous mixtures of agents with an indicator compound which is either converted or modified resulting in the production of a signal. The signal is measured by suitable means (for example detection of fluorescence emission, optical density, or radioactivity) followed by integration of the signals from each well containing the cells, agent and indicator compound.

hi a preferred embodiment of the invention said cells are transfected with a nucleic acid molecule that encodes a reporter molecule.

In a further preferred embodiment of the invention said cells are tumour cells. Preferably said cells are metastatic tumour cells.

In a preferred embodiment of the invention said cells are prostate cells; preferably said cells are prostate epithelial cells.

According to a further aspect of the invention there is provided a diagnostic test to diagnose cancer in a subject by determining the expression of both PTEN and SHIP2 in a biological sample comprising the steps of: i) providing an isolated biological sample comprising cells/tissue to be tested; ii) detecting the presence, or not, of first and second nucleic acid molecules that encode different phosphatase enzymes as represented by the nucleic acid sequence in Figure 7 and Figure 8, or nucleic acid molecules that hybridizes under stringent hybridisation conditions to the sequence in Figure 7 and Figure 8; iii) determining the expression levels of both nucleic acid molecules in (ii) above and comparing the expression levels to matched normal controls.

In a preferred method of the invention said detection is by a polymerase chain reaction.

hi a preferred method of the invention said cell/tissue sample comprises prostate cells/tissue. According to a yet further aspect of the invention there is provided a diagnostic test to diagnose cancer in a subject by determining the presence of both PTEN and SHIP2 in a biological sample comprising the steps of: i) providing an isolated biological sample comprising cells/tissue to be tested; ii) detecting the presence, or not, of first and second polypeptides as represented by the amino acid sequence in Figure 9 or 10, or variant first and second polypeptides; and iii) determining the presence or not of first and second polypeptides and comparing the presence of the polypeptides to matched normal controls.

In a preferred method of the invention the detection of first and second polypeptides is by antibody detection.

As used herein, the term "cancer" refers to cells having the capacity for autonomous growth, i.e., an abnormal state or condition characterized by rapidly proliferating cell growth. The term is meant to include all types of cancerous growths or oncogenic processes, metastatic tissues or malignantly transformed cells, tissues, or organs, irrespective of histopathologic type or stage of invasiveness. The term "cancer" includes malignancies of the various organ systems, such as those affecting, for example, lung, breast, thyroid, lymphoid, gastrointestinal, and genito-urinary tract, as well as adenocarcinomas which include malignancies such as most colon cancers, renal-cell carcinoma, prostate cancer and/or testicular tumours, non-small cell carcinoma of the lung, cancer of the small intestine and cancer of the esophagus. The term "carcinoma" is art recognized and refers to malignancies of epithelial or endocrine tissues including respiratory system carcinomas, gastrointestinal system carcinomas, genitourinary system carcinomas, testicular carcinomas, breast carcinomas, prostatic carcinomas, endocrine system carcinomas, and melanomas. Exemplary carcinomas include those forming from tissue of the cervix, lung, prostate, breast, head and neck, colon and ovary. The term "carcinoma" also includes carcinosarcomas, e.g., which include malignant tumours composed of carcinomatous and sarcomatous tissues. An "adenocarcinoma" refers to a carcinoma derived from glandular tissue or in which the tumor cells form recognizable glandular structures. The term "sarcoma" is art recognized and refers to malignant tumors of mesenchymal derivation.

hi a preferred method of the invention said cell/tissue sample comprises prostate cells/tissue.

The singular forms "a," "an," and "the" refer to one or more than one, unless the context clearly dictates otherwise. For example, the term "comprising a nucleic acid molecule" includes single or plural nucleic acids and is considered equivalent to the phrase "comprising at least one nucleic acid molecule." The term "or" refers to a single element of stated alternative elements or a combination of two or more elements, unless the context clearly indicates otherwise. As used herein, "comprises" means "includes." Thus, "comprising A or B," means "including A, B, or A and B," without excluding additional elements.

An embodiment of the invention will now be described by example only and with reference to the following Figures:

Figure 1: PKB phosphorylation at ser473 in five prostate cell lines in response to PI3K inhibition or GF withdrawal and replacement. Cells were treated as follows: maintained continuously in medium plus serum/GFs (see Experimental Procedures) (lane 1); treated with DMSO vehicle only for 3 hours (lane 2) or with lOμM LY294002 (PI3K inhibitor) for 15 minutes (lane 3), 1 hour (lane 4) or 3 hours (lane 5); incubated overnight in medium without serum or GFs, and then harvested immediately (lane 6) or at 15 min (Lane 7), 1 hour (Lane 8), or 3 hours (lane 9) after refeeding with medium plus serum/GFs. Analysis was by Western blotting and probing for PKB phosphorylated at ser473. The results shown are typical of at least three independent experiments; Figure 2 Kinetics of dephosphorylation of PKB and GSK3α following inhibition of PI3K. Cells were grown in medium containing serum/GFs. Triplicate wells were treated for 0, 2, 5, 10, 15 or 20 minutes with lOμM LY294002 before harvesting and analysis by SDS-polyacrylamide gel electrophoresis, Western blotting, and probing for ser473-phosphorylated PKB and for ser21-phosphorylated GSK3α. The blots were then stripped and reprobed for total PKB protein. The band intensities were quantified (see Experimental Procedures) and the ratio of ser473-phosphorylated PKB (A) and ser21-phosphorylated GSK3α (B) to total PKB for each lane was determined and expressed as a percentage of the ratio at time = 0. The mean and s.d. (n=3) for each time point are shown;

