WO2006054748A1

WO2006054748A1 - Remedy for nephritis

Info

Publication number: WO2006054748A1
Application number: PCT/JP2005/021383
Authority: WO
Inventors: Yumiko Kamogawa; Sahori Namiki
Original assignee: Ginkgo Biomedical Research Institute Co., Ltd.
Priority date: 2004-11-22
Filing date: 2005-11-21
Publication date: 2006-05-26
Also published as: JPWO2006054748A1

Abstract

It is intended to provide a remedy for nephritis which contains, as the active ingredient, an interferon producing cell (IPC) activity inhibitor. As the IPC activity inhibitor, use may be made of, for example, an antibody capable of recognizing a surface antigen of IPC. Namely, an antibody recognizing, for example, BST2 or its homolog is useful therefor. It is also intended to provide a method of screening a remedy for nephritis which involves the step of selecting a substance having an effect of controlling the IPC activity. Thus, it has been clarified that the immune balance of a patient suffering from nephritis can be controlled by regulating the IPC activity. Namely, a novel therapeutic strategy against nephritis is provided. It is particularly useful in treating lupus nephritis accompanying SLE.

Description

Specification

Nephritis treatment

Technical field

[0001] The present invention relates to the treatment of nephritis.

Background art

[0002] Nephritis is a disease caused by inhibition of the urinary filtration function by the kidney. Leakage of protein and blood into the urine is observed due to the reduced filtration function. On the other hand, the excretion function of metabolites that should be excreted in the urine is reduced and accumulates in the body. Due to decreased renal function, nitrogen-containing compounds such as urea, uric acid, and creatine accumulate in the body. Patients with nephritis often have high blood pressure.

[0003] Many causes have been pointed out for nephritis. For example, the glomeruli are damaged by the autoimmune response. Autoimmune diseases such as rheumatism are often associated with nephritis, and autoimmunity is considered one of the major causes of nephritis. There are also known cases where a normal immune response to infection causes nephritis. For example, acute nephritis observed after infection with hemolytic streptococci is considered to be one of the causes. That is, antibodies are produced as a normal immune response to infection with hemolytic streptococci. In the living body, an immune complex composed of the hemolytic streptococcal antigen and its antibody is produced. This immune complex accumulates in the glomerular basement membrane and activates the cytotoxic effect of complement, causing inflammation.

[0004] At present, the main treatment for nephritis is diet therapy for the purpose of limiting salt and protein. Dietary therapy can be expected to slow the progression of symptoms, but the cause of nephritis cannot be removed. Various types of steroids may also be used to treat nephritis. However, the therapeutic effects of steroids depend mainly on their anti-inflammatory effects. Alternatively, in nephritis associated with autoimmune disease, renal inflammation is suppressed by regulating immune function. In any case, because the cause of the disease cannot be eliminated by steroids, artificial dialysis may be necessary if the symptoms of nephritis have progressed. Artificial dialysis is a treatment method that places a heavy burden on the patient, both physically and socially. Also steroid The immunosuppressive action of the drug may increase the risk of infection.

[0005] Examples of nephritis include lupus nephritis caused by systemic lupus erythematosus (hereinafter referred to as SLE). SLE is a typical disease of collagen disease advocated by Klemperer in 1942. It is a disease mainly characterized by multiple organ disorders based on the appearance of autoantibodies and immune complexes. The facial butterfly erythema, characteristic of this disease, was named as Systemic Lupus Erythematosus because it resembles a lupus wound (lupus). The clinical symptoms of SLE are not limited to skin irritation, but are quite varied. Examples include fever, polyarthralgia and polyarthritis, serositis, anemia, thrombocytopenia, renal symptoms, or neurological symptoms. SLE is overwhelmingly common among women, especially women in their 20s and 30s, and the onset of gender is 1 to 10. There are 7,000-9,000 patients in Japan, and the prevalence is estimated at 66-85 per 100,000 population.

[0006] The kidney is one of the susceptible organs in SLE. In fact, kidney damage occurs in 70-80% of patients. The renal disorder found in SLE patients is specifically called lupus nephritis. Lupus nephritis is characterized by glomerular damage and progressive decreased renal function. The glomerular disorder of lupus nephritis is related to the autoimmune process that occurs because the immune system makes antibodies against autoantigens (autoantibodies). That is, it is thought that a complex of autoantibodies and complements bound to kidney tissues such as glomeruli accumulates in the kidney and causes an inflammatory reaction.

[0007] Lupus nephritis has various symptoms such as hematuria, fever, red spots on the face and limbs, and swelling. Patients with lupus nephritis often develop nephrotic syndrome (excessive protein excretion) and rapidly progressive glomerulonephritis and may transition to acute or chronic renal failure. Lupus nephritis is thought to be genetically predisposed. It may be associated with other autoimmune diseases such as rheumatoid arthritis and scleroderma. Also known is Gaith, who is evoked by pregnancy.

[0008] The treatment of lupus nephritis is centered on steroidal drug therapy, as is the treatment of the causative disease SLE. Usually, steroids are administered continuously for 2-3 years. Drug treatment is often prolonged over time because symptoms are likely to recur even after symptoms have resolved. In severe cases with strong disease activity, “pulse therapy” may be used, in which a large amount of steroids is administered intravenously. As a result, side effects of steroids may be problematic (Non-Patent Document lZSaag KG et al., AM.J.Med., 96, 115, 1994). For example, it has been pointed out that steroids may reduce the patient's immune function and increase the likelihood that the patient will suffer from an infection.

[0009] When an effect is not manifested only with a steroid, an immunosuppressant is further used in combination. Anticoagulants may be administered when there is a symptom of “rapidly progressive nephritis” in which kidney function suddenly declines.

In addition to drug treatment, there are also known treatments that remove the causative substances of autoimmune symptoms such as autoantibodies. One is a “plasma exchange” method that, like dialysis, draws blood out of the body, removes the causative agent, and returns it to the body. The time required is 3-4 hours and once a week. The other is called “blood adsorption”, in which blood is introduced outside the body, and the causative substances are removed by adsorbing them on a membrane fixed with tributophane. However, like pharmacotherapy, there are individual differences in treatment effects.

[0010] It has been reported that patients with autoimmune diseases such as SLE have high IFN concentrations in the blood (Non-Patent Document 2ZScience, 16 Nov. 2001 Vol.294). ₀ Suppressing can potentially control symptoms. As a site force-in antagonist for realizing such an approach, an antibody against type 1 interferon was used (Patent Document 1ZWO 01/054721). That is, treatment of SLE with an antibody against IFN-α was proposed. However, the effect of antibodies against IFN-α on renal inflammation is not clear.

[0011] More importantly, in nephritis associated with autoimmune diseases such as SLE, treatment of autoimmune diseases is the main. Needless to say, since autoimmune diseases are the cause of nephritis, treatment to remove the cause is important. Strength Nephritis is one of the disorders that has a major impact on patients' quality of life (QOL). Therefore, active treatment or prevention of nephritis is an important issue for maintaining the patient's QOL.

[0012] Patent Literature l: WO 01/054721

Non-patent literature l: Saag K.G. et al., AM.J.Med., 96, 115, 1994

Non-Patent Document 2: Science, 16 Nov. 2001 Vol.294 Disclosure of the invention

Problems to be solved by the invention

[0013] What is important in the treatment of nephritis is not only the control of autoimmune symptoms but also the alleviation of nephritic symptoms. That is, an object of the present invention is to provide a technique for treating and preventing nephritis.

Means for solving the problem

[0014] One of the causes of the imbalance in the immune system in humans is the action of type 1 interface. Type 1 interferons include interferon (IFN a) and interferon 13 (IFN β). IFN a or IFN β is known as an interferon having antiviral activity or antitumor activity. Interferon-producing cells (hereinafter sometimes abbreviated as IPC) have been identified as cells that produce these interferons in large quantities due to viral infection. IPC has only power in the blood. The proportion of IPC in peripheral blood lymphocytes is considered to be less than 1%. However, IPC has a very high ability to produce interferon. The ability of IPC to produce IFN reaches, for example, 3000 pg / mL / 10 ⁶ cells. In other words, although the number of cells is small, it can be said that most of IFN a or IFN jS in the blood is brought about by IPC.

[0015] Therefore, if the production of IPC interferon or the number of IPC cells themselves can be suppressed, the amount of type 1 interferon in vivo can be controlled. As a result, it may be possible to regulate the biased immune balance and achieve more essential treatment of autoimmune diseases such as SLE.

[0016] The present inventors thought that if IPC activity can be regulated in vivo, symptoms of autoimmune disease can be improved. The present inventors then produced a number of antibodies that recognize cell surface antigens of IPC and analyzed the effect on the activity of IPC. As a result, it was clarified that an antibody that recognizes a specific antigen has an action of regulating the activity of IPC. Furthermore, the therapeutic effect of the autoimmune disease was analyzed. The present invention was completed by confirming that an antibody that suppresses the activity of IPC can provide a therapeutic effect particularly on nephritis. That is, the present invention relates to the following nephritis therapeutic agent or preventive agent, therapeutic method, preventive method, and screening method for the therapeutic agent or prophylactic agent. [1] A therapeutic agent for nephritis comprising an interferon-producing cell activity inhibitor as an active ingredient.

[2] Interferon-producing cell activity inhibitory substance force The therapeutic agent according to [1], which has an action of suppressing either or both of interferon-producing cell interferon production and cell survival.

[3] Activity inhibitory substance power of interferon-producing cells The therapeutic agent according to [2], which is an antibody having an action of suppressing interferon-producing cell interferon production and / or cell survival.

[4] The therapeutic agent according to [3], wherein the antibody is an antibody that recognizes either or both of BST2 and its homolog, or an antibody fragment containing at least an antigen-binding region thereof.

[5] Hybridoma 3D3 # 7 deposited as FERM BP-10339 or FERM B

The therapeutic agent according to [4], which is an antibody comprising at least an antigen-binding region of a monoclonal antibody produced by hybridoma 3G7 # 6 deposited as P-10340.

[6] A method for treating nephritis, comprising a step of suppressing the activity of interferon-producing cells.

[7] The activity of interferon-producing cells to be suppressed The treatment method according to [6], which is either or both of interferon production and cell survival of interferon-producing cells.

[8] A process power for suppressing the activity of interferon-producing cells, comprising the step of administering an antibody having an action of suppressing interferon production and cell survival, interferon production, or both of the interferon-producing cells. Method of treatment.

[9] The treatment method according to [8], wherein the antibody is an antibody that recognizes either or both of BST2 and its homolog, or an antibody fragment containing at least an antigen-binding region thereof.

[10] Antibody power FERM Hybridoma 3D3 # 7 deposited as BP-10339, or FERM

The method according to [9], wherein the monoclonal antibody produced by hybridoma 3G7 # 6 deposited as BP-10340 is an antibody comprising at least an antigen-binding region.

[11] A method for detecting the therapeutic effect of a test compound on nephritis, comprising the following steps.

(1) contacting the interferon-producing cells and the interferon-producing inducer of the interferon-producing cells in any order of the following i) to iii): i) contacting the interferon-producing cells with a cell stimulator that induces interferon production after contacting the test compound with the interferon-producing cells;

ii) contacting a test compound and a cell stimulant that induces interferon production simultaneously with the interferon-producing cells, or

iii) Contact the interferon-producing cells with a cell stimulator that induces interferon production, and then contact the test compound with the interferon-producing cells.

(2) measuring the activity of interferon-producing cells, and

(3) A step in which the therapeutic effect of the test compound on nephritis is detected when the activity of interferon-producing cells is suppressed compared to the control.

[12] The method according to [11], wherein the cell stimulating agent is at least one cell stimulating agent selected from group power consisting of a virus, a viral component, and bacterial DNA.

[13] The method according to [11], wherein the test compound is an antibody that recognizes interferon-producing cells or an antibody fragment containing at least an antigen-binding region thereof.

[14] A screening method for a compound having a therapeutic effect on nephritis, comprising a step of selecting a test compound in which the therapeutic effect on nephritis is detected by the method according to [11].

[15] A therapeutic agent for nephritis comprising a compound selected by the screening method according to [14] as an active ingredient.

[16] Use of an interferon-producing cell activity inhibitor in the manufacture of a therapeutic agent for nephritis.

Alternatively, the present invention relates to the use of a compound selected by the above screening method in the manufacture of a therapeutic agent for nephritis. The present invention further relates to the use of an interferon-producing cell activity inhibitor in the treatment of nephritis. Power! The present invention further provides a pharmaceutical package for the treatment of nephritis, which comprises a pharmaceutical composition containing as an active ingredient a substance that suppresses the activity of interferon-producing cells, which is indicated to be used for the treatment of nephritis. By the way, anti-BDCA-2 monoclonal antibody (Dzionek, A. et al. J. lmmunol. 165: 6037-6046, 2000.), a known monoclonal antibody that recognizes IPC, suppresses IFN production of HCV. It has been clarified that it has an action to do. In addition, the ability of monoclonal antibodies to recognize mouse interferon-producing cells Suppress interferon production It has also been reported (Blood 2004 Jun 1; 103/11: 4201- 4206. Epub 2003 Dec). A decrease in the number of rod-shaped cells by a monoclonal antibody against plasmacytoid dendritic cells in mice was reported (J. Immunol. 2003, 171: 6466-6477). However, the therapeutic effect of these antibodies on nephritis is unknown.

The invention's effect

[0018] According to the present invention, a therapeutic agent for nephritis targeting IPC is provided. That is, it became clear that nephritis can be treated with IPC activity inhibitors. The activity of IPC is suppressed by, for example, administration of an antibody that recognizes the cell surface antigen of IPC. For example, antibodies against BST 2 and its homologues bind to IPC and act in a suppressive manner on its IFN production and cell survival itself. The antibody that binds to BST2 was actually confirmed to have a therapeutic effect on nephritis when administered in vivo.

[0019] In the present invention, a therapeutic effect for nephritis has been achieved by regulating the function of IPC. Incidentally, anti-BDCA-2 antibody and anti-BDCA-4 antibody are known as antibodies that suppress IFN-α production. It has been suggested that these antibodies may have therapeutic effects on autoimmune symptoms in SLE patients (Blomberg S. et al. Arthritis Rheum. 48. 2524, 2003). The effect of these antibodies on nephritis is unclear. On the other hand, the present invention has provided a therapeutic strategy for nephritis that targets cells that produce IFN, which is not regulated by IFN function. That is, the approach of the present invention enables more essential nephritis treatment. More specifically, for example, the following merits can be expected in the present invention.

