ANTI-BACTERIAL
VACCINE COMPOSITIONS
FIELD OF THE INVENTION
The present invention relates generally to the identification of genes responsible for virulence of streptococci, thereby allowing for production of novel attenuated mutant strains useful in vaccines and identification of new anti-bacterial agents that target the virulence genes and their products.
BACKGROUND OF THE INVENTION
There are a large variety of Streptococcus species, many of which cause infections in animals and man. Streptococci are gram positive cocci occurring in pairs and chains. The main groups of streptococcal diseases include upper respiratory infections with lymphadenitis (horses, swine, cats, guinea pigs, humans) neonatal respiratory and septicemic infections (horses, swine, dogs, humans), secondary pneumonias and complications (horses, non-human primates, small carnivores, humans) and pyrogenic infections unrelated to the respiratory tract (human genitourinary tract infections, bovine mastitis).
Little is known about the mechanisms of pathogenesis for streptococci of veterinary relevance. Various cellular components of Streptococcus uberis, such as the M-like protein, a plasminogen activator, capsule, and multiple proteins relating to adherance, have been suggested as virulence factors. However, the precise role of these protein components in the pathogenesis of the various diseases remains unclear. There is a pressing need therefore to identify additional virulence genes in the streptococci. In addition, there remains a need for safe and effective vaccines for treating and preventing diseases caused by streptococci. Information Disclosure
Jiang M et al, 1998. "The abp locus of Streptococcus uberis encodes a protein homologous to polar amino acid and opine binding proteins of gram-negative bacteria." Can. J. Microbiol. 44(8):784-788.
SUMMARY OF THE INVENTION In general, the present invention provides materials and methods for production and use of attenuated gram positive bacteria. In one aspect the invention comprises attenuated species in the streptococcal family of bacteria.
The attenuated bacteria of the invention have utility as immunogenic compositions and vaccines.
In one aspect of the invention, the attenuated bacteria are Streptococcus uberis.
Another aspect of the invention provides an attenuated streptococcal bacteria comprising a functional mutation in a virulence gene selected from the group consisting of glnQ, glnP, dltA, dltB, pstB, pstC2, braB, abp, SAG0300, SAG0948, Spyl228,
SpyM3-1631, SpyM13-0917, and SpyM18-1510, wherein said functional mutation attenuates the bacteria.
The functionally mutated genes enumerated above may comprise a polynucleotide selected from the group consisting of: a) a polynucleotide sequence selected from group consisting of SEQ ID NOs: 1 , 3, 5, 7,
9, 11, 13, 15, 17, 19, 21, 23, 25, and 27; b) a polynucleotide that hybridizes to the complement of a polynucleotide sequence set forth in a) under moderate to highly stringent conditions; and c.) a polynucleotide that encodes a polypeptide that has at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%,
81%, 80%, 79%, 78%, 77%, 76%, 75%, 74%, 73%, 72%, 71%, 70%, 69%, 68%,
67%, 66%, 65%, 64%, 63%, 62%, 61%, or 60% identity and/or similarity to a polypeptide selected from the group consisting of the polypeptide sequences set forth in
SEQ DDNOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, and 28. Also contemplated are immunogenic compositions, preferably vaccine compositions, comprising the attenuated bacteria of the invention, optionally comprising a suitable adjuvant and/or a pharmaceutically acceptable diluent or carrier.
In order for a modified strain to be effective in a vaccine formulation, the attenuation must be significant enough to prevent the pathogen from evoking severe clinical symptoms, but also insignificant enough to allow limited replication and growth of the bacteria in the host.
The invention also provides polynucleotides encoding gene products that are required for virulence in gram-positive bacteria, particularly streptococci .
Polynucleotides of the invention include DNA, such as complementary DNA, genomic DNA, including complementary or anti-sense DNA, and wholly or partially synthesized DNA; RNA, including sense and antisense strands; and peptide nucleic acids as described, for example in Corey, TIBTECH 15:224-229 (1997).
Virulence gene polynucleotides of the invention include an isolated polynucleotide comprising a polynucleotide sequence selected from the group consisting of:
(a) a polynucleotide sequence set forth in SEQ ED NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, and 27;
(b) a polynucleotide that encodes a polypeptide that has at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%, 79%, 78%, 77%, 76%, 75%, 74%, 73%, 72%, 71%, 70%, 69%, 68%, 67%, 66%, 65%, 64%, 63%, 62%, 61%, or 60% identity and/or similarity to a polypeptide selected from the group consisting of the polypeptide sequences set forth in SEQ IDNOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, and 28;
(c) a polynucleotide encoding a polypeptide selected from the group consisting of SEQ ID NOs: SEQ IDNOs: 2, 4,6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, and 28;
(d) a polynucleotide which is the complement of any of (a), (b) or (c) This of course includes species homologs and clonal variants of SEQ ID NOs:
1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, and 27.
The invention therefore comprehends gene sequences from other streptococci as well as related gene sequences from other gram-positive bacterial organisms, including naturally occurring (i.e. i.e. clonal variants) and artificially induced variants thereof. Knowledge of the sequence of a polynucleotide of the invention makes readily available every possible fragment of that polynucleotide. The invention therefore provides fragments of a polynucleotide of the invention.
The invention further embraces expression constructs comprising polynucleotides of the invention. Host cells transformed, transfected or electroporated with a polynucleotide of the invention are also contemplated. The invention provides methods to produce a polypeptide encoded by a polynucleotide of the invention comprising the steps of growing a host cell of the invention under conditions that permit, and preferably promote, expression of a gene product encoded by the polynucleotide, and isolating the gene product from the host cell or the medium of its growth.
Identification of polynucleotides of the invention makes available the encoded polypeptides. The invention therefore comprises an isolated polypeptide comprising a polypeptide that has at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%, 79%, 78%, 77%, 76%,
75%, 74%, 73%, 72%, 71%, 70%, 69%, 68%, 67%, 66%, 65%, 64%, 63%, 62%, 61%, or 60% identity and/or similarity to a polypeptide selected from the group consisting of the polypeptide sequences set forth in SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, and 28. Polypeptides of the invention include full length and fragment, or truncated, proteins; variants thereof; fusion, or chimeric proteins; and analogs, including those wherein conservative amino acid substitutions have been introduced into wild-type polypeptides.
Antibodies that specifically recognize polypeptides of the invention are also provided, and include monoclonal and polyclonal antibodies, single chain antibodies, chimeric antibodies, humanized antibodies, human antibodies, and complementary determining region (CDR)-grafted antibodies, as well as compounds that include CDR sequences which specifically recognize a polypeptide of the invention. The invention also provides anti-idiotype antibodies immunospecific for antibodies of the invention.
According to another aspect of the invention, methods are provided for identifying novel anti-bacterial agents that modulate the function of gram-positive bacterial virulence genes or gene products. Methods of the invention include screening potential agents for the ability to interfere with expression or activity of one or more gene products selected from the group consisting of glnQ, glnP, dltA, dltB, pstB, pstC2, braB, abp, SAG0300, SAG0948, Spyl228, SpyM3-1631, SpyMU-0917, and SpyM18-1510.
Also contemplated are methods for screening potential agents for the ability to interfere with biological function of a bacterial gene product encoded one or more streptococcal genes selected from the group consisting of glnQ, glnP, dltA, dltB, pstB, pstC2, braB, abp, SAG0300, SAG0948, Spyl228, SpyM3-1631, SpyMl 3-0917, and SpyM18-1510, followed by identifying agents that provide positive results in such screening assays. In particular, agents that interfere with the expression of virulence gene products include anti-sense polynucleotides and ribozymes that are complementary to the virulence gene sequences. The invention further embraces methods to modulate transcription of gene products of the invention through use of oligonucleotide-directed triplet helix formation.
Agents that interfere with the function of virulence gene products include variants of virulence gene products, binding partners of the virulence gene products
and variants of such binding partners, and enzyme inhibitors (where the product is an enzyme).
Novel anti-bacterial agents identified by the methods described herein are provided, as well as methods for treating a subject suffering from infection with gram positive bacteria involving administration of such novel anti-bacterial agents in an amount effective to reduce bacterial presence.
Another aspect of the invention is the use of attenuated bacteria of the invention in the preparation of immunogenic compositions and vaccines.
