WO2006050984A2 - Recombinant newcastle disease virus - Google Patents

Recombinant newcastle disease virus Download PDF

Info

Publication number
WO2006050984A2
WO2006050984A2 PCT/EP2005/012186 EP2005012186W WO2006050984A2 WO 2006050984 A2 WO2006050984 A2 WO 2006050984A2 EP 2005012186 W EP2005012186 W EP 2005012186W WO 2006050984 A2 WO2006050984 A2 WO 2006050984A2
Authority
WO
WIPO (PCT)
Prior art keywords
virus
recombinant
protein
ndv
prodrug
Prior art date
Application number
PCT/EP2005/012186
Other languages
French (fr)
Other versions
WO2006050984A3 (en
Inventor
Rudolf Beier
Florian PÜHLER
Klaus Bosslet
Hans Jörg WILLUDA
Original Assignee
Bayer Schering Pharma Aktiengesellschaft
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to US11/667,563 priority Critical patent/US20080206201A1/en
Priority to JP2007540601A priority patent/JP2008519590A/en
Priority to EP05818947A priority patent/EP1812026A2/en
Priority to EA200700975A priority patent/EA013615B1/en
Priority to CA002585435A priority patent/CA2585435A1/en
Priority to AU2005303912A priority patent/AU2005303912B2/en
Application filed by Bayer Schering Pharma Aktiengesellschaft filed Critical Bayer Schering Pharma Aktiengesellschaft
Priority to NZ554429A priority patent/NZ554429A/en
Priority to BRPI0517834-7A priority patent/BRPI0517834A/en
Publication of WO2006050984A2 publication Critical patent/WO2006050984A2/en
Publication of WO2006050984A3 publication Critical patent/WO2006050984A3/en
Priority to IL182083A priority patent/IL182083A0/en
Priority to NO20072967A priority patent/NO20072967L/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00Rearing or breeding animals, not otherwise provided for; New breeds of animals
    • A01K67/027New breeds of vertebrates
    • A01K67/0271Chimeric animals, e.g. comprising exogenous cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66Microorganisms or materials therefrom
    • A61K35/76Viruses; Subviral particles; Bacteriophages
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66Microorganisms or materials therefrom
    • A61K35/76Viruses; Subviral particles; Bacteriophages
    • A61K35/768Oncolytic viruses not provided for in groups A61K35/761 - A61K35/766
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/1703Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • A61K38/1709Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/19Cytokines; Lymphokines; Interferons
    • A61K38/20Interleukins [IL]
    • A61K38/2013IL-2
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/43Enzymes; Proenzymes; Derivatives thereof
    • A61K38/46Hydrolases (3)
    • A61K38/47Hydrolases (3) acting on glycosyl compounds (3.2), e.g. cellulases, lactases
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00Cosmetics or similar toiletry preparations
    • A61K8/18Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/33Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds containing oxygen
    • A61K8/34Alcohols
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00Cosmetics or similar toiletry preparations
    • A61K8/18Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/33Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds containing oxygen
    • A61K8/35Ketones, e.g. benzophenone
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00Cosmetics or similar toiletry preparations
    • A61K8/18Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/33Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds containing oxygen
    • A61K8/37Esters of carboxylic acids
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00Cosmetics or similar toiletry preparations
    • A61K8/18Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/49Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds containing heterocyclic compounds
    • A61K8/494Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds containing heterocyclic compounds with more than one nitrogen as the only hetero atom
    • A61K8/4953Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds containing heterocyclic compounds with more than one nitrogen as the only hetero atom containing pyrimidine ring derivatives, e.g. minoxidil
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00Cosmetics or similar toiletry preparations
    • A61K8/18Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/92Oils, fats or waxes; Derivatives thereof, e.g. hydrogenation products thereof
    • A61K8/922Oils, fats or waxes; Derivatives thereof, e.g. hydrogenation products thereof of vegetable origin
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00Cosmetics or similar toiletry preparations
    • A61K8/18Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/96Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution
    • A61K8/99Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution from microorganisms other than algae or fungi, e.g. protozoa or bacteria
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61QSPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00Preparations for care of the skin
    • A61Q19/08Anti-ageing preparations
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00Animals characterised by purpose
    • A01K2267/03Animal model, e.g. for test or diseases
    • A01K2267/0331Animal model for proliferative diseases
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/33Fusion polypeptide fusions for targeting to specific cell types, e.g. tissue specific targeting, targeting of a bacterial subspecies
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011Details
    • C12N2760/18011Paramyxoviridae
    • C12N2760/18111Avulavirus, e.g. Newcastle disease virus
    • C12N2760/18122New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011Details
    • C12N2760/18011Paramyxoviridae
    • C12N2760/18111Avulavirus, e.g. Newcastle disease virus
    • C12N2760/18132Use of virus as therapeutic agent, other than vaccine, e.g. as cytolytic agent
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011Details
    • C12N2760/18011Paramyxoviridae
    • C12N2760/18111Avulavirus, e.g. Newcastle disease virus
    • C12N2760/18141Use of virus, viral particle or viral elements as a vector
    • C12N2760/18143Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector

Abstract

The goal of the invention is to increase the therapeutical activity of oncolytic NDV. This issue is solved by a Newcastle Disease Virus comprising a recombinant nucleic acid, wherein the nucleic acid codes for a binding protein that has a therapeutic activity when expressed by the virus-infected tumor cell. Binding proteins belong to the following group: A natural ligand or a genetically modified ligand, a recombinant soluble domain of a natural receptor or a modified version of it, a peptide-ligand, an antibody molecule and derivatives thereof or antibody-like molecules like ankyrin repeat molecules or derivatives thereof.