[0020] First, an IPC activity inhibitor can achieve a high therapeutic effect even in a small amount. In IPC, few cells produce large amounts of IFN. For neutralization of IFN, an antibody corresponding to the number of IFN molecules is required. However, in the present invention, the activity of the production cell is directly suppressed. As a result, compared to neutralization with anti-IFN antibody, a strong IFN suppression effect can be expected with a smaller amount of antibody. When the function of IFN is regulated by an antibody or a soluble receptor, a therapeutic agent corresponding to the concentration of IFN is required. On the other hand, IPC activity regulators act directly on IPC, which produces very large amounts of IFN. Therefore, IFN production can be efficiently suppressed. Generally, the manufacturing cost of an antibody drug is high. At present, no method has been established that can significantly reduce manufacturing costs. Therefore, necessary for treatment The low dose of antibody is a great economic advantage. In addition, lower doses can not only be economically advantageous, but also reduce the risk of side effects.

[0021] Furthermore, when IFN is continuously produced, neutralization of IFN with an antibody is expected to be only transient suppression. The antibody bound to IFN forms an immune complex and is quickly removed by the action of phagocytic cells. The neutralizing action of the antibody's IFN activity is lost. IPC is a cell with a high IFN production function. Therefore, even if the IFN concentration is temporarily reduced by the action of the anti-IFN antibody, IFN is likely to be replenished quickly again.

On the other hand, in the present invention, since the activity of IPC is suppressed, an effect of suppressing IFN production over a long period can be expected. In particular, according to a desirable embodiment of the present invention, an antibody that recognizes BST2 or a homolog thereof suppresses not only IFN production of IPC but also the number of cells. In other words, the effect of suppressing IFN production continues until new IPC is supplied. In addition, production of other inflammatory site force ins that can be produced by IPC is also directly or indirectly suppressed. These effects act synergistically and IFN production is effectively suppressed. As a result, an advanced therapeutic effect for nephritis is achieved. Particularly in the treatment of chronic diseases such as nephritis, the sustainability of the therapeutic effect is a great advantage.

Brief Description of Drawings

[0022] [Fig.l] Cell surface of mouse bone marrow cells (IPC enriched) cultured for 10 days after addition of FLT-3 ligand, FACS analysis image stained with the prepared antibody and other markers is there. The culture supernatant positive fraction and negative fraction were designated R2 and R3, respectively. In the graph, R1 & R2 represents an antibody positive cell population, and R1 & R3 represents an antibody negative cell population.

FIG. 2 is a photomicrograph (x400) showing the morphology of cells extracted with each monoclonal antibody. (A) shows the form before infection with influenza virus PR8, and (b) shows the form after incubation with influenza virus PR8 for 24 hours. After infection, the cells had rod-shaped processes and showed a typical morphology for rod-shaped cells.

FIG. 3 is a graph showing interferon-producing ability of cells separated using monoclonal antibodies SNK01 and SNK03. In the figure, the horizontal axis indicates the type of cell treatment, and the vertical axis indicates the IFNα concentration (pg / mL) in the culture supernatant. P (+) on the horizontal axis indicates the number of cells bound to the monoclonal antibody. N (+) infects cells that did not bind to the monoclonal antibody, N (+) infects the virus, and N (-) infects the cells that did not bind to the monoclonal antibody and infect the virus. The result when a strong effort is shown.

FIG. 4 is a graph showing the effect of monoclonal antibody SNK01 on interferon production ability. In the figure, the horizontal axis represents the concentration (g / mL) of the antibody used in the treatment, and the vertical axis represents the IFNa concentration (pg / mL) in the culture supernatant. The (-) on the horizontal axis shows the result of virus processing. SNK01 showed interferon production inhibitory activity in a concentration-dependent manner.

FIG. 5 is a graph showing the effect of monoclonal antibody SNK03 on interferon production ability. In the figure, the horizontal axis represents the concentration (g / mL) of the antibody used for the treatment, and the vertical axis represents the IFN α concentration (pg / mL) in the culture supernatant. CTL shows the results for the horizontal axis treated with the control antibody. SNK03 showed interferon production inhibitory activity in a concentration-dependent manner.

FIG. 6 is a photograph showing the results of Western blotting assay using monoclonal antibody SNK01. The photo shows the results with the anti-His tag antibody, and the bottom shows the results with the monoclonal antibody SNK01 of the present invention. The left side of the photo is the result of COS7 cells transformed with PCDNA3.1-mBST2D-His, and the right side is pcDNA3.1-mBST2H-His. The results for the precipitate (P) and the supernatant (S) when the cultured cells were lysed were shown.

FIG. 7 shows the amino acid sequence and genomic structure of mouse BST2 and its homologue. (A) shows the alignment of amino acid sequences of each isoform, and (b) shows exon mapping.

FIG. 8 shows the amino acid sequence and genomic structure of human BST2 and its homologue. (A) shows the alignment of amino acid sequences of each isoform, and (b) shows exon mapping.

FIG. 9 is a graph showing the influence of the produced monoclonal antibody against mouse BST2 on the ability to produce interferon. In the figure, the horizontal axis indicates the type of culture supernatant used in the treatment, and the vertical axis indicates the IFN o concentration (pg / mL) in the culture supernatant. When CpG is treated with CpG, PR8 shows the result of infection with influenza virus PR8.

FIG. 10 is a graph showing the influence of the prepared monoclonal antibody against human BST2 on the ability to produce interferon. In the figure, the horizontal axis represents the type and concentration of the antibody used for the treatment, and the vertical axis represents the IFNa concentration (pg / mL) in the culture supernatant when HCV was stimulated with HSV.

[11] FIG. 11 is a view showing the analysis results of cells from which the force of a mouse administered with an antibody was also collected. (a) Indicates a given schedule. (B) shows the concentration of IFN produced when bone marrow cells were stimulated with CpG or influenza virus PR8. The horizontal axis indicates the administered antibody, and IgG indicates the control antibody.

FIG. 12 shows the effect of administration of anti-mouse BST2 antibody SNK01 in mice infected with virus. (A) shows the schedule of administration. (B) shows the concentration of INFa in the serum, and the horizontal axis shows the administered antibody. (C) shows the ratio of IPC in the spleen, the horizontal axis shows the administered antibody, and the vertical axis shows the ratio of IPC. “No antibody” indicates a group in which only PBS was administered instead of the antibody.

FIG. 13 shows the results of analyzing the number of IPC cells in various mice. The vertical axis shows the percentage (%) of IPC in various organs. The horizontal axis shows the mouse strain, and F1 shows the mouse that has been crossed by NZB and NZW.

FIG. 14 is a graph showing the effects of antibodies on IFN production using bone marrow cells derived from various mice. This is the result of measuring the concentration of IFN produced when bone marrow cells were stimulated with influenza virus PR8 (top) or CpG (bottom), with the vertical axis representing IFNa concentration (pg / mL) and the horizontal axis derived from Each column indicates the antibody used for the treatment.

FIG. 15ab is a diagram showing the results of examining the effect of an antibody using a lupus nephritis onset model (n = 10). (A) shows the schedule of antibody administration. (b) shows changes over time in the frequency of proteinuria in the group of mice administered with the antibody.

FIG. 15c is a diagram showing the results of examining the effect of an antibody using a lupus nephritis onset model (n = 10). (C) shows the amount of protein in the urine of each mouse. Proteinuria on the vertical axis is protein of 1: -37 mg / dl, 2: -74 mg / dl, 3: -lllmg / dl, 4: -333 mg / dl, 5: -1000 mg / dl, 6: -3000 mg / dl Indicates the amount. ○ is the value of surviving mice, and 參 is the value of dead mice.

FIG. 16 shows the results of studying antibody effects using a lupus nephritis onset model (n = 10). The horizontal axis represents the antibody administered, and the vertical axis represents the concentration of serum cytodynamic force at 5 months of age in the mouse administered the antibody. The numbers in the figure represent average values.

[17] This figure shows the results of studying the therapeutic effect of administration of antibodies after onset using lupus nephritis onset model (n = 6). The abscissa indicates the administered drug, and PD indicates water-soluble predonin (Shionogi Pharmaceutical Co., Ltd.). The proteinuria on the vertical axis is the same as in Fig. 15c. : -74 mg / dl, 3: -llllmg / dl, 4: -333 mg / dl, 5: -1000 mg / dl, 6: -3000 mg / dl. ○ is the value of the surviving mouse, and 參 is the value of the dead mouse. The numbers in the figure represent average values.

BEST MODE FOR CARRYING OUT THE INVENTION

[0023] The present invention relates to a therapeutic agent for nephritis comprising an interferon-producing cell activity inhibitor as an active ingredient.

In the present invention, nephritis refers to a disease caused by inhibition of the urinary filtration function by the kidney, and its cause is not limited. Decreased renal filtration function is diagnosed using protein or blood leakage into the urine as an indicator.

In the present invention, nephritis including an immune response as an onset mechanism is preferable as a treatment target. Nephritis involving the immune response includes nephritis associated with autoimmune diseases. For example, nephritis associated with the deposition of immune complexes on the glomeruli can be indicated as a treatment target in the present invention. Such nephritis is called immune complex nephritis. The antigen or antibody constituting the immune complex may be self or foreign antigen. As such nephritis, lupus nephritis can be indicated. Alternatively, nephritis associated with an autoimmune disease includes, for example, nephritis caused by autoantibodies against glomeruli, or anti-basement membrane nephritis caused by autoantibodies against glomerular basement membrane. Nephritis)

[0025] In the present invention, the autoimmune disease means that an immune function causes tissue damage or inflammation. Immune functions include humoral immunity with antibodies and cellular immunity with immunocompetent cells. The autoimmune disease in the present invention can also be defined by the activation of an immune mechanism against a self antigen. The self-antigen here includes foreign antigens introduced into the host by some means in addition to the antigens present in the tissues of healthy individuals. For example, an immune function attack against a foreign antigen introduced into a living body by infection, transplantation, or contact may damage cells or tissues. Such a disorder is included in the autoimmune disease in the present invention. The presence of an autoimmune disease in the living body can be detected using the reactivity of the immune mechanism against the self antigen as an index. IgG is known as an autoantigen that can be used as an indicator of autoimmune diseases In the present invention, nephritis associated with an autoimmune disease can be said to be a state in which cell or tissue damage due to an autoimmune mechanism is observed and inflammation in the kidney is observed. The nephritis in the present invention includes not only a direct disorder caused by an autoimmune mechanism but also an indirect disorder. For example, nephritis resulting from excessive production of inflammatory site force-in due to enhanced function of immunocompetent cells is a typical pathology of nephritis associated with autoimmune diseases. Furthermore, nephritis caused by complex mechanisms including autoimmune diseases is included in nephritis, which is the subject of treatment in the present invention. For example, lupus nephritis is a typical disease of nephritis associated with an autoimmune disease in the present invention.

In the present invention, lupus nephritis refers to nephritis caused by systemic lupus erythematosus (SLE). More specifically, symptoms of autoimmune diseases and diseases associated with nephritis are included in lupus nephritis. The symptoms of an autoimmune disease can be confirmed using, for example, an autoantibody such as an anti-double-stranded DNA (dsDNA) antibody as an index. Lupus nephritis is preferable as nephritis associated with the autoimmune disease in the present invention.

[0028] In any of the autoimmune diseases as described above, it is considered that enhancement of the autoimmune mechanism is brought about by IPC. Therefore, therapeutic effects can be expected by regulating autoimmune diseases based on suppression of IPC function. Therefore, in the present invention, these diseases can also be referred to as nephritis having an autoimmune disease due to hyperfunction of IPC.

[0029] In the present invention, the treatment of nephritis includes, in addition to suppressing the renal inflammation state, delaying the progression or preventing the progression to the renal inflammation state. More specifically, for example, the therapeutic effect of nephritis is achieved by suppressing at least one symptom characteristic of nephritis as shown below, preventing its progression, or preventing the occurrence of the symptom itself. Proteinuria,

—Hematuria,

Increased blood concentration of nitrogen compounds with reduced blood filtration function

Immune complex deposition in the glomerulus, or

Autoantibody deposition on kidney tissue, etc. Thus, the present invention includes the prevention of nephritis. That is, the present invention provides either or both of a therapeutic agent and a preventive agent for nephritis, which contain an IPC activity inhibitor as an active ingredient. Alternatively, the present invention provides either or both of a method for treating and preventing nephritis, which comprises a step of suppressing the function of IPC.

[0030] Methods for evaluating the progress of symptoms characteristic of nephritis are known. For example, albumin concentration in urine can generally be measured by a urine test strip method based on a biochemical reaction or by immunoassay. Similarly, a urine test paper for detecting hemoglobin is used to detect blood in urine. Further, urea, uric acid, and creatine can be shown as nitrogen-containing compounds in blood that serve as an index of renal function. Among them, Creatun is a typical renal function marker. Creatun can be measured by the Jaffe method or an enzymatic measurement method. Furthermore, immune complex or autoantibody deposition in kidney tissue can be detected by microscopic observation of kidney tissue. The kidney tissue required for the examination can also be collected for vitality by renal biopsy.

[0031] The interferon-producing cell (IPC) in the present invention refers to a cell having the ability to produce IFN. For example, a cell in which expression of either or both of BST2 and its homolog on the cell surface is detected can be identified as an IPC. One or both of BST2 and its homologues are included when expressed in association with cell activity. For example, in humans and mice, cells that are progenitor cells of rod cells and produce IFN upon stimulation are preferable as IPC. Hereinafter, unless otherwise specified, IPC refers to not only cells that are precursor cells of rod cells but also cells that have the ability to produce IFN. In particular, cells expressing BST2 and / or its homologues on the cell surface are preferred as IPC. Such IPC identification methods are known. For example, IPC can be distinguished from other blood cells using several cell surface markers as indicators. Specifically, the cell surface marker profile of HI HPC is as follows (Shortman, K. and Liu, YJ. Nature Reviews 2: 151-161, 2002). Recently, there is a report that positions BDCA-2 positive cells as IPC (Dzionek, A. et al. J. Immunol. 165: 6037-6046, 2000.). Therefore, BDCA-2 positive cells are preferred as IPC in the present invention. [Profile of cell surface antigen of HCV]

CD4 positive, CD123 positive,

Uneage (CD3, CD14, CD16, CD19, CD20, CD56) negative, CDllc negative

[0032] Alternatively, the mouse IPC is defined by the following profile.