The use of novel anti-bacterial agents identified by the methods described herein in the preparation of medicaments for treating a subject suffering from infection with gram positive bacteria is also contemplated.
Numerous additional aspects and advantages of the invention will become apparent to those skilled in the art upon consideration of the following detailed description of the invention which describes presently prepared embodiments thereof. BRIEF DESCRIPTION OF THE FIGURES
Figure 1. Percent identity and homology obtained when the S. uberis protein sequences are aligned with homologous proteins from other streptococci. Figure 2. Evaluation of efficacy of the S. uberis mutant P2B5 (glnQ) in an experimental goat model. DETAILED DESCRIPTION OF THE INVENTION
Some General Definitions
In the discussion below we will often make use of the term "identity" or similarity as applied to the amino acid sequences of polypeptides. Percent amino acid sequence "identity" with respect to polypeptides is defined herein as the percentage of amino acid residues in the candidate sequence that are identical with the residues in the target sequences after aligning both sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. Percent sequence identity is determined by conventional methods. For example, BLASTP 2.2.6 [Tatusova TA and TL Madden, "BLAST 2 sequences- a new tool for comparing protein and nucleotide sequences." (1999) FEMS Microbiol Lett. 174:247-250.]
Briefly, as noted above, two amino acid sequences are aligned to optimize the alignment scores using a gap opening penalty of 10, a gap extension penalty of
0.1, and the "blosum62" scoring matrix of Henikoff and Henikoff (Proc. Nat. Acad. Sci. USA 89:10915-10919. 1992) .
The percent identity is then calculated as:
Total number of identical matches x 100
[length of the longer sequence + number of gaps introduced into the longer sequence to align the two sequences]
Percent sequence "similarity" (often referred to as "homology") with respect to a polypeptide of the invention is defined herein as the percentage of amino acid residues in the candidate sequence that are identical with the residues in the target sequences after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity (as described above), and also considering any conservative substitutions as part of the sequence identity.
Total number of identical matches and conservative substitutions x 100 [length of the longer sequence +number of gaps introduced into the longer sequence to align the two sequences]
Amino acids can be classified according to physical properties and contribution to secondary and tertiary protein structure. A conservative substitution is recognized in the art as a substitution of one amino acid for another amino acid that has similar properties.
Exemplary conservative substitutions are set out in Table 1.
Table 1
As used hereinafter "isolated" means altered by the hand of man from the natural state. If an "isolated" composition or substance occurs in nature, it has been changed or removed from its original environment, or both. For example, a polynucleotide or a polypeptide naturally present in a living animal is not "isolated," but the same polynucleotide or polypeptide separated from the coexisting materials of its natural state is "isolated", as the term is employed herein.
This application makes reference to sequences which "hybridize under moderate to highly stringent conditions" to the non-coding strand, or complement, of any one of the polynucleotides of the invention. Exemplary high stringency conditions include a final wash in buffer comprising 0.2X SSC/0.1% SDS, at 650C to 750C, while exemplary moderate stringency conditions include a final wash in buffer comprising 2X SSC/0.1% SDS, at 35°C to 45°C. It is understood in the art that conditions of equivalent stringency can be achieved through variation of temperature and buffer, or salt concentration as described in Ausubel, et al. (Eds.), Protocols in Molecular Biology. John Wiley & Sons (1994), pp. 6.0.3 to 6.4.10. Modifications in hybridization conditions can be empirically determined or precisely calculated based on the length and percentage of guanosine/cytosine (GC) base pairing of the probe. The hybridization conditions can be calculated as described in Sambrook, et at, (Eds.), Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press: Cold Spring Harbor, New York (1989), pp. 9.47 to 9.51.
"Virulence genes," as used herein, are genes whose function or products are required for successful establishment and/or maintenance of a bacterial population within a host animal. Thus, virulence genes and/or the proteins encoded thereby may be involved in, but not essential for, growth of the organism in the host organism; they may also be involved in pathogenesis in the host organism. We have identified glnQ, glnP, dltA, dltB, pstB, pstC2, hraB, abp, SAG0300, SAG0948, Spyl228, SpyM3- 1631, SpyM13-0917, and SpyM18-1510 as virulence genes in the streptococci. The activities of the proteins encoded by the virulence genes we have identified are discussed below.
GInQ, a component of the glutamine permease operon which functions in glutamine transport, is an ATP-binding cassette protein. GInP is the permease protein which binds to glutamine. (Neidhart, F. C, Ed. In Chief. Escherichia coli and Salmonella Cellular and Molecular Biology, 2nd Edition. 1996. ASM Press, Washington, D. C.) GInQ has been shown in some streptococci species to be required for fϊbronectin adherence and virulence. (Tamura GS, et al. "A glutamine transport gene, glnQ, is required for fibronectin adherence and virulence of group B streptococci." 2002. Infect. Immun. 70(6):2877-85.)
The operon encoding DItA and DItB catalyzes the incorporation of D-alanine residues (D-alanyl ester formation) into the lipoteichoic acids of gram-positive bacterial membranes. DItA is the cytoplasmic D-alanine-D-alanyl carrier ligase, while DItB is proposed to be a transmembrane protein involved in efflux of the activated D-alanine to the site of acylation. (Perego M., et al. 1995. "Incorporation of D-alanine into lipoteichoic acid and wall teichoic acid in Bacillus subtilis. Identification of genes and regulation." J Biol. Chem. 270(26): 15598-606.)
PstB and PstC2 are components of a phosphate ABC transporter system responsible for the uptake of inorganic phosphate. PstB is the ATP-binding cassette protein, while PstC2 is an integral membrane protein that interacts with PstA to form a transmembrane channel through which inorganic phosphate can pass. (Neidhart, F.C., Ed. In Chief. Escherichia coli and Salmonella Cellular and Molecular Biology, 2nd Edition. 1996. ASM Press, Washington, D.C.)
BraB is a Na+-coupled carrier protein for the branched-chain amino acids, leucine, isoleucine, and valine. (Hoshino T., et al, 1990. "Cloning and nucleotide sequence of the gene braB coding for the sodium-coupled branched-chain amino acid carrier in Pseudomonas aeruginosa PAO." MoI. Gen. Genetics. 220(3) :461-7.)
Abp appears to be involved in the transport of polar amino acids, having homology to the amino acid-binding protein of such ABC transporter systems. (Jiang M., et ah, 1998. "The abp locus of Streptococcus uberis encodes a protein homologous to polar amino acid and opine binding proteins of gram-negative bacteria. Can. J Microbiol. 44(8):784-8.)
SAG0948 is proposed to be the ATP-binding component of an amino acid transport system. (Tettelin H, et al. 2002. "Complete genome sequence and comparative genomic analysis of an emerging human pathogen, serotype V Streptococcus agalactiae " Proc Natl Acad Sci U S A. 99(19): 12391-6.)
Spy 1228 is a putative lipoprotein; possibly part of an ABC transporter system. (Ferretti JJ, et al. 2001. "Complete genome sequence of an Ml strain of Streptococcus pyogenes." Proc Natl Acad Sci U S A. 98(8):4658-63.)
SAG0300, SpyM3-1631, SpyM13-0917, and SpyM18-1510 are hypothetical proteins.
By way of example, the genes enumerated above may comprise a polynucleotide selected from the group consisting of: a) a polynucleotide sequence selected from group consisting of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, and 27; b) a polynucleotide that hybridizes to the complement of a polynucleotide sequence set forth in a) under moderate to highly stringent conditions; or c.) a polynucleotide that encodes a polypeptide that has at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%, 79%, 78%, 77%, 76%, 75%, 74%, 73%, 72%, 71%, 70%, 69%, 68%, 67%, 66%, 65%, 64%, 63%, 62%, 61%, or 60% identity and/or similarity to a polypeptide selected from the group consisting of the polypeptide sequences set forth in SEQ IDNOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, and 28.
"Streptococci", "streptococcal bacteria", and species in the genus Streptococcus include, but are not limited to, S. acidominimus, S. agalactiae, S. bovis, S. equinus, S. earns, S. cricetus, S. downei, S. dysgalactiae, S. entericus, S. equi, S. equinus, S. equisimilis, S. gallinaceus, S. iniae, S. mutans, S. parauberis, S. pluranimalium, S. porcinus, S. pyogenes, S. pneumoniae, S. sobrinus, S. uberis, S. suis, and S. zooepidemicus.