Description

Recombinant Newcastle Disease Virus
Introduction
5The invention refers to a recombinant RNA-virus, preferably a paramyxovirus, preferably Newcastle Disease Virus (NDV) for treatment of diseases, especially for oncolytic tumor treatment. Recombinant viruses are produced that encode binding proteins (antibodies, ankyrin repeat molecules, peptides etc.), prodrug-converting enzymes and/or proteases and lead to the loselective expression of these molecules in virus-infected tumor cells. The activity of these binding proteins, prodrug-converting enzymes and/or proteases increases the anti-tumor effect of the virus. Further the invention describes manufacture and the use of such modified viruses for treatment of cancer.
15
Description of the State of the Art
Newcastle Disease Virus
Oncolytic viruses in general for the treatment of tumors are reviewed in θChiocca (2002). Newcastle Disease Virus has been used as an experimental therapeutic agent for more than 40 years and is reviewed by Sinkovics and Horvath (2000). The Newcastle Disease Virus in general is described in the book by Alexander (1988). NDV strain PV701 is being developed as an anticancer treatment for glioblastoma (Lorence et al., 2003). The NDV strain 5MTH68 has been used as an experimental cancer treatment and has been administered to humans for more than 30 years (Csatary et al., 2004).
In the paper by Stojdl et al. (2003) it is described that in the range of 80% of all tested tumor cell lines, there is a defect in the interferon response 0following infection with Vesicular Stomatitis Virus (VSV). It may be assumed that a similar percentage of tumor cell lines will be susceptible to infection with NDV because both VSV and NDV are members of the order mononegavirales. It has also been shown that the mechanism of selective replication of NDV in tumor cells is based on a defect in the cellular interferon δresponse against the virus (see e.g. US: 20030044384).
Recombinant paramyxoviruses
EP-A-0702085 relates to genetically manipulated infectious replicating non- segmented negative-stranded RNA virus mutants, comprising an insertion ioand/or deletion in an open reading frame, a pseudogen region or an intergenic region of the virus genome.
WO 99/66045 relates to genetically modified NDV viruses obtained from full- length cDNA molecules of the virus genome.
15
WO 00/62735 relates to a method of tumor treatment comprising administering an interferon-sensitive, replication-competent clonal RNA virus, e.g. NDV.
0ln WO 01/20989 (PCT/USOO/26116) a method for treating patients having tumor with recombinant oncolytic paramyxoviruses is described. The tumor is reduced by administering a replication-competent Paramyxoviridae virus. Various methods are described that can be used to engineer the virus genome in order to improve the oncolytic properties. 5
WO 03/005964 relates to recombinant VSV comprising a nucleic acid encoding a cytokine. US 6,699,479 describes NDV mutants expressing the V-protein at a reduced level and comprising nucleotide substitutions in an editing locus.
US 2004/0170607 relates to the treatment of melanoma by administering a δvirus which is not a common human pathogen.
Genetic manipulation of NDV
NDV can be genetically manipulated using the reverse genetics technology as described e.g. in EP-A-0702 085. For example, it is known to make iorecombinant NDV constructs comprising additional nucleic acids coding for secreted alkaline phosphatase (Zhao and Peeters, 2003), green fluorescent protein (Engel-Herbert et al., 2003), VP2 protein of infectious bursal disease virus (Huang et al., 2004), influenza virus hemagglutinin (Nakaya et al., 2001) and chloramphenicol acetyl transferase (Huang et al., 2001) (Krishnamurthy
I5et al., 2000). None of these recombinant NDV has been constructed for use in the treatment of human disease. The recombinant NDVs were made to study either basic virology of NDV or to develop vaccine strains for poultry. As parental virus strains served lentogenic strains of NDV. These strains do not have significant oncolytic properties.
20
Summary of the Invention
This present invention relates to an RNA virus, e.g. an NDV having increased oncolytic activity. More particularly, the invention relates to an RNA virus, particularly a Newcastle disease virus comprising a recombinant nucleic acid 25having the therapeutical relevance in treatment of cancer, wherein the nucleic acid codes for a binding protein, a prodrug-converting enzyme and/or a protease that have a therapeutic activity when expressed by the virus- infected tumor cell. More preferred are recombinant oncolytic viruses, e.g. NDVs comprising one ore more transgenes, wherein the transgene(s) is / are coding for a binding protein, a prodrug-converting enzyme and/or a protease. Combinations of different specificities are possible.
5
Further, the invention relates to the nucleocapsid of the recombinant virus as indicated above, comprising viral RNA complexed with capsid proteins or to the viral RNA and/or an RNA complementary to the viral RNA in its isolated form. 0
Furthermore, the invention relates to a DNA, e.g. a cDNA encoding the viral RNA and/or an DNA complementary to the viral RNA. Furthermore, the invention relates to the prevention or treatment of tumor diseases.
5Detailed description of Preferred Embodiments:
Viruses
The invention generally relates to RNA viruses, preferably negative strand RNA viruses, more preferably such viruses that have both oncolytic θproperties and can be genetically engineered. Such viruses are:
- paramyxoviruses, preferably Newcastle Disease Virus (NDV)1 measles virus, mumps virus, Sendai virus;
- orthomyxoviruses, preferably influenza virus;
- rhabdoviruses, preferably vesicular stomatitis virus. 5
Therefore, the subject of the present invention is a recombinant oncolytic RNA virus comprising a nucleic acid with at least one transgene, wherein the nucleic acid of this transgene(s) codes for a binding protein that has a therapeutic activity when expressed by the virus-infected tumor cell. Another subject of the present invention is a recombinant oncolytic RNA virus comprising a nucleic acid with at least one transgene, wherein the nucleic acid of this transgene(s) codes for a prodrug-converting enzyme that has a therapeutic activity when expressed by the virus-infected tumor cell, δpreferably in combination with the corresponding prodrug.
Yet another subject of the present invention is a recombinant oncolytic RNA virus comprising a nucleic acid with at least one transgene, wherein the nucleic acid of this transgene(s) codes for a protease that has a therapeutic loactivity when expressed by the virus-infected tumor cell.
Preferably the virus of the present invention exhibits a tumor-selective infection that leads to a tumor-selective expression of the encoded transgene.
15
The recombinant oncolytic virus of the present invention may carry at least one transgene gene independently selected from transgenes coding for binding proteins, prodrug-converting enzymes, and/or proteases.
0lt is preferred that the virus of the present invention is a negative strand RNA virus, more preferably a paramyxovirus.
In the context of the present invention, a nucleic acid with at least one transgene is a nucleic acid comprising a gene which is heterologous to the 5oncolytic RNA virus on which the recombinant RNA virus of the present invention is based. The term "heterologous" refers to the complete gene or a part thereof, which may be the coding region of the gene or a part thereof.
The heterologous gene may be an artificial sequence or may be obtained 0from natural sources or by recombination of at least two sequences selected from sequences obtained from natural sources and/or artificial sequences. "Natural sources" include animals such as mammals, plants, fungi, and microorganisms such as bacteria, protozoa and viruses, which may be different from other oncolytic RNA viruses of the present invention. The δtransgene may also encode for a fusion protein. Mammals include humans and mice.
In an especially preferred embodiment, the virus of the present invention is a Newcastle Disease Virus, (NDV), most preferred is NDV strain MTH68. The 0NDV may be a lentogenic, mesogenic or velogenic strain. Especially preferred are mesogenic or velogenic NDV strains. The virus is preferably replication competent.
Genetic manipulation of viruses 5
Methods for genetically manipulating RNA viruses are well known as stated above. Further, genetic manipulation of oncolytic viruses is reviewed e.g. in Bell et al. (2002). RNA viruses as virotherapy agents are reviewed in Russell (2002). The content of any of these documents is herein incorporated by θreference.
Binding proteins
In the oncolytic recombinant RNA virus of the present invention, at least one 5transgene may code for a binding protein.
Binding proteins are proteins, which, when expressed in a target cell, are capable of binding to a component of said cell and/or a neighbouring cell. Preferably, binding proteins are proteins which bind to intracellular θcomponents. In a preferred embodiment, binding proteins belong to the following group: a natural ligand or a genetically modified ligand, a recombinant soluble domain of a natural receptor or a modified version of it, e.g. a peptide- or polypeptide- δligand, an antibody molecule and fragments and derivatives thereof or an antibody-like molecule and derivatives thereof.
An incomplete review of high-affinity binding frameworks is given by Ladner and Ley (2001). 0
The binding proteins as described above might be of human, murine or closely related origin or a chimeric version, i.e. a protein which may be a fusion protein comprising sequences from different species, e.g. human and mouse. 5
The recombinant binding molecules based on the description above can be monomeric, dimeric, trimeric, tetrameric or multimeric and bispecific or multispecific.
θThe preferred binding proteins are selected from binding proteins having a therapeutic activity.
A natural ligand as described above can be a growth factor or a peptide. A genetically modified ligand may be an analogue of a naturally occurring 5growth factor or peptide.
Recombinant soluble domains of a natural receptor or modified versions of it as described above are recombinantly expressed soluble extracellular domains of a cell-surface receptor and/or fragments of it, a recombinantly expressed soluble extracellular domain of a cell adhesion molecule and/or fragments thereof.
Antibody molecules as mentioned above may be monoclonal immunoglobulin δantibodies of any known specificity and isotype, fragments thereof and/or fragments thereof fused to effector proteins. The antibody molecules may be chimeric, humanized or human antibodies. Antibody fragments contain at least one antigen-binding domain of an antibody. Antibody fragments have been described extensively in the literature (reviewed eg. in Allen (2002), ioherein incorporated by reference). Preferred examples are single-chain Fv fragments, Fab fragments, F(ab2'), domain-deleted versions called minibodies, and other immunoactive portions, fragments, segments and other smaller or larger partial antibody structures wherein the latter possess sufficient targeting properties or immunological stimulatory or inhibitory iδactivity so as to be therapeutically useful within the methods of the present invention.
Such antibodies may be derived from hybridoma cloning experiments by use of transgenic mice or from phage display selections, ribosome display 2θselections, or colony filter screening of antibody libraries containing human antibody sequences or related methodologies.
Binding proteins with antibody like properties as described above may be genetically modified proteins or domains of it in which one or more peptide
25loops are randomized on the level of amino acids in such a way that high affinity binding molecules with high specificity can be enriched against any antigen from libraries of such molecules by phage display, ribosome display, colony filter screen or related methodologies. The selected proteins usually have high thermal and thermodynamic stability and are well expressed in
3θrecombinant expression systems such as E.coli, yeast, insect and mammalian expression system. Examples for such binding proteins with antibody like properties are ankyrin repeat proteins as described in Binz et al. (2004), the lipocalins as described in Skerra (2000), the gamma-crystallins as described in DE199 32 688.6, the modified protein A scaffold (affibodies) as described in Hogbom et al. (2003), or Nord et al. (2000) or the fibronectin δframework and others. Antibody-like molecules can be monomeric or repetitive molecules either constructed as single-chain molecules or as multichain molecules wherein the antibody-like molecule possesses sufficient targeting properties or immunological stimulatory or inhibitory activity so as to be therapeutically useful within the methods of the present invention.
10 Binding molecules with additional function
The binding protein may be a fusion protein comprising at least one binding domain, e.g. from an antibody, and a heterologous domain. "Heterologous" iδhas the meaning as discussed above in the context of heterologous genes.
The binding proteins described above are able to deliver a payload to a disease specific site (e.g. a tumor) as a so called intrabody or as extracellular available binding protein. The delivered payload can be a heterologous
20domain, e.g. a toxin such as human RNAse (De Lorenzo et al., 2004) (Zewe et al., 1997) Pseudomonas exotoxin (Chaudhary et al., 1989) (Kreitman and Pastan, 1995) (Batra et al., 1992) , Diphtheria toxin (Kreitman et al., 1993) (Chaudhary et al., 1990) (Batra et al., 1991), or an enzyme such as beta- galactosidase, beta-glucuronidase (Roffler et al., 1991) (Wang et al., 1992) 5(Bosslet et al., 1992), beta-glucosidase (Rowlinson-Busza, 1992), carboxypeptidase, (Antoniw et al., 1990), (Bagshawe et al., 1988), beta- lactamase with therapeutic efficacy, or an immune-stimulatory protein with cytokine activity such as IL-2, IL-12, TNF-alpha, IFN-beta or GM-CSF (see eg. review by Allen (2002).
30 In another example the binding proteins described above have themselves antagonistic or agonistic efficacy which is therapeutically useful. Examples for antagonistic/blocking binding molecules are the VEGF inhibitory antibody Avastin (Ferrara et al., 2004), the HER2/neu receptor δblocking antibody Herceptin (Noonberg and Benz, 2000) or the EGF-receptor blocking antibody Erbitux (Herbst and Langer, 2002). Agonistic binding proteins can be binding proteins which induce for example apoptosis (Georgakis et al., 2005) or have regulatory activity on DNA, RNA or proteins (e.g. induce transcription, stabilize proteins). The review by (Adams and loWeiner, 2005) describes various therapeutic antibodies that could also be incorporated into an oncolytic virus
Prodrug-converting enzymes
15In the oncolytic recombinant RNA virus of the present invention, at least one transgene may code for a prodrug-converting enzyme.
A prodrug is a derivative or a precursor of a therapeutically active compound, which can be enzymatically converted into the active compound. Prodrug- 2θconverting enzymes are enzymes capable of converting a prodrug into the therapeutically active drug.
Therefore subject of the present invention is a pharmaceutical composition comprising a recombinant oncolytic virus of the present invention, a virus 5genome of the present invention, a virus antigenome of the present invention, and/or a DNA molecule of the present invention as an active ingredient optionally together with pharmaceutically acceptable carriers, diluents and/or adjuvants, which virus, virus genome, antigenome and/or DNA molecule comprises at least one transgene encoding for a prodrug-converting enzyme. 0 The pharmaceutical composition may further comprise a prodrug which can be converted into a therapeutically active compound by the prodrug- converting enzyme encoded by the virus, virus genome, antigenome and/or DNA molecule. The pharmaceutical composition may be suitable for δtreatment and/or alleviation of a proliferative disorder.
The prodrug may be formulated in a single composition with the recombinant oncolytic virus of the present invention, a virus genome of the present invention, a virus antigenome of the present invention, and/or a DNA iomolecule of the present invention as an active ingredient, or may be formulated in a composition distinct from the oncolytic virus formulation.
If the oncolytic recombinant RNA virus of the present invention encodes for a prodrug-converting enzyme, the oncolytic virus of the present invention iδcauses selective expression of the prodrug-converting enzyme in a virus- infected target cell (in particular a tumor cell) which is usually not or not sufficiently expressing the prodrug converting enzyme. Thus, during treatment of a subject in need thereof, the prodrug is specifically converted into the pharmaceutical active compound in a target cell, in particular in a
20tumor cell, but may essentially not be converted into the therapeutically active compound in a non-target cell, in particular in a healthy cell of the subject to be treated. Thus, undesired side-effect of the therapeutically active compound are reduced compared with treatment of the therapeutically active compound alone.
25
In the context of the present invention, the prodrug may be a derivative or a precursor of a therapeutically active compound suitable for treatment and/or alleviation of a proliferative disorder, which prodrug can be converted by a prodrug converting enzyme. The prodrug may be a compound known by a 3θperson skilled in the art. Derivatives and/or precursors are known by a person skilled in the art. It is preferred that the prodrug is essentially pharmaceutically inactive and/or nontoxic.
sExamples of prodrug-converting enzymes of the present invention are beta- glucuronidase, beta-galactosidase, beta-glucosidase, carboxypeptidase, beta-lactamase, D-amino acic oxidase. Further examples are known by a person skilled in the art.
iolt is preferred that the prodrug-converting enzyme is essentially not expressed in non-tumor cells.
The prodrug-converting enzyme may be obtained from an organism selected from mammals, plants, fungi, and microorganisms such as bacteria, protozoa I5and viruses.
A most preferred combination of the prodrug-converting enzyme and a prodrug is E. coli beta-glucuronidase and a prodrug which can be converted by beta-glucuronidase into an active cytotoxic compound. An examle is 0HMR1826 (doxorubicin-glucuronide) which can be converted into doxorubicin which is a known compound for treatment of cancer.
Another subject of the present invention is a method for treatment of a proliferative disease, in particular a hyperproliferative disease, such a cancer, 5comprising administering in a pharmaceutically effective amount to a subject in need thereof