[Mouse IPC cell surface antigen profile]

-Positive for CDllc, B220, Ly6C, and CD45RB

— CDllb, CD3, CD19 negative

Furthermore, the following features can be shown as common features seen in human or mouse IPC.

[Characteristics of cell morphology]

Similar to plasma cells

A round cell with a smooth cell surface

—The nucleus is relatively large

[Functional characteristics of cells]

—A large amount of Type-1 interferon is produced in a short time during virus infection

Differentiate into rod-shaped cells after viral infection

In the present invention, IPC activity suppression refers to suppression of at least one of the functions of IPC. That is, the IPC activity inhibitor includes any substance that suppresses at least one of the functions of IPC. IPC function can show IFN production and cell survival. Cell survival can be rephrased as the number of cells. Therefore, it is said that IPC activity is suppressed when both or any of these functions are suppressed. A substance that suppresses both or any of these functions can be used as an IPC activity inhibitor.

[0034] It has been clarified that type 1 IFN produced by IPC causes various diseases. Therefore, suppressing its production is useful as a therapeutic strategy for these diseases. For example, the relationship between autoimmune disease pathology and IFN a has been pointed out. The majority of IFN o; is produced by IPC. Therefore, if the production is suppressed, the pathological condition caused by IFN o; can be alleviated. In the present invention, IPC The suppression of IFN production by means that the production of at least one IFN produced by IPC is suppressed. A preferred IFN in the present invention is type 1 IFN. Of these, IFN a is important.

[0035] IPC includes cells that produce large amounts of IFN with a small number of cells. For example, progenitor cells of rod-shaped cells stimulated with a virus or the like produce most of IFN produced by the living body. Suppressing the number of IPC cells that produce large amounts of IFN results in suppression of IFN production. Therefore, suppression of the IPC cell number can also alleviate the pathology caused by IFNa.

[0036] In the present invention, the IPC activity inhibitor is preferably an antibody that recognizes an IPC cell surface antigen and suppresses its activity. Specifically, it is an antibody that suppresses either or both of the ability of IPC to produce interferon and the number of IPC cells. It can be confirmed, for example, by a method for detecting the therapeutic effect of nephritis described later that an antibody suppresses the activity of IPC. For example, the present inventors have confirmed that an antibody recognizing either or both of BST2 and its homolog suppresses the activity of IPC.

That is, the present invention relates to a therapeutic agent for nephritis comprising an antibody that recognizes either or both of BST2 and its homolog, or an antibody fragment containing at least an antigen-binding region as an active ingredient. The present invention also relates to a method for treating nephritis, which comprises the step of administering an antibody that recognizes either or both of BST2 and its homolog, or an antibody fragment containing at least an antigen-binding region thereof. Alternatively, the present invention relates to the use of an antibody that recognizes either or both of BST2 and its homolog, or an antibody fragment containing at least an antigen-binding region thereof, in the manufacture of a therapeutic agent for nephritis.

In the present invention, IPC is not particularly limited as long as it is a cell that produces IFN. For example, in humans and mice, a cell group expressing either or both of BST2 and its homologue was confirmed to have a high ability to produce IFN (hereinafter referred to as BST2 and its homologue. Or a group of cells expressing both, may be described as BST2-positive cells). Accordingly, human and mouse BST2-positive cells are preferred as IPCs in the present invention. In particular, in hi-HPC, the expression level of BST2 and its homolog is markedly increased with its activation. So BST2 and its homologues Recognizing antibodies act specifically on activated IPC in humans. Therefore, HIHPC is particularly preferred as the IPC of the present invention.

[0038] The present inventors have clarified that antibody activity against BST2 or its homologue suppresses the activity of IPC. It was confirmed that the symptoms of nephritis can be alleviated through suppression of IPC activity. That is, the present inventors have found a method for suppressing the activity of IPC, and have confirmed that treatment of nephritis can be realized by actually suppressing the activity of IPC by the method. Based on these findings, it was clarified that IPC function is effective as a therapeutic strategy for nephritis.

[0039] In addition, antibodies against BDCA-2 (Dzionek, A. et al. J. Immunol. 165: 6037-6046, 20 00.) have also been shown to suppress IPC function (Dzionek, A. et al. J. Exp. M ed. 194; 1823-34. 2001.). Therefore, an antibody that binds to BDCA-2 can also be used as an “IPC activity inhibitor” in the present invention.

[0040] In the present invention, the BST2 gene is a human-derived protein defined by the amino acid sequence set forth in SEQ ID NO: 2. The amino acid sequence described in SEQ ID NO: 2 is encoded by cDNA consisting of the base sequence described in SEQ ID NO: 1! Human BST2 cDNA cloning and monoclonal antibodies have been reported (Ishikawa J. et al. Genomics 26: 527, 1995; GenBank Acc # .D28137) ₀ BST2 is a membrane protein that has the ability to support pre-B cell proliferation. White matter (Japanese Patent Laid-Open No. 7-196694). Knowledge about the BST2 genomic gene and promoter has also been obtained (WO99 / 43803). In addition, human BST2 has been shown to be an antigen recognized by anti-HM1.24 antibody, which is a monoclonal antibody against myeloma (Ohmoto T. et al. BBRC 258: 583, 1999). Anti-HM1.24 antibody is a monoclonal antibody established using human plasma cell line as an immunogen (Goto T. et al. Blood 84:19 92, 1994). Later, it was revealed that myeloma was specifically recognized, and a humanized antibody was created for the treatment of myeloma (Ozaki S. et al. Blood 93: 3922, 1999 ;: W 098/14580). The human anti-anti-HM1.24 antibody has a therapeutic effect on cancer of hematopoietic tissue (WO02 / 064159) _o Currently, clinical trials are in progress for its practical application. As described above, human BST2 is used as a marker in hematopoietic tumors. In addition, antibodies that specifically bind to human BST2 suppress the activation of T cells and B cells, resulting in autoimmune diseases. It has been suggested that it can be a therapeutic drug for patients (Japanese Patent Laid-Open No. 10-298106). However, there are no reports suggesting an association between antibodies that recognize BST2 and IPC.

[0041] In the present invention, BST2 includes a homologue thereof. The homologue of BST2 can be defined as a protein that is functionally equivalent to the protein consisting of the amino acid sequence set forth in SEQ ID NO: 2. Such proteins include naturally occurring proteins. In general, eukaryotic genes have polymorphism, as is known for IFN genes and the like. One or more amino acids may be substituted, deleted, inserted, and Z or added due to changes in the base sequence caused by this polymorphism. Thus, it is a human-derived protein, and in the amino acid sequence set forth in SEQ ID NO: 2, one or more amino acids have an amino acid sequence substituted, deleted, inserted, and Z or added, A protein functionally equivalent to the protein consisting of the amino acid sequence set forth in SEQ ID NO: 2 is included in the BST2 homologue of the present invention.

[0042] Specifically, for example, a BST2 splicing variant or a mutant caused by a gene polymorphism is included in the BST2 homolog. For example, the present inventors have clarified the existence of a splicing variant for cDNA having the nucleotide sequence of SEQ ID NO: 1. This splicing variant had the nucleotide sequence shown in SEQ ID NO: 3 or SEQ ID NO: 5, and encoded the amino acid sequence described in SEQ ID NO: 4 or SEQ ID NO: 6.

[0043] Alternatively, the amino acid sequence may not change even if the base sequence changes due to the polymorphism. Such a nucleotide sequence variation is called a silent variation. A gene comprising a nucleotide sequence having a silent mutation is also included in the present invention. The polymorphism mentioned here means that a certain gene has a different nucleotide sequence among individuals within a population. In general, polymorphisms and mutations are genetically defined by genotype distribution rates. However, the polymorphism referred to here is independent of the ratio (distribution rate) at which different nucleotide sequences are found.

[0044] BST2 homologs include functionally equivalent proteins in species other than humans. A protein functionally equivalent to BST2 can be identified using, for example, hybridization. That is, a polynucleotide encoding BST2 as shown in SEQ ID NO: 1 or a fragment thereof is used as a probe, and a polynucleotide capable of hybridizing therewith is isolated. If hybridization is performed under stringent conditions As a result, a highly homologous polynucleotide is selected as the base sequence, and as a result, there is an increased possibility that the protein to be isolated contains a protein functionally equivalent to BST2.

[0045] The present inventors confirmed that the antibody strength against homologues of BST2 mice suppresses the activity of mouse IPC in the same manner as antibodies in humans. Mouse BST2 had the base sequence set forth in SEQ ID NO: 9 and encoded the amino acid sequence set forth in SEQ ID NO: 10. Furthermore, the present inventors also confirmed the presence of homologues in mice in the same manner as for BST2H, which is a BST2 splicing nootropic. The base sequence of mouse BST2H is shown in SEQ ID NO: 7, and the amino acid sequence encoded by this base sequence is shown in SEQ ID NO: 8. It was confirmed that the antibody against BST2H in mice also suppresses IPC activity.

The base sequence information and amino acid sequence information of human and mouse BST2 and homologues clarified in the present invention are summarized below.

Base sequence Amino acid sequence Amino acid sequence length Human BST2D SEQ ID NO: 1 SEQ ID NO: 2 (180)

Human BST2H SEQ ID NO: 3 SEQ ID NO: 4 (158)

Human BST2HS SEQ ID NO: 5 SEQ ID NO: 6 (100)

Mouse BST2H SEQ ID NO: 7 SEQ ID NO: 8 (178)

Mouse BST2D SEQ ID NO: 9 SEQ ID NO: 10 (172)

Mouse BST2HS SEQ ID NO: 18 SEQ ID NO: 19 (105)

The stringent conditions specifically indicate conditions such as 6 X SSC, 40% formamide, hybridization at 25 ° C, and IX SSC, washing at 55 ° C. it can. Stringency depends on conditions such as salt concentration, formamide concentration, or temperature. Those skilled in the art can adjust these conditions appropriately to obtain the required stringency.

[0047] By using the hybridization, it is possible to isolate a polynucleotide encoding a homologue of BST2 in, for example, an animal species other than human. Non-human animal species, ie, animal species such as mice, rats, rabbits, pigs, goats, etc. can be obtained. The BST2 homologue encoded by the polynucleotide constitutes a functionally equivalent protein in the present invention. . [0048] The protein encoded by the polynucleotide isolated using the noblerization technique or the like usually has high homology in amino acid sequence with human BST2D (SEQ ID NO: 2). High homology refers to sequence identity of at least 30% or more, preferably 50% or more, more preferably 80% or more (eg, 95% or more, 98%, or even 99% or more). The identity of nucleotide sequences and amino acid sequences can be examined using a homology search site using the Internet [For example, in Japan DNA Data Bank (DDBJ)! /, FAS TA, BLAST, PSI-BLAST] , And SSEARCH etc. can be used [For example, search and analysis of Japan DNA Databank (DDBJ) website: ~~~; http://www.ddbj.nig.ac .Jp / E—mail / homology—j.ntml]. You can also search using BLAST in the National Center for Biotechnology Information (NCBI) (for example, the BLAST page of the NCBI website; http: 〃 www.ncbi.nlm.nih .gov / BLAST /; Altschul, SF et al "J. Mol. Biol, 1990, 215 (3): 403-10; Altschul, SF & Gish, W., Meth. EnzymoL, 1996, 266: 460-480; Altschul, SF et al., Nucleic Acids Res., 1997, 25: 3389-3402)].

[0049] For example, the calculation of amino acid sequence identity in Advanced BLAST 2.1 uses blastp as the program, sets the Expect value to 10, all filters are OFF, uses BLOSUM62 as the matrix, Gap existence cost, Per residue gap cost , And Lambda ratio can be set to 11, 1, 0.85 (default value) and searches can be performed to obtain identity values (%) (Karlin, S. and SF Altschul (1990) Proc. Natl. Acad. Sci. USA 87: 2264-68; Karlin, S. and SF Altschul (1993) Proc. Natl. Acad. Sci. USA 90: 5873-7).

[0050] Furthermore, BST2 homologues in other species can be found by searching the nucleotide sequence information of cDNA or genomic DNA whose structure has already been clarified. In other words, similar sequence information is searched by a homology search that uses known BST information or a database that accumulates amino acid sequence information as a query using the base sequence information of human BST2 and Z or amino acid sequence information. Is done. If a known gene or protein having high homology derived from another species exists in the database, it can be found by homology search. Even if the full length of the gene is not identified, if the sequence information of fragments such as EST is obtained, the full length sequence of the gene can be constructed by in silico cloning. Sometimes you can. If homologs derived from other species thus identified are actually confirmed in the IPC of the animal species, they can be used as BST2 homologs in the present invention.

[0051] An antibody that recognizes either or both of BST2 and its homologue used in the present invention can be prepared using BST2 and its homologue or a fragment thereof as an immunogen. The antibodies in the present invention may be of any class. The species from which the antibody is derived is not limited. Furthermore, a fragment containing an antigen-binding region of an antibody can be used as an antibody. For example, an antibody fragment containing an antigen binding site produced by enzymatic digestion of IgG can also be used as the antibody in the present invention. Specifically, antibody fragments such as Fab or F (ab ′) 2 can be obtained by digestion with papain or pepsin. It is well known that these antibody fragments can be used as antibody molecules having binding affinity for an antigen. Alternatively, an antibody constructed by gene recombination can be used as long as the necessary antigen-binding activity is maintained. The antibody constructed by gene recombination can be, for example, a chimeric antibody, a CDR-grafted antibody, or a single chain Fv. Methods for obtaining these antibodies using any immunogen are known

[0052] In the present invention, the antibody can be modified as necessary. According to the present invention, an antibody that recognizes either or both of BST2 or a homologue thereof has an action of suppressing the number of IPC cells. That is, the antibody itself was considered to have cytotoxicity against IPC. Subclasses of antibodies that exhibit strong effector activity are known. Alternatively, the effect of suppressing the activity of IPC can be further enhanced by modifying the antibody with a cytotoxic agent. The following substances can be shown as cytotoxic substances.