"Lancefϊeld serologic grouping", a step in streptococcal identification, is determined by cell wall polysaccharides (C substance, group antigen) Groups are designated by capital letters. Lancefield group A Streptococcus (GAS, Streptococcus pyogenes), are infections are common among children, causing nasopharyngeal infections and complications, thereof. Cattle are often susceptible to GAS, and they are a frequent causative organism of mastitis. Lancefield group B Streptococcus (GBS) are most often seen in cattle, causing mastitis. However, human infants are susceptible as well, often with fatal consequences. Group B streptococci (GBS) constitute a major cause of bacterial sepsis and meningitis among human neonates born in the United States and Western Europe, and are emerging as significant neonatal pathogens in developing countries as well. Lancefϊeld group C infections,
such as those caused by & equi, S. zooepidemicus, S. dysgalactiae, and others are mainly seen in horses, cattle and pigs, but can also cross the species barrier to humans. Lancefield group D infections are found in all mammals and some birds, sometimes resulting in endocarditis or septicaemia. Lancefield groups E, G, L, P, U and V (S. porcinus, S, canis, S. dysgalactiae) are found in various hosts, causing neonatal infections, nasopharyngeal infections, or mastitis. Within Lancefield groups R, S, and T, (and with ungrouped types) S. suis is found, an important cause of meningitis, septicemia, arthritis, and sudden death in young pigs. S. suis can also cause meningitis in man. There also exists a number of ungrouped streptococcal species, such as S. mutans, causing caries in humans, S. uheris, causing mastitis in cattle, and S. pneumonia, causing major invasive diseases such as pneumonia, bacteremia, and meningitis in humans.
"Signature-tagged mutagenesis (STM)," as used herein, is a method generally described in International Patent Publication No. WO 96/17951, incorporated herein by reference, and includes, for example, a method for identifying bacterial genes required for virulence in a murine model of bacteremia. In this method, bacterial strains that each have a random mutation in the genome are produced using transposon integration. Each insertional mutation carries a different DNA signature tag which allows mutants to be differentiated from each other. The tags comprise 40 bp variable central regions flanked by invariant "arms" of 20 bp which allow the central portions to be co-amplified by polymerase chain reaction (PCR). Tagged mutant strains are assembled in microtiter dishes, then combined to form the "inoculum pool" for infection studies. At an appropriate time after inoculation, bacteria are isolated from the animal and pooled to form the "recovered pool. " The tags in the recovered pool and the tags in the inoculum pool are separately amplified, labeled, and then used to probe filters arrayed with all of the different tags representing the mutants in the inoculum. Mutant strains with attenuated virulence are those which cannot be recovered from, or whose recovery is reduced in, the infected animal, i.e., strains with tags that give strong hybridization signals when probed with tags from the inoculum pool but not when probed with tags from the recovered pool. In a variation of this method, longer tags and non-radioactive detection methods such as chemiluminescence can be used.
Signature-tagged mutagenesis allows a large number of insertional mutant strains to be screened simultaneously in a single animal for loss of virulence.
Screening 16 pools of mutant S. uberis strains resulted in the identification of 38 strains with reduced virulence. Of these, mutations in 14 genes results in significantly attenuated S. uberis strains. The nucleotide sequence of the open reading frame disrupted by the transposon insertion was determined by sequencing both DNA strands, and an encoded amino acid sequence was deduced. The putative identity of both the polynucleotide and amino acid sequences was determined by comparison of the sequences with DNA and protein database sequences. The sequence information also permitted identification of species homologs or clonal variants in other streptococci by database mining. A "functional mutation" may occur in protein coding regions of a virulence gene of the invention, as well as in regulatory regions or genes that modulate transcription of the virulence gene mRNA. Functional mutations that decrease expression and/or biological activity of a gene product include insertions, deletions, substitutions, or point mutations in the protein coding region of the gene itself or in sequences responsible for, or involved in, control of target gene expression, including non-coding regulatory sequences or regulatory genes themselves. Deletion αnutants include those wherein all or part of a specific sequence, coding or non-coding, is deleted. Attenuated Strains and Vaccines The identification of gram-positive bacterial, and more particularly *S. uberis, virulence genes provides for microorganisms exhibiting reduced virulence Qi. e., attenuated strains), which are useful in vaccines and immunogenic compositions.
One aspect of the invention provides an attenuated streptococcal bacteria comprising a functional mutation in a virulence gene selected from thue group consisting of glnQ, glnP, dltA, dltB, pstB, pstC2, braB, abp, SAG0300, SAG0&48, Spy 1228, SpyM3-1631, SpyMl 3-0917, and SpyMl 8-1510, wherein said functional mutation attenuates the bacteria.
The functionally mutated genes enumerated above may comprise a polynucleotide selected from the group consisting of: a) a polynucleotide sequence selected from group consisting of SEQ IDNOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, and 27; b) a polynucleotide that hybridizes to the complement of a polynucleotide s&quence set forth in a) under moderate to highly stringent conditions; or c.) a polynucleotide that encodes a polypeptide that has at least 99%, 98%, 97%, 96%,
95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%, 79%, 78%, 77%, 76%, 75%, 74%, 73%, 72%, 71%, 70%, 69%, 68%, 67%, 66%, 65%, 64%, 63%, 62%, 61%, or 60% identity and/or similarity to a polypeptide selected from the group consisting of the polypeptide sequences set forth in SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, and 28.
The worker of ordinary skill in the art will realize that a "functional mutation" may occur in protein coding regions of a virulence gene of the invention, as well as in regulatory regions or genes that modulate transcription of the virulence gene rnRNA. Functional mutations result in decreased expression and/or biological activity of a gene product include insertions, deletions, substitutions, or point mutations. S"uch functional mutations are easily screened because they result in a reduction in virulence as described herein.
The worker of ordinary skill will also appreciate that attenuated streptococcal strains of the invention include those bearing more than one functional mutation. More than one mutation may result in additive or synergistic degrees of attenuation. Multiple mutations can be prepared by design or may fortuitously arise from a deletion event originally intended to introduce a single mutation. An example of an attenuated strain with multiple deletions is a S. uberis strain wherein the glnζ> and dltA genes are functionally deleted. Identification of virulence genes in comprising SEQ ID NOS: 1, 3, 5, 7, 9, 11,
13, 15, 17, 19, 21, 23, 25, and 27 in S. uberis provides information regarding similar genes in other streptococcal species. As an example, identification of any of the genes could potentially lead to identification of conserved genes in a diverse number of streptococcal pathogens, including S. acidominimus, S. agalactiae, S. bovis, S. equinus, S. canis, S. cricetus, S. downei, S. dysgalactiae, S. enteήcus, S. equi, S. equinus, S. equisimilis, S. gallinaceus, S. iniae, S. mutans, S. parauberis, S. pluranimalium, S. porcinus, S. pyogenes, S. pneumoniae, S. sobrinus, S. uberis, S. suis, and S. zooepidemicus. Using the virulence genes sequences identified in S. uberis, similar or homologous genes can be identified in other organisms, particularly within the streptococci, as well as other gram-positive species. Hybridization., using the streptococcal genes as probes, can identify related genes in chromosomal libraries derived from other organisms. Alternatively, PCR can be equally effective iτx gene identification across species boundaries. As still another alternative, complementation of, for example, a S. uberis mutant with a chromosomal library from other species can
also be used to identify genes having the same or related virulence activity. The increasing availability of genomic information for streptococcal species makes bioinformatic approaches an important method for identification of related virulence genes. This can therefore lead to production of an attenuated strain of the other organism which can be useful as still another vaccine formulation. Examples of S. uberis genes that have been demonstrated to exist in other species {e.g. S. agalactiae, S. pyogenes, and S. pneumoniae) include genes glnQ, glnP, dltA, dltB, pstB, pstC2, braB, abp, SAG0300, SAG0948, Spy 1228, SpyM3-1631, SpyMl 3-0917, and SpyMl 8- 1510. It is appreciated also, that even within S. uberis that strain variations may exist in the sequences of the virulence genes identified. These variants are easily identified by the ordinarily skilled artisan.