(a) a recombinant oncolytic virus of the present invention, a virus genome of the present invention, a virus antigenome of the present invention, and/or a DNA molecule of the present invention comprising at least one transgene θencoding for a prodrug-converting enzyme, and (b) a prodrug suitable for treatment of the proliferative disease, which prodrug can be converted into a pharmaceutically active compound by the prodrug- converting enzyme of (a).
5The method may comprise the administration of a single pharmaceutical composition comprising both components (a) and (b), or may comprise the administration of two distinct pharmaceutical compositions, one of which comprises component (a) and the other comprises (b).
0
Proteases
In the oncolytic recombinant RNA virus of the present invention, at least one transgene may code for a protease. 5
Therefore subject of the present invention is a pharmaceutical composition comprising a recombinant oncolytic virus of the present invention, a virus genome of the present invention, a virus antigenome of the present invention, and/or a DNA molecule of the present invention as an active ingredient θoptionally together with pharmaceutically acceptable carriers, diluents and/or adjuvants, which virus, virus genome, antigenome and/or DNA molecule comprises at least one transgene encoding for a protease. The pharmaceutical composition may be suitable for treatment and/or alleviation of a proliferative disorder. 5
If the oncolytic recombinant RNA virus of the present invention encodes for a protease, the oncolytic virus of the present invention causes selective expression of the protease in a virus-infected target cell (in particular a tumor cell) which is usually not or not sufficiently expressing the protease. Thus, 0during treatment of a subject in need thereof, the protease may irreversibly cleave a target polypeptide in a target cell, thereby inhibiting proliferation and/or growth of the target cell or killing the target cell, but may essentially not cleave the target molecule in a non-target cell, in particular in a healthy cell of the subject to be treated. By this strategy, undesired side-effects of δprotease treatment are reduced.
It is preferred that the protease is a sequence-specific protease. More preferred is a protease specifically cleaving a target polypeptide. The protease may either be of natural origin and may be derived from any iospecies or it may be engineered. Amino acid sequences suitable for a specific cleavage of a predetermined target polypeptide can be determined by a person skilled in the art, e.g. on the basis of publicly available sequence databases. US 2005-0175581 and US 2004-0072276 describe the generation of protein-engineered proteases with a predetermined substrate
I5specifity. These two documents are herein included by reference.
The target molecule of the protease may be any target molecule as described below for targets of binding proteins.
2θAnother subject of the present invention is a method for treatment of a proliferative disease, in particular a hyperproliferative disease, such a cancer, comprising administering in a pharmaceutically effective amount to a subject in need thereof a recombinant oncolytic virus of the present invention, a virus genome of the present invention, a virus antigenome of the present invention,
25and/or a DNA molecule of the present invention comprising at least one transgene encoding for a protease.
The transgene of the present invention may encode a fusion protein of a prodrug-converting enzyme as defined above, a binding molecule as defined 3θabove and/or a protease as defined above. Especially preferred is a fusion protein of a prodrug-converting enzyme and a binding molecule or a fusion protein of a protease and a binding molecule.
Therapeutic Applications
5
The present invention shows for the first time that a transgene coding for a binding protein, a prodrug-converting enzyme and/or a protease may be functionally expressed in oncolytic virus-infected tumor cells. Thus, the present invention relates to a pharmaceutical composition which comprises ioas an active ingredient a virus as indicated above, a nucleocapsid of the virus, a genome of the virus or a DNA molecule encoding the genome and/or the antigenome of the virus, optionally together with pharmaceutically acceptable carriers, diluents and/or adjuvants.
i5The pharmaceutical composition may be provided as a solution, suspension, a lyophilisate or in any other suitable form. In addition to the active ingredient, the composition may comprise carriers, buffers, surfactants and/or adjuvants as known in the art. The composition may be administered e.g. orally, topically, nasally, pulmonally or by injection locally or intravenously. The
2θpharmaceutical composition is administered in a pharmaceutically effective amount depending on the type of disorder, the patient's condition and weight, the route of administration etc. Preferably 109 to 1012 virus particles, 108 to 1011, 107 to 1010, or 106 to 109 virus particles are administered per application. The oncolytic therapy may be optionally combined with other
25tumor therapies such as surgery, radiation and/or chemotherapy such as cyclophosphamide treatment and/or hyperthermia treatment.
According to the present invention, a recombinant oncolytic paramyxovirus can express a soluble binding protein, a prodrug-converting enzyme and/or a 3θprotease that may remain either in the infected cell or may be secreted, such as an antibody, an antibody fragment, an ankyrin repeat protein or another binding molecule as specified below. It has especially not been described that such a protein can be expressed by an oncolytic strain of an RNA virus, e.g. of a Newcastle disease virus.
5As an example NDV, the strain MTH68 was chosen in the present application because it has an inherent oncolytic property with promising data from experimental clinical treatments of patients (Sinkovics and Horvath, 2000). In principle, however, most NDV strains with multibasic fusion protein cleavage sites may be used as oncolytic agents for the treatment of tumors. The loreverse genetics technology is applicable to all strains.
Binding proteins as described above have been demonstrated to be of high therapeutic potential.
I5ϊhe combination of oncolytic NDV with therapeutic binding proteins, prodrug- converting enzymes and/or proteases of the above described properties will have additional or even synergistic efficacy of two therapeutical principles. The oncolytic self-replicating virus targets the binding protein drug, the prodrug-converting enzyme and/or the protease to the preferred site of action θwhere it is expressed in situ in high local concentrations. Such protein expression is expected to be very selective and the binding protein, the prodrug-converting enzyme and/or the protease with its respective mode of action will add to the intrinsic therapeutic oncolytic activity of the NDV. Based on the replication competent nature of the used virus and the selective 5replication in tumor cells the amount of expressed transgene [binding protein, the prodrug-converting enzyme and/or protease] is expected to be roughly proportional to the mass of the tumor.
Antibody molecules or antibody like molecules or derivatives thereof are 0ideal binding proteins to be used with the NDV-system. Antibody molecules have been the subject of intensive research and technologies are now available to generate antibody molecules which are non-immunogenic, very selective and of high affinity. The local expression of antibody molecules at high concentrations lead to very significant agonistic or antagonistic efficacy or efficient targeting of effector molecules with reduced toxicity profile δcompared to standard therapy.
The use of antibody-like molecules in the NDV system is expected to be even superior. These molecules are designed for selective high affinity binding with very high thermal stability and yield compared to normal antibodies. In iothe case of the ankyrin-based antibody-like molecules the repetitive nature of the molecule can be finetuned according to the respective target for optimized targeting, binding, inhibition or activation. Also different binding specificities can be combined within one ankyrin molecule, exploiting the possibility of joining in one ankyrin-repeat molecule several units with
I5different binding specificities. This modular structure allows the multivalent binding of greater protein surfaces than it is possible for antibodies, which can be extremely important in blocking protein-protein interactions. The modular structure can also be exploited to block several effectors with only one single blocking ankyrin-repeat-protein.
2θSince the ankyrin-repeat-molecules are extremely stable even under reducing condition these molecules can be designed to target proteins inside the cell ("Intrabody").
Also possible is the use of libraries of binding protein-coding sequences with 25NDV for in vivo target identification.
Possible targets for binding molecules or/and proteases can be all structures of a target cell or of the extracellular matrix surrounding the target cell which can be recognized by the described binding proteins or/and proteases and 3θwhich are relevant to a certain type of pathological phenotype. These can be structural proteins, enzymes, growth factors, growth factor receptors, integrins, transcription factors etc.
Even targets that are not drugable by small molecules (protein-protein δinteractions, DNA-binding etc.) can be addressed by this invention.
The combination of the oncolytic NDV and therapeutic binding proteins, prodrug-converting enzymes and/or proteases as described above are envisaged for the treatment of inflammatory disease e.g. rheumatoid arthritis ioand of cancer.
For the treatment of cancer all pathways which contribute to the development of cancer can be targeted. These pathways are: self-sufficiency in growth signals, insensitivity to growth-inhibitory (antigrowth) signals, iδevasion of apoptosis, limitless replicative potential, sustained angiogenesis, and tissue invasion and metastasis. A summary of these pathways is given in (Hanahan and Weinberg, 2000). Signaling pathways that are involved in the tumorigenesis process and can be targeted by the described approach are the receptor tyrosine kinase pathway (RTK) pathway, RB and p53 pathway,
2θapoptosis pathway, APC pathway, HIF1 pathway, GLI pathway, PI3K pathway and the SMAD pathway. A detailed description of these signaling pathways are given in Vogelstein and Kinzler (2004).
Other signaling pathways where described binding proteins could interfere with are the ras, Wnt and Hedgehog pathway, where for example protein 5protein interactions can be blocked.
Examples of binding proteins intervening beneficially in the above described pathways in cancer cells are:
- blocking proteins of autonomous active growth factor receptors (eg. EGFR, 0 Met) - competitive binders for growth factors (antagonists)
- blocking proteins for Rb-phosphorylation
- blocking proteins for E2F-dependent transcription
- stabilizers for p53 - antagonistic binders for antiapoptotic proteins (e.g. Bcl-2)
- antagonistic binders for cyclins
- antagonistic binders for Ras effectors (eg. GEFs)
- antagonistic binders for hypoxia induced proteins (e.g. HIF1α)
- inhibitors of transcription factors that interfere with dimerization or DNA- binding or cofactor binding (eg. Myc/Max)
- inducers of differentiation
- inhibitors of smad signaliing/translocation
- inhibitors of cellular adhesion interactions (cadherins, integrins, eg. α5β1 , αvβ3) - inhibitors of enzymes that degrade the extracellular matrix (eg. MMPs)
- antagonistic binders for proangiogenic ligands (eg. soluble VEGF-R)
- inhibitors of mitotic kinases (eg. Plk-1)
- antagonistic binders to proangiogenic receptors
- inhibitors of scaffold complex formation (eg. KSR/Ras) - inhibitors of translation initiation (elF4E, EIF2a)
The protease of the present invention, the prodrug-converting enzyme and/or the therapeutically active compounds derived from prodrugs of the present invention by the prodrug-converting enzyme may also beneficially intervene in the above described pathways of cancer cells.
Definitions Newcastle Disease Virus:
Paramyxoviruses contain single-stranded RNA genomes of negative polarity having genomes of 15-19 kb in length (wild-type) and the genomes contain 6- 510 genes. The viral envelope is formed by the surface glycoproteins and a membrane part derived from the host cell. The surface glycoproteins (F and HN or H or G) mediate entry and exit of the virus from the host cell. The nucleocapsid is inside the envelope and contains the RNA genome and the nucleocapsid protein (NP), phospho- (P) and large (L) proteins responsible iofor intercellular virus transcription and replication. The matrix (M) protein connects the viral envelope and the nucleocapsid. In addition to these genes encoding structural proteins, Paramyxoviridae may contain "accessory" genes which may be additional transcriptional units interspersed with the genes mentioned above. The accessory genes are mostly ORFs that overlap iδwith the P gene transcriptional unit. A comprehensive description of paramyxoviridae can be found in (Lamb, 2001).
NDV is the prototypic member of the genus Avulavirus in the family Paramyxoviridae belonging to the order Mononegavirales. The viral genome is a single-stranded negative-sense RNA coding for six major proteins: the θnucleocapsid protein (NP), phosphoprotein (P)1 matrix protein (M), fusion protein (F), hemagglutinin protein (HN), and the polymerase protein (L). By editing of the P protein mRNA, one or two additional proteins, V (and W), are translated.
5NDV strains are classified on their pathogenicity for chicken as velogenic strains (highly virulent) leading to acute lethal infection of chicken of all ages, mesogenic isolates (intermediate virulence) that are only lethal in young chicks, and lentogenic strains (nonvirulent) manifested in a mild or unapparent form of the disease. Classification of NDV isolates in velo-, θmeso- or lentogen is determined by the mean death time (MDT) of the chicken embryo in 9 day-old embryonated eggs after inoculation with the minimum lethal dose to kill the embryo. One of the determinants of NDV virulence seems to be the cleavage site of the precursor F protein.
NDV is in detail characterized in Alexander (1988) and Lamb (2001).
5
Recombinant virus
Recombinant virus means a virus that has an engineered defined alteration in its genomic RNA sequence. This alteration may be one or more insertions, -lodeletions, point mutations or combinations thereof.
A recombinant RNA virus of the present invention may comprise the full genomic sequence of a natural (unmodified) RNA virus or a sequence derived thereof and may additionally comprise at least one recombinant
-^transcriptional cassette. The at least one transcriptional cassette may be located in between two genes (transcriptional units) of the viral genome. In this case, the at least one transcriptional cassette is flanked by transcriptional start and stop sequences. The at least one transcriptional cassette may also be located within a transcriptional unit of the viral genome. In this case, no
2θadditional transcriptional start and stop sequences are required.
The at least one transcriptional cassette may comprise restriction sites, such as Pad or/and Ascl, which may be unique. If two transcriptional cassettes are present, they may comprise different restriction sites. 5
It is preferred that the RNA virus of the present invention comprises one or two recombinant transcriptional cassettes. In the at least one transcriptional cassette of the present invention, there is a transgene located, which may encode for a binding protein, a prodrug- converting enzyme and/or a protease as described above.
5Any intergenic region between each of two genes (transcriptional units) of the viral genome is suitable for introducing the at least one recombinant transcriptional cassette. If more than one recombinant transcriptional cassette is present, they may be located in the same or different intergenic regions. Figure 1 describes an example of two recombinant transcriptional iocassettes within one intergenic region. It is preferred that at least one recombinant transcriptional cassette is located between the viral F and HN genes, in particular if the RNA virus of the present invention is a recombinant Newcastle Disease Virus.
i5There is no known upper limit for the size of the genome of Paramyxoviridae. Therefore, there is no upper limit for the number and size of transgenes introduced into the recombinant RNA virus of the present invention. It is preferred that the transgene has a size of up to about 10 kb, more preferred up to about 5 kb, most preferred up to about 2 kb. 0
The recombinant RNA virus of the present invention preferably carries up to five transgenes, more preferably up to four transgenes, even more preferably up to three transgenes, most preferably one or two transgenes. If the recombinant virus of the present invention carries at least two transgenes, 5they may be identical or different. The recombinant RNA virus of the present invention may carry more than one copy of a particular transgene, in particular two, three, four of five copies.
In the expression (including transcription of the viral RNA into mRNA and 0translation of the mRNA) of the transgene, expression control sequences such as transcriptional start and stop sequences and sequences controlling the translation are used. The expression control sequences of an RNA virus may be used which may be the RNA virus on which the recombinant RNA virus of the present invention is based. In particular, transcriptional start and stop sequences may be obtained from an RNA virus. Expression control δsequences may also be obtained from a target cell, in particular sequences controlling the translation and/or protein transport.
Due to the replication mechanism of Paramyxoviridae, the genomic or antigenomic RNAs usually do not appear as naked RNAs. The genomic and ioantigenomic RNAs are assembled with the nucleoprotein. Therefore, a further subject of the present invention is a nucleocapsid of a recombinant oncolytic RNA virus of the present invention. The nucleocapsid comprises the RNA molecule encoding the genome or/and the antigenome of the RNA virus and the nucleocapsid protein. The nucleocapsid may also comprise the
I5polymerase protein L or/and the phosphoprotein P.
Also subject of the present invention is the anti-genome of the genome of the present invention as described above.
2θA further aspect of the present invention is a DNA molecule encoding the genome and/or the anti-genome of a recombinant oncolytic RNA virus of the present invention. The DNA molecule may be a plasmid. The DNA molecule of the present invention can be used for genetically engineering the RNA virus of the present invention. Further, the DNA molecule may be used for 5producing the RNA virus of the present invention. Therefore, the DNA molecule may be operatively linked to a transcriptional control sequence e.g. a prokaryotic or eukaryotic transcription control sequence.