Figure 3 Loss of PI (3, 4, 5) P3 from the cell membrane following inhibition of PI3K. Cells transfected with GRPlPH (ΔNLS)-EGFP expression plasmid were examined by confocal microscopy. For each cell line, a complete Z-series of a field showing representative cells was captured and used to create a three-dimensional projection to demonstrate the overall distribution of signal in the different cell types (labelled '3D'). Individual transfected cells from each line were then observed before (0') and at the indicated times (in minutes) after addition of lOμM LY294002 to the medium. EGFP fluorescence at the cell surface indicates the presence of PIP3. A complete Z- series of images was acquired at each time point to ensure that alterations in the intensity of membrane-associated fluorescence were not due to changes in the shape of the cells or redistribution of the signal to restricted areas within the plane of the membrane. Li each case the image at the centre of the Z-series is shown. The results are typical of at least three independent experiments, a, PNT2. b, PNTIa. c, P4E6. d, LNCaP; note the persistence of membrane-associated signal for between 60 and 90 minutes (arrowheads) and an area of relocation of signal within the plane of the membrane (0-30 minutes) before loss of signal from the cell surface between 30 and 90 minutes (thin arrows), e, PC3; note the accumulation of signal at the ruffled membranes (arrowed) seen in the 3D projection of the PC3 cell; Figure 4: Kinetics of rephosphorylation of PKB after removal of the PI3K inhibitor LY294002. Cells from each line were plated into 24-wells at 10⁵ cells per well and treated with lOμM LY294002 in serum-free medium for 165 minutes. The cells were then placed in medium containing serum and lOμM LY294002 and the incubation continued for a further 15 minutes. Three wells of each cell line were then harvested immediately and three were washed twice with medium plus serum without LY294002 before being incubated in drug-free medium for five minutes followed by harvesting. Analysis of PKB phosphorylation at ser473 was by Western blotting and densitometry as before. Values for levels of phosphorylated PKB/ 10⁵ cells for the five cell lines (mean +/- s.d., n = 3) before (-) or five minutes after (+) LY294002 washout were calculated relative to the quantity found in PNT2 cells after washout of the drug;

Figure 5: Expression of SHIPl, SHIP2 and PTEN in prostate cell lines, a, Western blotting for the expression of SHIPl. The first lane contains an extract of THPl cells as a positive control for detection of SHIPl. b, Western blotting for expression of

SHIP2 in the five prostate cell lines, c, Western blotting for PTEN expression.

Samples are the same as in b. d, RT-PCR for the core sequence of SHIP '2 (bases

430-1090 of the open reading frame). The lane at the right contains a DNA ladder, demonstrating that the major PCR product has the expected size of 660 bp. The sizes of protein molecular weight markers are as indicated to the right of panels a, b and c.

Figure 6: Effects of siRNA-mediated knockdown of expression of PTEN and SHIP2 on the rate of loss of PKB phosphorylation following PI3K inhibition. Cells were mock-transfected or transfected with SmartPool siRNA directed against PTEN, SHIP2 or both molecules as described in Experimental Procedures. After 72 hours, the cells were treated for 5 minutes with either lOμM LY294002 or an equivalent amount of vehicle (DMSO) control. The cells were then harvested, analysed by Western blotting, and probed sequentially for ser473 -phosphorylated PKB, PTEN, SHIP2, and pan-cytokeratin. For each cell line, the results of probing the Western blots for PTEN and for SHIP2 are shown in the panels at the upper left. Band intensities for phosphorylated PKB and cytokeratin were quantified as described in Experimental Procedures. The ratio of ser473-phosphorylated PKB to cytokeratin (S473/CK) for each lane was calculated and normalised against the S473/CK ratio for mock-transfected cells treated with DMSO to give the values for 'relative PKB ser473 phosphorylation' shown in histogram a for each cell line. Then, for each siRNA treatment (mock, PTEN, SHIP2, and PTEN + SHIP2), the ratio of S473/CK after treatment with LY294002 to S473/CK after treatment with DMSO was calculated to obtain the 'PKB ser473 phosphorylation ratio (+LY294002/control)' shown in histogram b for each cell line. The results shown are typical of at least three independent experiments.

Figure 7 is the nucleic acid sequence of PTEN;

Figure 8 is the nucleic acid sequence of SHIP 2;

Figure 9 is the amino acid sequence of PTEN; and

Figure 10 is the amino acid sequence of SHIP 2.

EXPERIMENTAL PROCEDURES

Cell lines - PNTIa and PNT2 (22,23) are non-tumorigenic epithelial cell lines derived by SV40 immortalisation of normal prostate epithelial outgrowths. P4E6 is a cell line derived from an early stage carcinoma of prostate by immortalisation with the E6 gene of human papillomavirus 16 (24). LNCaP and PC3 are established prostatic carcinoma cell lines with androgen dependent and androgen independent phenotypes respectively, obtained from American Type Culture Collection. PNTIa, PNT2, P4E6 and LNCaP cells were grown in RPMI1640 containing 2 mM glutamine, 1OmM HEPES and 10% foetal calf serum (FCS). PC3 cells were grown in Ham's F12 medium containing 2 mM glutamine and 7% FCS.

Reagents and expression constructs - LY294002 was obtained from Calbiochem and prepared as a stock solution of 20 mM in dimethylsulfoxide (DMSO). The plasmid GRP1PH(ΔNLS)EGFP, which encodes the pleckstrin homology (PH) domain of GRPl (with the nuclear localisation signal deleted) fused to Enhanced Green Fluorescent Protein (EGFP), was a generous gift of Professor Peter Downes, University of Dundee.

Western blotting - Cells grown in 24-well plates were harvested by scraping into 200 μl buffer containing 1% SDS, 1% dithiothreitol, 62.5 itiM tris HCl pH 6.8, 10% glycerol, 0.1 M sodium fluoride, 10 mM sodium pyrophosphate and 1 mM sodium orthovanadate. The samples were heated to 100°C for 5 min, analysed by SDS-polyacrylamide gel electrophoresis, and blotted to PVDF membranes (Roche Diagnostics). The membranes were equilibrated in TBST (50 mM tris-HCl pH 7.5 - 150 mM NaCl - 0.05% w/v Tween 20), incubated in Blocking Solution (1% w/v Roche BM Blocking Reagent in TBST) for 60 min, then shaken overnight in primary antibody diluted in Blocking Solution. Rabbit anti-Akt, rabbit anti-phospho-Akt (ser473), rabbit anti-phospho-GSK3α/β (ser21/9) and rabbit anti-PTEN were obtained from Cell Signaling Technology and used at 1 : 5000. Goat anti-SHIP2 (120) was obtained from Santa Cruz and used at 1 :2000. Mouse anti-pan-cytokeratin was obtained from Sigma and used at 1:100,000. After 4 x 5 min washes in TBST, the membranes were incubated for 60 minutes in Blocking Solution containing 1:5000 anti-rabbit IgG-peroxidase, 1:5000 anti-mouse IgG-peroxidase, or 1:20,000 anti-goat IgG -peroxidase (all from Sigma) as appropriate. The blots were washed 4 x 5 min in TBST and detected by chemiluminescence (BM chemiluminescence substrate, Roche Diagnostics) using pre-flashed Hyperfilm ECL (Amersham Biosciences). The images were scanned using a Hewlett Packard ScanJet 5370C and quantified using NIH image software.