Attenuated S. uberis strains identified using STM are insertional mutants wherein a virulence gene has been rendered non-functional through insertion of transposon sequences in either the open reading frame or regulatory DNA sequences. These insertional mutants still contain all of the genetic information required for bacterial virulence, and can possibly revert to a pathogenic state by deletion of the inserted transposon. Therefore, in preparing a vaccine formulation, it is desirable to take the information gleaned from the attenuated strain and create a deletion mutant strain wherein some, most, or all of the virulence gene sequence is removed, thereby precluding the possibility that the bacteria will revert to a virulent state.
The vaccine properties of an attenuated insertional mutant identified using STM are expected to be the same or similar to those of a bacteria bearing a deletion in the same gene. However, it is possible that an insertion mutation may exert "polar" effects on adjoining gene sequences, and as a result, the insertion mutant may possess characteristics distinct from a mutant strain with a deletion in the same gene sequence. Deletion mutants can be constructed using any of a number of techniques well known and routinely practiced in the art.
In one example, a strategy using counterselectable markers can be employed which has commonly been utilized to delete genes in many bacteria. For a review, see, for example, Reyrat et ah, Infection and Immunity 66:4011-4017 (1998), incorporated herein by reference. In this technique, a double selection strategy is often employed, wherein a plasmid is constructed encoding both a selectable and counterselectable marker, with flanking DNA sequences derived from both sides of the desired deletion. The selectable marker is used to select for bacteria in which the
plasmid has integrated into the genome in the appropriate location and manner. The counterselecteable marker is used to select for the very small percentage of bacteria that have spontaneously eliminated the integrated plasmid. A fraction of these bacteria will then contain only the desired deletion with no other foreign DNA present. The key to the use of this technique is the availability of a suitable counterselectable marker.
In another technique, the cre-lox system is used for site-specific recombination of DNA. The system consists of 34 base pair lox sequences that are recognized by the bacterial ere recombinase gene. If the lox sites are present in the DNA in an appropriate orientation, DNA flanked by the lox sites will be excised by the ere recombinase, resulting in the deletion of all sequences except for one remaining copy of the lox sequence. Using standard recombination techniques, it is possible to delete the targeted gene of interest in the streptococcal genome and to replace it with a selectable marker {e.g., a gene coding for kanamycin resistance) that is flanked by the lox sites. Transient expression (by electroporation) of a suicide plasmid containing the ere gene under control of a promoter that functions in streptococcal species of interest of the ere recombinase should result in efficient elimination of the /ox-flanked marker. This process would result in a mutant containing the desired deletion and one copy of the lox sequence. In another approach, it is possible to directly replace a desired deleted sequence in the genome of the streptococcal species of interest with a marker gene, such as green fluorescent protein (GFP), β-galactosidase, or luciferase. In this technique, DNA segments flanking a desired deletion are prepared by PCR and cloned into a suicide (non-replicating) vector for streptococcal species of interest. An expression cassette, containing a promoter active in streptococci and the appropriate marker gene, is cloned between the flanking sequences. The plasmid is introduced into a wild-type streptococcal strain. Bacteria that incorporate and express the marker gene (probably at a very low frequency) are isolated and examined for the appropriate recombination event {i.e. replacement of the wild type gene with the marker gene). The present invention provides combination vaccines suitable for administration to a subject animal. The combination vaccines of the present invention include an attenuated streptococcal strain in combination with at least one other antigen capable of inducing a protective immune response in the subject animal against disease caused by such other antigen. Preferred combination vaccines of the
present invention include, but are not limited to, other environmental streptococcal species, including Streptococcus agalactiae and Streptococcus dysgalactiae, Neospora caninum, bovine viral diarrhea virus type 1 and 2, bovine herpes virus type 1, parainfluenza virus type 3, bovine coronavirus, bovine rotavirus, foot and mouth disease virus, bovine spongiform encephalopathy agent, Escherichia coli, Pasteurella multocida, Mannheimia haemolytica, Mycoplasma spp., including Mycoplasma bovis, Haemophilus somni, Clostridial spp., Fusobacterium necrophorum, Ar canobacterium pyogenes, Moraxella bovis, Staphylococcus aureus, Enterococcus faecalis, Leptospiras, Campylobacter spp., including Campylobacter fetus, Mycobacterium pseudotuberculosis, and Salmonella spp.
The reduced virulence of these organisms and their immunogenicity may be confirmed by administration to a subject animal. While it is possible for an avirulent microorganism of the invention to be administered alone, one or more of such mutant microorganisms are preferably administered in a vaccine composition containing suitable adjuvant(s) and pharmaceutically acceptable diluent(s) or carrier(s). The carrier(s) must be "acceptable" in the sense of being compatible with the avirulent microorganism of the invention and not deleterious to the subject to be immunized. Typically, the carriers will be water or saline which will be sterile and pyrogen-free. The subject to be immunized is one needing protection from a disease caused by a virulent form of streptococci or other pathogenic microorganisms.
Any adjuvant known in the art may be used in the vaccine composition, including oil-based adjuvants such as Freund's Complete Adjuvant and Freund's Incomplete Adjuvant, mycolate-based adjuvants {e.g., trehalose dimycolate), bacterial lipopolysaccharide (LPS), peptidoglycans {i.e., mureins, mucopeptides, or glycoproteins such as N-Opaca, muramyl dipeptide [MDP], or MDP analogs), proteoglycans {e.g., extracted from Klebsiella pneumoniae), streptococcal preparations {e.g., OK432), Biostim™ {e.g., 01K2), the "Iscoms" of EP 109 942, EP 180 564 and EP 231 039, aluminum hydroxide, saponin, DEAE-dextran, neutral oils (such as miglyol), vegetable oils (such as arachis oil), liposomes, Pluronic® polyols, the Ribi adjuvant system (see, for example GB-A-2 189 141), or interleukins, particularly those that stimulate cell mediated immunity. An alternative adjuvant consisting of extracts of Amycolata, a bacterial genus in the order Actinomycetales, has been described in U.S. Patent No. 4,877,612. Other adjuvants include mineral gels, e.g., aluminum hydroxide; surface active substances such as lysolecithin;
glycosides, e.g., saponin derivatives such as Quil A or GPI-0100 (United States Patent No. 5,977,081); cationic surfactants such as DDA, pluronic polyols; polyanions; non- ionic block polymers, e.g., Pluronic F-127 (B.A.S.F., USA); peptides; mineral oils, e.g. Montanide ISA-50 (Seppic, Paris, France), carbopol, Amphigen (Hydronics, Omaha, NE USA), Alhydrogel (Superfos Biosector, Frederikssund, Denmark) oil emulsions, e.g. an emulsion of mineral oil such as BayolF/Aiiacel A and water, or an emulsion of vegetable oil, water and an emulsifϊer such as lecithin; alum, cholesterol, rmLT, cytokines and combinations thereof. Additionally, proprietary adjuvant mixtures are commercially available. The immunogenic component may also be incorporated into liposomes, or conjugated to polysaccharides and/or other polymers for use in a vaccine formulation.
The adjuvant used will depend, in part, on the recipient organism. The amount of adjuvant to administer will depend on the type and size of animal. Optimal dosages may be readily determined by routine methods. The vaccine compositions optionally may include vaccine-compatible pharmaceutically acceptable (i.e., sterile and non-toxic) liquid, semisolid, or solid diluents that serve as pharmaceutical vehicles, excipients, or media. Any diluent known in the art may be used. Exemplary diluents include, but are not limited to, polyoxyethylene sorbitan monolaurate, magnesium stearate, methyl- and propylhydroxybenzoate, polyphosphazene, poly-lactide-(co)-glycolide, talc, alginates, starches, lactose, sucrose, dextrose, sorbitol, mannitol, gum acacia, calcium phosphate, mineral oil, cocoa butter, and oil of theobroma.