An example of DNA molecules of the present invention is pflMTH68 murine 0IgG EDB (Fig. 2). The genome, antigenome, nucleocapsid and/or DNA molecule of the present invention may comprise at least one transgene which may be located within the transcriptional cassette as described above. As discussed above, the transgene may encode for a binding protein, a prodrug-converting enzyme 5and/or a protease.
Another aspect of the present invention is a method for producing a recombinant oncolytic RNA virus comprising expressing a DNA molecule encoding the genome and/or the anti-genome of a recombinant oncolytic lovirus of the present invention.
A further aspect of the present invention is a cell comprising the recombinant oncolytic virus of the present invention, a virus genome of the present invention, a virus anti-genome of the present invention and/or a DNA
I5molecule of the present invention. The cell may be a prokaryotic cell or a eukaryotic cell. The cell may be a cell line, in particular a mammalian cell line, more particularly a human or murine cell line. The cell may be used in the method of the present invention for producing the RNA virus of the present invention. Suitable systems for transcribing a DNA molecule are 0known by a person skilled in the art, e.g. in prokaryotic systems such as E. coli or eukaryotic systems such as HeLa or CHO.
Yet another aspect is an oncolytic RNA virus, a genome or anti-genome thereof or a DNA molecule comprising the full set of genes of 5Paramyxoviridae or a set of genes of Paramyxoviridae in which at least one gene or intergenic region is genetically modified, and further comprising at least one recombinant transcriptional cassette as described above. Such a virus, genome or antigenome or DNA molecule may be used for the manufacture of a medicament and/or treatment of cancer. Such RNA virus, θgenome, anti-genome or DNA molecule is suitable for constructing a recombinant Paramyxoviridae virus, in particular a recombinant Newcastle Disease Virus by genetic engineering techniques in order to introduce a recombinant sequence into the transcription cassette. For this purpose, the at least one transcription cassette may comprise a restriction site. If more than one transcription cassettes are present, the unique restriction sites of the δtranscriptional cassettes may be different. An example is plasmid pflMTH68_Asc_Pac of Fig. 1.
Therapeutical relevance:
ioTreatment of Cancer means inhibition of tumor growth, preferably the killing of the tumor cells or the blocking of proliferation in a time gap by infection. NDV replicates selectively in tumor cells.
The virus of the present invention can be used to treat proliferative I5disorders, in particular hyperproliferative disorders. Preferably neoplasms can be treated with the described virus, preferably cancers from the group consisting of lung, colon, prostate, breast and brain cancer can be treated.
2θMore preferably a solid tumor can be treated.
More preferably a tumor with low proliferation rate can be treated.
Examples of tumors with low proliferation rate are prostate cancer or breast cancer. 5
More preferably a brain tumor can be treated.
More preferably a glioblastoma can be treated. Manufacture of the recombinant RNA virus
5
The recombinant RNA virus of the present invention, in particular the recombinant NDV, can be constructed as described in Romer-Oberdorfer et al. (1999). The construction of the new nucleic acid sequences is on the level of the cDNA which then is translated into RNA within a eucaryotic cell using iothe following starting plasmids: pCITE P, pCITE N, pCITE L, pXδδT flNDV
NDV can be any strain of Newcastle Disease Virus, more preferred a strain that is oncolytic in its wildtype form.
15
The plasmid pXδδT is described in EP0702085 (Conzelmann KK).
The recombinant RNA virus of the present invention, in particular the recombinant NDV, can be recovered initially from T7 polymerase expressing θcells, eg. BHK T7 cells or transiently with T7 polymerase transfected CHO cells. It can be amplified in cells like 293, CEC32, HT29 or A431. It can also be amplified in the allantoic fluid of embryonated chicken eggs.
The recombinant RNA virus, in particular the recombinant NDV, is stored 5under the following conditions. The recombinant RNA-virus, in particular NDV is stable in 5% D-mannitol / 1% (w/v) L-lysine / pH 8,0 or standard cell culture medium.
At -2O0C for up to one month. At -8O0C for up to 10 years.
Use of the recombinant NDV as a Medicament
The recombinant RNA virus of the present invention, in particular the purified recombinant NDV according to the invention can be used as a medicament, because it shows pharmacological effects.
ioThe recombinant RNA virus of the present invention, in particular the NDV of the invention is a medicament especially for prevention and/or treatment of cancer, especially for prevention and/or treatment of lung cancer, prostate cancer, brain cancer, colon cancer, breast cancer.
iδThe invention comprises the recombinant RNA virus of the present invention, in particular the NDV of the invention as a medicament combined with pharmaceutically acceptable carrier and diluents. Such carrier and diluents are described in Remington's Pharmaceutical Science, 15*n ed. Mack Publishing Company, Easton Pennsylvania (1980). The used virus titers may 20be in the range of 109to 1012 pfu per dose, in a range of 108to 1011 pfu, in a range of 107to 1010 pfu or in a range of 106to 109pfu dependent on the indication of treatment.
Therefore, another subject of the present invention is a pharmaceutical 5composition comprising a recombinant oncolytic virus of the present invention, a virus genome of the present invention, or a DNA molecule of the present invention together with pharmaceutically acceptable carriers, diluents and/or adjuvants. The pharmaceutical composition of the present invention may be used for the prevention or/and treatment of a proliferative disorder, θsuch as cancer. The pharmaceutical composition of the present invention may comprise an emulsion of the recombinant oncolytic RNA virus of the present invention, in particular the NDV of the invention and may be administered by inhalation, 5intravenous infusion, subcutaneous injection, intraperitoneal injection or intratumoral injection.
Yet another subject of the present invention is a method for the prevention or/and treatment of a proliferative disorder, in particular cancer, comprising ioadministration to a subject in need thereof a pharmaceutically effective amount of the pharmaceutical composition of the present invention. A pharmaceutically effective amount is a titre of the oncolytic RNA virus of the present invention, in particular the NDV of the present invention, the virus genome of the present invention, or the DNA molecule of the present iδinvention which cures or suppresses the disease.
For the therapeutic effect the acceptable dosis is different and depends for example from the construct, the patient, the ways of administration and the type of cancer. 0
It is preferred that the subject (the patient) is a mammal, more preferably a human patient.
Yet another aspect of the present invention is the use of the recombinant 5RNA virus of the present invention, in particular the NDV of the invention, the virus genome of the present invention, or the DNA molecule of the present invention for manufacture of a medicament for treatment of cancer.
The present invention is further illustrated by the following Figures and 0Examples. Figure legends
Figure 1 describes plasmid pflMTH68_Asc_Pac comprising the full genome of NDV and two transcriptional cassettes comprising the unique restriction δsite Ascl or Pad, respectively. The nucleotide sequence describes the intergenic region between F and HN comprising two recombinant transcriptional cassettes (SEQ. ID. NO: 5).
Figure 2 describes plasmid pflMTH68 murine IgG ED-B, which is based on iθpflMTH68_Asc__Pac and comprises sequences encoding the light chain and the heavy chain of anti-ED-B IgG antibody MOR03257 (see claim 42 of German Patent Application DE10 2004 05 0101.7-43; Seq ID No. 77). The light chain and the heavy chain are each inserted in one of the transcriptional cassettes.
15
Figure 3 describes that infection of CHO or HT29 cells with NDV MTH 146 containing the genes for the anti-ED-B IgG antibody MOR03257 leads to expression of the antibody into the cell supernatant. 24 hours post infection, a level of about 20% of the maximal expression level is reached. After about 2072 hours post infection, maximal expression of the antibody is reached. As a control, cells were infected with MTH115 (containing the gene for beta- glucuronidase). In these cells, no IgG was detected.
Figure 4 demonstrates by immunofluorescence that cells infected with 25MTH146 exhibit a staining pattern indistinguishable from the staining with the recombinant antibody MOR03257.
Figure 5 demonstrates by immunohistochemistry that the supernatant from MTH 146 infected cells yields an undistinguishable staining pattern compared with purified αED-B antibody MOR03257 expressed from stably transfected 239 cell in tumor vasculature where ED-B is present.
Figure 6 demonstrates that intravenous injection of MTH87 leads to δexpression of GFP in the tumor in a mouse xenograft model.
Figure 7 describes expression of β-glucuronidase in MTH115 infected HeIa cells.
ioFigure 8 describes expression levels of β-glucuronidase in MTH115-infected cell lines.
Figure 9 and Figure 10 describe synergistic effect of HMR1826 and MTH 115 in selectively killing tumor cells.
15
Examples
Example 1 :
θGeneration of a recombinant NDV with transgenes that lead to the expression of an antibody
The oncolytic strain MTH68 of NDV was used to obtain viral RNA. Using RT- PCR several fragments of cDNA were obtained and in a multi-step cloning 5procedure they were assembled into a full-genome cDNA that was cloned into the vector pXδδT (Schnell et al., 1994) yielding the plasmid pflMTHδδ. This vector can be used for transfection in order to rescue recombinant virus from a T7-polymerase expressing cell line. Two additional transcriptional cassettes were cloned into the full-length genomic plasmid of NDV MTH68 (pflMTH68) between the genes encoding the F-protein and the HN-protein into the unique Sfil restriction site. The two
DNA-oligonucleotides 5Sfi fw (5'-aggccttaattaaccgacaacttaagaaaaaatacgggtagaacggcctgag~3\ SEQ.
ID. NO: 1) and
Sfi back (δ'-aggccgttctacccgtattttttcttaagttgtcggttaattaaggcctctc-S', SEQ. ID.
NO: 2) were annealed and subsequently ligated into the Sfil-site of pflMTH68. θThe resulting plasmid pflMTH68Pac was cut with Pad and another dsDNA- oligonucleotide consisting of
Asc fw (5'- cgggcgcgccccgacaacttaagaaaaaatacgggtagaacagcagtcttcagtcttaat-3', SEQ.
ID. NO: 3) and Asc back (5'- Staagactgaagactgctgttctacccgtattttttcttaagttgtcggggcgcgcccgat-S', SEQ. ID.
NO: 4) was inserted into the Pacl-restriction site thereby destroying one of the flanking Pad-recognition sites and inserting a unique Ascl-site. The resulting plasmid was designated pflMTH68 Asc Pac. This plasmid has two additional 0transcriptional cassettes inserted between the genes for the viral F and HN- genes. Both transcriptional cassettes were flanked by identical viral transcriptional start and stop sequences (Fig. 1). Cassette 1 contains a unique Pad restriction site, cassette 2 contains a unique Ascl restriction site for the insertion of a transgene cDNA. 5
The heavy and light chains of a recombinant function blocking therapeutic antibody against the extra-domain B (ED-B) of fibronectin (MOR03257) were cloned into the two additional unique restriction sites Ascl and Pad respectively. The murine lglambda light chain for the anti-ED-B antibody was 0inserted into the Ascl site. The murine IgG heavy chain for the anti-ED-B antibody was inserted into the Pad site. The length of the inserts together with the adaptor sequences was adjusted to a base number which was a multiple of six in order to follow the rule of six for the length of the complete genome of the recombinant virus. The resulting plasmid was designated pflMTH68 murine IgG ED-B (Fig. 2).
Using standard techniques for the rescue of recombinant NDV (transfection 5of T7-expressing BHK cells), a virus was produced that contained two additional genes coding for the two chains of the anti-ED-B IgG antibody. That virus was called MTH 146.
Example 2:
10
Expression of an antibody by recombinant Newcastle Disease Virus. Cells infected with MTH 146 produce an antibody that recognizes its antigen ED-B fibronectin (ELISA).
iδMaterials and Methods:
HT29 (human colon carcinoma) and CHO (Chinese hamster ovary) cells were seeded in 6well plates at 4x105 cells/well. The day after, cells were infected in triplicate with a MOI of 0,01 either with virus MTH146 (containing the genes 0for an anti-ED-B antibody) or with virus MTH 115 (containing the gene for an irrelevant secreted transgene [beta-glucuronidase]).
At the time points Oh, 2Oh, 3Oh, 2d, 3d, 6d post infectionem an aliquot of the cell supernatant was taken and subjected to an antibody titer determination. 5
The antibody titer was determined by ELISA. Plastic wells were coated with the recombinant antigen ED-B. The tissue culture supernatant containing the antibody or as a standard known amounts of recombinant antibody was added to the wells. After washing, bound antibody was detected with a HRP- θcoupled secondary antibody raised against murine IgG. Using purified recombinant antibody (expressed by plasmid-transfected cells) as a standard the concentration of the virally produced antibody could be determined. Results:
Infection with MTH146 leads to the expression of an antibody into the cell supernatant that specifically binds to its target ED-B (Fig. 3). Infection of the 5same cells with a virus expressing an irrelevant secreted transgene (MTH115) does not lead to a signal in the ED-B ELISA with the cell supernatant. In HT29 tumor cells the concentration of the antibody in the supernatant reaches titers of ca. 8 μg / ml (binding IgG), which is a sufficient concentration for biological activity. In CHO cells the antibody titer reaches loeven > 20 μg / ml in the supernatant.
Example 3:
Virally expressed antibody binds to its target: Immunofluorescence
15
Materials and Methods:
Murine F9 teratocarcinoma cells were seeded in 6well plates. The cells were infected either with MTH146 (anti-ED-B antibody) or MTH115 (irrelevant 0transgene β-glucuronidase) or mock infected.
Two days after the infection the cells were fixed with 4% formaldehyde. The cells were washed and bound antibody was visualized by staining with a Cy3-coupled secondary antibody directed against mouse IgG. As a positive control mock-infected cells were incubated prior to fixation for 1 hour with 5 5μg/ml recombinant α-ED-B IgG.
Results:
The negative controls do not show a significant staining of the F9 cells. Cells 0infected with MTH146 show a staining pattern that is indistinguishable from the staining with the recombinant antibody (Fig. 4). Therefore it can be concluded that the viral infection leads to the production of the correct antibody that binds to its antigen like the recombinant antibody. The virally produced antibody concentration is also sufficient to give a staining similar to an antibody concentration of 5 μg/ml. That is consistent with the estimated concentration of the virally expressed antibody, which is in the range of 5 μg/ml. 5 Example 4:
Virally expressed antibody binds to its target: lmmunohistochemistry
ioMaterials and Methods:
Cryopreserved tissue sections (10 μm) of the SK-MEL melanoma grown as xenograft subcutaneously in mice were fixed in cold acetone for 10 min, washed in PBS and stained with antibody. As control served a purified α-ED-
15B IgG antibody MOR03257 (cone. 5 μg/ml for staining) that was expressed from stable transfected 293 cells. The negative control was incubated with buffer only and no primary antibody. The supernatants of 293 cells infected with recombinant viruses were used for staining as undiluted supernatants. Prior to staining, virus was inactivated by treatment with UV-light. MTH 146 0infected cells produce the α-ED-B IgG antibody, control infected cells were infected with a recombinant virus that did not produce an antibody as a transgene. The bound antibody was visualized by detection with protein-A- peroxidase and staining with diaminobenzidine as a substrate. The sections were counterstained with hematoxilin QS. Photodocumentation was 5performed with a Zeiss Axiophot imaging system.
Results:
No unspecific staining of the cryosections can be observed when incubated θwithout antibody or with a tissue culture supernatant from control-virus- infected 293 cells. Staining with the purified α-ED-B antibody expressed from stable transfected 293 cells shows a characteristic signal for tumor vasculature where ED-B is present. The incubation with the supernatant from MTH146-infected cells yields an undistinguishable staining pattern (Fig. 5). This demonstrates that 5the virally expressed antibody is able to specifically bind its target ED-B also in tumor tissue sections and that the concentration in the supernatant of infected cells is sufficient to give a signal comparable to 5 μg/ml purified antibody.
loExample 5:
Tumor-selective replication of recombinant NDV in vivo
This example demonstrates that intravenous injection of the GFP expressing oncolytic virus MTH87 leads to the expression of GFP in the tumor in a I5mouse xenograft model.
MiaPaCa pancreas carcinoma xenografts were grown subcutaneously in nude mice. The mice were treated repeatedly (6x) with 1x109 pfu of MTH87 (NDV with GFP as transgene) every other day.
2θAt day 21 and day 34 after the last treatment individual animals were sacrificed and sectioned. Sections of the organs (ca. 2 mm) were directly analysed under a fluorescence microscope to detect GFP-expression (Fig. 6). Photographs of tumor sections show GFP-expression. No such GFP- 5expression could be found in any of the following organs: spleen, liver, lung, heart, kidney, intestine, adrenal.
Reisolation of NDV (MTH87) from organs:
0ln order to prove that replicating virus was present in the tumor but not in the other organs, slices of the organs (ca. 2 mm thickness) were incubated on top of a monolayer of virus-sensitive HT29 cells in tissue-culture medium. The day after, the HT29 cells were scored for the expression of GFP which indicated infection by MTH87 that originated from the organ/tumor. Reisolation of MTH87 was only possible from tumor pieces but not from any of the organs tested. Out of 6 tumor pieces from each tumor at least 4 were positive for the virus-reisolation. Negative organs were: spleen, liver, lung, δheart, kidney, intestine, adrenal (no other organs were included in the test).
These results document that the recombinant virus MTH87 selectively replicates in tumor tissue and not in other organs. The virus replication is detectable many days after the last intravenous administration of the virus. 0 Example 6:
Generation of an oncolytic NDV that expresses an antibody-effector fusion protein L19-IL2: 5