Polymerase chain reaction (PCR) - 8 ng of DNA from each cell line was amplified in 20μl reaction mixture containing 200 μM dNTPs, 1.5 mM MgCl2, 0.7 μM of each primer, 1 x Expand buffer and 1 unit of Expand High Fidelity DNA polymerase (Roche). The primers used were ACCTGTT AAGTTTGT ATGC AAC (PTEN exon 5 fwd) and TCCAGGAAGAGGAAAGGAAA (PJEN exon 5 rev). Amplification was carried out in a Perkin-Elmer 2400 thermal cycler according to the protocol: 2 min at 94⁰C; 35 cycles of 20 sec 94°C, 15 sec at 58°C and 75 sec + 2 sec/cycle at 72°C; 5 min at 72°C. PCR products were analysed by agarose gel electrophoresis in the presence of ethidium bromide.

Reverse transcriptase-PCR (RT-PCR) - 5 μg of total RNA from each cell line was primed with 0.25 μg oligo(dT) 12-15 (Life Technologies) and reverse-transcribed to cDNA in a 20μl reaction containing 5OmM tris HCl pH 8.3, 75 mM KCl, 3 mM MgCl2, 1OmM dithiothreitol, ImM dNTPs and 100 units Superscript II reverse transcriptase (InVitrogen), incubated at 45°C for 120 min. Equal volumes of each of the cDNA preparations were PCR-amplified as above using the primers 5'- CGCTCTGGCTCCACCAGCATT-3' (SHIP2 fwd) and 5'-

TGCGGTCGTGCGTGAAGGTGG-3' {SHIP2 rev). This primer pair amplifies the core sequence (bases 430-1090) of the SHIP2 open reading frame. In order to confirm the quality of RNA used and to test the efficiency of the cDNA synthesis reactions, equal volumes of each of the cDNA preparations were also PCR-amplified for 16 cycles using the primers 5'-AAGGTGAAGGTCGGAGTCAA-3^l and 5'- GGACACGGAAGGCCATGCCA-3', which amplify a 700 bp product from the cDNA of the GAPDH gene. Gel analysis confirmed that equal amounts of GAPDH product were amplified from all cDNAs.

3'-RACEfor alternatively-spliced PTEN transcripts - lOμg of RNA from PC3 cells was primed with 0.5 μg Ll -dT primer (5'-GAC TCG AGT CGA CAT CGA _{τττ τττ τττ τττ TTT 3}^ _{and reV}e_rse-transcribed using Superscript π as described above. The cDNA from this step was PCR-amplified for 35 cycles as above using Ll primer (5'-GAC TCG AGT CGA CAT CGA-3¹) and a primer from within exon 1 (5'-GAG GAT GGA TTC GAC TTA GA-3¹), exon 2 (5'-CCA AAC ATT ATT GCT ATG GGA-3') or exon 5 (5'-ACA AGA GGC CCT AGA TTT CT- 3') of PTEN. The products were cloned into pGEM T-easy (Promega) and the inserts sequenced from the flanking T7 and SP6 primer sites. Transfection of cells - 5 x 10^ cells of each line were plated into each well of an 8-well tissue culture slide with a glass coverslip base. After adhesion, the cells were transfected with 0.5 μg/well of GRPl PH(ANLS)EGFP. Transfection was carried out using Fugene 6 (Roche Diagnostics) according to the manufacturer's instructions.

Confocal microscopy of transfected cells - 24-48 hours after the start of transfection, the cells were observed using a Zeiss LSM 510 meta inverting confocal microscope fitted with a stage-mounted tissue culture chamber maintained at 37°C with a humidified atmosphere of 5% CO₂ - 95% air. After initial equilibration, images of EGFP-expressing cells were captured using the argon laser and a detection filter at 512 nm. The medium was then removed from individual wells and replaced with CO₂-equlibrated, pre- warmed medium containing lOμM LY294002. Further images were captured at timed intervals after addition of the drug.

Small inhibitory RNA (siRNA) treatment of cells - Knockdown of expression of PTEN and SHIP2 (INPPLl) was achieved using SmartPool siRNAs (Dharmacon). Cells were plated into 48-wells at 10⁵ per well and allowed to adhere. The cells were washed with serum- free medium, then 125 μl serum- free medium containing 1 μl of Oligofectamine (InVitrogen) mixed with 25 pmol of PTEN-directed siRNA, 25 pmol of SHIP2-directed siRNA, or 25 pmol of each siRNA was added to each well. Mock-transfected cells received Oligofectamine only. The cells were placed in a tissue culture incubator for 4 hours, then 1 ml of medium containing serum/GFs was added and the cells returned to the incubator for a further 68 hours. The cells were then treated for 5 minutes with medium containing either lOμM LY294002 or an equivalent amount of vehicle (DMSO) control before harvesting and analysis by Western blotting as described above. EXAMPLES

Sensitivity of prostatic epithelial cell lines to serum deprivation and PI3K inhibition The cell lines PNT2 and PNTIa were derived from non-tumour prostate epithelium and P4E6 was derived from an early prostate tumour; these cells express wild-type PTEN (19). The prostate tumour cell lines LNCaP (derived from a metastasis to lymph node) and PC3 (from a metastasis to bone) lack expression of wild-type PTEN (18, 19). When grown in medium containing serum, all of these cells showed detectable levels of activation of PKB as evidenced by phosphorylation of this protein at ser473 (Fig. 1, lane 1). Serum deprivation resulted in a complete loss of PKB phosphorylation at ser473 in PNT2, PNTIa and P4E6; in contrast, PC3 cells showed only partial loss of PKB phosphorylation in the absence of serum, and LNCaP were unaffected (Fig. 1, lane 6). Refeeding with 10% FCS resulted in rapid rephosphorylation of PKB (Fig. 1, lanes 7-9). Treatment with the PI3K inhibitor LY294002 (lOμM) revealed clear differences between the cell lines. In PNT2, PNTIa, P4E6 and PC3, treatment with LY294002 for 15 minutes resulted in almost complete dephosphorylation of PKB at ser473, while a similar level of PKB dephosphorylation was achieved in LNCaP cells only after three hours (Fig. 1, lanes 3-5). While complete dephosphorylation of PKB in the presence of LY294002 was maintained for three hours in P4E6 and PC3 cells, a low level of PKB rephosphorylation over this time period was observed in PNT2 and PNTIa cells. This phenomenon has been shown to result from the induction or activation of a form of PI3K that has a higher IC₅₀ for LY294002².