The vaccine compositions can be packaged in forms convenient for delivery. The compositions can be enclosed within a capsule, caplet, microparticle emulsion, sachet, cachet, gelatin, paper, or other container. These delivery forms are preferred when compatible with entry of the immunogenic composition into the recipient organism and, particularly, when the immunogenic composition is being delivered in unit dose form. The dosage units can be packaged, e.g., in tablets, capsules, suppositories or cachets. The vaccine compositions may be introduced into the subject to be immunized by any conventional method including, e.g., by intravenous, intradermal, intranasal, peri-rectal, intramuscular, intramammary, intraperitoneal, or subcutaneous injection; by oral, sublingual, nasal, anal, or vaginal delivery, as well as introduction into the
area of the supramammary lymph node. The treatment may consist of a single dose or a plurality of doses over a period of time.
The invention also comprehends use of an attenuated bacterial strain of the invention for manufacture of a vaccine medicament to prevent or alleviate bacterial infection and/or symptoms associated therewith. The invention also provides use of inhibitors of the invention for manufacture of a medicament to prevent or alleviate bacterial infection and/or symptoms associated therewith.
It will be appreciated that the vaccine of the invention may be useful in the fields of human medicine and veterinary medicine. Thus, the subject to be immunized may be a human or other animal, for example, farm animals including cows, sheep, pigs, horses, goats and poultry (e.g., chickens, turkeys, ducks and geese) companion animals such as dogs and cats, exotic and/or zoo animals, and laboratory animals including mice, rats, rabbits, guinea pigs, and hamsters. Polynucleotides The invention also provides polypeptides and corresponding polynucleotides required for streptococcal virulence. The invention includes both naturally occurring and non-naturaUy occurring polynucleotides and polypeptide products thereof. Naturally occurring virulence products include distinct gene and polypeptide species, as well as corresponding species homologs expressed in organisms other than S. uberis. Non-naturally occurring virulence products include variants of the naturally occurring products, such as analogs and virulence products which include covalent modifications.
The invention includes isolated genes gene fragments and gene products from the loci glnQ, glnP, dltA, dltB,pstB,pstC2, braB, abp, SAG0300, SAG0948, Spy 1228, SpyM3-l 631, SpyMl 3-0917, and SpyMl 8-1510 from S. uberis.
Preferred DNA sequences are set out in SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, and 27, and species homologs or clonal variants thereof. The worker of skill in the art will readily appreciate that the preferred DNA of the invention comprises a double-stranded molecule, for example, molecules having the sequences set forth in SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, and 27 and species homologs or clonal variants thereof, along with the complementary molecule (the "non-coding strand" or "complement") having a sequence deducible from the sequence of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, and 25 according to Watson-Crick base pairing rules for DNA. Also preferred are
polynucleotides encoding the gene products encoded by any one of the polynucleotides set out in SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, and 27 and species homologs or clonal variants thereof.
The invention includes therefore, an isolated polynucleotide comprising a polynucleotide sequence selected from the group consisting of :
(a) a polynucleotide sequence set forth in SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, and 27; and
(b) a polynucleotide that encodes a polypeptide that has at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%, 79%, 78%, 77%, 76%, 75%, 74%, 73%, 72%, 71%, 70%, 69%, 68%, 67%, 66%, 65%, 64%, 63%, 62%, 61%, or 60% identity and or similarity to a polypeptide selected from the group consisting of the polypeptide sequences set forth in SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, and 28; and
(c) a polynucleotide encoding a polypeptide selected from the group consisting of SEQ ID NOs: SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, and 28;
(d) a polynucleotide that hybridizes to the complement of a polynucleotide sequence under moderately or highly stringent conditions.
(e) a polynucleotide which is the complement of any of (a), (b), (c) or (d).
The present invention provides novel isolated streptococcal polynucleotides (e.g., DNA sequences and RNA transcripts, both sense and complementary antisense strands) encoding the bacterial virulence gene products. DNA sequences of the invention include genomic as well as wholly or partially chemically or enzymatically synthesized DNA sequences. Genomic DNA of the invention comprises the protein coding region for a polypeptide of the invention and includes variants that may be found in other bacterial strains of the same species. "Synthesized," as used herein and is understood in the art, refers to purely chemical, as opposed to enzymatic, methods for producing polynucleotides. "Wholly" synthesized DNA sequences are therefore produced entirely by chemical means, and "partially" synthesized DNAs embrace those wherein only portions of the resulting DNA were produced by chemical means. The polynucleotide sequence information provided by the invention makes possible the identification and isolation of polynucleotides encoding related bacterial virulence molecules and genes which are species homologues by well known techniques including Southern and/or Northern hybridization, polymerase chain reaction (PCR), and database mining. Examples of polynucleotides related to glnQ,
glnP, dltA, dltB,pstB,pstC2, braB, abp, SAG0300, SAG0948, Spy 1228, SpyM3-1631, SpyMl 3-0917, and SpyM18-1510 are set out in Figure 1. Vectors and Host Cells
Autonomously replicating recombinant expression constructions such as plasmid and viral DNA vectors incorporating virulence gene sequences are also provided. Expression constructs wherein virulence polypeptide-encoding polynucleotides are operatively linked to an endogenous or exogenous expression control DNA sequence and a transcription terminator are also provided. The virulence genes may be cloned by PCR, using streptococcal genomic DNA as the template. For ease of inserting the gene into expression vectors, PCR primers are chosen so that the PCR-amplifϊed gene has a restriction enzyme site at the 5' end preceding the initiation codon, and a restriction enzyme site at the 3 ' end after the termination codon. If desirable, the codons in the gene are changed, without changing the amino acids, according to the codon preference of the organism being used for expression. Optimization of codon usage may lead to an increase in the expression of the gene product in the expression system If the gene product is to be produced extracellularly, either in the periplasm of E. coli or other bacteria, or into the cell culture medium, the gene is cloned without its initiation codon and placed into an expression vector behind a signal sequence. According to another aspect of the invention, host cells are provided, including procaryotic and eukaryotic cells, either stably or transiently transformed, transfected, or electroporated with polynucleotide sequences of the invention in a manner which permits expression of virulence polypeptides of the invention. Expression systems of the invention include bacterial, yeast, fungal, viral, invertebrate, and mammalian cells systems. Host cells of the invention are a valuable source of immunogen for development of antibodies specifically immunoreactive with the virulence gene product. Host cells of the invention are conspicuously useful in methods for large scale production of virulence polypeptides wherein the cells are grown in a suitable culture medium and the desired polypeptide products are isolated from the cells or from the medium in which the cells are grown by, for example, immunoaffinity purification or any of the multitude of purification techniques well known and routinely practiced in the art. Any suitable host cell may be used for expression of the gene product* such as E. coli, other bacteria, including Bacillus and S. aureus, yeast, including Pichia pastoris and Saccharomyces cerevisiae, insect cells,
or mammalian cells, including CHO cells, utilizing suitable vectors known in the art. Proteins may be produced directly or fused to a peptide or polypeptide, and either intracellularly or extracellularly by secretion into the periplasmic space of a bacterial cell or into the cell culture medium. Secretion of a protein requires a signal peptide (also known as pre-sequence). A number of signal sequences from prokaryotes and eukaryotes are known to function for the secretion of recombinant proteins. During the protein secretion process, the signal peptide is removed by signal peptidase to yield the mature protein. Polypeptides The invention also provides isolated streptococcal virulence polypeptides encoded by a polynucleotide of the invention. Presently preferred are polypeptides comprising the amino acid sequences encoded by any one of the polynucleotides set out in SEQ ID NOs : 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, and 27 or the polypeptides set forth in SEQ ID NOs:2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, and 28, and species homologs or clonal variants thereof. The invention embraces virulence polypeptides encoded by a DNA selected from the group consisting of : a) the DNA sequence set out in any one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, and 27, and species homologs or clonal variants thereof, and b) a DNA molecule, encoding a virulence gene product, that hybridizes under moderately stringent conditions to the DNA of (a). The invention also embraces polypeptides that have at least about 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%, 79%, 78%, 77%, 76%, 75%, 74%, 73%, 72%, 71%, 70%, 69%, 68%, 67%, 66%, 65%, 64%, 63%, 62%, 61%, or 60% identity and/or homology to the preferred polypeptides of the invention. Variant virulence products of the invention include mature virulence gene products, i.e., wherein leader or signal sequences are removed, or having additional amino terminal residues. Virulence gene products having an additional methionine residue at position -1 are contemplated, as are virulence products having additional methionine and lysine residues at positions -2 and -1. Variants of these types are particularly useful for recombinant protein production in bacterial cell types. Variants of the invention also include gene products wherein amino terminal sequences derived from other proteins have been introduced, as well as variants comprising amino terminal sequences that are not found in naturally occurring proteins.