The fusion protein L19-IL2 is a antibody targeted cytokine. The antibody fragment L19 is directed against the extradomain B of fibronectin (ED-B) which is expressed mainly surrounding tumor blood vessels but also in the tumor stroma. θThe cytokine lnterleukin-2 induces proliferation of T-cells and activates NK- cells. Free, non-targeted interleukin-2 (Proleukin) is currently used in low dose application for treatment of Renal cell carcinoma (RCC). The clinical use of Proleukin is limited due to its high systemic toxicity. It has been shown that the targeted delivery of IL-2 by an antibody such as L19 can be used to 5deliver therapeutic efficacious doses to tumors while maintaining non-toxic systemic levels of IL-2. The tumor specific delivery and expression of L19-IL2 combines the tumorselectivity of the oncolytic virus with the additional tumorselectivity of the L19 antibody fragment and the strong effector activity of IL-2. Material and Methods:
Generation of recombinant NDV expressing the fusion protein L19-IL2
5
The plasmid pflMTH68 Pac contains the full genomic sequence of NDV MTH68 plus one additional transcriptional cassette with a unique Pad restriction site. A DNA-transgene coding for the fusion protein L19-IL2 is cloned into the Pad site. This transgene is composed of a Kozak sequence
10CCACC, a signal peptide for the extracellular secretion and the cDNA for the fusion protein L19-IL2 (Carnemolla et al., 2002). The total length of the genome is adjusted to be a multiple of 6 to follow the "rule of six" for the length of the viral genome. Recombinant virus is rescued from T7-expressing cells transfected with the full-length viral genomic plasmid containing the iδgene for L19-IL2 by a standard virus rescue technique. The resulting virus is designated MTH201. The virus is cultivated either in tissue culture or in the allantoic fluid of chicken eggs to produce high titres.
Murine F9-teratocarcinoma Xenograft experiment
20
Therapeutic studies are performed in the syngeneic F9 murine teratocarcinoma model. The murine F9-teratocarcinoma model is a rapid- growing syngenic tumor characterized by a high ED-B - fibronectin expression mainly in surrounding tumor blood vessels but also in the tumor 25stroma.
2 x106 F9 tumor cells in 50% matrigel are implanted s.c. into nude mice strain 129 (clone SvHsd). When tumors reach a size of approximately 20 mm2 mice are infected with recombinant NDV MTH201 (encoding the L19-IL2 fusion 3θprotein) or control virus MTH87 (encoding GFP as a transgene) at 1x109 pfu at days 1 , 3, 5 and 7 intravenously. L19-IL2 (CHO-derived, dimer) and IL2 (PROLEUKINE) are administered as a daily i.v. bolus injection in sterile saline solution over a period of 5 days. All concentrations that are used in animal studies are in the range of 1.8 - 2.16 Mio. IU/kg/day.
5After 12 days the mice are sacrificed and the tumor weight is assessed by measurement of the tumor area (product of the longest diameter and its perpendicular) or tumor volume using a caliper.
Result:
10
Dimeric L19-IL2 shows a 54.7% tumor weight reduction even at the lowest dose of 1430 IU/g/day corresponding to a low dose regimen used in humans whereas 3- and 6-fold higher doses only slightly improve the therapeutic efficacy of targeted IL2. PROLEUKINE reduces the tumor weight by 50.5% at
I5its highest dose. No therapeutic efficacy is observed at 1430- and 4290 IU/g/day. Best results are obtained in the group of mice treated with NDV MTH201. Tumor weight reduction is above 55%. This can be explained by a combined action of the virus-expressed L19-IL2 and the oncolytic effect of the NDV. Another advantage is that the achieved results are obtained with
20less administrations of the NDV MTH201 compared to fusion protein alone.
Example 7:
Generation of an oncolytic NDV that expresses an ankyrin repeat 25protein that binds VEGF and is biologically active.
It has been demonstrated that VEGF and its receptor are essential for the growth of colorectal cancers and the formation and growth of colon cancer metastases in the liver in experimental models (Warren et al., 1995) and this 3θprinciple has now been clinically validated by the systemic use of the VEGF- neutralizing human antibody avastin in patients with metastatic colorectal cancer (Salgaller, 2003). VEGF (or VPF) is a homodimeric glycoprotein consisting of four isoforms (containing either 121 , 165, 189, 206 amino acid residues in the mature monomer) which are generated by alternative splicing of mRNA derived from 5a single gene. While all forms of VEGF possess a signal sequence only the smaller two species are secreted. In contrast the larger forms are associated with heparin-bound-proteoglycans in the extracellular matrix. VEGF is mitogenic for a variety of large and small vessel endothelial cells, induces the production of tissue factor, collagenase, plasminogen activators, and their ioinhibitors and stimulates hexose transport in these cells as well. Most important receptors for VEGF are fms-like tyrosine kinase flt1 and KDR (Waltenberger et al., 1994). The Expression of VEGF has been demonstrated in several human cancer lines in vitro and in surgically resected tumors of the human gastrointestinal tract, ovary, brain, kidney, iδlung, and others. In many experimental tumor models the neutralization of VEGF leads to an efficient and significant growth inhibition (Gerber and Ferrara, 2005).
Here we demonstrate that the tumor targeted delivery of the anti-VEGF 2θankyrin repeat protein by the recombinant NDV is advantageous for the treatment of this disease. This is shown in an experimental athymic mouse model of colorectal cancer. Typically the liver is the first and most frequent site of metastasis in colorectal cancer. Therefore the potency of the new reagent is also demonstrated in an orthotopic experimental model of liver 5metastasis.
Material and Methods:
Generation of recombinant NDV expressing an ankyrin repeat protein 0that neutralizes VEGF
An anti-VEGF ankyrin repeat molecule of the type N3C is selected with standard procedures (Binz et al., 2004). The sequence of the selected ankyrin repeat protein is known. An expression cassette coding for a designed ankyrin repeat protein (dARPIN) with inhibitory activity against VEGF is cloned into the full-length genomic NDV-MTH68 plasmid.
The plasmid pflMTH68 Pac contains the full genomic sequence of NDV 5MTH68 plus one additional transcriptional cassette with a unique Pad restriction site. A DNA-transgene coding for the dARPIN agains VEGF is cloned into the Pad site. This transgene is composed of a Kozak sequence CCACC, a signal peptide for the extracellular secretion and the cDNA for the ankyrin repeat molecule. The total length of the genome is adjusted to be a iomultiple of 6 to follow the "rule of six" for the length of the viral genome. Recombinant virus is rescued from T7-expressing cells transfected with the full-length viral genomic plasmid containing the gene for the dARPIN agains VEGF by a standard virus rescue technique. The resulting virus is designated MTH268. The virus is cultivated either in tissue culture or in the allantoic fluid I5of chicken eggs to produce high titres.
Subcutaneous tumors:
Confluent cultures of LS LJM6 cells are grown in 10 cm2 Petri dishes and are 0harvested by brief trypsinization, (0.05% trypsin/0.02% EDTA in Ca2+/Mg2+ free HBSS) washed several times in Ca2+/Mg2* -free PBS and are resuspended at a final concentration of 5 x 107 cells in serum free DMEM. The presence of single cells is confirmed by phase contrast microscopy, and cell viability is determined by trypan blue exclusion. Pathogen-free Balb/c 5NCR-NU athymic mice (3 - 4 week-old females obtained from Simonson laboratories, Gilroy, Ca) are housed in sterilized cages and injected subcutaneously with 5 x 106 viable tumor cells. Animals are observed daily for tumor growth, and subcutaneous tumors are measured using a caliper every 3 d. On day 1 , 3, 5 and 7 after the tumor inoculation groups of five θanimals are injected intraperitoneally with varying amounts of either anti VEGF mAB 4.6.1 (0 - 200μg per mouse), a control mAb of the same isotype (200 μg/ mouse), with anti-VEGF ankyrin repeat protein (0 - 200 μg/ per mouse), 1x109 pfu NDV MTH268 or 1x109 control NDV MTH87. Prior to high- dose virus treatment the animals are desensitized with the increasing virus doses 1x106 pfu, 1x107 pfu, 1x108 pfu, 5x108 pfu every other day. Tumor volumes are calculated as previously described (Kuan et al., 1987).
5
Liver metastases:
H7 cells are grown to confluence and are harvested as described above for subcutaneous injection and resuspended in serum free DMEM at a ioconcentration of 20 x 106 cell/ ml. Athymic mice are anesthetized with methoxyfluorance by inhalation prepared in a sterile fashion, and the spleen is exteriorized through a left flank incision. 2 x 106 cells in 100 ml are slowly injected into the splenix pulp through a 27-gauge needle over 1 min, followed by splenectomy 1 min later. Experimental animals receive VEGF antibody
154.6.1 , control antibody (100 μg/ mouse), anti-VEGF ankyrin repeat protein (100 μg/ ml) by intraperitoneal injection beginning 1 d after splenic-portal injection and every 3 to 4 days thereafter. Alternatively mice are treated intraperitoneally with 1x109 pfu NDV MTH268 or 1x109 control NDV MTH87 at days 1 , 3, 5 and 7. All animals are killed when the first mouse appears
20lethargic and an enlarged liver is palpated (day 28). The livers are excised and weighed, and the metastases are enumerated using a dissecting microscope.
To estimate tumor volume, the diameter of each liver metastases is 5measured to the nearest millimeter, and the volume of each tumor is calculated by assuming it to be a sphere. The sum of the volumes of all tumors in each liver is determined. The livers of two control animals is nearly replaced by tumor and individual nodules can not be distinguished. Tumor volume is estimated in these two livers as follows: the total liver volume mass 0is measured by displacement of water in a 20-ml graduated cylinder and the tumor volume is estimated to represent 85% of the liver.
Result: Subcutaneous tumors:The tumor size of treated animals is monitored and dose-dependent tumor growth inhibition is found for all tested reagents. The tumor size in the animals which received the control mAb is approximately 5100 mm3 on day 8, 400 mm3 on day 16 and 900 mm3 on day 22. For the mAb 4.6.1 the measured tumor size at day 22 is 500 mm3 when 10 μg of mAb are injected each time of administration, and 200 mm3 (100 μg), 150 mm3 (50 μg), 100 mm3 (200 μg) respectively. Similar dose dependency is found for the anti-VEGF ankyrin repeat protein when up to 200 μg are injected, with iothe best result of a tumor size of 100 - 500 mm3 when 200 μg of the reagent are applied. By treatment of athymic mice with the control NDV MTH87 the tumor size at day 22 is above 200 mm3. This antitumor effect is due to the antiproliferative effect caused oncolytic NDV. Best effects are found when athymic mice are infected with NDV MTH268 (expressing the anti-VEGF iδAnkyrin repeat protein). Measured tumor size is below 100 mm3. This effect is due to the advantageous combination of tumorselective expression of the VEGF-neutralizing ankyrin repeat binding protein and its antiangiogenic effect and the independent antiproliferative effect of the tumorselective NDV on the tumor cells. The tumorselective delivery and expression of the anti-
20VEGF ankyrin binding protein ensures a steady and high level site-specific expression of the neutralizing protein which overcomes pharmacological limitations of the systemic administered ankyrin repeat protein e.g. such as rapid clearance and non-specific tissue distribution and ensures efficient VEGF neutralisation. This effect is obtained at a reduced number of
25administrations and therefore a higher convenience for the patient population is expected.
Liver metastases:
30AII animals show evidence of hepatic tumors but differ in number, size and weight of liver metastases. A dramatic reduction in comparison to the control mAb treated mice is seen after anti-VEGF treatment. The average number of tumors per liver and the mean estimated tumor volume per liver is 10- and 18-fold lower in the anti-VEGF mAb 4.6.1 -treated animals compared to the control antibody treated animals. Similar results are found for the anti-VEGF ankyrin repeat protein treated-mice.The most dramatic reduction is observed in the animals treated with NDV MTH268. Though administered less times 5the numbers of tumors in the liver is reduced and the tumor volume is smaller when compared to A4.6.1 treated mice.
As for the primary tumor the beneficial effect of NDV MTH268 on the inhibition of formation and growth of liver metastases is due the advantageous combination of tumorselective expression of the VEGF- loneutralizing ankyrin repeat binding protein and its antiangiogenic effect and the independent antiproliferative effect of the tumorselective NDV on the tumor cells. The NDV selectively proliferates in these remaining tumor buds and exerts its antiproliferative effect on these tumor cells further decreasing the number of surviving tumor cells and number of detectable metastases.
15
An even increased therapeutic efficacy on the growth of the primary tumor and the number, size and weight of colorectal liver metastases is seen when a multi-specific ankyrin repeat binding protein is used which contains specificities for VEGF-A, VEGF-C and PDGF.
20
Example 8:
Generation of recombinant NDV expressing an intracellular ankyrin repeat protein that inhibits polo-like kinase activity and inhibits tumor 25growth
Plk-1 has been shown to be a target for cancer therapy. Expression of Plk-1 is elevated in neoplastic tissues and has a prognostic potential in a broad range of human tumors (see eg. WO2005042505 and references therein). 0
An anti-human Plk-1 ankyrin repeat molecule of the type N3C is selected with standard procedures (Binz et al., 2004, Amstutz et al., 2005). Binding to Plk-1 is measured in an ELISA with recombinant GST-Plk-1 on glutathion-plates as a substrate. Positive binders are selected and the corresponding genes are cloned into the eukaryotic CMV expression plasmid pcDNA3.1. The plasmids are transfected into HeIa and MaTu cells and the cells are subjected to a 5proliferation assay as described e.g. in WO2005042505. This method is preferred to an in vitro kinase assay in order to be able to also identify binding dARPINS that block function without directly blocking the kinase activity. The dARPIN with the best inhibitory activity of cell proliferation is selected for insertion into the genome of the oncolytic recombinant NDV. The lOsequence of the selected ankyrin repeat protein comprises 161 amino acids corresponding to 483 bp. An expression cassette coding for the designed ankyrin repeat protein (dARPIN) with inhibitory activity against human Plk-1 is cloned into the full-length genomic NDV-MTH68 plasmid.
i5The plasmid pflMTH68 Pac contains the full genomic sequence of NDV MTH68 plus one additional transcriptional cassette with a unique Pad restriction site. A DNA-transgene coding for the dARPIN against Plk-1 is cloned into the Pad site. This transgene is composed of a Kozak sequence CCACC and the cDNA for the ankyrin repeat molecule. The total length of
20the genome is adjusted to be a multiple of 6 to follow the "rule of six" for the length of the viral genome. Recombinant virus is rescued from T7-expressing cells transfected with the full-length viral genomic plasmid containing the gene for the dARPIN against Plk-1 by a standard virus rescue technique. The resulting virus is designated MTH261. The virus is cultivated either in tissue
25culture or in the allantoic fluid of chicken eggs to produce high titres. The virus is purified and concentrated using tangential flow filtration and eluted in buffer with 5% mannitol/1% L-lysine.
In vivo tumor growth inhibition. 0 Female NMRI nude mice are injected subcutaneously with 1,5x106 MaTu cells diluted 1 :1 (medium : matrigel). When tumors have reached a size of 20-25 mm2 (appr. 3 days later) the animals are treated with the recombinant virus. The animals are injected with 200 μl virus suspension (in 5% 5mannitol/1 % L-lysine buffer) intravenously every other day with the following consecutive doses: 1x106 pfu, 1x107 pfu, 1x108 pfu, 5x108 pfu, 1x109 pfu, 1x109 pfu, 1x109 pfu, 1x109 pfu, 1x109 pfu. The increasing doses at the beginning allow for a desensitisation of the mice against the virus. One group receives only buffer (5% mannitol/1% L-lysine), one group receives iorecombinant virus MTH87 that expresses a non-therapeutic transgene (GFP) and one group the recombinant oncolytic virus MTH261 expressing the dARPIN that has inhibitory activity against Plk-1. Tumor growth is monitored for three weeks and the tumors are weighed at the end (day 21). Control tumors are in the range of 1 ,0 g. Tumors treated with MTH87 show a
I5significant weight reduction. Tumors treated with MTH261 are even smaller and show a significant weight reduction in comparison with MTH87. This demonstrates a benefit of the dARPIN expression by the virus compared to the virus treatment alone. The result also proves that an intracellular^ active transgene can improve the oncolytic properties of a recombinant oncolytic
2θvirus.
Example 9:
Generation of an oncolytic NDV that expresses an ankyrin repeat 5protein that binds HIF1α and is biologically active
Hypoxia in tumors is developed if the tumor cells grow faster than the endothelial cells that form the blood vessel system, leading to a deprivation of oxygen and nutrients in the tumor . 0
The establishment of hypoxic areas in solid tumors promotes the progression of the tumor development. Oxygen deficiency in tumor cells leads to genetic instability, followed by a selection process, ending up in tumor cells with reduced apoptotic potential and increased resistance against conventional therapies, like chemotherapy and radiation. As a consequence hypoxia in tumors contributes to a more malignant phenotype. The hypoxia-inducible transcription factor HIF-1α is mainly responsible for 5the activation of most genes in tumor cells under hypoxic conditions. HIF-1α induced gene products are regulating processes like angiogenesis, glucose metabolism, cell growth and oxygen transport. Examples of upregulated genes by HIF-1α are glucose transporter 1 and 3, adenylate-kinase 3, lactate dehydrogenase, VEGF, Flt-1 and others. ioThe heterodimeric transcription factor HIF-1α is composed of a HIF-1α and a HIF-I p subunit. The HIF-1α-subunit and the HIF-1 β-subunits are constitutively expressed. But HIF-1α is in contrast to HIF-1β immediately degraded under normoxic conditions. In a normal oxygen milieu the HIF-1β subunit is recognised and marked for proteasomal degradation by the Von- iδHippel-Lindau protein (pVHL), which is part of an E3 ubiquitin ligase complex. Under hypoxic condition the HIF-1α-subunit is no more recognised by the pVHL and the protein is immediately transported into the nucleus. In the nucleus a dimerisation with the HIF-1β-subunit takes place and DNA binding to a HRE (hypoxia reponse element) leads to specific gene induction.