We investigated the time-course of PKB dephosphorylation in the five cell lines in response to PI3K inhibition by lOμM LY294002 (i.e. in the absence of synthesis of PI(3,4,5)P3 from PI(4,5)P2). PNT2, PNTIa and P4E6 showed rapid loss of PKB phosphorylation following exposure to the drug (Ti_/2 < 2 minutes) while the response of LNCaP cells was considerably slower (Ti_/2 > 20 minutes)(Fig. 2A). This is consistent with LNCaP harbouring a defective mechanism for degrading PIP3, as suggested by the results in Fig. 1. In PC3 cells, however, the rate of PKB dephosphorylation in the presence of LY294002 (T₁Z₂ = 3 min) was only slightly slower than that in the PTEN-positive PNT2 and P4E6 cells (Fig. 2A). Assay of the phosphorylation status of the PKB substrate GSK3α showed that decrease of GSK3 phosphorylation closely followed loss of PKB phosphorylation for all five cell lines, indicating that loss of PKB phosphorylation was reflected in loss of its catalytic activity (Fig. 2B).

Kinetics of loss of PIP3 from the plasma membrane in response to LY294002

The slow kinetics of dephosphorylation of PKB in LY294002-treated LNCaP cells could be due to slow degradation of PIP3 or could result from a low activity of protein phosphatases that remove phosphate groups from ser473 of PKB in these cells. We therefore investigated whether the loss of PKB phosphorylation paralleled loss of PIP3 in cells treated with LY294002. Cells were transfected with a plasmid encoding the PH domain of GRPl fused to EGFP. The GRPl PH domain shows high specificity of binding for PIP3 and this construct is thus a useful tool for tracking the location of PIP3 in live cells (25). Confocal microscopy of transfected cells showed an accumulation of EGFP at the plasma membrane, indicating the presence of PIP3 (Fig. 3). Reconstruction of three-dimensional images of cells from Z-series stacks showed strong EGFP signal at areas of cell-cell contact in PNT2, PNTIa, P4E6 and LNCaP cells, but in PC3 cells the highest concentration of signal was in areas of motility-associated ruffled membrane and was independent of cell contact. Cells were treated with lOμM LY294002 and monitored for redistribution of EGFP. In PNT2, PNTIa, P4E6 and PC3 cells (Fig. 3 a-c and e), EGFP signal was clearly depleted from the membrane within 5 minutes of treatment with lOμM LY294002, indicating rapid loss of PIP3. However, in LNCaP cells a similar degree of loss was only achieved after 90 minutes (Fig. 3d), consistent with much slower kinetics of loss of membrane PIP3 after PI3K inhibition in these cells. For each time- point, a Z-series of the entire cell under examination was captured to ensure that the signal was indeed lost from the plasma membrane rather than redistributed within the plane of the membrane. The results indicate that the kinetics of loss of PKB phosphorylation in response to LY294002 treatment parallel the loss of PIP3 from the plasma membrane and that the slow decrease in PKB phosphorylation in LNCaP cells is a result of slow PIP3 degradation rather than lack of protein phosphatases in this cell line.

Levels of PI3 K activity in the prostate cell lines

The slower kinetics of loss of PEP3 in LY294002-treated LNCaP cells compared to the other cell lines might result from low levels of enzymes that degrade PIP3 or from higher rates of PIP3 synthesis in LNCaP cells. We tested the five cell lines for the rate at which PKB was rephosphorylated after treatment with LY294002 and its washout (Fig. 4). We found that the differences in PKB rephosphorylation rates between the cell lines were relatively small, with the highest rate (in PNTIa) being only 1.66 times the lowest (PNT2); LNCaP cells showed a rate intermediate between these (1.29 time the rate of PNT2). We conclude from these results that the slow rate of loss of PIP3 in LY294002-treated LNCaP is not due to higher rates of PIP3 synthesis in these cells.

PC3 cells contain exons 1 and 2 of PTEN but not the phosphatase domain in exon

5

As shown in Fig. 2, PC3 cells possess a mechanism for degrading PIP3 that is almost as efficient as that in the PTEN-expressing PNT2 and P4E6 cells. We have previously shown that PC3 cells contain exon 1 , but not exon 9, of PTEN and that human cells can express two alternatively-spliced forms of PTEN, designated PTEN- Δ and PTEN-B, which contain the phosphatase site encoded by exon 5 but do not require exon 9 (26). PC3 cells might thus express a cryptic form of PTEN activity encoded by the partially-deleted PTEN gene. When we carried out 3'-RACE analysis of PC3 RNA using primers from exon 1, exon 2 and exon 5, the 3'-RACE downstream of exon 1 showed that PC3 cells express a sequence that contains exons 1 and 2 of PTEN fused to material encoded by DNA from chromosome 1 (results not shown). No clones could be derived by 3'-RACE using an upstream primer from exon 5, and genomic PCR for exon 5 using intron-directed primers failed to detect this exon in PC3, whereas positive results were obtained from PNT2, PNTIa, P4E6 and LNCaP cells. We thus conclude that PC3 cells do not express an active phosphatase derived from residual segments of the PTEN gene.