Toxins: Pseudomonas aeruginosa toxin (Pseudomonas Endotoxin; PE), diphtheria toxin, ricin ^{^{radioisotope: Tc "m, Sr 89,}} I 131, Y 9 °

Anticancer drugs: calikiamycin, mitomycin, paclitaxel

Toxins that also have protein power can be bound to antibodies or fragments thereof by a bifunctional reagent. Alternatively, the gene encoding the antibody encodes a toxin Genes can be joined to obtain a fusion protein of both. Methods for binding radioisotopes to antibodies are also known. For example, a method for labeling an antibody with a radioisotope using a chelating agent is known. Furthermore, anticancer agents can be bound to antibodies by using sugar chains or bifunctional reagents.

[0053] The antibody used in the present invention may be an artificially modified antibody. For example, various modification methods for improving the cytotoxic effect and stability of antibodies are known. Specifically, an immunoglobulin having a modified heavy chain sugar chain is known (Shinkawa, T. et al. J. Biol. Chem. 278: 3466-3473. 2003.). The sugar chain modification enhanced the ADCC (antibody-dependent cell-mediated cytotoxicity) activity of immunoglobulin. Alternatively, immunoglobulins with modified Fc region amino acid sequences are also known. That is, ADCC activity was enhanced by artificially increasing the binding activity of immunoglobulin to the Fc receptor (Shield, RL. Et al. J. Biol. Chem. 27 6; 6591-6604, 2001. ).

[0054] IgG bound to the Fc receptor is once taken up into cells. Subsequently, it has been revealed that it binds to the Fc receptor expressed in the endosome and is released into the blood again. IgG with high Fc receptor binding activity is more likely to be released into the blood after being taken up by cells. As a result, the residence time of IgG in the blood is extended (Hinton.PR. Et al. J Biol Chem. 279: 6213-6216. 2004). In addition, modification of the amino acid sequence of the Fc region is also said to cause a change in CDC (Complement Dependent Cytotoxicity) activity. Antibodies with these modifications can be used as antibodies in the present invention.

[0055] For example, for a monoclonal antibody, the antibody-producing cell force that produces the monoclonal antibody can also be collected. Monoclonal antibody-producing cells that can be used in the present invention include, for example, BST2 or a homolog thereof, a fragment thereof, a cell that produces them, or a cell membrane fraction thereof administered to an immunized animal as an immunogen, It can be obtained by cloning. More specifically, the antibody used in the present invention can be obtained, for example, by a method including the following steps.

(Step of administering BST2 or a homolog thereof to an immunized animal as an immunogen (2) selecting an antibody-producing cell that produces an antibody that recognizes BST2 from the antibody-producing cells of the immunized animal of (1),

(3) culturing the antibody-producing cells selected in (2), or isolating a gene encoding an antibody produced by the antibody-producing cells and culturing cells that retain this gene in an expressible manner, and

(4) A step of recovering an antibody that suppresses the activity of interferon-producing cells from the culture of (3) In a general method for producing a monoclonal antibody, a hyperidoma obtained by cell fusion of immune cells and tumor cells is used. Used as antibody-producing cells. As an immunogen in the present invention, BST2 or a homologue thereof, or a fragment thereof can be used. The immunogen can be purified from cells transformed with the gene encoding it. Furthermore, cells expressing BST2 or a homologue thereof can be used as an immunogen. Specific examples of such cells include the following cells. The cell membrane fraction of these cells can also be used as an immunogen.

—IPC with vitality

IPC differentiated from hematopoietic stem cells

Cells that can express an exogenous BST2 gene or its homologous gene

In order to collect IPC from a living body, for example, a target cell may be collected based on the expression profile of a cell surface marker as described above. Methods for collecting specific cells using a plurality of cell surface markers as an index are known. For example, by using immunostaining and a cell sorter, cells that meet the target expression profile can be easily separated. For example, human IPC is enriched by selecting BDCA-2 positive cells. IPCs collected from humans are used as an immunogen after being activated as necessary.

IPC can also be obtained as cultured cells in addition to the peripheral blood or hematopoietic tissue of a living body. For example, it can be obtained in large quantities by culturing hematopoietic stem cells of humans and mice and distributing them to IPC. Conditions for differentiating human and mouse hematopoietic stem cells into IPC in vitro are known. [0057] For example, humans from hematopoietic stem cells in vitro (Blom, B. et al. J. Exp. Med. 192: 17 85-1796, 2000 .; Chen, W. et al. Blood 103: 2547-2553 , 2004.), and induction of IPC in mice (Gillie rt et al 2002, J. Exp. Med. 958-953) has been reported. Alternatively, induction of mouse IPC in vivo is also known (Bjorck et al. Blood 2001, 3520-3526). However, there have been no reports of using IPCs induced by these methods as immunogens. However, the present inventors have found that the in vitro differentiated IPC force is advantageous as an immunogen for obtaining a monoclonal antibody that recognizes IPC. In particular, it was completely unexpected that the use of this immunogen would yield a monoclonal antibody capable of regulating the ability of mouse IPC to produce IFN.

[0058] Specifically, differentiation into IPC is induced by culturing a cell population containing hematopoietic stem cells in the presence of an IPC inducer. As a cell population containing hematopoietic stem cells, for example, bone marrow cells can be used. As the IPC inducer, FLT-3 ligand or a combination of FLT-3 ligand and thrombopoietin (TPO) can be used. The concentration of FLT-3 ligand in the medium can usually be 1 to: LOOng / mL. As other culture conditions, general blood cell culture conditions may be applied. That is, RPMI1 640 or the like can be used as a basal medium, and about 10% fetal bovine serum can be obtained. Alternatively, Yssel's Medium was used to guide HPC. In vitro differentiation into IPC peaks in humans, for example, around 25 days.

[0059] If cells differentiated into IPC are obtained from cultured hematopoietic stem cells, IPCs for immunogens can be obtained. In practice, several cell surface markers are used to sort cells with cell surface antigens characteristic of IPC. That is, for example, BDCA-2 positive cells can be obtained as HCHP. Alternatively, CDllc positive, CDllb negative, and B220 positive cell fractions can be sorted using a cell sorter to obtain mouse IPC.

Alternatively, by using an antibody that is already known to be IPC-specific, the antibody-positive cells can be sorted as IPC. A monoclonal antibody produced by the present inventors and produced by a monoclonal antibody-producing cell 2E6 that recognizes a mouse IPC-specific antigen (WO 2004/013325, FERM-BP-8445) can be used for fractionation of mouse IPC. it can.

[0060] IPC can also be collected from peripheral blood. However, as mentioned earlier, IPC peripheral blood The population that can be collected is extremely low, so a large amount of blood is required to collect IPC from peripheral blood. Therefore, it is advantageous to use cells differentiated from hematopoietic stem cells for IPC as an immunogen.

[0061] In the preparation of the monoclonal antibody used in the present invention, not only IPC but also SEQ ID NO:

: Group power consisting of SEQ ID NO: 4, and SEQ ID NO: 6 A protein containing the amino acid sequence described in any selected SEQ ID NO: or a fragment thereof can also be used as an immunogen. The monoclonal antibody of the present invention recognizes a protein containing the amino acid sequence described in any one of SEQ ID NO: 2, SEQ ID NO: 4, and SEQ ID NO: 6 as an antigen. It was revealed that Therefore, the monoclonal antibody of the present invention can be obtained by using these proteins as immunogens.

[0062] A protein containing the amino acid sequence described in any one of SEQ ID NOs: selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, and SEQ ID NO: 6 can be obtained as a recombinant. For example, the base sequence described in SEQ ID NO: 1 encodes the amino acid sequence described in SEQ ID NO: 2. The base sequence described in SEQ ID NO: 3 encodes the amino acid sequence described in SEQ ID NO: 4. Therefore, the target protein can be obtained by expressing DNA consisting of these base sequences using an appropriate host vector.

[0063] Alternatively, an amino acid sequence ability described in any one of SEQ ID NOs selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, and SEQ ID NO: 6 An oligopeptide having a selected continuous amino acid sequence ability It can also be an immunogen. The amino acid sequence to be selected as the immunogen has an amino acid strength of, for example, about 5-50, preferably about 7-20. Methods for obtaining oligopeptides having an arbitrary amino acid sequence are known. For example, an amino acid can be chemically bonded to obtain an oligopeptide having the target amino acid sequence. Alternatively, a fragment having a predetermined amino acid sequence can be obtained by cleaving a protein having a full-length amino acid sequence obtained as the above recombinant. The obtained oligopeptide can be made more immunogenic by binding to an appropriate carrier protein. As the carrier protein, keyhole limpet Hesiyaninu serum serum albumin and the like are used.

[0064] SEQ ID NO: 2 and most of the amino acid sequences of SEQ ID NO: 4 and SEQ ID NO: 6 are identical. Yes. Therefore, a monoclonal antibody that recognizes all of these proteins can be obtained by using an amino acid sequence that is selected for its common amino acid sequence ability. In addition, for each of the three types of proteins, two specific proteins can be distinguished from the other by using the amino acid sequence shared by the two types. Alternatively, a monoclonal antibody that specifically identifies each protein can be obtained by using an amino acid sequence unique to each amino acid sequence. For example, in the amino acid sequence described in SEQ ID NO: 4, the amino acid sequence from 139 to 158 from the N-terminus is an amino acid sequence unique to SEQ ID NO: 4. Similarly, the amino acid sequence set forth in SEQ ID NO: 6 is an amino acid sequence unique to SEQ ID NO: 6 having an amino acid sequence of 96 to 100 from the N-terminus.

[0065] Subsequently, an appropriate immunized animal is immunized with the immunogen. IPC can be administered to immune animals with appropriate adjuvants. Alternatively, the group force consisting of SEQ ID NO: 2, SEQ ID NO: 4, and SEQ ID NO: 6 is selected from any of the selected SEQ ID NOs, or a peptide having a partial amino acid sequence power, and an immunized animal together with an adjuvant. It can be administered.

[0066] Furthermore, the transformation is carried out so that the DNA encoding the amino acid sequence described in any one of SEQ ID NO: 2, SEQ ID NO: 4, and SEQ ID NO: 6 can be expressed. Cells can be used as immunogens. For example, a DNA containing a base sequence constituting a coding region of a base sequence described in any one of SEQ ID NO: selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, and SEQ ID NO: 5 is preferable as the DNA. . By incorporating these DNAs into an appropriate expression vector and transforming host cells, transformed cells useful as immunogens can be obtained.

[0067] A host cell for use as an immunogen can be a cell derived from the same species as the immunized animal. By using the same type of cells, a specific immune response against foreign proteins can be induced. For example, if a rat is used as an immunized animal, it is advantageous to use a host cell derived from the rat. A fraction of transformed cells containing the protein can also be used as an immunogen. As shown in the examples, SEQ ID NO: 2, SEQ ID NO: 4, and SEQ ID NO: 6 group power of force A transmembrane domain was found in the amino acid sequence described in any selected SEQ ID NO: (the transmembrane region of FIG. 8; transmembrane region) ₀ Mr. Therefore, proteins with these amino acid sequences may be expressed on the cell membrane

. When actually expressed in COS cells, a larger amount of the protein having the amino acid sequence of SEQ ID NO: 8 and SEQ ID NO: 10 was detected in the precipitate fraction of the transformant culture. Therefore, the cell membrane fraction of cells expressing the above protein can be used as an immunogen.

[0068] As the immunized animal in the present invention, any non-human vertebrate that recognizes IPC as a foreign substance can be used. In order to obtain a monoclonal antibody, an animal for which a fusion partner for obtaining a hyperpridoma is readily available is advantageous. For example, the establishment of hybridomas derived from cells such as mice, rats, rabbits, bushes, and goats has been established. These immunized animals can be used in the present invention. On the other hand, Freund's complete adjuvant or Freund's incomplete adjuvant is used as the adjuvant.

[0069] Immunized animals are immunized multiple times at 3 to: L0 day intervals. The number of IPCs used for one immunization is arbitrary. Usually, 10 ³ to 10 ⁸ , for example 10 ⁶ IPCs are immunized. In general, immunization with protein peptide is immunized with 1 ~: LOO / zg. The monoclonal antibody of the present invention can be obtained by collecting immunocompetent cells from an immunized animal that has undergone multiple immunizations and cloning the cells that produce the target antibody. An immunocompetent cell refers to a cell having antibody-producing ability in an immunized animal.

[0070] Immunocompetent cells can be cloned, for example, by the hypridoma method.

In immunocompetent cells, one cell produces one kind of antibody. Therefore, if a cell population derived from one cell can be established (ie, cloning), a monoclonal antibody can be obtained. The hyperidoma method refers to a method in which immunocompetent cells are fused with an appropriate cell line, immortalized, and then cloned. Many cell lines useful for the hybridoma method are known. These cell lines are excellent in the immortalization efficiency of lymphocyte cells and have various genetic markers necessary for selection of cells successfully fused. Furthermore, for the purpose of obtaining antibody-producing cells, a cell line lacking antibody-producing ability can also be used.

For example, mouse myeloma P3x63Ag8.653 (ATCC CRL-1580) is widely used as a cell line useful for mouse or rat cell fusion. Use human IPC as immunogen If so, mice and rats can be used as immunized animals. On the other hand, in the examples described later, since the mouse IPC is used as the immunogen, the immunized animal is an animal other than the mouse (for example, rat). In general, hyperpridoma is obtained by obtaining a monoclonal antibody that has heterohypridoma force between closely related different types of force generated by the fusion of cells of the same type.

[0072] Specific protocols for cell fusion are known. That is, immunized cells of an immunized animal are mixed with an appropriate fusion partner to cause cell fusion. Spleen cells and peripheral blood B cells are used as immunocompetent cells. As the fusion partner, the various cell lines mentioned above can be used. For cell fusion, the polyethylene glycol method or the electrofusion method is used.

Next, a cell that has succeeded in cell fusion is selected based on a selection marker possessed by the fused cell. For example, when a HAT-sensitive cell line is used for cell fusion, cells that have succeeded in cell fusion are selected by selecting cells that grow in the HAT medium. Furthermore, it is confirmed that the antibody produced by the selected cell has the desired reactivity.

[0073] Each noblebroma is screened based on antibody reactivity. That is, a hybridoma producing an antibody that binds to either or both of BST2 and its homolog is selected. Preferably, the selected hybridoma is subcloned and finally selected as a hyperidoma that produces the monoclonal antibody of the present invention when production of the target antibody is confirmed.