20ln the described experiment it is demonstrated that intracellular targeting of the HIF-1α-transcription factor by an anti HIF-1α ankyrin repeat protein expressed by a recombinant NDV in a solid tumor model is superior over NDV treatment alone and application of recombinant purified anti HIF-1α ankyrin repeat protein alone. In vivo efficacy is proven in a prostate cancer
25xenograft model in nude mice.
Material and Methods
Generation of recombinant NDV expressing an ankyrin repeat protein 30that binds HIF-1α
An anti-HIF-1α ankyrin repeat molecule of the type N3C is selected with standard procedures (Binz et al., 2004). The sequence of the selected ankyrin repeat protein is known. An expression cassette coding for a designed ankyrin repeat protein (dARPIN) with inhibitory activity against HIF- 1α is cloned into the full-length genomic NDV-MTH68 plasmid.
5The plasmid pflMTH68 Pac contains the full genomic sequence of NDV MTH68 plus one additional transcriptional cassette with a unique Pad restriction site. A DNA-transgene coding for the dARPIN against HIF1α is cloned into the Pad site. This transgene is composed of a Kozak sequence CCACC and the cDNA for the ankyrin repeat molecule. The total length of iothe genome is adjusted to be a multiple of 6 to follow the "rule of six" for the length of the viral genome. Recombinant virus is rescued from T7-expressing cells transfected with the full-length viral genomic plasmid containing the gene for the dARPIN agains HIF-1α by a standard virus rescue technique. The resulting virus is designated MTH288. The virus is cultivated either in iδtissue culture or in the allantoic fluid of chicken eggs to produce high titers.
PC-3 xenograft model:
PC-3 xenografts are passaged in vivo in athymic female or male nude mice.
2θXenografts are established by subcutaneous (sc) injection of 5 x 105 PC-3 cells per animal. After the third passage tumors are cut into 2 mm3 pieces. Subcutaneous inocculation of nonnecrotic tumor tissues in nude mice is performed using sterile stainless steel needles. Mice are randomly allocated to various treatment groups, when the tumor volume reaches an average
25size of 150-200 mm3.
On day 0 after the group allocation the mice are treated every other day with increasing doses of MTH288 (encoding anti HIF-1α dARPIN) or MTH87 (control virus encoding GFP as a transgene). Prior to high dose virus 0treatment, virus doses of 106 PFU, 107 PFU, 108 PFU and 5x108 PFU are given intravenously for desensitization against NDV. After desensitization the highest dose of 109 PFU is applied three times. The control group is treated intravenously with purified anti HIF-1α ankyrin repeat protein (200 μg/per mouse). Application of the anti HIF-1α ankyrin repeat protein starts at the time point of the first virus injection and is also repeated every other day as long as the virus treatment is done. A third control group is treated with PBS δalone. On day 20 after the first treatment animals are observed for tumor growth and subcutaneous tumors are measured using a caliper.
Results:
0On day 20 after first treatment the tumors of PBS injected animals show in average a volume of 1500 mm3. The second control group treated only with anti HIF-1α ankyrin repeat protein displays a slight tumor growth reduction. Animals receiving the NDV MTH87 show a strong tumor reduction on day. The best tumor growth inhibition on day 20 is seen in mice injected with the 5NDV MTH288 expressing the anti HIF-1α ankyrin repeat protein. The inhibition of tumor growth after treatment with MTH288 is significantly better than after the other treatments.
This result demonstrates that intracellular expression of an ankyrin repeat θprotein against HIF-1α by NDV is advantageous over NDV treatment alone or over application of recombinant purified anti HIF-1α ankyrin repeat protein.
It is expected that the viral expression of a secreted anti HIF-1α ankyrin repeat protein fused to a cell penetrating peptide (e.g. tat peptide, 5oligoarginine peptides, AntP peptide, VP22 peptide, penetratin, transportan (for review see (Ford et al., 2001) enhances the therapeutic effect. This strategy allows the targeting of tumor cells with the anti HIF-1α ankyrin repeat fusion protein that are themselves not infected with NDV.
θA virus that expresses simultaneously transgenes for two separate dARPINS - one intracellular against HIV-1α and one secreted against interleukin-8 - is expected to have an increased anti-tumor activity due to blockade of two compensatory pathways (Mizukami et al., 2005). Example 10
MTH1151 leads to expression of β-glucuronidase in infected cells
δMaterials and Methods:
HeIa cells were plated in 6well dishes. After reaching confluency cells were infected with very low MOI = 0.00001 of MTH87 and MTH115. At the indicated time points aliquots of the cell supernatant were taken and frozen at 10-200C. 72 hours after the infection the activity of β-glucuronidase was measured simultaneously in all supernatants in a MUG-assay.
MUG-assay for the quantification of β-glucuronidase activity
MU (4-methylumbelliferon) and MUG (4-methylumbelIiferyl-β-D-gIucuronide) I5are from Sigma. MU is used to produce a standard curve. Virus containing samples are UV-radiated for 30 min to inactivate virus prior to the MUG- assay. Samples are incubated in a 25 mM sodium-acetate buffer pH 5.6 with 10 μM MUG for 60 min at 37°C. The reaction is stopped by addition of 200 mM glycin buffer pH 10.4. Fluorescence is measured with excitation at 320 20nm and emission at 460 nm in a fluorescence photometer. From the fluorescence emission the specific activity in nmol per ml per hour is calculated.
Results: 5
The infection with MTH 115 leads to a time-dependent increase in the expression of β-glucuronidase, which is a result of the viral replication (Figure 7). Although MTH87 eventually kills the cells and thus liberates endogenous β-glucuronidase from the cells the resulting activity in the supernatant is 3θnegligable. MTH115 infection clearly achieves a massive production of the transgene. The CPE by MTH115 is comparable to that of MTH87 and MTH68 (wt), so the expression of β-glucuronidase by the virus does neither attenuate replication of the virus nor decrease the cytopathogenicity of the virus.
Example 11
5
Quantification of transgene expression by MTH115 in various cells
Materials and Methods:
10CeIIs were seeded in 96well plates. The number of cells was chosen to reach confluency one day after plating:
HeIa 15 000 Cells / well
HT29 30 000 Cells /well iδFibroblasts 10 000 Cells / well
HDMVEC 20 000 Cells / well
One day after seeding cells were infected with the virus MTH 115 at an MOI of 0.01. In detail cells were washed with PBS, inoculated with 100 μl virus- 20suspension at 370C, virus was aspirated and 200 μl warm medium was added to the cells.
At the indicated time points the supernatants were taken off the cells and subject to a beta-glucuronidase MUG-assay. For each time point triplicate 25wells were analysed.
Results:
The results are summarized in Figure 8. In the normal cells HDMVEC and 30fibroblasts no transgene expression can be detected. Also no cytopathic effect was observed (not shown). In the tumor cells that are susceptible for the virus HeIa and HT29 there is a massive production of the transgene beta- glucuronidase whose activity can be measured in the supernatant. HeIa cells which are killed by the virus within 48 hours produce relatively lower levels of the transgene. HT29 cells that die only after 5 days at the virus doses used, produce even higher activity of beta-glucuronidase, about 10fold more than HeIa cells and more than IOOOfold over background.
Example 12
NDV-beta-glucuronidase and HMR1826 synergistically kill cells that are resistant to either treatment alone
Materials and Methods:
Cells were plated on day 1 in 24well dishes. On day 2 the cells were infected with NDV-beta-glucuronidase (MTH115) at an MOI of 0,001. On day 3 the CeIIs were treated either with doxorubicin at 1 μM or the Doxorubicin- glucuronide HMR1826 at 1 μM. On day 8 the cells were washed, fixed and stained with Giemsa and photographs of the wells were taken.
Results:
The results are summarized in Figure 9 and Figure 10. Doxorubicin alone kills the cells at the given concentration. The prodrug at the same concentration is not toxic to the cells. The virus alone at the given MOI is also not toxic because tumor cells were selected that have a degree of resistance to the virus treatment. The combination of both glucuronidase-expressing virus and the prodrug is able to kill cells that are not killed by either treatment alone. A control virus (that expresses GFP instead of beta-glucuronidase) does not show any synergy with the prodrug treatment. References
Adams, G. P. and Weiner, LM. (2005) Monoclonal antibody therapy of cancer. Nat Biotechnol, 23, 1147-1157. δAlexander, D.J. (1988) Newcastle disease. Kluwer Academic Publishers, Norwell, Massachusetts.
Allen, T.M. (2002) Ligand-targeted therapeutics in anticancer therapy. Nat Rev Cancer, 2,
750-763. 0
Amstutz, P., Binz, H. K., Parizek, P., Stumpp, M.T., Kohl, A., Grutter, M. G., Forrer, P. and Pluckthun, A. (2005) Intracellular kinase inhibitors selected from combinatorial libraries of designed ankyrin repeat proteins. J Biol Chem, 280, 24715-24722. 5Antoniw, P., Springer, C. J., Bagshawe, K.D., Searle, F., Melton, R.G., Rogers, G.T., Burke, P.J. and Sherwood, R.F. (1990) Disposition of the prodrug 4-(bis (2-chloroethyl) amino) benzoyl-L-glutamic acid and its active parent drug in mice. SrJ Cancer, 62, 909-914. 0Bagshawe, K.D., Springer, CJ. , Searle, F., Antoniw, P., Sharma, S. K., Melton, R. G. and Sherwood, R.F. (1988) A cytotoxic agent can be generated selectively at cancer sites. BrJ Cancer, 58, 700-703.
Batra, J. K., Fitzgerald, D.J., Chaudhary, V.K. and Pastan, I. (1991) Single-chain 5 immunotoxins directed at the human transferrin receptor containing Pseudomonas exotoxin A or diphtheria toxin: anti-TFR(Fv)-PE40 and DT388-anti-TFR(Fv). MoI Cell Biol, 11, 2200-2205.
Batra, J. K., Kasprzyk, P.G., Bird, R.E., Pastan, I. and King, CR. (1992) Recombinant anti- 0 erbB2 immunotoxins containing Pseudomonas exotoxin. Proc Natl Acad Sci U S A,
89, 5867-5871.
Bell, J. C, Garson, K.A., Lichty, B. D. and Stojdl, D.F. (2002) Oncolytic viruses: programmable tumor hunters. Curr Gene Ther, 2, 243-254. 5 Binz, H. K., Amstutz, P., Kohl, A., Stumpp, M.T., Briand, C, Forrer, P., Grutter, M.G. and
Pluckthun, A. (2004) High-affinity binders selected from designed ankyrin repeat protein libraries. Nat Biotechnol, 22, 575-582. 0Bosslet, K., Czech, J., Lorenz, P., Sedlacek, H. H., Schuermann, M. and Seemann, G. (1992) Molecular and functional characterisation of a fusion protein suited for tumor specific prodrug activation. BrJ Cancer, 65, 234-238.
Carnemolla, B., Borsi, L., Balza, E., Castellani, P., Meazza, R., Berndt, A., Ferrini, S., 5 Kosmehl, H., Neri, D. and Zardi, L. (2002) Enhancement of the antitumor properties of interleukin-2 by its targeted delivery to the tumor blood vessel extracellular matrix. Blood, 99, 1659-1665.
Chaudhary, V.K., GaIIo, M.G., FitzGerald, D.J. and Pastan, I. (1990) A recombinant single- chain immunotoxin composed of anti-Tac variable regions and a truncated diphtheria toxin. Proc Natl Acad Sci U S A, 87, 9491-9494.
Chaudhary, V.K., Queen, C, Junghans, R. P., Waldmann, T.A., FitzGerald, D.J. and Pastan,
I. (1989) A recombinant immunotoxin consisting of two antibody variable domains fused to Pseudomonas exotoxin. Nature, 339, 394-397.
Chiocca, E.A. (2002) Oncolytic viruses. Nat Rev Cancer, 2, 938-950. Csatary, L. K., Gosztonyi, G., Szeberenyi, J., Fabian, Z., Liszka, V., Bodey, B. and Csatary, CM. (2004) MTH-68/H oncolytic viral treatment in human high-grade gliomas. J Neurooncol, 67, 83-93. De Lorenzo, C1 Arciello, A., Cozzolino, R., Palmer, D. B., Laccetti, P., Piccoli, R. and
D'Alessio, G. (2004) A fully human antitumor immunoRNase selective for ErbB-2- positive carcinomas. Cancer Res, 64, 4870-4874.
Engel-Herbert, I., Werner, O., Teifke, J. P., Mebatsion, T., Mettenleiter, T.C. and Romer- Oberdorfer, A. (2003) Characterization of a recombinant Newcastle disease virus expressing the green fluorescent protein. J Virol Methods, 108, 19-28.
Ferrara, N., Hillan, KJ. , Gerber, H. P. and Novotny, W. (2004) Discovery and development of bevacizumab, an anti-VEGF antibody for treating cancer. Nat Rev Drug Discov, 3, 391-400.
Ford, K.G., Souberbielle, B. E., Darling, D. and Farzaneh, F. (2001) Protein transduction: an alternative to genetic intervention? Gene Ther, 8, 1-4. Georgakis, G.V., Li, Y., Humphreys, R., Andreeff, M., O'Brien, S., Younes, M., Carbone, A., Albert, V. and Younes, A. (2005) Activity of selective fully human agonistic antibodies to the TRAIL death receptors TRAIL-R1 and TRAIL-R2 in primary and cultured lymphoma cells: induction of apoptosis and enhancement of doxorubicin- and bortezomib-induced cell death. Br J Haematol, 130, 501-510.
Gerber, H. P. and Ferrara, N. (2005) Pharmacology and pharmacodynamics of bevacizumab as monotherapy or in combination with cytotoxic therapy in preclinical studies. Cancer Res, 65, 671-680. Hanahan, D. and Weinberg, R.A. (2000) The hallmarks of cancer. Cell, 100, 57-70.
Herbst, R.S. and Langer, CJ. (2002) Epidermal growth factor receptors as a target for cancer treatment: the emerging role of IMC-C225 in the treatment of lung and head and neck cancers. Semin Oncol, 29, 27-36. Hogbom, M., Eklund, M., Nygren, P.A. and Nordlund, P. (2003) Structural basis for recognition by an in vitro evolved affibody. Proc Natl Acad Sci U S A, 100, 3191-
3196. Huang, Z., Elankumaran, S., Yunus, A.S. and Samal, S.K. (2004) A recombinant Newcastle disease virus (NDV) expressing VP2 protein of infectious bursal disease virus (IBDV) protects against NDV and IBDV. J Virol, 78, 10054-10063.
Huang, Z., Krishnamurthy, S., Panda, A. and Samal, S.K. (2001) High-level expression of a foreign gene from the most 3'-proximal locus of a recombinant Newcastle disease virus. J Gen Virol, 82, 1729-1736.
Kreitman, RJ. , Chaudhary, V.K., Waldmann, TA, Hanchard, B., Cranston, B., FitzGerald,
DJ. and Pastan, I. (1993) Cytotoxic activities of recombinant immunotoxins composed of Pseudomonas toxin or diphtheria toxin toward lymphocytes from patients with adult T-cell leukemia. Leukemia, 7, 553-562.
Kreitman, RJ. and Pastan, I. (1995) Importance of the glutamate residue of KDEL in increasing the cytotoxicity of Pseudomonas exotoxin derivatives and for increased binding to the KDEL receptor. Biochem J, 307 ( Pt 1), 29-37.
Krishnamurthy, S., Huang, Z. and Samal, S.K. (2000) Recovery of a virulent strain of newcastle disease virus from cloned cDNA: expression of a foreign gene results in growth retardation and attenuation. Virology, 278, 168-182. Kuan, S. F., Byrd, J. C1 Basbaum, CB. and Kim, Y.S. (1987) Characterization of quantitative mucin variants from a human colon cancer cell line. Cancer Res, 47, 5715-5724.
Ladner, R.C. and Ley, A.C. (2001) Novel frameworks as a source of high-affinity ligands. 5 Curr Opin Biotechnol, 12, 406-410.
Lamb, R.A., Kolakofsky, D. (2001) Paramyxoviridae: The Viruses And Their Replication. In Fields, B.N. (ed.), Virology. Lippincott Williams & Wilkins, pp. 1305-1485. lOLorence, R.M., Pecora, A.L., Major, P.P., Hotte, SJ. , Laurie, S.A., Roberts, M.S., Groene, W.S. and Bamat, M. K. (2003) Overview of phase I studies of intravenous administration of PV701 , an oncolytic virus. Curr Opin MoI Ther, 5, 618-624.
Mizukami, Y., Jo, W.S., Duerr, E.M., Gala, M., Li, J., Zhang, X., Zimmer, MA1 lliopoulos, O., 15 Zukerberg, LR., Kohgo, Y., Lynch, M.P., Rueda, B.R. and Chung, D.C. (2005)
Induction of interleukin-8 preserves the angiogenic response in HIF-1alpha-deficient colon cancer cells. Nat Med, 11, 992-997.
Nakaya, T., Cros, J., Park, M.S., Nakaya, Y., Zheng, H., Sagrera, A., Villar, E., Garcia- 20 Sastre, A. and Palese, P. (2001) Recombinant Newcastle disease virus as a vaccine vector. J Virol, 75, 11868-11873.
Noonberg, S. B. and Benz, CC. (2000) Tyrosine kinase inhibitors targeted to the epidermal growth factor receptor subfamily: role as anticancer agents. Drugs, 59, 753-767. 5
Nord, K., Gunneriusson, E., UhI inverted question marken, M. and Nygren, P.A. (2000)
Ligands selected from combinatorial libraries of protein A for use in affinity capture of apolipoprotein A-1 M and taq DNA polymerase. J Biotechnol, 80, 45-54.
30Roffler, S.R., Wang, S.M., Chern, J.W., Yeh, M.Y. and Tung, E. (1991) Antineoplastic glucuronide prodrug treatment of human tumor cells targeted with a monoclonal antibody-enzyme conjugate. Biochem Pharmacol, 42, 2062-2065.
Romer-Oberdorfer, A., Mundt, E., Mebatsion, T., Buchholz, U.J. and Mettenleiter, T.C. 5 (1999) Generation of recombinant lentogenic Newcastle disease virus from cDNA. J
Gen Virol, 80 ( Pt 11), 2987-2995.
Rowlinson-Busza, G., Bamias, A., Krausz, T. and Epenetos, A.A. (1992) Antibody guided enzyme nitrile therapy (Agent): in vitro cytotoxicity and in vivo tumor localisation. In 0 Epenetos, a. (ed.), Monoclonal Antibodies 2. Applications in Clinical Oncology.
Chapman and Hall, London, pp. 111-118.
Russell, S.J. (2002) RNA viruses as virotherapy agents. Cancer Gene Ther, 9, 961-966. 5Salgaller, M. L. (2003) Technology evaluation: bevacizumab, Genentech/Roche. Curr Opin MoI Ther, 5, 657-667.
Schnell, M.J., Mebatsion, T. and Conzelmann, K.K. (1994) Infectious rabies viruses from cloned cDNA. Embo J, 13, 4195-4203. 0
Sinkovics, J. G. and Horvath, J. C. (2000) Newcastle disease virus (NDV): brief history of its oncolytic strains. J CHn Virol, 16, 1-15.
Skerra, A. (2000) Lipocalins as a scaffold. Biochim Biophys Acta, 1482, 337-350. 5
Stojdl, D. F., Lichty, B.D., tenOever, B.R., Paterson, J. M., Power, AT., Knowles, S., Marius, R., Reynard, J., Poliquin, L., Atkins, H., Brown, E.G., Durbin, R.K., Durbin, J.E., Hiscott, J. and Bell, J.C (2003) VSV strains with defects in their ability to shutdown innate immunity are potent systemic anti-cancer agents. Cancer Cell, 4, 263-275. 0 Vogelstein, B. and Kinzler, K. W. (2004) Cancer genes and the pathways they control. Nat Med, 10, 789-799.
Waltenberger, J., Claesson-Welsh, L, Siegbahn, A., Shibuya, M. and Heldin, CH. (1994) Different signal transduction properties of KDR and FItI , two receptors for vascular endothelial growth factor. J Biol Chem, 269, 26988-26995.
Wang, S.M., Chem, J.W., Yeh, M.Y., Ng, J.C., Tung, E. and Roffler, S.R. (1992) Specific activation of glucuronide prodrugs by antibody-targeted enzyme conjugates for cancer therapy. Cancer Res, 52, 4484-4491.
Warren, R.S., Yuan, H., Matli, M. R., Gillett, N.A. and Ferrara, N. (1995) Regulation by vascular endothelial growth factor of human colon cancer tumorigenesis in a mouse model of experimental liver metastasis. J CHn Invest, 95, 1789-1797.
Zewe, M., Rybak, S.M., Dubel, S., Coy, J.F., Welschof, M., Newton, D.L. and Little, M. (1997) Cloning and cytotoxicity of a human pancreatic RNase immunofusion. Immunotechnology, 3, 127-136. Zhao, H. and Peeters, B. P. (2003) Recombinant Newcastle disease virus as a viral vector: effect of genomic location of foreign gene on gene expression and virus replication. J Gen Virol, 84, 781-788.