Expression of SHIPl, SHIP2 and PTEN in prostate cell lines

We next investigated whether one or more of the PIP3 -degrading SHIP enzymes, which convert PI(3,4,5)P3 to PI(3,4)P2, might contribute to the inactivation of PKB following inhibition of PI3K in the prostate cell lines. SHIPl protein was not detectable by Western blotting in any of the prostate cell lines, although it is clearly detected in the positive control cell line THPl (Fig. 5a). In contrast, Western blotting for SHEP2 showed that the 160 kD SHIP2 protein is expressed in PNTIa, P4E6 and PC3 cells, but not in PNT2 or LNCaP cells (Fig. 5b). We also confirmed that PTEN protein expression was detectable in PNT2, PNTIa and P4E6 cells but not LNCaP or

PC3 cells (Fig. 5c). Interestingly, RT-PCR for the core sequence of SHIP2 demonstrated its expression as mRNA in all five cell lines (Fig. 5d), suggesting either that the coding sequence of the expressed mRNA is defective or that expression is subject to stringent translational control in PNT2 and LNCaP.

Effects of siRNA-mediated knockdown of expression of PTEN and SHIP2

We next used siRNA directed against PTEN or against SHIP2 to knock down the endogenous expression of these proteins, either singly or together (Fig. 6). Western blot analysis of mock-transfected and siRNA-transfected cells after 72 hours demonstrated the effectiveness of this treatment (Fig. 6, inset panels). Densitometry of the blots showed that the average knockdown of PTEN expression was 88.4% in

PNT2, 96.3% in PNTIa and 89.6% in P4E6; the average knockdown of SHIP2 expression was 92.5% in PNTIa, 85.2% in P4E6 and 85.9% in PC3. The effects of PTEN and SHIP2 expression knockdown upon the extent of dephosphorylation of PKB ser473 in response to a 5-minute treatment with lOμM LY294002 were measured by Western blot analysis and probing for ser473- phosphorylated PKB. To account for variations in growth between cells exposed to the different siRNA treatments over 72 hours, the blots were also probed for cytokeratin, which we have found to be a reliable indicator of cell number in all the cell lines used in these experiments, and the values for the ratio of phosphorylated PKB to cytokeratin were calculated for each sample.

hi PNT2, PNTIa and P4E6 cells, knockdown of PTEN resulted in an increase in the level of PKB phosphorylation before treatment with LY294002 (Fig. 6, histograms Aa, Ba and Ca). This represents a steady state level influenced by the rate of both synthesis and degradation of PIP3, so the result demonstrates that PTEN is acting as a negative regulator of PKB activation in these cells. The extent of the effect of PTEN knockdown on the steady-state level of PKB phosphorylation varies between these three lines in the rank order PNT2 > PNTIa > P4E6, which reflects their relative expression levels of PTEN (see Fig. 4c). In these cell lines, PTEN knockdown also results in increased amounts of ser473-phosphorylated PKB remaining after five minutes of PI3K inhibition with LY294002 compared to LY294002-treated mock- transfected cells. However, the proportion of PKB remaining phosphorylated after LY294002 treatment of PTEN-depleted cells is still quite low (Fig. 6, histograms Ab, Bb and Cb: 12% in PNT2, 20% in PNTIa, 52% in P4E6), indicating that these cells still retain the capacity to degrade PIP3 rapidly under conditions of reduced PTEN expression. In contrast, treatment of LNCaP and PC3 cells with siRNA directed against PTEN showed little effect upon either the steady-state level of PKB phosphorylation or the rate of dephosphorylation in the presence of LY294002 (Fig. 6 D and E), providing further evidence that PTEN is not involved in PKB regulation in these cells.

SiRNA treatment directed against SHIP2 expression showed different effects on PKB phosphorylation between the cell lines, hi PNT2, siRNA against SHEP2 alone resulted in a decrease in the steady-state level of PKB phosphorylation (resulting in an anomalously high ratio of phosphorylated PKB in LY294002-treated cells relative to controls in histogram Ab); on the other hand, SHIP2-directed siRNA did not affect steady-state levels of PKB or rates of LY294002-induced PKB dephosphorylation when PTEN expression was also inhibited. PNT2 cells may express a modified form of SHIP2 (see Fig. 5), not detected by the antibody used in our Western blots, that has little or no PIP3-degrading activity but which interferes with the action of PTEN.

hi PNTIa cells, knockdown of SHIP2 alone had little effect on the steady-state or LY294002-inhibited levels of PKB phosphorylation; however, the rate of loss of PKB phosphorylation in the presence of LY294002 was slower when both proteins were inhibited compared to when only PTEN was knocked down, suggesting that SHDP2 may partially substitute for PTEN in its absence in these cells. A third pattern was seen in P4E6 cells; here knockdown of SHIP2 alone reduced PKB phosphorylation and increased its rate of loss on treatment with LY294002, but also had the same effect on PTEN-reduced cells (i.e. when both siRNAs were used, compared to PTEN siRNA alone). This indicates a negative effect of SHIP2 on PIP3 degradation that may operate via other proteins than PTEN.

SiRNA against SHIP2 appeared to have a small effect on LNCaP cells (Fig. 6 D), raising the possibility that these cells also express a modified, undetected form of the protein with low-level PIP3 -degrading activity; however, SHIP2 siRNA treatment did not enhance PKB dephosphorylation when LNCaP were treated with LY294002. In contrast, knockdown of SHIP2 in PC3 cells not only doubled the steady-state levels of PKB phosphorylation but dramatically reduced the extent of PKB dephosphorylation after five minutes exposure to LY294002 from 89% to 34% (Fig. 6 E). These results indicate that SHIP2 can substitute for absent PTEN in the regulation of PKB phosphorylation in PC3 cells, though it cannot do so in LNCaP cells due to lack of expression. Despite efficient suppression of PTEN and (in PNTIa and P4E6) SHIP2 expression by dual siRNA treatment, PNTIa cells still lost 63%, P4E6 cells lost 66% and PNT2 lost 90% of their PKB phosphorylation within five minutes of PDK inhibition by LY294002. In contrast, LNCaP cells lost only 4%, and PC3 cells 34%, of their PKB phosphorylation under parallel conditions (Fig. 6). Although the residual levels of PTEN and SHIP2 after knockdown will undoubtedly continue to participate in PIP3 degradation, the results suggest that PTEN and SHIP2 may not be the only enzymes which antagonise PI3K in the regulation of PKB in the cell lines PNT2, PNTIa and P4E6.