The invention also embraces variant polypeptides having additional amino acid residues which result from use of specific expression systems. For example, use of commercially available vectors that express a desired polypeptide as a fusion protein with glutathione-S-transferase (GST) provide the desired polypeptide having an additional glycine residue at position -1 following cleavage of the GST component from the desired polypeptide. Variants which result from expression using other vector systems are also contemplated.
To simplify the protein purification or isolation process, a purification tag may be added either at the 5' or 3' end of the gene coding sequence. Commonly used purification tags include a stretch of six histidine residues (U.S. Patent Nos. 5,284,933 and 5,310,663), a streptavidin-affϊnity tag described by Schmidt and Skerra, Protein Engineering, 6: 109-122 (1993), a FLAG peptide [Hopp et al, Biotechnology, 6: 1205- 1210 (1988)], glutathione S-transferase [Smith and Johnson, Gene, (57:31-40 (1988)], and thioredoxin [LaVallie et al. , Bio/Technology, 27:187-193 (1993)]. To remove these peptides or polypeptides, a proteolytic cleavage recognition site may be inserted at the fusion junction. Commonly used proteases are factor Xa, thrombin, and enterokinase. Antibodies
Also contemplated by the present invention are antibodies (e.g., monoclonal and polyclonal antibodies, single chain antibodies, chimeric antibodies, humanized, human, and CDR-grafted antibodies, including compounds which include CDR sequences which specifically recognize a polypeptide of the invention) and other binding proteins specific for virulence gene products or fragments thereof. The term "specific for" indicates that the variable regions of the antibodies of the invention recognize and bind a virulence polypeptide exclusively (i.e., are able to distinguish a single virulence polypeptides from related virulence polypeptides despite sequence identity, homology, or similarity found in the family of polypeptides), but may also interact with other proteins (for example, S. aureus protein A or other antibodies in ELISA techniques) through interactions with sequences outside the variable region of the antibodies, and in particular, in the constant region of the molecule. Screening assays to determine binding specificity of an antibody of the invention are well known and routinely practiced in the art. For a comprehensive discussion of such assays, see Harlow et al. (Eds), Antibodies A Laboratory Manual; Cold Spring Harbor Laboratory; Cold Spring Harbor , NY (1988), Chapter 6. Antibodies that recognize
and bind fragments of the virulence polypeptides of the invention are also contemplated, provided that the antibodies are first and foremost specific for, as defined above, a virulence polypeptide of the invention from which the fragment was derived. Modulation or Manipulation of Expression of the Nucleic Acids and Polypeptides of the Invention
The DNA and amino acid sequence information provided by the present invention also makes possible the systematic analysis of the structure and function of the virulence genes and their encoded gene products. Knowledge of a polynucleotide encoding a virulence gene product of the invention also makes available anti-sense polynucleotides which recognize and hybridize to polynucleotides encoding a virulence polypeptide of the invention. Full length and fragment anti-sense polynucleotides are provided. The worker of ordinary skill will appreciate that fragment anti-sense molecules of the invention include (i) those which specifically recognize and hybridize to a specific RNA (as determined by sequence comparison of DNA encoding a virulence polypeptide of the invention to DNA encoding other known molecules), as well as (ϋ) those which recognize and hybridize to RNA encoding variants of the family of virulence proteins. Antisense polynucleotides that hybridize to RNA encoding other members of the virulence family of proteins are also identifiable through sequence comparison to identify characteristic, or signature, sequences for the family of molecules.
The invention further contemplates methods to modulate gene expression through use of ribozymes. For a review, see Gibson and Shillitoe, MoI. Biotech. 7: 125-137 (1997). Ribozyme technology can be utilized to inhibit translation of mRNA in a sequence specific manner through (i) the hybridization of a complementary RNA to a target mRNA and (ii) cleavage of the hybridized mRNA through nuclease activity inherent to the complementary strand. Ribozymes can be identified by empirical methods but more preferably are specifically designed based on accessible sites on the target mRNA [Bramlage, et at, Trends in Biotech 16:434- 438 (1998)]. Delivery of ribozymes to target cells can be accomplished using either exogenous or endogenous delivery techniques well known and routinely practiced in the art. Exogenous delivery methods can include use of targeting liposomes or direct local injection. Endogenous methods include use of viral vectors and non-viral plasmids.
Ribozymes can specifically modulate expression of virulence genes when designed to be complementary to regions unique to a polynucleotide encoding a virulence gene product. "Specifically modulate" therefore is intended to mean that ribozymes of the invention recognize only a single polynucleotide. Similarly, ribozymes can be designed to modulate expression of all or some of a family of proteins. Ribozymes of this type are designed to recognize polynucleotide sequences conserved in all or some of the polynucleotides which encode the family of proteins.
The invention further embraces methods to modulate transcription of a virulence gene of the invention through use of oligonucleotide-directed triplet helix formation. For a review, see Lavrovsky, et ah, Biochem. MoI. Med. 62: 11-22 (1997). Triplet helix formation is accomplished using sequence specific oligonucleotides which hybridize to double stranded DNA in the major groove as defined in the Watson-Crick model. Hybridization of a sequence specific oligonucleotide can thereafter modulate activity of DNA-binding proteins, including, for example, transcription factors and polymerases. Preferred target sequences for hybridization include transcriptional regulatory regions that modulate virulence gene product expression. Oligonucleotides which are capable of triplet helix formation are also useful for site-specific covalent modification of target DNA sequences. Oligonucleotides useful for covalent modification are coupled to various DNA damaging agents as described in Lavrovsky, et a [supra]. Methods of Identifying Anti-Bacterial Agents.
The identification of streptococcal virulence genes renders the genes and gene products useful in methods for identifying anti-bacterial agents. Such methods include assaying potential agents for the ability to interfere with expression of virulence gene products represented by the DNA sequences set forth in any one of SEQ IDNOS: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, and 27, and species homologs or clonal variants thereof (i.e., the genes represented by DNA sequences of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, and 27 encode the virulence gene product, or the DNA sequences of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, and 27 are adjacent the gene encoding the virulence gene product, or are involved in regulation of expression of the virulence gene product), or assaying potential agents for the ability to interfere with the function of a bacterial gene product encoded in whole or in part by a DNA sequence set forth in any one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, and 27, species homologs or
clonal variants thereof, or the complementary strand thereof, followed by identifying agents that are positive in such assays. Polynucleotides and polypeptides useful in these assays include not only the genes and encoded polypeptides as disclosed herein, but also variants thereof that have substantially the same activity as the wild-type genes and polypeptides.
The virulence gene products produced by the methods described above are used in high throughput assays to screen for inhibitory agents. The sources for potential agents to be screened are chemical compound libraries, fermentation media of Streptomycetes, other bacteria and fungi, and cell extracts of plants and other vegetations. For proteins with known enzymatic activity, assays are established based on the activity, and a large number of potential agents are screened for ability to inhibit the activity. For proteins that interact with another protein or nucleic acid, binding assays are established to measure such interaction directly, and the potential agents are screened for ability to inhibit the binding interaction. ■ The use of different assays known in the art is contemplated according to this aspect of the invention. When the function of the virulence gene product is known or predicted by sequence similarity to a known gene product, potential inhibitors can be screened in enzymatic or other types of biological and/or biochemical assays keyed to the function and/or properties of the gene product. When the virulence gene product is known or predicted by sequence similarity to a known gene product to interact with another protein or nucleic acid, inhibitors of the interaction can be screened directly in binding assays. The invention contemplates a multitude of assays to screen and identify inhibitors of binding by the virulence gene product. In one example, the virulence gene product is immobilized and interaction with a binding partner is assessed in the presence and absence of a putative inhibitor compound. In another example, interaction between the virulence gene product and its binding partner is assessed in a solution assay, both in the presence and absence of a putative inhibitor compound. In both assays, an inhibitor is identified as a compound that decreases binding between the virulence gene product and its binding partner. Other assays are also contemplated in those instances wherein the virulence gene product binding partner is a protein. For example, variations of the di-hybrid assay are contemplated wherein an inhibitor of protein/protein interactions is identified by detection of a positive signal in a transformed or transfected host cell as described in PCT publication number WO 95/20652, published August 3, 1995.