Claims

Claims
1. A recombinant oncolytic RNA virus comprising a nucleic acid with at least one transgene, wherein the nucleic acid of this transgene(s) codes for a
5 binding protein that has a therapeutic activity when expressed by the virus-infected tumor cell.
2. The virus of claim 1 , which is a negative-strand RNA virus.
103. The virus of claim 1 or 2, which is a paramyxovirus.
4. The virus of any one of claims 1-3, which is a Newcastle disease virus (NDV).
155. The virus of claim 4 which is a non-lentogenic NDV, e.g. a mesogenic or velogenic NDV, in particular the mesogenic strain MTH68.
6. The virus according to any one of claims 1-5 wherein the binding protein belongs to the following group: a natural ligand or a genetically modified 20 ligand, a recombinant soluble domain of a natural receptor or a modified version of it, a peptide- or polypeptide-ligand, an antibody molecule or a fragment or a derivative thereof or an antibody-like molecule like an ankyrin-repeat protein or a fragment or derivatives thereof.
257. The virus according to any one of claims 1-6 wherein the binding protein is of mammalian, e.g. human, murine or closely related origin or a chimeric protein.
8. The virus according to any of the preceding claims wherein the binding protein is a monomeric, dimeric, trimeric, tetrameric or multimeric protein.
9. The virus according to any one of the preceding claims wherein the binding protein is monospecific, bispecific or multispecific.
10. The virus according to any one of the preceding claims wherein the binding protein is a fusion protein comprising at least one binding domain and a heterologous domain.
11. The virus according to claim 13 wherein the binding protein is a fusion protein with a toxin such as human RNAse (pseudomonas exotoxin, Diphtheria toxin), or a fusion protein with an enzyme like beta- glucuronidase, beta-galactosidase, beta-glucosidase, carboxypeptidase, beta-lactamase or a fusion protein with an immune-stimulatory protein with cytokine activity like IL-2, IL-12, TNF-alpha, IFN-beta or GM-CSF.
12. The virus according to any one of the preceding claims wherein the binding protein is selected from the following group: blocking proteins of autonomous active growth factor receptors (eg. EGFR, Met), competitive binders for growth factors (antagonists), blocking proteins for Rb- phosphorylation, blocking proteins for E2F-dependent transcription; stabilizers for p53; antagonistic binders for antiapoptotic proteins (eg. Bcl-2); antagonistic binders for cyclins; antagonistic binders for Ras effectors (eg. GEFs); antagonistic binders for hypoxia induced proteins (eg. HIF1α); inhibitors of transcription factors that interfere with dimerization or DNA-binding or cofactor binding (eg. Myc/Max); Inducers of differentiation; Inhibitors of smad signalling/translocation; inhibitors of cellular adhesion interactions (cadherins, integrins, eg. βα5β1, αvβ3); inhibitors of enzymes that degrade the extracellular matrix (eg. MMPs); antagonistic binders for proangiogenic ligands (eg. soluble VEGF-R); antagonistic binders to proangiogenic receptors; inhibitors of scaffold complex formation (eg. KSR/Ras); inbibitors of translation initiation (eg. elF4E, EIF2a); inhibitors of mitotic kinases (eg. Plk-1).
13. A nucleocapsid of a recombinant oncolytic RNA virus of any one of 5 claims 1-12.
14. A genome of a recombinant oncolytic RNA virus of any one of claims 1- 12.
1015. A DNA molecule encoding the genome and/or antigenome of a recombinant oncolytic RNA virus of any one of claim 1-12.
16. The DNA molecule of claims 15 operatively linked to a transcriptional control sequence.
15
17. A cell comprising a recombinant oncolytic virus of any one of claims 1-12, a virus genome of claims 14 or a DNA molecule of claim 15 or 16.
18. A pharmaceutical composition comprising a recombinant oncolytic virus 20 of any one of claims 1-12, a virus genome of claims 14 or a DNA molecule of claim 15 or 16 as an active ingredient optionally together with pharmaceutically acceptable carriers, diluents and/or adjuvants.
19. The pharmaceutical composition of claim 18 for the prevention and/or 25 treatment of cancer.
20. A method for the prevention and/or treatment of cancer comprising administering a subject in need thereof a pharmaceutically effective amount of a composition of claim 18 or 19.
30
21. The method of claim 20 wherein the subject is a human patient.
22. A recombinant oncolytic RNA virus comprising a nucleic acid with at least one transgene, wherein the nucleic acid of this transgene(s) codes for a
5 prodrug-converting enzyme that has a therapeutic activity when expressed by the virus-infected tumor cell.
23. A recombinant oncolytic RNA virus comprising a nucleic acid with at least one transgene, wherein the nucleic acid of this transgene(s) codes for a
10 protease that has a therapeutic activity when expressed by the virus- infected tumor cell.
24. A pharmaceutical composition comprising a recombinant oncolytic virus of any one of claims 1 to 12, a virus genome of claim 14, and/or a DNA
15 molecule of claims 15 or 16 as an active ingredient optionally together with pharmaceutically acceptable carriers, diluents and/or adjuvants, which virus, virus genome and/or DNA molecule comprises at least one transgene encoding for a prodrug-converting enzyme.
2025. The pharmaceutical composition of claim 24 further comprising a prodrug which can be converted into a therapeutically active compound by the prodrug-converting enzyme encoded by the virus, virus genome and/or DNA molecule of claim 24.
2526. The pharmaceutical composition of claim 24 or 25 for treatment and/or alleviation of a proliferative disorder.
27. A method for treatment of a proliferative disease, comprising administering in a pharmaceutically effective amount to a subject in need 30 thereof (a) a recombinant oncolytic virus of any one of claims 1 to 12, a virus genome of claim 14, and/or a DNA molecule of claims 15 or 16 comprising at least one transgene encoding for a prodrug-converting enzyme, and (b) a prodrug suitable for treatment of the proliferative disease, which prodrug can be converted into a pharmaceutically active compound by the prodrug-converting enzyme of (a).
28. A pharmaceutical composition comprising a recombinant oncolytic virus of any one of claims 1 to 12, a virus genome of claim 14, and/or a DNA molecule of claims 15 or 16 as an active ingredient optionally together with pharmaceutically acceptable carriers, diluents and/or adjuvants, which virus, virus genome and/or DNA molecule comprises at least one transgene encoding for a protease.
29. The pharmaceutical composition of claim 28 for treatment and/or alleviation of a proliferative disorder.
30. A method for treatment of a proliferative disease, comprising administering in a pharmaceutically effective amount to a subject in need thereof a recombinant oncolytic virus of any one of claims 1 to 12, a virus genome of claim 14, and/or a DNA molecule of claims 15 or 16 comprising at least one transgene encoding for a protease.
PCT/EP2005/012186 2004-11-12 2005-11-10 Recombinant newcastle disease virus WO2006050984A2 (en)

Priority Applications (10)

Application Number Priority Date Filing Date Title
JP2007540601A JP2008519590A (en) 2004-11-12 2005-11-10 Recombinant Newcastle disease virus
EP05818947A EP1812026A2 (en) 2004-11-12 2005-11-10 Recombinant newcastle disease virus
EA200700975A EA013615B1 (en) 2004-11-12 2005-11-10 Recombinant oncolytic paramyxovirus and use thereof
CA002585435A CA2585435A1 (en) 2004-11-12 2005-11-10 Recombinant newcastle disease virus
AU2005303912A AU2005303912B2 (en) 2004-11-12 2005-11-10 Recombinant Newcastle Disease Virus
US11/667,563 US20080206201A1 (en) 2004-11-12 2005-11-10 Recombinant Newcastle Disease Virus
NZ554429A NZ554429A (en) 2004-11-12 2005-11-10 Recombinant newcastle disease virus comprising a transgene encoding a antibody or antibody like fragment or derivative thereof for use in cancer treatments
BRPI0517834-7A BRPI0517834A (en) 2004-11-12 2005-11-10 recombinant newcastle disease virus
IL182083A IL182083A0 (en) 2004-11-12 2007-03-21 Recombinant newcastle disease virus
NO20072967A NO20072967L (en) 2004-11-12 2007-06-11 Recombinant Newcastle disease virus

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP04090432.8 2004-11-12
EP04090432 2004-11-12

Publications (2)

Publication Number Publication Date
WO2006050984A2 true WO2006050984A2 (en) 2006-05-18
WO2006050984A3 WO2006050984A3 (en) 2006-09-08

Family

ID=35892593

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2005/012186 WO2006050984A2 (en) 2004-11-12 2005-11-10 Recombinant newcastle disease virus

Country Status (14)

Country Link
US (2) US20080206201A1 (en)
EP (2) EP1812026A2 (en)
JP (1) JP2008519590A (en)
KR (1) KR20070085314A (en)
CN (2) CN101875919A (en)
AU (1) AU2005303912B2 (en)
BR (1) BRPI0517834A (en)
CA (1) CA2585435A1 (en)
EA (1) EA013615B1 (en)
IL (1) IL182083A0 (en)
NO (1) NO20072967L (en)
NZ (4) NZ585895A (en)
WO (1) WO2006050984A2 (en)
ZA (1) ZA200705060B (en)

Cited By (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007106882A3 (en) * 2006-03-15 2008-01-17 Intervet Int Bv Recombinant mononegaviral virus vectors
EP2085092A1 (en) 2008-01-29 2009-08-05 Bayer Schering Pharma Aktiengesellschaft Attenuated oncolytic paramyxoviruses encoding avian cytokines
WO2009101149A2 (en) * 2008-02-14 2009-08-20 Bayer Schering Pharma Aktiengesellschaft Anti-tumour effective paramyxovirus
JP2009529861A (en) * 2006-03-15 2009-08-27 インターベツト・インターナシヨナル・ベー・ベー Recombinant Newcastle disease virus expressing avian influenza virus H5 hemagglutinin
WO2011154476A1 (en) 2010-06-10 2011-12-15 Intervet International B.V. Anti-tumor composition
US8377450B2 (en) 2009-11-30 2013-02-19 United Cancer Research Institute Clone of Newcastle disease virus, its manufacture and its application in the medical treatment of cancer
WO2014001442A1 (en) * 2012-06-28 2014-01-03 Molecular Partners Ag Designed ankyrin repeat proteins binding to platelet-derived growth factor
US10035984B2 (en) 2009-02-05 2018-07-31 Icahn School Of Medicine At Mount Sinai Chimeric newcastle disease viruses and uses thereof
US10251922B2 (en) 2013-03-14 2019-04-09 Icahn School Of Medicine At Mount Sinai Newcastle disease viruses and uses thereof
US10308913B2 (en) 2005-12-02 2019-06-04 Icahn School Of Medicine At Mount Sinai Chimeric viruses presenting non-native surface proteins and uses thereof
EP3795160A1 (en) * 2019-09-19 2021-03-24 Arno Thaller Recombinant oncolytic newcastle disease viruses with increased activity
EP3795161A1 (en) * 2019-09-19 2021-03-24 Arno Thaller Recombinant oncolytic newcastle disease viruses with increased activity and improved viral safety
US11389495B2 (en) 2014-02-27 2022-07-19 Merck Sharp & Dohme Llc Combination method for treatment of cancer