The cell lines LNCaP and PC3 have been extensively used as model systems of metastatic prostate cancer and as examples of PTEN-null cells. Indeed, it is often assumed that PKB in these cell lines is constitutively activated as a result of PTEN abrogation and concomitant effects of deregulated synthesis of PIP3. In this paper we show clear differences between LNCaP and PC3 cells in terms of their regulation of the PI3K/PKB pathway. While LNCaP cells show a genuine reduction in ability to degrade PIP3 compared to PTEN-expressing prostatic lines, SHIP2 activity in PC3 cells at least partially compensates for the absence of PTEN, resulting in the potential for regulated rather than constitutive PKB activation in these cells. The identification of SHIP2 as a regulator of the PI3K-PKB pathway in PC3 cells calls for a reassessment of this cell line as a model for PTEN-null prostate cancer. It is well established that the mechanisms that activate this pathway upstream of PI3K differ between LNCaP and PC3 (21,27). The present report further underlines the need to consider these two widely-used model cell lines for metastatic prostate cancer as separate, and very different, examples of the disruption of signalling pathways regulating proliferation and survival that may accompany loss of the PTEN gene.

In the PTEN-positive prostate cell lines investigated, SHIP2 appears to play a minor role in regulating PI3K activation of PKB when cells are maintained in the continuous presence of serum. This is consistent with the findings of Blero et al (28), who showed that SHIP2 regulates PIP3 levels and PKB phosphorylation in mouse embryonic fibroblasts only after short-term (5-10 minutes) stimulation with serum. They suggested that SHIP2 might only be able to degrade PIP3 while PTEN is inactivated by serum-induced reactive oxygen species in these cells. In the PTEN- positive prostatic epithelial cells studied here, siRNA-mediated knockdown of PTEN was not compensated to any great extent by SHIP2, suggesting that activation of additional factors, possibly controlling recruitment of SHTP2 to the plasma membrane (14), may be required for SHIP2 to replace PTEN as the main PIP3- degrading enzyme. However, we also found evidence that a third activity, possibly but not necessarily also a PIP3 -degrading phosphatase, shares the ability to downregulate PKB when PI3K is inhibited. This is especially clear in PNT2 cells, which lack expression of SHIP2. These cells lose almost 90% of their PKB phosphorylation after five minutes of PI3K inhibition even when PTEN expression is reduced to less than 12% of its normal level in these cells (compare the much smaller loss of PKB phosphorylation in PI3K-inhibited LNCaP cells). If multiple PTEN-like activities can degrade PIP3 in epithelial cells, SHIP2 may have limited opportunities to be the predominant regulator of the PI3K-PKB pathway in these cells. In PC3 cells, both PTEN and the putative additional PIP3 -degrading enzyme(s) may have been lost, leaving SHIP2 as the major antagonist to PI3K, while LNCaP must have lost all three PIP3 -degrading activities.

The identity of the additional enzyme(s) is not yet known, although various candidates exist amongst known PTEN-like phosphatases, including TPIP (29), PTEN2 (30), PLlP (31), and SKIP (32). The expression of these proteins shows restricted tissue distribution and functional analysis, indicating that they are unlikely to represent widespread functional homologues of PTEN (7). The recently-described PTEN homologue Cl-TEN has also been shown to downregulate PKB through its phosphatase activity (33).

What physiological role may SHIP2 play in prostatic epithelial cells? Sasaoka et al (14) showed that, in adipocytes, SHIP2 is important in the regulation of the PKB isoform Akt2, while PTEN is associated with regulation of Aktl. If this mechanism were to operate in prostatic cells, we would expect increased levels of phosphorylated Akt2 in cells that lack SHIP2 or when SHIP2 expression is suppressed by siRNA. However, although all five cell lines used in this study express Akt2, only Aktl (clearly resolved from Akt2 in our Western blotting system³) showed detectable levels of ser473 phosphorylation throughout the study.

Targeting of SHIP2 to the plasma membrane is required for its efficient negative regulation of PKB (14). Translocation to the membrane may be mediated through interaction with She or c-Cbl (34,35); SHIP2 also associates with fϊlamin and pl30Cas and regulates actin-based cytoskeletal activity (36,37). Indeed, SHIP2 has recently been reported to modulate hepatocyte growth factor-mediated lamellopodium formation, cell scattering and cell spreading through direct interaction with the c-Met protein (38). Thus the role of SHIP2 may be as a mediator of both the PI3K-PKB signalling pathway and of cell motility, and may function as an interface between these cellular processes. It will thus be of interest to determine whether SHIP2 has an enhanced role in the regulation of cell motility in PC3 cells, and if so whether it does so via interactions with one or more of the proteins mentioned above. Further work will also be required to elucidate the role of SHIP2 and the factors involved in its regulation in normal and diseased prostate tissue, and to investigate whether experimental alterations of She or c-Cbl expression and activity affect the capability of SHEP2 to regulate the PI3K/PKB pathway.

PTEN is also known to act as an interface between the PI3K signalling pathways and cell motility. Significantly, neither LNCaP nor PC3 cells survive long-term reintroduction of PTEN expression (19). Davies et al (20) demonstrated that PTEN induced growth inhibition but only moderately increased apoptosis in LNCaP cells. We found that PTEN re-expression in LNCaP and PC3 induced changes in motility, adhesion and spreading, leading to loss of cells from culture initially through detachment from the growth surface, with apoptosis (where it occurred) being a secondary event (19). These findings indicate a major effect of re-expressed PTEN in these cells on cytoskeletal functions, possibly involving both the protein and the lipid phosphatase activities of PTEN as well as structural functions residing in its C- terminal segment or its tensin homology domain. The data in the present paper suggest that loss of PTEN may have less effect on the PBK-PKB pathway than originally proposed (8) if the cells maintain alternative mechanisms for degradation of PIP3. Conversely, changes in the regulation of adhesion and motility which cells such as LNCaP and PC3 have acquired to compensate for the absence of PTEN protein-phosphatase activity (or protein- plus lipid-phosphatase activity) may be responsible for the inability of these cells to tolerate reintroduction of PTEN (discussed in 19).