Candidate inhibitors contemplated by the invention include compounds selected from libraries of potential inhibitors. There are a number of different libraries used for the identification of small molecule modulators, including: (1) chemical libraries, (2) natural product libraries, and (3) combinatorial libraries comprised of random peptides, oligonucleotides or organic molecules. Chemical libraries consist of structural analogs of known compounds or compounds that are identified as "hits" or "leads" via natural product screening. Natural product libraries are collections of microorganisms, animals, plants, or marine organisms which are used to create mixtures for screening by: (1) fermentation and extraction of broths from soil, plant or marine microorganisms or (2) extraction of plants or marine organisms. Natural product libraries include polyketides, non-ribosomal peptides, and variants (non-naturally occurring) thereof. For a review, see Science 252:63-68 (1998). Combinatorial libraries are composed of large numbers of peptides, oligonucleotides, or organic compounds as a mixture. They are relatively easy to prepare by traditional automated synthesis methods, PCR, cloning, or proprietary synthetic methods. Of particular interest are peptide and oligonucleotide combinatorial libraries. Still other libraries of interest include peptide, protein, peptidomimetic, multiparallel synthetic collection, recombinatorial, and polypeptide libraries. For a review of combinatorial chemistry and libraries created therefrom, see Myers, Curr. Opin. Biotechnol 5:701-707 (1997). Identification of modulators through use of the various libraries described herein permits modification of the candidate "hit" (or "lead") to optimize the capacity of the "hit" to modulate activity.
Still other candidate inhibitors contemplated by the invention can be designed and include soluble forms of binding partners, as well as binding partners as chimeric, or fusion, proteins. Binding partners as used herein broadly encompasses antibodies, antibody fragments, and modified compounds comprising antibody domains that are immunospecific for the expression product of the identified virulence gene.
Other assays may be used when a binding partner {i.e., ligand) for the virulence gene product is not known, including assays that identify binding partners of the target protein through measuring direct binding of test binding partner to the target protein, and assays that identify binding partners of target proteins through affinity ultrafiltration with ion spray mass spectroscopy/HPLC methods or other physical and analytical methods. Alternatively, such binding interactions are evaluated indirectly using the yeast two-hybrid system described in Fields and Song,
Nature, 340:245-246 (1989), and Fields and Sternglanz, Trends in Genetics, 70:286- 292 (1994), both of which are incorporated herein by reference. The two-hybrid system is a genetic assay for detecting interactions between two proteins or polypeptides. It can be used to identify proteins that bind to a known protein of interest, or to delineate domains or residues critical for an interaction. Variations on this methodology have been developed to clone genes that encode DNA-binding proteins, to identify peptides that bind to a protein, and to screen for drugs. The two- hybrid system exploits the ability of a pair of interacting proteins to bring a transcription activation domain into close proximity with a DNA-binding domain that binds to an upstream activation sequence (UAS) of a reporter gene, and is generally performed in yeast. The assay requires the construction of two hybrid genes encoding (1) a DNA-binding domain that is fused to a first protein, and (2) an activation domain fused to a second protein. The DNA-binding domain targets the first hybrid protein to the UAS of the reporter gene; however, because most proteins lack an activation domain, this DNA-binding hybrid protein does not activate transcription of the reporter gene. The second hybrid protein, which contains the activation domain, cannot by itself activate expression of the reporter gene because it does not bind the UAS. However, when both hybrid proteins are present, the noncovalent interaction of the first and second proteins tethers the activation domain to the UAS, activating transcription of the reporter gene. When the virulence gene product (the first protein, for example) is already known to interact with another protein or nucleic acid, this assay can be used to detect agents that interfere with the binding interaction. Expression of the reporter gene is monitored as different test agents are added to the system; the presence of an inhibitory agent results in lack of a reporter signal. When the function of the virulence gene product is unknown and no ligands are known to bind the gene product, the yeast two-hybrid assay can also be used to identify proteins that bind to the gene product. In an assay to identify proteins that bind to the first protein (the target protein), a large number of hybrid genes each encoding different second proteins are produced and screened in the assay. Typically, the second protein is encoded by a pool of plasmids in which total cDNA or genomic DNA is ligated to the activation domain. This system is applicable to a wide variety of proteins, and it is not even necessary to know the identity or function of the second binding protein. The system is highly sensitive and can detect interactions not
revealed by other methods; even transient interactions may trigger transcription to produce a stable mRNA that can be repeatedly translated to yield the reporter protein.
Other assays may be used to search for agents that bind to the target protein. One such screening method to identify direct binding of test ligands to a target protein is described in U.S. Patent No. 5,585,277, incorporated herein by reference. This method relies on the principle that proteins generally exist as a mixture of folded and unfolded states, and continually alternate between the two states. When a test ligand binds to the folded form of a target protein (i.e., when the test ligand is a ligand of the target protein), the target protein molecule bound by the ligand remains in its folded state. Thus, the folded target protein is present to a greater extent in the presence of a test ligand which binds the target protein, than in the absence of a ligand. Binding of the ligand to the target protein can be determined by any method which distinguishes between the folded and unfolded states of the target protein. The function of the target protein need not be known in order for this assay to be performed. Virtually any agent can be assessed by this method as a test ligand, including, but not limited to, metals, polypeptides, proteins, lipids, polysaccharides, polynucleotides and small organic molecules.
Another method for identifying ligands for a target protein is described in Wieboldt et al., Anal. Chem., (59:1683-1691 (1997), incorporated herein by reference. This technique screens combinatorial libraries of 20-30 agents at a time in solution phase for binding to the target protein. Agents that bind to the target protein are separated from other library components by centrifugal ultrafiltration. The specifically selected molecules that are retained on the filter are subsequently liberated from the target protein and analyzed by HPLC and pneumatically assisted electrospray (ion spray) ionization mass spectroscopy. This procedure selects library components with the greatest affinity for the target protein, and is particularly useful for small molecule libraries.
The inhibitors/binders identified by the initial screens are evaluated for their effect on virulence in in vivo mouse models of streptococcal infections. Models of bacteremia, endocarditis, septic arthritis, soft tissue abscess, or pneumonia may be utilized. Models involving use of other animals are also comprehended by the invention. For example, rabbits can be challenged with a wild type streptococcal strain before or after administration of varying amounts of a putative inhibitor/binder compound. Control animals, administered only saline instead of putative
inhibitor/binder compound provide a standard by which deterioration of the test animal can be determined. Other animal models include those described in the Animal and Plant Health Inspection Sevice, USDA. January 1, 1994 Edition, §§113.69-113.70; Panciera and Corstvet, Λm. J. Vet. Res. 45:2532-2537; Ames, et al, Can. J. Camp. Med. 4P:395-400 (1984); and Mukkur, Infection and Immunity 75:583- 585 (1977). Inhibitors/binders that interfere with bacterial virulence are can prevent the establishment of an infection or reverse the outcome of an infection once it is established.
The present invention is illustrated by the following examples. Example 1 describes construction of the S. uberis mutants. Example 2 relates to murine screening of the S. uberis mutants. Example 3 details the methodology for identifying the sequences flanking the insertion site within each mutant strain. Example 4 describes safety screening of the mutants in dairy cows and goats. In Example 5, mutants were evaluated in goats for their efficacy against an experimental infection. Example 6 details safety evaluation of two mutants in dairy cattle. Example 7 details efficacy evaluation of mutants in dairy cattle. The Examples make reference to primer sequences. The sequences of primers used are included below in Table 2.