Families Citing this family (24)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2426142A3 (en) 2006-10-16 2012-06-13 Genelux Corporation Modified vaccinia virus strains for use in a diagnostic and therapeutic method
CN101205544B (en) * 2007-08-07 2010-12-08 中国人民解放军第四军医大学 Tumor targeting recombinant newcastle disease viruses and construction method thereof
WO2010032764A1 (en) * 2008-09-16 2010-03-25 ジェノミディア株式会社 Therapeutic/prophylactic agent for prostate cancer
WO2010060748A1 (en) * 2008-11-03 2010-06-03 Molecular Partners Ag Binding proteins inhibiting the vegf-a receptor interaction
WO2010080248A2 (en) * 2008-12-18 2010-07-15 The Board Of Regents Of The University Of Texas System Peptides that bind eukaryotic translation initiation factor 4e
TW201120210A (en) 2009-11-05 2011-06-16 Hoffmann La Roche Glycosylated repeat-motif-molecule conjugates
AR081361A1 (en) * 2010-04-30 2012-08-29 Molecular Partners Ag MODIFIED UNION PROTEINS THAT INHIBIT THE RECEPTOR INTERACTION OF THE VASCULAR ENDOTELIAL GROWTH FACTOR FROM GLICOPROTEIN TO VEGF-A
WO2013052915A2 (en) * 2011-10-05 2013-04-11 Genelux Corporation Method for detecting replication or colonization of a biological therapeutic
CN103451198B (en) * 2013-08-20 2015-11-25 中国农业科学院哈尔滨兽医研究所 The full-length infectious CDNA of oncolytic type newcastle disease virus D 90 strain and construction process thereof and application
CN104357408A (en) * 2014-03-13 2015-02-18 哈尔滨博翱生物医药技术开发有限公司 Recombined newcastle disease virus and application thereof
PL3169341T3 (en) 2014-07-16 2019-12-31 Transgene Sa Oncolytic virus for expression of immune checkpoint modulators
CN104164410B (en) * 2014-08-07 2016-07-13 哈尔滨博翱生物医药技术开发有限公司 A kind of Newcastle disease poison strain and the application in preparing Newcastle disease vaccine thereof
AU2015335607B2 (en) 2014-10-24 2020-04-23 Calidi Biotherapeutics, Inc. Combination immunotherapy approach for treatment of cancer
RU2562115C1 (en) * 2014-11-13 2015-09-10 Федеральное государственное автономное образовательное учреждение высшего образования "Новосибирский национальный исследовательский государственный университет"(Новосибирский государственный университет, НГУ) Newcastle disease virus strain for studying oncolytic properties and mechanisms of oncolysis to create prototype anticancer preparation
EP3270940A4 (en) * 2015-03-18 2018-08-29 Stemimmune, Incorporated Virotherapy with an antibody combination
BR112017020986A2 (en) 2015-04-02 2018-08-14 Molecular Partners Ag. recombinant binding proteins and their use
GB201505860D0 (en) * 2015-04-07 2015-05-20 Agalimmune Ltd Therapeutic compositions and methods of use for treating cancer
WO2017027757A2 (en) 2015-08-11 2017-02-16 StemImmune, Incorporated Smallpox vaccine for cancer treatment
US10717772B2 (en) 2016-09-22 2020-07-21 Molecular Partners Ag Recombinant binding proteins targeting HER2 and serum albumin, and their uses
US11505782B2 (en) 2018-06-04 2022-11-22 Calidi Biotherapeutics, Inc. Cell-based vehicles for potentiation of viral therapy
CA3106170A1 (en) * 2018-07-13 2020-01-16 Icahn School Of Medicine At Mount Sinai Apmv and uses thereof for the treatment of cancer
MX2022007122A (en) 2019-12-11 2022-09-09 Molecular Partners Ag Designed ankyrin repeat domains with altered surface residues.
CA3176845A1 (en) 2020-05-06 2021-11-11 Patrick AMSTUTZ Novel ankyrin repeat binding proteins and their uses
WO2022190016A1 (en) 2021-03-09 2022-09-15 Molecular Partners Ag Novel darpin based multi-specific t-cell engagers

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005014017A1 (en) * 2003-08-08 2005-02-17 Yuji Shino Medicinal composition for treating cancer

Family Cites Families (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ES2210273T5 (en) 1994-07-18 2010-03-29 Conzelmann, Karl-Klaus, Prof. Dr. VIRUS WITH NEGATIVE CHAIN NON-SEGMENTED RECOMBINANT INFECTIVE.
US20030044384A1 (en) 1997-10-09 2003-03-06 Pro-Virus, Inc. Treatment of neoplasms with viruses
EP0974660A1 (en) 1998-06-19 2000-01-26 Stichting Instituut voor Dierhouderij en Diergezondheid (ID-DLO) Newcastle disease virus infectious clones, vaccines and diagnostic assays
EP1390046A4 (en) 1999-04-15 2005-04-20 Wellstat Biologics Corp Treatment of neoplasms with viruses
DE19932688B4 (en) 1999-07-13 2009-10-08 Scil Proteins Gmbh Design of beta-sheet proteins of gamma-II-crystalline antibody-like
CA2312626A1 (en) 1999-07-27 2001-01-27 Akzo Nobel N.V. A recombinant newcastle disease virus as an embryo vaccine
US8147822B1 (en) 1999-09-17 2012-04-03 Wellstat Biologics Corporation Oncolytic virus
AU7607900A (en) 1999-09-22 2001-04-24 Mayo Foundation For Medical Education And Research Therapeutic methods and compositions using viruses of the recombinant paramyxoviridae family
US6896881B1 (en) * 1999-09-24 2005-05-24 Mayo Foundation For Medical Education And Research Therapeutic methods and compositions using viruses of the recombinant paramyxoviridae family
WO2003005964A2 (en) 2001-07-11 2003-01-23 University Of Miami Recombinant vsv for the treatment of tumor cells
US20040072276A1 (en) 2002-05-10 2004-04-15 Direvo BioTech AG. Process for generating sequence-specific proteases by directed evolution and use thereof
EP1633866A1 (en) 2003-06-18 2006-03-15 Direvo Biotech AG New biological entities and the pharmaceutical or diagnostic use thereof
DE10351744A1 (en) 2003-10-31 2005-06-16 Schering Ag Thiazolidinones, their preparation and use as pharmaceuticals

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005014017A1 (en) * 2003-08-08 2005-02-17 Yuji Shino Medicinal composition for treating cancer

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
EBERT OLIVER ET AL: "Syncytia induction enhances the oncolytic potential of vesicular stomatitis virus in virotherapy for cancer." CANCER RESEARCH. 1 MAY 2004, vol. 64, no. 9, 1 May 2004 (2004-05-01), pages 3265-3270, XP002384970 ISSN: 0008-5472 *
HERMISTON TERRY W ET AL: "Armed therapeutic viruses: Strategies and challenges to arming oncolytic viruses with therapeutic genes." CANCER GENE THERAPY, vol. 9, no. 12, December 2002 (2002-12), pages 1022-1035, XP002384972 ISSN: 0929-1903 *
POROSNICU MERCEDES ET AL: "The oncolytic effect of recombinant vesicular stomatitis virus is enhanced by expression of the fusion cytosine deaminase/uracil phosphoribosyltransferase suicide gene." CANCER RESEARCH. 1 DEC 2003, vol. 63, no. 23, 1 December 2003 (2003-12-01), pages 8366-8376, XP002384971 ISSN: 0008-5472 *
RIES S J ET AL: "Oncolytic viruses for the treatment of cancer: current strategies and clinical trials" DDT - DRUG DISCOVERY TODAY, ELSEVIER SCIENCE LTD, GB, vol. 9, no. 17, September 2004 (2004-09), pages 759-768, XP004534151 ISSN: 1359-6446 *
See also references of EP1812026A2 *

Cited By (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10308913B2 (en) 2005-12-02 2019-06-04 Icahn School Of Medicine At Mount Sinai Chimeric viruses presenting non-native surface proteins and uses thereof
JP2009529861A (en) * 2006-03-15 2009-08-27 インターベツト・インターナシヨナル・ベー・ベー Recombinant Newcastle disease virus expressing avian influenza virus H5 hemagglutinin
JP2009529889A (en) * 2006-03-15 2009-08-27 インターベツト・インターナシヨナル・ベー・ベー Recombinant Mononegavirales virus vector
US7951587B2 (en) 2006-03-15 2011-05-31 Intervet International B.V. Recombinant mononegaviral virus vectors
WO2007106882A3 (en) * 2006-03-15 2008-01-17 Intervet Int Bv Recombinant mononegaviral virus vectors
EP2085092A1 (en) 2008-01-29 2009-08-05 Bayer Schering Pharma Aktiengesellschaft Attenuated oncolytic paramyxoviruses encoding avian cytokines
WO2009095167A1 (en) * 2008-01-29 2009-08-06 Bayer Schering Pharma Aktiengesellschaft Attenuated oncolytic paramyxoviruses encoding avian cytokines
WO2009101149A2 (en) * 2008-02-14 2009-08-20 Bayer Schering Pharma Aktiengesellschaft Anti-tumour effective paramyxovirus
WO2009101149A3 (en) * 2008-02-14 2009-11-05 Bayer Schering Pharma Aktiengesellschaft Anti-tumour effective paramyxovirus
US10035984B2 (en) 2009-02-05 2018-07-31 Icahn School Of Medicine At Mount Sinai Chimeric newcastle disease viruses and uses thereof
US8377450B2 (en) 2009-11-30 2013-02-19 United Cancer Research Institute Clone of Newcastle disease virus, its manufacture and its application in the medical treatment of cancer
WO2011154476A1 (en) 2010-06-10 2011-12-15 Intervet International B.V. Anti-tumor composition
WO2014001442A1 (en) * 2012-06-28 2014-01-03 Molecular Partners Ag Designed ankyrin repeat proteins binding to platelet-derived growth factor
US10251922B2 (en) 2013-03-14 2019-04-09 Icahn School Of Medicine At Mount Sinai Newcastle disease viruses and uses thereof
US11389495B2 (en) 2014-02-27 2022-07-19 Merck Sharp & Dohme Llc Combination method for treatment of cancer
EP3795160A1 (en) * 2019-09-19 2021-03-24 Arno Thaller Recombinant oncolytic newcastle disease viruses with increased activity
EP3795161A1 (en) * 2019-09-19 2021-03-24 Arno Thaller Recombinant oncolytic newcastle disease viruses with increased activity and improved viral safety
WO2021052753A1 (en) * 2019-09-19 2021-03-25 Arno Thaller Recombinant oncolytic newcastle disease viruses with increased activity

Also Published As

Publication number Publication date
CA2585435A1 (en) 2006-05-18
KR20070085314A (en) 2007-08-27
NO20072967L (en) 2007-08-10
EP2292246A1 (en) 2011-03-09
CN101875919A (en) 2010-11-03
JP2008519590A (en) 2008-06-12
BRPI0517834A (en) 2008-10-21
CN101056646A (en) 2007-10-17
IL182083A0 (en) 2007-07-24
US20080206201A1 (en) 2008-08-28
NZ581958A (en) 2011-01-28
ZA200705060B (en) 2008-12-31
NZ554429A (en) 2010-08-27
AU2005303912B2 (en) 2011-02-17
EP1812026A2 (en) 2007-08-01
EA200700975A1 (en) 2007-12-28
EA013615B1 (en) 2010-06-30
WO2006050984A3 (en) 2006-09-08
US20110020282A1 (en) 2011-01-27
NZ585895A (en) 2011-05-27
AU2005303912A1 (en) 2006-05-18
NZ591733A (en) 2012-10-26

Similar Documents

Publication Publication Date Title
AU2005303912B2 (en) Recombinant Newcastle Disease Virus
EP2085092A1 (en) Attenuated oncolytic paramyxoviruses encoding avian cytokines
JP6862500B2 (en) Compositions characterized by attenuated Newcastle disease virus and usage for treating neoplasms
Lech et al. Use of attenuated paramyxoviruses for cancer therapy
US11723937B2 (en) Replication-competent vesicular stomatitis viruses
US9795643B2 (en) Oncolytic measles virus
US20240083966A1 (en) Vesicular stomatitis viruses
Lorence et al. Replication-competent, oncolytic Newcastle disease virus for cancer therapy
JP4423508B2 (en) Cancer gene therapy drug
US20230147975A1 (en) Pharmaceutical formulation comprising a combination of recombinant newcastle disease viruses for the treatment of cancer
US20220339222A1 (en) New oncolytic newcastle disease viruses and recombinant ndv strains
Biotech LOW PATHOGENIC HUMAN ENTEROVIRUSES AS NOVEL ANTI-CANCER AGENTS AGAINST MALIGNANT GLIOMA

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KM KN KP KR KZ LC LK LR LS LT LU LV LY MA MD MG MK MN MW MX MZ NA NG NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SM SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU LV MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

WWE Wipo information: entry into national phase

Ref document number: 182083

Country of ref document: IL

DPE1 Request for preliminary examination filed after expiration of 19th month from priority date (pct application filed from 20040101)
WWE Wipo information: entry into national phase

Ref document number: 2387/DELNP/2007

Country of ref document: IN

WWE Wipo information: entry into national phase

Ref document number: 554429

Country of ref document: NZ

WWE Wipo information: entry into national phase

Ref document number: 2005818947

Country of ref document: EP

Ref document number: 2007540601

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: 2585435

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2005303912

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 12007501008

Country of ref document: PH

WWE Wipo information: entry into national phase

Ref document number: 200580038676.9

Country of ref document: CN

Ref document number: MX/a/2007/005735

Country of ref document: MX

Ref document number: 1020077010755

Country of ref document: KR

WWE Wipo information: entry into national phase

Ref document number: CR2007-009127

Country of ref document: CR

ENP Entry into the national phase

Ref document number: 2005303912

Country of ref document: AU

Date of ref document: 20051110

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 07058654

Country of ref document: CO

WWE Wipo information: entry into national phase

Ref document number: a200706199

Country of ref document: UA

WWE Wipo information: entry into national phase

Ref document number: 200700975

Country of ref document: EA

WWP Wipo information: published in national office

Ref document number: 2005818947

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 11667563

Country of ref document: US

ENP Entry into the national phase

Ref document number: PI0517834

Country of ref document: BR