The role of multiple or redundant pathways for the degradation of PIP3 must be considered in assessing the role of PTEN loss in deregulating pathways downstream of PI3K in tumorigenesis. Different enzymes that share this function with PTEN may link regulation of the PI3K-PKB pathway with other cellular functions, in the same way that PTEN may act to integrate this pathway with cytoskeletal activity, motility, and cell adhesion. Alterations in the activity of the different PIP3-degrading enzymes would then result in different cellular phenotypes combined with altered kinetics of PKB activation. These differences could profoundly affect the course of tumour progression. Analysis of the pattern of PIP3 -regulating enzymes, in combination with mapping of pathways regulated by PIP3 availability, in individual tumours would thus supply valuable information for disease prognosis and provide a basis for improved design and selective administration of therapeutic agents.

REFERENCES

l. Brader, S., and Eccles, S. A. (2004) Tumori 90, 2-8

2. Parsons, R. (2004) Seminars CellDev. Biol. 15, 171-176

3. Alessi, D. R., Andjelkovic, M., Caudwell, B., Cron, P., Morrice, N., Cohen, P. and Hemmings, B.A. (1996) EMBOJ. 15, 6541-6551

4. Feng, J., Park, J., Cron, P., Hess, D., and Hemmings, B. A. (2004) J. Biol. Chem. 279, 41189-41196 5. Lawlor, M. A., and Alessi, D. R. (2001) J. Cell ScL 114, 2903-2910

6. Suzuki, H., Freije, D., Nusskern, D. R., Okami, K., Cairns, P., Sidransky, D., Isaacs, W. B., and Bova, G. S. (1998) Cancer Res. 58, 204-209

7. Leslie, N. R., and Downes, C. P. (2004) Biochem. J. 382, 1-11 8. Maehama, T., and Dixon, J. E. (1998) J. Biol. Chem. 273, 13375-13378

9. Zhang, L. N., Yu, Q., He, J. Y., and Zha, X. L. (2004) MoI. Cell. Biochem. 262, 25- 33

10. Drayer, A. L., Pesesse, X., DeSmedt, F., Woscholski, R., Parker, P., and Erneux, C. (1996) Biochem. Biophys. Res. Comm. 225, 243-249 11. Pesesse, X., Deleu, S., DeSmedt, F., Drayer, L., and Erneux, C. (1997) Biochem.

Biophys. Res. Comm. 239, 697-700

12. Muraille, E., Pesesse, X., Kuntz, C, and Erneux, C. (1999) Biochem. J. 342, 697- 705

13. Sly, L. M., Rauh, M. J., Kalesnikoff, J., Buchse, T., and Krystal, G. (2003) Exp. Hematol. 31, 1170-1181

14. Sasaoka, T., Wada, T., Fukui, K., Murakami, S., Ishihara, H., Suzuki, R., Tobe, K., Kadowaki, T., and Kobayashi, M. (2004) J. Biol. Chem. 279, 14835-14843

15. McMenamin, M. E., Soung, P., Perera, S., Kaplan, I., Loda, M., and Sellers, W. R. (1999) Cancer Res. 59, 4291-4296 16. Porkka, K. P., and Visakorpi, T. (2004) Eur. Urol. 45, 683-691

17. Kwabi-Addo, B., Giri, D., Schmidt, K., Podsypanina, K., Parsons, R., Greenberg, N., and lttmann, M. (2001) Proc. Natl. Acad. ScL U.S.A. 98, 11563-11568

18. Li, J., Yen, C, Liaw, D., Podsypanina, K., Bose, S., Wang, S. L, Puc, J., Miliaresis, C, Rodgers, L., McCombie, R., Bigner, S. H., Giovanella, B. C, Ittmann, M., Tycko, B., Hibshoosh, H., Wigler, M. H., and Parsons, R. (1997) Science 275, 1943-1947

19. Sharrard, R. M., and Maitland, N. J. (2000) Br. J. Cancer 83, 1102-1109

20. Davies, M. A., Koul, D., Dhesi, H., Berman, R., McDonnell, T. J., McConkey, D., Yung, W. K. A., and Steck, P. A. (1999) Cancer Res. 59, 2551-2556

21. Rochester, M. A., Riedemann, J., Hellawell, G. O., Brewster, S. F., and Macaulay, V. M. (2005) Cancer Gene Therapy 12, 90-100

22. Cussenot, O., Berthon, P., Faille, A., Berger, R., Mowszowicz, I., Teillac, P., LeDuc, A., and Calvo, F. (1991) J. Urol. 143, 881-886

23. Berthon, P., Cussenot,O., Hopwood, L., Le Due, A., and Maitland, N. J. (1995) Int. J. Oncol. 6, 333-343 24. Maitland, N. J., Macintosh, C. A., Hall, J., Sharrard, M., Quinn, G., and Lang, S. (2001) Radiation Res. 155, 133-142

25. Gray, A., Van der Kaay, J., and Downes, C. P. (1999) Biochem. J. 344, 929-936

26. Sharrard, R. M., and Maitland, N. J. (2000). Biochim. Biophys. Acta - Gene Struct. Expr. 1494, 282-285

27. Zheng, D. Q., Woodard, A. S., Tallini, G., and Languino, L. R. (2000) J. Biol. Chem. 275, 24565-24574

28. Blero, D., Zhang, J., Pesesse, X., Payrastre, B., Dumont, J. E., Schurmans, S., and Erneux, C. (2005) FEBSJ. 272, 2512-2522 29. Walker, S. M., Downes, C. P., and Leslie, N. R. (2001) Biochem. J. 360, 277-283

30. Wu, Y., Dowbenko, D., Pisabarro, M. T., Dillard-Telm, L., Koeppen, H., and Lasky, L. A. (2001) J. Biol. Chem. 276, 21745-21753

31. Pagliarini, D. J., Worby, C. A., and Dixon, J. E. (2004) J. Biol. Chem. 279, 38590- 38596 32. Ijuin, T., and Takenawa, T. (2003) MoI. Cell. Biol. 23, 1209-1220