[0074] Specifically, for example, the protein having the amino acid sequence ability described in any one of SEQ ID NO: 2, SEQ ID NO: 4, and SEQ ID NO: 6 selected from the group consisting of A peptide consisting of an amino acid sequence can be screened as an antigen. The antigen is bound to an appropriate solid phase, and the monoclonal antibody that binds to the antigen can be detected by a labeled antibody that recognizes the immunoglobulin of the immunized animal. A monoclonal antibody can be rapidly screened by using an ELISA method using an enzyme-labeled antibody by binding an antigen to the inner wall of the microplate. Monoclonal antibodies that have been confirmed to have an antigen-binding activity are actually confirmed to have an effect on IPC activity as needed. IP The effect on C can be confirmed, for example, by the method described later.

[0075] Such a monoclonal antibody can be expressed by obtaining cDNA encoding the antigen-binding region of the antibody from the hyperidoma and inserting it into an appropriate expression vector. Techniques for obtaining cDNA encoding the variable region of an antibody and expressing it in an appropriate host cell are known. Also known is a technique for producing a chimeric antibody by binding a variable region including an antigen-binding region to a constant region.

[0076] Furthermore, the antigen-binding activity of the monoclonal antibody can be transplanted to other immunoglobulins. The variable region of immunoglobulin is composed of a complementarity determining region (CDR) and a frame region. The antigen-binding properties of each immunoglobulin are determined by CDR, and the frame maintains the structure of the antigen-binding region. The amino acid sequence in the frame part is highly conserved, whereas the amino acid sequence of CDR is very diverse. It is known that antigen-binding activity can also be transplanted by incorporating the amino acid sequence constituting the CDR into the frame region of another immunoglobulin molecule. Using this method, a method has been established for transplanting the antigen-binding properties of different types of immunoglobulins to human immunoglobulins. In the present invention, the antigen-binding region can include CDR grafted in a frame. Therefore, a “fragment containing an antigen-binding region” of a certain monoclonal antibody includes a human immunoglobulin fragment containing a variable region grafted with the CDR of the monoclonal antibody.

Any of the monoclonal antibodies thus prepared can be used in the present invention. That is, an immunoglobulin-binding monoclonal antibody containing an antigen-binding region encoded by a polynucleotide derived from a cDNA encoding the antigen-binding region of the monoclonal antibody or an antibody fragment containing the antigen-binding region is used in the present invention. can do.

As a hyperidoma producing a monoclonal antibody that can be used in the present invention, for example, hyperidoma 3D3 # 7 or 3G7 # 6 can be shown. Hypridoma 3 D3 # 7 and Hypridoma 3G7 # 6 were registered with the Patent Biological Depositary Center of the National Institute of Advanced Industrial Science and Technology as of May 27, 2005, with accession numbers FERM BP-10339 and accession number FERM BP. Deposited as -10340. Below is a description of the deposit. Included.

(a) Depositor's name

Name: National Institute of Advanced Industrial Science and Technology, Patent Biological Deposit Center

Address: Japan Tsukuba Sakai Higashi 1-chome No. 1 No. 1 Central No. 6 (Postal code 305-8566)

(b) Date of deposit: May 27, 2005

(c) Accession number: BP-10339 (Hybridoma 3D3 # 7)

(c) Accession number: BP-10340 (Hybridoma 3G7 # 6)

[0078] The monoclonal antibody to be used in the present invention can be recovered from the culture by culturing the hyperidoma that produces the monoclonal antibody. Hypridoma can be cultured in vitro or in vivo. In vitro, a known medium such as RPMI1640 can be used to cultivate wild and hybridomas. The immunoglobulin secreted by the hyperidoma accumulates in the culture supernatant. Therefore, the monoclonal antibody of the present invention can be obtained by collecting the culture supernatant and purifying it as necessary. The medium is easy to purify immunoglobulin without adding serum. However, for the purpose of more rapid growth of hypridoma and promotion of antibody production, it is possible to release about 10% urine fetal serum into the medium.

[0079] Nobridoma can also be cultured in vivo. Specifically, a hyperidoma can be cultured in the peritoneal cavity by inoculating the peritoneal cavity of a nude mouse. Monoclonal antibodies accumulate in ascites. Therefore, the necessary monoclonal antibodies can be obtained by collecting ascites and purifying it as necessary. The obtained monoclonal antibody can be appropriately modified or covered according to the purpose.

[0080] Antibodies that bind to either or both of BST2 and its homologues suppress their activity when contacted with IPC. Therefore, these antibodies can be used as IPC activity inhibitors in the present invention. That is, the present invention provides a therapeutic agent for nephritis comprising as an active ingredient at least one component selected from the following (a) to (c) powerful group forces. Alternatively, the present invention relates to a method for treating nephritis comprising the step of administering at least one component selected from the following group powers (a) to (c) that also have powers. The present invention further relates to the use of at least one component selected from the following groups (a) to (c) in the manufacture of a therapeutic agent for nephritis. (a) An antibody that binds to one or both of BST2 and its homolog, or a fragment containing the antigen-binding region thereof

(b) an immunoglobulin transplanted with the complementarity-determining region of the antibody of (a), or a fragment containing the antigen-binding region thereof, and

(c) a polynucleotide encoding the component according to (a) or (b)

In the present invention, the monoclonal antibody that suppresses the activity of IPC includes SEQ ID NO: 2, SEQ ID NO: 4, and SEQ ID NO: 6. Protein having the amino acid sequence described in any selected SEQ ID NO: 6 Monoclonal antibodies that recognize can be used.

[0081] It can be confirmed as follows that the antibody has an inhibitory effect on IPC IFN production activity. IPC produces large amounts of IFN upon viral stimulation. Before and after virus stimulation of IPC, give antibody at the same time as virus stimulation, and compare the ability of IFN to produce IPC without antibody. The IFN production ability can be evaluated by measuring IFN-a and IFN-β contained in the culture supernatant of IPC. As a result of the comparison, if the amount of IFN in the supernatant is significantly reduced by the addition of the antibody, it can be confirmed that the tested antibody has an action of suppressing IFN production ability. Methods for measuring these IFNs are known. I PC is a cell that produces most of IFN in the living body. Therefore, the production state of IFN in the living body can be regulated by suppressing the IFN production ability of IPC.

[0082] In the present invention, IPC activity includes maintenance of the number of IPC cells. Therefore, suppression of IPC activity in the present invention includes suppression of the number of IPC cells. Similar to IFN production, IPC activity is induced by stimulating infectious viruses. If it is confirmed that the number of activated IPC cells is suppressed in the presence of the antibody, it can be seen that the antibody suppresses the IPC activity. As a comparative control, inactive immunoglobulin derived from the same animal species as the antibody whose activity is to be confirmed can be used, as in IFN production. The number of cells in IPC can be compared quantitatively by counting cells. The number of cells can be counted with a FACS microscope.

[0083] In the present invention, the IPC activity inhibitor is preferably an antibody that recognizes an IPC cell surface antigen and suppresses its activity. For example, BST2 and its homologue Antibodies that recognize both are preferred as IPC activity inhibitors in the present invention. When an antibody is administered to a host different from the species from which the antibody is derived, it is desirable to cover the antibody in a form that is difficult for the host to recognize as a foreign object. For example, by processing into the following molecules, immunoglobulin can be recognized as a foreign substance. A technique for covering the immunoglobulin molecule as follows is known.

Fragment containing antigen-binding region lacking one constant region (Monoclonal Ant¾odies: Principles and Practice, third edition, Academic Press Limited. 1995; Antioody Engineering, A Practical Approach, IRL PRESS, 1996)

A chimeric antibody composed of the antigen-binding region of a monoclonal antibody and the constant region of the immunoglobulin of the host (Gene Expression Experiment Manual Kodansha 1994 (Ishida Isao, Ando Tamie))

A CDR-substituted antibody in which the complementarity-determining region (CDR) in the immunoglobulin of one host is replaced with CDR of the monoclonal antibody (Gene Expression Experiment Manual Kodansha 1994 (Ishida Isao, Ando Tamie))

[0084] Alternatively, by using a non-human animal into which a human antibody gene has been incorporated as an immunized animal, a human antibody can be obtained using the non-human animal. For example, transgenic mice incorporating human antibody genes have been put to practical use as immunized animals for producing human antibodies (Ishida et al., Cloning and Stem Cells, 4: 85-95, 2002). By using such an animal, a human antibody that recognizes BST2 can be obtained using human BST2 as an antigen. Human antibodies are preferred antibodies for administration to humans.

[0085] Alternatively, the phage display method (McCafferty J. et al., Nature 348: 552-554, 1990;

The human immunoglobulin variable region gene can also be obtained by Kretzschmar T et.al, Curr Opin Biotechnol. 2002 Dec; 13 (6): 598-602.). In the phage display method, a gene encoding a human immunoglobulin variable region is incorporated into a phage gene. A phage library can also be created using various immunoglobulin genes as sources. The phage expresses the variable region as a fusion protein of its constituent proteins. The variable region of the phage surface expressed by the phage maintains the binding activity to the antigen. Therefore, it binds to the antigen or cells expressing the antigen. By selecting a phage to be combined, a phage expressing a variable region having a target binding activity can be screened from a phage library. Furthermore, the phage particles thus selected retain a gene that codes for a variable region having the desired binding activity. That is, in the phage display method, a gene encoding a variable region having a target binding activity can be obtained using the binding activity of the variable region as an index.

[0086] In the therapeutic agent or therapeutic method for nephritis according to the present invention, an antibody or an antibody fragment containing at least an antigen-binding region thereof can be administered as a protein or a polynucleotide encoding the antibody. In order to administer the polynucleotide, it is desirable to use a vector in which a polynucleotide encoding the target protein is placed under the control of an appropriate promoter so that the target protein can be expressed. An enhancer or terminator can be placed in the vector. Vectors that retain the heavy and light chain genes that make up immunoglobulin and are capable of expressing immunoglobulin molecules are known.

A vector capable of expressing an immunoglobulin can be administered by introduction into a cell. In administration to a living body, those that can infect cells by administration to a living body can be administered as they are. Alternatively, the vector can be introduced into lymphocytes once separated from the living body and returned to the living body (ex vivo).

[0087] In the therapeutic agent or therapeutic method for nephritis according to the present invention, the amount of monoclonal antibody administered to the living body is usually 0.5 mg to 100 mg, for example, lmg to 50 mg, preferably 1 mg to 50 mg per kg body weight as immunoglobulin. Is 2 mg ~: LOmg. The administration interval of the antibody to the living body can be appropriately adjusted so that the effective concentration of immunoglobulin in the living body during the treatment period can be maintained. Specifically, for example, it can be administered at intervals of 1 to 2 weeks. The administration route is arbitrary. A person skilled in the art can appropriately select an effective administration route for treatment. Specifically, oral or parenteral administration can be indicated. For example, the antibody can be administered whole or locally by intravenous injection, intramuscular injection, intraperitoneal injection, or subcutaneous injection. Examples of preparations suitable for parenteral administration in the present invention include injections, suppositories, and sprays. When giving to cells In general, 1 μg / mL, preferably 10 g / mL or more, more preferably 50 g / mL or more, and even more preferably 0.5 mg / mL or more of immunoglobulin is provided in the culture solution.

[0088] In the therapeutic agent or therapeutic method for nephritis of the present invention, the monoclonal antibody can be administered to a living body by any method. Usually, monoclonal antibodies are combined with a pharmaceutically acceptable carrier. Monoclonal antibodies can be blended with additives such as thickeners, stabilizers, preservatives, and solubilizers as necessary. Such carriers or additives include latatoses, citrates, stearic acid, magnesium stearate, sucrose, starch, talc, dielatin, agar, vegetable oil, ethylene glycol and the like. The term “pharmaceutically acceptable” is approved by national government supervisory authorities, or in the national pharmacopoeia or generally recognized pharmacopoeia for animals, mammals, and especially humans. Say what is listed for use. The therapeutic agent for nephritis of the present invention can also be supplied in the form of one or more doses of lyophilized powder or tablets. The lyophilized powder or tablet may be further combined with sterile water for injection, physiological saline or buffer to dissolve the composition to the desired concentration prior to administration.

[0089] Further, when administered as an immunoglobulin-expressing vector, each plasmid is 0.1 to 10 mg per kg body weight, for example, l -5 mg can be administered. For introduction into cells in vitro, 1-5 μg / 10 ⁶ cell vectors are used.

[0090] The present invention further relates to a method for detecting the therapeutic effect of a test compound on nephritis, comprising the following steps.

(1) contacting the interferon-producing cells and the interferon-producing inducer of the interferon-producing cells in any order of the following i) to iii):

After contacting the test compound and interferon-producing cells, a cell stimulator that induces interferon production is contacted with the interferon-producing cells.

iii) A cell stimulant that induces interferon production is contacted with the interferon-producing cells. The test compound and interferon-producing cells are contacted

(2) measuring the activity of interferon-producing cells, and

[0091] In the method of the present invention, the cell stimulating agent refers to a substance capable of inducing IPC activity and interferon production. For example, viruses and virus components can be indicated as cell stimulants. Specifically, it is known that IPC is activated by administration of a virus such as Herpes simplex virus (HS V) or influenza virus (Influenza virus). In addition, the IPC activation action of CpG, which is DNA in bacteria, is also known. These cell stimulants may be used alone or in combination with different cell stimulants. The cell stimulant and test compound may be contacted with the IPC at the same time, or by contacting the IPC with the test compound before or after contact with the cell stimulant.

In the present invention, the cell stimulator, IPC, and test compound can be contacted in vitro, in vivo, or ex vivo. In vitro, cell stimulants and test compounds can be contacted with IPC in any order as described above under conditions where IPC can be cultured. In vivo, the test compound or cell stimulant is administered to the in vivo IPC, and then the IPC is collected. After the collected IPC is contacted with a cell stimulant or a test compound in vitro, the level of cell activity can be evaluated. The level of cell activity can be evaluated by changing the concentration of IFN produced by the cell.

Furthermore, in ex vivo evaluation, a cell stimulant or a test compound is brought into contact with IPC prepared in vitro. The contacted IPC is administered to the living body, and the test compound or cell stimulant is administered. The level of IPC activity in vivo is evaluated, and the effect of the test compound is evaluated. The level of IPC activation can be evaluated using, for example, the level of IFN in blood as an index. The preparation of IPC in vitro refers to collecting IPC from a living body or artificially preparing IPC by induction of IPC progenitor cells. [0093] As a control in the method of the present invention, a substance whose therapeutic effect on nephritis is known in advance can be used in place of the test compound. For example, saline is a substance with no therapeutic effect. Alternatively, a substance that has been confirmed to have a therapeutic effect on nephritis can be used as a target, and the action of the test compound can be evaluated by relative comparison with the substance.