33. Hafizi, S., Ibraimi, F., and Dahlback, B. (2005) FASEB J. 19, NIL433-NIL451

34. Ishihara, H., Sasaoka, T., Ishiki, M., Wada, T., Hori, H., Kagawa, S., and Kobayashi, M. (2002) MoI. Endocrinol. 16, 2371-2381

35. Vandenbroere, I., Paternotte, N., Dumont, J. E., Erneux, C, and Pirson, I. (2003) Biochem. Biophys. Res. Comm. 300, 494-500

36. Dyson, J. M., O'Malley, C.J., Becanovic, J., Munday, A. D., Berndt, M. C, Coghill, I. D., Nandurkar, H. H., Ooms, L. M., and Mitchell, C. A. (2001) /. Cell Biol. 155, 1065-1079

37. Prasad, N. K., and Decker, S. J. (2005) J. Biol. Chem. 280, 13129-13136 38. Koch, A., Mancini, A., El Bounkari, O., and Tamura, T. (2005) Oncogene 24,

3436-3447

Claims

1. A screening method for the detection of agents that modulate the activity of protein kinase B comprising, providing: a) a first cell preparation comprising cells that express a first nucleic acid molecule that encodes a polypeptide as represented by the nucleic acid sequence in Figure 7, or a nucleic acid molecule that hybridizes under stringent hybridisation conditions to the sequence in Figure 7, wherein said polypeptide is a phosphatase and a second nucleic acid molecule that encodes a polypeptide, as represented by the nucleic acid sequence in Figure 8, or a nucleic acid molecule that hybridizes under stringent hybridisation conditions to the sequence in Figure 8, wherein said polypeptide is a second phosphatase; b) a second cell preparation wherein said cells express said first nucleic acid molecule but have reduced expression of said second nucleic acid molecule; c) a third cell preparation wherein said cells have reduced expression of said first nucleic acid molecule and express said second nucleic acid molecule; and d) a forth cell preparation wherein said cells have reduced expression of both said first and second nucleic acid molecules; i) contacting the cell preparations in (a), (b), (c) and (d) with an agent to be tested; ii) determining the activity of said agent with respect to the activity of protein kinase B in each of (a), (b), (c) and (d).

2. A method according to Claim 1 wherein said screening method includes the steps of: collating the activity data in (ii); converting the collated data into a data analysable form; and optionally providing an output for the analysed data

3. A method according to Claim 1 or 2 wherein said cells are tumour cells.

4. A method according to Claim 3 wherein said tumour cells are metastatic tumour cells.

5. A method according to Claims 3 or 4 wherein said tumour cells are prostate tumour cells.

6. A method according to Claim 5 wherein said prostate tumour cells are prostate epithelial cells.

7. A method according to any of Claims 1-6 wherein said cells are transfected with a further nucleic acid molecule wherein said nucleic acid molecule encodes a reporter molecule.

8. A method according to Claim 7 wherein said reporter molecule is green fluorescent protein.

9. A method according to any of Claims 1-8 wherein said agent is an antagonist that directly inhibits the activity of protein kinase B.

10. A method according to any of Claims 1-8 wherein said agent is an antagonist that directly inhibits the activity of phosphatidylinositol-dependent kinase 1.

11. A method according to any of Claims 1-8 wherein said agent is an antagonist that directly inhibits the activity of a phosphatidylinositol 3-kinase.

12. A method according to Claim 11 wherein said phosphatidylinositol 3-kinase is a Class I phosphatidylinositol 3-kinase.

13. A method according to Claim 11 wherein said phosphatidylinositol 3-kinase is a Class II phosphatidylinositol 3-kinase.

14. A method according to Claim 11 wherein said phosphatidylinositol 3-kinase is a Class in phosphatidylinositol 3-kinase.

15. An assay device comprising: a) a first cell preparation comprising cells that express a first nucleic acid molecule that encodes a polypeptide as represented by the nucleic acid sequence in Figure 7, or a nucleic acid molecule that hybridizes under stringent hybridisation conditions to the sequence in Figure 7, wherein said polypeptide is a phosphatase and a second nucleic acid molecule that encodes a polypeptide, as represented by the nucleic acid sequence in Figure 8, or a nucleic acid molecule that hybridizes under stringent hybridisation conditions to the sequence in Figure 8, wherein said polypeptide is a second phosphatase; b) a second cell preparation wherein said cells express said first nucleic acid molecule but have reduced expression of said second nucleic acid molecule; c) a third cell preparation wherein said cells have reduced expression of said first nucleic acid molecule and express said second nucleic acid molecule; and d) a forth cell preparation wherein said cells have reduced expression of both said first and second nucleic acid molecules.

16. A device according to Claim 15 wherein said cells are transfected with a nucleic acid molecule that encodes a reporter molecule.

17. A device according to Claim 15 or 16 wherein said cells are tumour cells.

18. A device according to Claim 17 wherein said cells are metastatic tumour cells.

19. A device according to any of Claims 15-18 wherein said cells are prostate cells.

20. A device according to Claim 19 wherein said cells are prostate epithelial cells.

21. A diagnostic test to determine the expression of both PTEN and SHIP2 in a biological sample comprising the steps of: i) providing an isolated biological sample comprising cells/tissue to be tested; ii) detecting the presence, or not, of first and second nucleic acid molecules that encode different phosphatase enzymes as represented by the nucleic acid sequence in Figure 7 and Figure 8, or nucleic acid molecules that hybridizes under stringent hybridisation conditions to the sequence in Figure 7 and Figure 8; iii) determining the expression levels of both nucleic acid molecules in

(ii) above.

22. A test according to Claim 21 wherein said detection is by a polymerase chain reaction.

23. A test according to Claim 21 or 22 wherein said cell/tissue sample comprises prostate cells/tissue.

24. A diagnostic test to determine the presence of both PTEN and SH1P2 in a biological sample comprising the steps of: i) providing an isolated biological sample comprising cells/tissue to be tested; ii) detecting the presence, or not, of first and second polypeptides as represented by the amino acid sequence in Figure 9 or 10, or variant first and second polypeptides; iii) determining the presence or not of first and second polypeptides.

25. A test according to Claim 24 wherein the detection of first and second polypeptides is by antibody detection.

26. A test according to Claim 24 or 25 wherein said cell/tissue sample comprises prostate cells/tissue.