[0094] In the method for detecting the therapeutic effect of nephritis according to the present invention, the activity of IPC refers to, for example, either or both of the production level of IFN and the number of IPCs. A particularly preferred activity is the ability to produce IFN by IPC. The ability of IPC to produce IFN can be compared by determining the amount or concentration of IFN contained in the cell culture. Reagents or kits for measuring various IFNs are commercially available. Alternatively, the number of IPC cells can be compared by counting the number of cells present in the IPC culture. The number of cells can be determined by FACS using an antibody that recognizes the cell surface antigen of IPC. For example, BST2 or BDCA-2 can be used as the cell surface antigen of IPC. In addition, CD4 and CD123 can also be used as markers for counting IPC.

[0095] In the present invention, the reagent necessary for detecting the therapeutic effect of nephritis is further combined with a cell stimulant for activating IPC, a medium for culturing IPC, a culture vessel, and the like. You can also. Substances that have a clear effect on IPC activity can also be combined as a control.

Furthermore, a method for screening a candidate compound for a therapeutic agent for nephritis is provided by using the method for measuring the therapeutic effect of nephritis of the present invention. That is, the present invention relates to a screening method for a test compound having a therapeutic effect for nephritis, including the following steps.

(1) a step of measuring a therapeutic effect of nephritis possessed by a test compound by the method for measuring a therapeutic effect of nephritis of the present invention, and

(2) a step of selecting a test compound having a greater effect than the control

As a test compound to be used in the screening method of the present invention, an antibody that recognizes an IPC cell surface antigen, an antibody fragment containing at least an antigen-binding region thereof, or a fragment containing a variable region thereof can be used. . As an antibody, a phage library expressing a variable region is used. A brary can also be used. Alternatively, in addition to compound preparations synthesized by combinatorial chemistry, a mixture containing multiple compounds such as extracts of animal and plant tissues or microbial cultures, and preparations purified from them can be combined. Use it as a thing.

On the basis of the present invention, in order to find out the therapeutic effect of nephritis of an antibody that recognizes the IPC surface antigen, for example, a detection method including the following steps can be carried out.

After contacting the antibody and IPC, contact the cell stimulant that induces IFN production with IPC, ii) contact the antibody and the cell stimulator that induces IFN production simultaneously with IPC, or

iii) Contacting the IPC with a cell stimulator that induces IFN production, and then contacting the antibody with the IPC

(2) measuring the activity of IPC, and

(3) The step of detecting the therapeutic effect of antibody nephritis when the activity of IPC is suppressed compared to the control

The method for detecting the therapeutic effect of an antibody nephritis based on the present invention further enables a screening method for an antibody having the activity. That is, the present invention relates to a method for screening an antibody having a therapeutic effect for nephritis, including the following steps.

(1) a step of measuring a therapeutic effect of nephritis possessed by an antibody by the method for measuring a therapeutic effect of nephritis of the present invention, and

(2) A step of selecting an antibody having the above effect compared to the control

In the detection method and screening method of the present invention, an antibody includes a natural immunoglobulin molecule, a fragment containing the antigen-binding region thereof, a variant with a modified amino acid sequence or sugar chain, and a derivative with chemical modification. included. A fragment containing the antigen-binding region of an antibody can be obtained by enzymatic digestion of immunoglobulin. Alternatively, it can be obtained by genetic engineering by isolating a gene encoding the region and expressing it in an appropriate expression system. As such an immunoglobulin recombinant, for example, a phage antibody library can be shown. On the other hand, IPCs and cell stimulants can be used as described above. [0098] Since stimulation to IPC induces IFN production, IFN production can be regulated by regulating its activation. The present inventors have clarified that a therapeutic effect for nephritis can be obtained through suppression of IPC activity. Therefore, a substance capable of suppressing IPC activity can be used as a therapeutic agent for nephritis. That is, the compound that can be selected by the screening method of the present invention is useful as a therapeutic agent for nephritis.

[0099] In the screening method of the present invention, a substance having a therapeutic effect greater than this substance can be found by using as a control an IPC that has been brought into contact with a substance that is apparently effective in treating nephritis. IPC is an important cell that produces most of the IFN in the body. Therefore, the compound obtainable by the screening method of the present invention is important as a therapeutic agent for nephritis by regulating immune balance. Alternatively, the compound obtained by the screening method of the present invention can be used for the production of a therapeutic agent for nephritis by regulating immune balance.

[0100] By contacting the compound selected by the screening of the present invention with various cells other than IPC as necessary, the action on other cells can be confirmed. If significant growth inhibition and cytotoxic effects are not detected on cells other than IPC, the compound is likely to be used as a safe therapeutic agent. Alternatively, even when a disordered effect on specific cells is confirmed, there is a possibility that it can be used as a therapeutic agent by selecting an administration form such as local administration. Furthermore, it can be administered to SLE model animals and the like to evaluate the therapeutic effect of nephritis in more detail.

It should be noted that all prior art documents cited in this specification are incorporated herein by reference.

Hereinafter, the present invention will be described in more detail based on examples.

Example 1

[0101] Monoclonal antibody production protocol

Cells used as an immunogen were prepared as follows. The bone marrow cells of Balb / c female mice (4-6 weeks old) were mixed with 10% FCS-RPMI164 0 medium supplemented with 10 ng / ml FLT-3 ligand (R & D Systems) [10% fetal bovine serum ( FCS), and RPMI 16 40 medium containing penicillin and streptomycin] for 10 days. 10 days later, IPC (Interferon producing cell) Sex, CDllb negative, and B220 positive fractions were separated with a cell sorter (FACSVantage, manufactured by Becton Dickinson). The antibody manufactured by Becton Dickinson was used.

On day 0, 4, and 11, the separated cells were injected into rat foot pads together with ⁶ lxlO per leg together with complete Freund's adjuvant (CFA: manufactured by Jatron). On day 12, the lymph nodes of the immunized rat were isolated and lymphocytes were collected. Mouse myeloma cells P3x63Ag8.653 and rat lymphocytes were mixed at a ratio of 4: 5, and polyethylene glycol (PEG) was added to fuse the cells. The fused cells were thoroughly washed and dispersed in HAT medium, and spread on a 96-well plate to contain 5xl0 ⁴ cells per well.

[0102] Well cells in which the cells had proliferated were collected and diluted, and the culture supernatant was screened using the reactivity to mouse spleen cells and cultured bone marrow cells as an indicator. The details of the screening method are as in Example 2. The positive cells of the well were cloned by limiting dilution to establish a hybridoma clone producing monoclonal antibodies. Furthermore, the reactivity of the antibody purified from ascites obtained by transplanting the culture supernatant of hybridoma or hybridoma or hyperpridoma into the abdominal cavity of mice was analyzed.

Example 2

[0103] Screening of culture supernatant

Bone marrow cells of female Balb / c mice (4-6 weeks old) were cultured for 10 days in 10% FCS-RPMI1640 medium supplemented with 10 ng / ml FLT-3 ligand. On day 10, about 40% of the cells became IPC. Using these cells, the hyperpridoma culture supernatant was used as a primary antibody, and the secondary antibody was stained with a FITC-labeled anti-ra Hg antibody (BD Pharmingen). Thereafter, double staining was performed with various antibodies (CDllb, CDllc ゝ CD3, CD19, CD45RB, B220, Ly6C; all manufactured by Becton Dickinson) and analyzed by flow cytometry (FACS analysis).

[0104] The culture supernatant positive fraction and negative fraction were R2 and R3, respectively, and the expression of various antigens in each Gate was shown as a histogram (Fig. 1). The cell groups stained with several kinds of antibodies produced matched the cell surface antigen profile of mouse IPC (Nature Immunol, 2001; 2, 1144-1150.) Defined in the literature. Therefore, these antibodies were considered to be antibodies that specifically bind to mouse IPC.

Example 3 [0105] Morphology of cells separated by antibody

Bone marrow cells cultured as in Example 2 were stained using the culture supernatant as the primary antibody and FITC-labeled anti-rat Ig antibody as the secondary antibody. Thereafter, positive cells were separated using a cell sorter (FACSVantage, manufactured by Becton Dickinson). After cytospinning, Giemsa staining and observation under a microscope showed a form specific to IPC (Fig. 2a). That is, the shape of this cell had a large round nucleus.

[0106] lxlO ⁵ cells were cultured with influenza virus PR8 at 24 hours between 37 ° C at 96 well round bottom plate, after Giemsa staining similarly, was observed under a microscope, morphologically typical Differentiated into typical rod cells (Figure 2b). From these results, it was confirmed that the cells isolated by the above-mentioned antibody have the characteristics of mouse IPC when they are separated into rod-like cells by viral infection! Of these mouse IPC-specific monoclonal antibodies and hybridomas producing such antibodies, SNK01 and SNK03 were selected and used for the subsequent experiments.

Example 4

[0107] Interferon-producing ability of cells separated by antibody

Bone marrow cells cultured as in Example 2 were stained with SNK01, SNK03 culture supernatant and secondary antibody, and then positive and negative cells were separated using a cell sorter. Dispense ⁵ lxlO cells from each fraction into a 96-well round-bottom plate (100 μl / well), infect with influenza virus PR8, and concentrate IFNa in the culture supernatant after 24 hours. Was measured by the following ELISA method.

[0108] First, rat anti-mouse IFNa antibody (PBL Biomedical Laboratory) was reacted overnight at 4 ° C in a 96 well plate and coated. After washing the plate, culture supernatant 1001 was added and allowed to react overnight at 4 ° C. After the plate was washed, a labeled anti-interferon antibody that recognizes IFNa and IFNβ was added and reacted for 1 hour for detection. Each reaction was performed in triplicate and the average value was determined. The concentration of IFNa in the culture supernatant was calculated by creating a calibration curve.

Antibody positive cells produced higher interferon production than negative cells. In other words, the antigen recognized by monoclonal antibodies SNK01 and SNK03 is a table specific to IPC. It was confirmed that it was a surface antigen (Fig. 3).

Example 5

[0109] Effects of antibodies on the ability to produce mouse interferon

Mouse bone marrow cells cultured in the same manner as in Example 2 were dispensed into 96-well round-bottom plates, ⁵ lxlO at a time. This is supplemented with antibody or control antibody Lag HgG and incubated at 37 ° C for 30 minutes, followed by influenza virus PR8 and cultured at 37 ° C for 24 hours. IFN o; was measured by ELISA shown in Example 4 above (FIG. 4). As a result, SNK01 inhibited IFNa production in a concentration-dependent manner. Similarly, SNK03 antibody also suppressed IFNα production in a concentration-dependent manner (Fig. 5).

Example 6

[0110] Molecular cloning recognized by antibodies

1) Preparation of IPC-cDNA library

In the same manner as in Example 2, total RNA was extracted from the IPC in which bone marrow cell force was also induced by FLT-3 ligand by the phenol-guanidine method, and mRNA was purified by an oligo-dT column. CDNA is synthesized from purified mRNA by the Gubler-Hoffinan method, EcoRI-Notl adapters (Invitrogen) are coupled to both ends, and then unreacted EcoRI adapters and 500 by Span column (Chromaspin 400, Clontech). CDNA shorter than the base was removed. The resulting cDNA having EcoRI sites at both ends was ligated to the EcoRI site of the animal cell expression vector pME18s (excluding the Xhol fragment) by T4 ligase, and E. coli DH10 (manufactured by Invitrogen) using the erect-mouth polarization method. Was transformed. This is incubated in 500 ml of LB medium (LB. carbecillin) containing 100 g / ml carbecillin at 30 ° C and the protocol of the kit is prepared using QIA filter plasmid ma xi kit (Qiagen). The plasmid was extracted and purified according to the procedure described above to obtain an IP C-cDNA library.

[0111] 2) Expression cloning by COS7 cells

COS7 cells are spread on a 6cm dish, ⁵ sheets of 5xl0, 10 sheets at 37 ° C in the presence of 5% CO for 20 hours

2

After culturing, the IPC cDNA library obtained in 1) above was ransfectioned using Effectene trasfection Reagent (Qiagen) according to the protocol of the product. Incubate for 48 hours at 37 ° C, 5% CO, wash with PBS (Phosphate Buffered Saline), and cells with PBS / 5mM EDTA Was peeled from the dish, further washed with PBS, and passed through a cell strainer (70 m, manufactured by Falcon). After centrifugation (1300 rpm, 5 minutes), remove the supernatant, add lml of PBS / 0.5% BSA / 2mM EDTA, suspend, add 40 μ 1 of Fc block (Pharmingen), and add 20 μC at 4 ° C. Left for a minute. To this was added 30-50 μg of SNK01 antibody that had been biotinized and kept on ice for 30 minutes. After washing with PBS, the suspension was suspended in 100 μl of PBS, added with streptavidin microbeads (Miltenyi Biotec) 10-20 μ1, and allowed to stand at 10 ° C. for 15 minutes. Excess streptavidin microbeads were removed by washing with PBS / 0.5% BSA / 2 mM EDTA and suspended in 1 ml PBS / 0.5% BSA / 2 mM EDTA. Cells were sorted using AutoMACS (Miltenyi Biotec) under posselds conditions. Plasmid was extracted and purified by the modified Hirt method (BioTechniques Vol.24,760-762,1998). The resulting plasmid was transformed into E. coli DH10 by the electopore polarization method, cultured in 30 ml at 30 ° C with 100 ml of L Β carbe-cillin, and the protocol of the kit was prepared using QIA filter plasmid midi kit (Qiagen). The plasmid was extracted and purified according to

[0112] The above operation was taken as one course, and thereafter the same operation was repeated four times to concentrate a plasmid encoding an antigen that reacts with the SNK01 antibody. Finally, positive cells were collected using a cell sorter (FACSVantage, manufactured by Becton Dickinson) instead of AutoMACS, and an appropriate amount of Escherichia coli DH10 transformed with the plasmid was applied to an LB ′ carbe-silin plate. The cells were cultured at 30 ° C and picked up 30 colonies. Plasmids were extracted from each colony, transfected into COS7 cells, and positive plasmid was selected by FACS analysis using SNK01 antibody.

[0113] The nucleotide sequence of the cDNA cloned on the obtained plasmid was determined, and the gene was determined by blast search with the nucleotide sequence information registered in the mouse gene database. At the same time, we searched the human gene database to identify the power partner.

As a result, the clone bound with the monoclonal antibody SNK01 had the nucleotide sequences set forth in SEQ ID NO: 7 and SEQ ID NO: 9. The amino acid sequences encoded by these base sequences are shown in SEQ ID NO: 8 and SEQ ID NO: 10.

[0114] The base sequence described in SEQ ID NO: 9 was a base sequence known as mouse BST2 (GenBank Acc # .BC027328). On the other hand, the base sequence described in SEQ ID NO: 7 is the salt of SEQ ID NO: 9. Although it had a partially identical base sequence to the base sequence, a different base sequence was seen on the 3 ′ end side, and a different amino acid sequence was encoded. That is, of the amino acid sequence described in SEQ ID NO: 8, the amino acid sequence from the N-terminal to the 139th position was identical to the amino acid sequence described in SEQ ID NO: 10. In the amino acid sequence shown in SEQ ID NO: 8, the 140th to 178th amino acids from the N-terminal were unique to the amino acid sequence shown in SEQ ID NO: 8. Both were considered to be the norits generated by alternative splicing. Based on these findings, the amino acid sequence (SEQ ID NO: 8) that is encoded by the nucleotide sequence set forth in SEQ ID NO: 7 was considered to be a novel splicing noun of mouse BST2. Hereinafter, the gene consisting of the base sequence shown in SEQ ID NO: 7 is also called mBST2H, and the gene consisting of the base sequence shown in SEQ ID NO: 9 is also called mBST2D. (Figure 7 (a))

[0115] 3) Confirmation by FACS

The plasmid obtained by the above expression cloning method was again highly purified from Escherichia coli again using QIA filter plasmid midi kit (manufactured by Qiag en), and again transfected into COS7 cells. After 48 hours, according to a conventional method, reaction with SNK01 antibody and FITC-labeled anti-ra Hg antibody was performed, and FACS analysis was carried out to confirm whether or not the cDNA force antigen cloned on the plasmid was encoded.

As a result, the monoclonal antibody SNK01 was observed to bind to COS7 cells into which the plasmid was introduced. Therefore, it was confirmed that all cDNAs cloned on the plasmid encoded the antigen recognized by this monoclonal antibody.

Example 7

[0116] Confirmation of antibody reactivity by Western blotting

Recognizing and binding to the protein having the amino acid sequence of SEQ ID NO: 8 or SEQ ID NO: 10 was confirmed by Western blotting. The amino acid sequence shown in SEQ ID NO: 8 or SEQ ID NO: 10 was expressed as a gene recombinant, and the reactivity with the monoclonal antibody of the present invention was confirmed. The specific operation is as follows. [0117] 1) Construction of pcDNA3.1- mBST2D and pcDNA3.1- mBST2H

Using the cloned plasmids (l μg) encoding mBST2D and mBST2H as a saddle, DNA having the nucleotide sequence set forth in SEQ ID NO: 7 or SEQ ID NO: 9 was amplified by PCR. The base sequences of the primers used for PCR are as follows.

forward primer

5 -tttttgctagcgacggatcacatggcgccctctttctatcactatctgcccgtgcccatggatgagatgggggggaa gcaagga-3

reverse primer (Tsubaki line number ： 12)

5 -tttttttctcgagtcctcaaaagagcaggaacagtgac-ύ '

The composition of the reaction solution is as follows.

1XGC bufferl,

dNTP mix (0.25 mM),

LA Taq DNA polymerase 5U (above Takara Bio) / 100 μL

forward primer (1 pmol):

reverse primer (1 pmol)

[0118] After incubating at 95 ° C for 1 minute, PCR was performed under the conditions of 25 times, with [95 ° C 30 seconds Z55 ° C 30 seconds Z72 ° C 1 minute 30 seconds] as one cycle. After confirming that a DNA fragment of the desired size was amplified by agarose gel electrophoresis, phenol chloroform extraction and ethanol precipitation were performed, and the recovered amplification product was dissolved in 10 μL of TE buffer. This was cleaved with restriction enzymes Nhe I and Xho I (Takara Bio), purified by agarose gel electrophoresis using QIAquick Gel Extraction Kit (QIAGEN), precipitated with ethanol, and dissolved in 4 L of TE buffer.

[0119] Meanwhile, 5 μg of mammalian cell expression plasmid pcDNA3.1 (Invitrogen) was digested with restriction enzymes Nhe I and Xho I, treated with CIAP (Takara Bio), and purified by agarose gel electrophoresis. After ethanol precipitation, it was dissolved in 4 μL of TE buffer. 2 μL of each of the aforementioned DNA fragments and 0.5 μL of this plasmid were ligated using ligation kit ver. II (manufactured by Takara Bio Inc.), and transformed into E. coli DH5.

[0120] Several colonies appeared after culturing at 37 ° C in LB medium (100 μg / ml ampicillin) The plasmid was extracted using a QIAprep Spin miniprep kit (manufactured by QIAGEN). The base sequence of the DNA fragment inserted into the extracted plasmid was determined according to a standard method. Confirm that the plasmid is inserted with a DNA fragment having a nucleotide sequence encoding the amino acid sequence set forth in SEQ ID NO: 8 or SEQ ID NO: 10, and construct the desired constructs PCDNA3.1- mBST2D and PCDNA3.1- mBST2H was obtained.

[0121] 2) Construction of pcDNA3.1- mBST2D-His and PCDNA3.1- mBST2H-His

pcDNA3.1- mBST2D (for pcDNA3.1- mBST2D-His construction) or pcDNA3.1- m BST2H (for pcDNA3.1- mBST2H-His construction) 1 μg as a saddle type, and coding His tag by PCR The base sequence to be added was added. The base sequences of the primers used for PCR are as follows. The same forward primer (SEQ ID NO: 13) was used for pcDNA3.1-mBST2D-His and pcDNA3.1-mBST2H-His. The composition of the reaction solution and the temperature cycle conditions were the same as in 1).

forward primer (Tsubaki line number ： 13):

5 -ccagctcacccgcacccaggacagtc-ύ '

reverse primer (for pcDNA3.1-mBST2D-His, SEQ ID NO: 14):

5 -tttttttctcgagtcaatgatgatgatgatgatgaaagagcagaaacagtgacactttga-3

reverse primer (for pcDNA3.1-mBST2H-His, SEQ ID NO: 15):

5'— tttttttctcgagtcaatgatgatgatgatgatggaagtctccttttggatcctgagctg— 3,

[0122] After confirming that the DNA fragment of the desired size was amplified by agarose gel electrophoresis, phenol chloroform extraction, ethanol precipitation, and dissolution in 10 μL of TE buffer were performed. This was cleaved with restriction enzymes BamH I and Xho I (Takara Bio), purified by agarose gel electrophoresis using QIAquick Gel Extra ction Kit (QIAGEN), ethanol precipitated, and dissolved in TE buffer 4 μ1 .

[0123] On the other hand, 5 μg of PCDNA3.1—mBST2D and pcDNA3.1—mBST2H were digested with restriction enzymes BamH I and Xho I, treated with CIAP (Takara Bio), purified by agarose gel electrophoresis, and ethanol precipitated. Then, it was dissolved in 4 μL of TE buffer. 2 μL of each DNA fragment amplified by PCR and 0.5 μL of these plasmids were ligated using ligation kit ver. II (manufactured by Takara Bio Inc.), and transformed into E. coli DH5. [0124] After culturing at 37 ° C in LB medium (100 μg / ml ampicillin), several colonies that appeared were selected, and plasmids were extracted from them using QIAprep Spin miniprep kit (QIAGEN) . The base sequence of the DNA fragment inserted into the extracted plasmid was determined according to a standard method. It was confirmed that a DNA fragment to which a base sequence encoding a His tag was added was inserted, and the desired constructs PCDNA3.1-mBST2D-His and PCDNA3.1-mBST2H-His were obtained.

[0125] 3) Western— blotting

Spread 10 COS7 cells with 5xl0 ⁵ on a 6cm dish and incubate at 37 ° C, 5% CO for 20 hours.

2

It was. The cultured COS7 cells were transformed with pcDN A3. L-mBST2D-His or pcDNA3.1-mBST2H-His by Effectene trasfection Reagent (Qiagen). The operation followed the protocol of the product. After incubation for 48 hours at 37 ° C '5% CO, wash with PBS, PBS /

2

Cells were detached and recovered with 5 mM EDTA. The collected cells were further washed with PBS, and 2 ml of RIPA buffer containing IxHalt Protease Inhibitor Coctail (PIERCE) was collected and lysed on ice for 1 hour. The composition of RIPA buffer is shown below.

50 mM Tris-HCl (pH 7.4),

150 mM NaCl,

1% Triton x- 100,

0.5% sodium deoxycholate,

0.1% SDS

[0126] The cells after lysis were centrifuged at 4 ° C, 15000 rpm for 5 minutes. The supernatant was concentrated to L or less with Microcon YM-10 (MILLIPORE) and used as a sample for Western blotting. On the other hand, the precipitate was washed once again with 1 mL of RIPA buffer containing IxHalt Protease Inhibitor Coctail (PIERCE) and used as a sample for Western blotting.

Precipitate with 200 L of lx-denatured buffer and concentrate the supernatant with an equal volume of 2x-denatured buffer, boil at 100 ° C for 10 minutes, and then add 5 μL each of NuPAGE4-12% Bis-Tris Gel Electrophoresis was performed using (Invitrogen). The gel force after electrophoresis was also transferred to a PVDF membrane (MILLIPORE) using a semi-dry blotting device (BIO CRAFT, MODEL BE-330). [0127] Imnostar kit (manufactured by Wako Pure Chemical Industries, Ltd.) was used for detection by antibody. First, as a primary antibody, an HRP-labeled anti-His tag antibody (manufactured by Invitrogene) was used at a concentration of 5000-fold dilution, and a signal was detected according to the protocol of the Imunostar kit. After detection of the signal, the PVDF membrane is treated with a denaturing solution (7M guanidine hydrochloride, 50 mM glycine, 0.05 mM EDTA, 0.1 M potassium chloride, 20 mM 2-mercaptoethanol) for 1 hour at room temperature. Thus, the labeled anti-His tag antibody was removed. Next, a signal was detected in the same manner using a SNK01 antibody labeled with piotin. The result is shown in FIG.

[0128] In the monoclonal antibody SNK01, a clear band was observed at the position of the molecular weight (about 20 kD) predicted from the amino acid sequence. SNK01 reacted strongly against both BST2D (SEQ ID NO: 10) and BST2H (SEQ ID NO: 8). A strong reaction was detected even at positions above 20 kD. These large molecular weight proteins were expected to have sugar chain modifications. BST2D (SEQ ID NO: 10) showed a stronger signal in the precipitate than the supernatant. BST2H (SEQ ID NO: 8) also showed a stronger signal in the precipitate, but a strong antibody reaction was also detected in the supernatant. The reason why the His tag antibody signal against BST2D (SEQ ID NO: 10) was not detected was thought to be because the His tag added to the C-terminal had been removed by processing.

Example 8

[0129] Cloning of a novel splicing variant of mouse BST2

Mouse isolated from RNA extracted from mouse IPC that is highly isolated by a cell sorter (FACSVantage, manufactured by Becton Dickinson) It was confirmed. The base sequences of primers used for PCR are as follows.

Forward for SEQ ID NO: 7 (SEQ ID NO: 16):

5 -acatggcgccctctttctatcac-3

reverse (SEQ ID NO: 17):

0 -gagcccaggttttgaaggaagtg-3

As a result, short amplified fragments were observed in addition to the amplified fragments corresponding to the cDNA. When this amplified fragment was cloned by a conventional method and the nucleotide sequence was confirmed, it was shown in SEQ ID NO: 7. In addition, the second exon part of mBST2H had a deleted base sequence. That is, it was considered to be a novel splicing variant of mouse BST2 having the nucleotide sequence shown in SEQ ID NO: 18. The amino acid sequence encoded by this gene is shown in SEQ ID NO: 19. The gene described in SEQ ID NO: 18 is hereinafter also referred to as mBST2HS.

The alignment of the amino acid sequences of mBST2D, mBST2H, and mBST2HS is shown in Fig. 7 (a), and the genome structure of each is shown in Fig. 7 (b).

Example 9

[0130] Construction of mouse BST2 expression vector

The mBST2D and mBST2H cDNA obtained in Example 6 was used as a saddle, and PCR was performed under the following conditions using primers consisting of the following base sequences.

forward primer ；

tttttgctagcgacggatcacatggcgccctctttctatcactatctgcccgtgcccatggatgagatgggggggaagca agga (SEQ ID NO: 11) and

reverse primer ； tttttttctcgagtcctcaaaagagcaggaacagtgac (lc ^ [J¾-^ ": 12)

DNA polymerase: LA Taq (Takara Bio Inc.)

[95 ° C for 30 seconds, 55 ° C for 30 seconds, 72 ° C for 2 minutes] 25 cycles

[0131] Each amplified fragment was digested by treating with restriction enzymes Nhel and Xhol (V, both are manufactured by Takara Bio Inc.), and then similarly treated with Nhel and Xhol. PcD NA3.1 -Ligated using Zeo (+) (Invitrogen) and ligation kit ver.II (Takara Bio Inc.) to obtain each expression vector. The mBST2HS expression vector was prepared by removing the second exon portion of mBST2H according to a standard method using PCR. Example 10

[0132] Humanolog cDNA cloning and expression vector construction

When a human orthologue of the mouse IPC-specific antigen BST2 identified in the present invention was searched, it was a known gene reported as human BST2 (IshikawaJ. Et al. Genomics, 1995; 26, 527-; GenBank Acc #. D28137). Furthermore, including the novel splicing variant humanolog found in mice, it was cloned by PCR as follows to prepare three types of expression vectors. [0133] In accordance with the method described in the following example, human IPC stimulated with Herpes Simplex virus was prepared, RNA was extracted, and first strand cDNA was extracted using Superscript First Strand System Kit (Invitrogen). Synthesized. In this form, hBST2 primer F; aaaaaaagctagctggatggcatctacttcgtatg (酉 Self sequence number: 20) and hBST2 primer R; PCR (95 ° C for 30 seconds, 55 ° C for 30 seconds, 72 ° C for 2 minutes, 25 cycles) The amplified fragment was digested with restriction enzymes Nhel and Xhol, and then PCDNA3.1-Zeo It was inserted into the Nhe Xhol site of (+) (Invitrogen) and used as an expression plasmid for human BST2.

[0134] For genes that are orthologues of mouse splicing variants, PCR (95 ° C at 30 ° C) using LA Taq as an enzyme with primers consisting of the following base sequences from the IPC cDNA library. Second, 55 ° C for 30 seconds, 72 ° C for 2 minutes, 25 cycles). cDNA was synthesized by GeneRacer kit (Invitrogen). The amplified fragment was cleaved with the restriction enzymes Nhel and Xhol, and then inserted into the Nhel-Xhol site of pcDNA3.1-Zeo (+) (Invitrogen) to obtain an expression plasmid.

Primer for mBST2H ortholog

hBST2 primer F (SEQ ID NO: 20) and

primerhBHR; ttttttctcgagctagggatgtgggggtgagaggaatgtggcaggtggagggtagcgggggaagg ctatctctgacctcagtcgctccacctctgcagac (self column number: 22)

Primer for mBST2HS ortholog

hBST2 primer F (SEQ ID NO: 20) and

pnmerhBi f2HSRl; aaaaaaactcgagcttatggtttaatgtagtgatctctccacagtgtggttgcaggtggc ggcct (SEQ ID NO: 23)

[0135] The base sequence of human BST2, which is a known gene, is shown in SEQ ID NO: 1, and the amino acid sequence is shown in SEQ ID NO: 2. Hereinafter, the gene having this sequence is also referred to as hBST2D. In addition, the base sequence of the human ortholog of mBST2H (hereinafter also referred to as hBST2H) obtained as described above is shown in SEQ ID NO: 3, the amino acid sequence is shown in SEQ ID NO: 4, and the human ortholog of mBST2HS (hereinafter also referred to as hBST2HS). The nucleotide sequence is shown in SEQ ID NO: 5, and the amino acid sequence is shown in SEQ ID NO: 6. The alignment of the amino acid sequences of hBST2D, hBST2H, and hBST2HS is shown in Fig. 8 (a). The genome structure is shown in Fig. 8 (b). It was suggested that hBST2H and hBST2HS are novel splicing variants.

Example 11

[0136] Production and evaluation of antibodies recognizing mouse BST2

1) Preparation of anti-mouse BST2 antibody

An antibody that recognizes any of the three subtypes D, H, and HS of mouse BST2 or multiple antibodies was prepared as follows.

Inoculate ⁵ x 6 cm dishes with 5 x ⁴ CLO cells per cell, and after culturing for 20 hours, according to the protocol of the same product using Effectectransection Reagent (Qiagen) Three expression vectors cloned with type cDNA were mixed in the same amount (1 g per dish) and transfected. After 24 hours, the medium was replaced with fresh medium. After another 24 hours, the cells were collected with PBS / 5 mM EDTA, washed with PBS, and then added to the foot pads of both feet of Wister rat (5-6 weeks old). Infused with CFA.

[0137] Lymph nodes were collected on the 12th day from rats immunized by performing such operations on the 0th, 4th, and 11th days, and hyperpridoma was administered in the same manner as shown in Example 1. Produced. Hypridoma culture supernatants were screened by Cell ELISA, and clones were selected that reacted with COS7 cells transfected with the three expression vectors but did not react with host COS7 cells. In addition, FACS analysis confirmed the binding activity and cell cloning, and finally 5 positive clones were obtained.

[0138] 2) Effects on mouse IFN production

Using the culture supernatant of the obtained clone, the effect on IFN production was examined in accordance with the method shown in Example 5. V and the deviation were less active in inhibiting IFN production of IPC than the control antibody. there were. Furthermore, when stimulated with 0.1 μ 示し CpG ODN 1668 (MWG Biotech), it also showed IFN production inhibitory activity (FIG. 9). From this, it was confirmed that antibodies against mBST2 other than SNK01 also showed activity to suppress IFN production from IPC. Example 12

[0139] Production and evaluation of antibodies recognizing human BST2 (hBST2) 1) Production of human BST2 antibody

An antibody that recognizes any or all of the three subtypes D, H, and HS of human BST2 was prepared in the same manner as in Example 11. Using three types of expression vectors cloned in each type of human cDNA prepared in Example 10, the culture supernatant was subjected to FACS analysis to screen for hyperidoma. Multiple clones such as 3D3 # 7, 3E2 # 8, 5C11 # 7, 3G7 # 6 were obtained. Purified antibodies of the obtained clones were obtained and further analyzed.

[0140] 2) Effects on human IFN production

Peripheral blood was collected from healthy individuals and PBL (peripheral blood lymphocytes) were isolated. Various cells were removed by MACS with Lineage antibodies (CD3, CD14, CD16, CD19, CD20, CD56 antibodies), and then CD4-positive, CD123-positive, and Lineage-negative cell groups were separated as IPCs using a cell sorter. The good urchin acquired human IPC was seeded in 96 well plates at 2xl0 ⁴ cells / well, were each cultured for 1 hour at 3, 10, 30 μ g / in a concentration mL by the addition of anti-BST2 antibody 37 ° C. After culturing for 1 hour, Herpes Simplex virus (20 pfo / cell) was added and cultured at 37 ° C for 24 hours, and IFN a in the culture supernatant was measured by ELISA kit (Bender Med System). As a result, it was clarified that the anti-human BST2 antibody exhibited HI HFN production inhibitory activity in the same manner as the previously reported BDCA2 antibody (Miltenyi) (FIG. 10). That is, it became clear that an antibody that recognizes human BST2 affects the IFN production activity of cells expressing the molecule.

Example 13

[0141] In vivo evaluation of antibodies

1) Analysis of cells collected from antibody-treated mice

Balb / c mice were intraperitoneally administered SNK01, SNK03, and control rat IgG, 300 g each, 3 times every other day (0.9 mg / mouse). On day 6, spleen and bone marrow were Collected. Furthermore, bone marrow cells were seeded in 96well plates at lxl0 ⁶ / well, had there CpG (0.5 M) were stimulated by influenza virus PR8, were measured by ELISA site force in value of the culture supernatant after 24 h ( (Figure 11).

As a result, it was clarified that in the SNK01 and SNK03 administration groups, IFN production ability to various IPC stimuli was low. In other words, IPC function changes due to antibody administration. It was shown that the ability to produce IFN by in vitro stimulation was suppressed.

[0142] 2) Analysis using virus-infected mice

5xl0 ⁴ pfo / mouse MCMV (mouse cytomegalovirus) was administered intraperitoneally to mice (n = 3) pre-administered with antibodies (500 g per mouse 1.5 days and 0.5 days before) to cause infection. . After this infection, IFNa in the serum of mice 1.5 days later was measured by ELISA. In addition, the cell population of IPC in the spleen was analyzed by staining with B220, CDllc, and CD1 lb (FIG. 12).

As a result, serum IFN production was suppressed in the SNK01 administration group. In other words, it was shown that administration of this antibody resulted in a change in the function of cells expressing the molecule, and the ability to produce IFN in vivo was suppressed.

Example 14

[0143] Analysis using autoimmune disease model mouse

NZB (New Zealand Black) mice that spontaneously develop autoimmune hemolytic anemia and F1 mice that appear to be normal NZW (New Zealand White) mice spontaneously develop lupus nephritis. (Helyer BJ et al. Nature 197; 197,1963) These mice (Japan SLC) were used for analysis. First, the IPC cell population in bone marrow, spleen, and peripheral blood was measured by FACS analysis. As a result, compared to 129 mice used as controls, NZB and NZB / WF1 mice that develop autoimmune disease showed an increase in the number of IPCs, particularly in the bone marrow (Figure 13). .

[0144] In addition, each mouse force also bone marrow cells harvested and sowing in 96well plates at lxl0 ⁶ / well, and stimulated by CpG (0.5 M) or influenza virus PR8, by adding various antibody, after 24 hours The cytodynamic force-in value of the culture supernatant was measured by ELISA as shown in Example 5. As a result, IFN production-suppressing activity was observed when SNK01 antibody and SNK03 antibody were added, unlike control IgG or 2E6 antibody-added as described in WO2004 / 013325 (FIG. 14). This revealed that the SNK01 and SNK03 antibodies inhibit IFN production of model mouse-derived IPC.

Example 15

[0145] Antibody administration test to lupus nephritis model mice NZB / W Fl mice (Japan SLC) were bred in an SPF environment and administered with antibodies as follows for 5 months from 2 months to 7 months of age. Each group of 10 mice, SNK01, SNK03, and control rat I _{g G} (ICN Pharmaceuticals ^) to 250 g each per animal was administered a week 2 Kaihara lumen.

[0146] Once every two weeks, 10 μL of urine is periodically taken on filter paper, fixed with alcohol, stained with BPB (Bromophenol Blue), and a protein (BSA; bovine serum albmin) solution at a known concentration as a standard. (Knight et al. Clin. Exp. Immunol. 28; 352-358, 1977) o As an indicator of protein mass, 1: -37 mg / dl, 2: -74 mg / dl, 3: ~ Ll lmg / dl, 4: ~ 3 33mg / dl, 5: ~ 1000mg / dl, 6: ~ 3000mg / dl, 3: ll lmg / dl or more as positive and cumulative positive rate (proteinuria frequency) Was calculated. As a result, suppression of proteinuria was observed in the SNK01 and SNK03 antibody administration groups, indicating that nephritis was suppressed (FIG. 15).

Serum was collected from each 5-month-old mouse, and the IFNa concentration in the serum was measured by the method shown in Example 4, and the TNFα concentration was measured by ELISA Development kit (Genzyme-Techne). As a result, in each of the SNK01 and SNK03 antibody administration groups, the amount of production of site force in was suppressed (FIG. 16).

Example 16

[0147] Therapeutic effect of antibody administration to lupus nephritis model mice

NZB / W F1 mice were bred, and antibodies were administered from 5 to 8 months of age when nephritis developed, and the effects were compared. Each group consisted of 6 animals, and the following substances were administered intraperitoneally twice a week. The amount of protein in urine of each group was measured in the same manner as in Example 15 for comparison. Predonin is a steroid used to treat autoimmune diseases. Prednisolone sodium succinate manufactured by Shionogi & Co. was used as predonin (hereinafter referred to as predonin or PD).

1) SNK01 antibody 250 μg + predonin 0.5 mg,

2) Control rat IgG (ICN Pharmaceuticals, Inc.) 250 _i ug + predonin 0.5mg

3) Predonin 0.5mg only

In 8-month-old mice after treatment, the degree of proteinuria was higher in the combination of SNK01 antibody and predonin than in the group administered predonin alone or predonin + control antibody. It was suggested that there is a therapeutic effect on the onset of nephritis (Fig. 17). In the figure, black circles are dead mice and indicate the degree of proteinuria immediately before death.

Industrial applicability

[0148] According to the present invention, a therapeutic agent and a therapeutic method for nephritis targeting the IPC are provided. IPC includes cells that produce thousands of times as many IFNs as other cells. Therefore, if IFN production ability and cell survival (some! /, Is the number of cells) are suppressed, shifted or both, IFN production is effectively suppressed and alleviates symptoms such as nephritis. be able to. The therapeutic agent of the present invention that acts on IPC realizes more essential treatment through improvement of immune balance of nephritis patients that is not limited only by suppression of renal inflammation symptoms.

[0149] In addition, the present invention provides a method for detecting therapeutic activity for nephritis and a method for screening candidate compounds useful for treatment using the method. According to the present invention, regulation of IPC activity was revealed to be an important issue in the treatment of 1S nephritis. Therefore, a compound useful for treating nephritis can be selected by selecting a compound that modulates the activity of IPC. That is, the compound selected based on the screening method of the present invention is useful for the treatment of nephritis.

Claims

The scope of the claims

[I] Therapeutic agent for nephritis containing an interferon-producing cell activity inhibitor as an active ingredient

[2] The agent for inhibiting the activity of interferon-producing cells The therapeutic agent according to claim 1, which is a substance having an action of suppressing either or both of interferon production and cell survival of interferon-producing cells.

[3] The therapeutic agent according to claim 2, which is an antibody having an action of suppressing either or both of interferon production and cell survival of interferon-producing cells.

[4] The therapeutic agent according to claim 3, wherein the antibody is an antibody that recognizes one or both of BST2 and its homolog, or an antibody fragment containing at least an antigen-binding region thereof.

[5] Hybridoma 3D3 # 7 deposited as FERM BP-10339, or FERM BP-1

The therapeutic agent according to claim 4, which is an antibody comprising at least an antigen-binding region of a monoclonal antibody produced by hybridoma 3G7 # 6 deposited as 0340.

[7] The therapeutic method according to claim 6, wherein the interferon-producing cells are to be inhibited by interferon-producing cells, interferon production and / or cell survival.

[8] The process power of suppressing the activity of interferon-producing cells. The method comprises the step of administering an antibody having an action of suppressing either or both of interferon production and cell survival of interferon-producing cells. The method of treatment described.

[9] The method according to claim 8, wherein the antibody is an antibody that recognizes either or both of BST2 and its homologue, or an antibody fragment containing at least an antigen-binding region thereof.

[10] The antibody is an antibody containing at least the antigen-binding region of the monoclonal antibody produced by hybridoma 3D3 # 7 deposited as FERM BP-10339 or hybridoma 3G7 # 6 deposited as FERM BP-10340. The treatment method according to claim 9.

[II] A method for detecting the therapeutic effect of a test compound on nephritis, comprising the following steps:

(1) Induction of interferon production by interferon-producing cells and interferon-producing cells The step of contacting the conductive material in the following order i) -iii):

(2) measuring the activity of interferon-producing cells, and

12. The method according to claim 11, wherein the cell stimulating agent is at least one cell stimulating agent selected from the group consisting of viruses, viral components, and bacterial DNA.

[13] The method according to claim 11, wherein the test compound is an antibody recognizing an interferon-producing cell or an antibody fragment containing at least an antigen-binding region thereof.

[14] A screening method for a compound having a therapeutic effect on nephritis, comprising a step of selecting a test compound in which the therapeutic effect on nephritis is detected by the method according to claim 11.

[15] A therapeutic agent for nephritis comprising a compound selected by the screening method according to claim 14 as an active ingredient.