Table 2
* Denotes oligo labeled with, biotiα at 5 'end. SEQ ID
NO: Oligo Name Sequence (S'-3')
29 DEL-2124 CCTCGAGGTCGACGGTATCGATA
30 DEL-2403 CCGAAGAAATGGAACGCTCT
31 DEL-2404 TCGATAGCTTGATGGAGAGA
32 TEF-5 TACCTACAACCTCAAGCT
33 TEF-6 TACCCATTCTAACCAAGC
34 TEF-326 CATGAATTCCATGGTACCCATTCTAAC
35 TEF-327 CTAGAATTCCTAGGTACCTACAACCTC
36 TEF-598 GGCCACGCGTCGACTAGTAC
37 TEF-663 GGCCACGCGTCGACTAGTACNNNNMSINNNNATGCAT
38 TEF-664 GGCCACGCGTCGACTAGTAO^NNNNISDNNNNGTTAAC
39 TEF-665 GGCCACGCGTCGACTAGTAQWNNNNNNNNTTCGAA
40 TEF-666 GGCCACGCGTCGACΓAGTACNTSINNNNNNNNGATATC
41 TEF-667 GGCCACGCGTCGACTAGTAOSINNNNNNNNNTGATCA
42 TEF- 668 GGCCACGCGTCGACTAGTA.CNNNTSINNNNNNCAGCTG
43 TEF-703 *GTGCTGCAAGGCGATT AAGTTGGG
44 TEF-704 *CGCGTAATACGACTCACTATAGGGC
45 TEF-705 AGGAGTTCTTGAATTTCACGATAGC
46 TEF-706 *GGGTCAATCGAGAATATCGTCAACTG
47 TEF-707 *GGTATACTACTGACAGCTTCCAAGGAG
48 TEF-708 CGATTAAGGGCATGGAAACAATTCG * Denotes oligo labeled with biotin at 5 'end.
Example 1. Construction of a Streptococcus uberis Library Containing Transposon-Tagged Mutants A library of Streptococcus uberis (S. uberis) strain UT888 (provided by Dr.
Steven P. Oliver; University of Tennessee) signature-tagged mutants was constructed using the thermosensitive suicide vector pGh9:ISSl [Maguin, et al, J Bacterid. 178:931-935 (1996)]. The pG+host9 (pGh9) replicon is functional at 28°C, but at 37 C, the plasmid is lost. The addition of ISSl to the plasmid allows for integration of the plasmid into the bacterial chromosome at 37°C. Plasmid pGh9:ISSl was modified to include sequence tags that contain a semi-random PS[K]35 sequence (N= A,G,C, or T; K= G or T) used to identify mutants isolated from animals, as described later. These sequence tags were generated using the GeneAmpXL PCR kit (Applied Biosystems) and reactions contained 250μM of dNTP, 1.5M Mg(OaC)2, lOOpmol each of Primers TEF326 and TEF 327, 2.5 units of rTth DNA polymerase XL, and lμl of plasmid template. The template consisted of individual pTEFl : [NK]35 plasmids [Fuller, T.E. et al, Microb. Path., 29:25-38 (2000)], each with a different tag. Reaction conditions were as follows: 2 min at 95°C, followed by 30 cycles of 30 sec at 95°C, 15 sec at 470C, and 15 sec at 72°C, followed by a final step of 2 min at 72°C. The resulting 125bp products were gel purified, extracted, and digested with EcoRI. The tags were cleaned using the Qiagen Nucleotide Removal Kit and ligated into the EcoRI site of pGh9:ISSl. This process was carried out for 86 unique tags.
Εlectrocompetent S. uberis were prepared as follows: A 5ml Brain Heart Infusion (BHI) overnight culture of S. uberis was centrifuged at 3600 rpm in a Beckman CS-6R centrifuge for 10 min. Pelleted cells were washed with 5ml PBS. Following a second spin, the pellet was resuspended in ImI PBS, and 500μl was used to incoculate 100ml of chemically-defined media [Leigh, J. A. and T. R. Field, Infect. Imm. 62:1854-1859 (1994)]. The initial OD550 of the culture was between 0.1-0.2,
and it was incubated at 37°C with 5% CO2 until the OD550 reached approximately 1.0.. After a 1 hr incubation on ice in a pre-chilled 250ml tube, the cells were centrifuged 10 min at 3600 rpm. The cells were washed twice with 20ml of 15% cold glycerol, and then resuspended in 2ml of 15% cold glycerol. Aliquots of 40μl were immediately frozen in microcentrifuge tubes in a dry ice/ ethanol bath. Electrocompetent cells were stored at -7O0C.
Transformation of pGh9:ISSl into S. uberis was carried out as previously described [Ward, P.N. et al, Infect. Imm. 69:392-399 (2001)]. Briefly, 40μl aliquots of competent S. uberis cells were thawed on ice, 2μl pGh9:ISSl was added and the mix incubated on ice for 1 min; 60μl of cold 10% glycerol was subsequently added. The mixture was transferred to a pre-chilled 0.1 cm cuvette and immediately electroporated with a Gene Pulser Apparatus (Bio-Rad; Hercules, CA) using parameters of 25μF, 2.4 kV and 100Ω. The mixture was added to 0.5ml prewarmed BHI, and incubated at 28°C while shaking at 190 rpm. After 2.5 hr, 200μl was plated on BHI agar containing 0.5mg/ml erythromycin, and incubated at 28°C in 5% CO2 overnight. Electroporations were performed for every pGh9:ISSl plasmid containing a different sequence tag, resulting in 86 different S. uberis strains, each containing a unique plasmid/tag combination. These were frozen in glycerol in individual wells of a 96-well round bottom plate (Corning Costar; Cambridge, MA). Erythromycin-resistant colonies were analyzed by PCR to verify that they contained the unique sequence tags, meaning the pGh9:ISSl plasmid was present. To prepare template for PCR, a bacterial suspension was made by inoculating 1 colony into lOOμl of sterile water. The PCR reaction contained lμl template, Ix XL Buffer II, 0.8mM dNTP blend, 1.5mM Mg(Oac)2, 0.5μM TEF5, 0.5μM TEF6, and 1 Unit rTth DNA polymerase. The reactions were carried out in an Applied Biosystems GeneAmp PCR System 2400 as follows: 95°C for 2 min, 30 cycles of (95°C for 30 sec, 55°C for 1 min, 72°C for 1.5 min), 72°C for 10 min, and held at 4°C. Products were electrophoresed in a 2% agarose gel; confirmation of the plasmid was by visualization of a 125 bp band. Transposition of the plasmid into the chromosome was completed for all 86 S. uberis strains. This was accomplished by first using sterile toothpicks to inoculate from each well of the 96-well plate containing the stocks into each well of a new 96- well plate containing 200μl Bffl/Ermo-5mg/ml, making sure that the frozen stock in well
Al was used to inoculate well Al of the new plate. After overnight growth, the culture was diluted 1 : 100 into lOOμl total volume in a new 96-well plate. The cultures were incubated at 28 C for 2.5 hr, at which time the "temperature was shifted to 37°C and incubated and additional 2.5 hr to promote transposition of the plasmid into the chromosome by ISSl. The cultures were serially diluted, and the entire 10"3 dilution for all 86 was plated onto individual BFQ/Erm05 agar plates. The resulting plates contained several hundred colony forming units (CFlT). Pools were constructed by first inoculating lOOμl BHI/Erm0-5 broth into the wells of -40 different 96-well plates. Using a sterile toothpick, the same corresponding well from each 96-well plate was inoculated with a different colony from one agar plate (-40 colonies total from each plate picked) containing erythromycin-resistant S. uberis cells harboring one of the 86 unique pGh9:ISSl constructs. All of the wells of all of the plates were inoculated in this fashion, creating 40 pools, each with 86 different signature-tagged mutants in each pool. Example 2. Murine Screening of S. uberis Transposon Mutants
Individual transposon mutants from 16 pools (1392 mutants total) were screened in a septicemic mouse model to identify attenuated candidates. Frozen pools of S. uberis signature tagged mutants were removed from -7O0C storage and subcultured, using sterile technique to a new 96-well round bottom plate containing 200μl BHI/Erm.0-5. Plates were incubated without shaking overnight at 37°C with 5% CO2. The next day, the entire 200μl was used to inoculate 4-ml BHI/Erm0'5 broth in a sterile 13x100mm glass tube. The cultures were incubated a* 37°C while shaking at 150 rpm, to an OD550 of 0.8-0.9. CF-I female mice were then infected with 1 ml of culture (approximately 1 x 109 CFU/ml) by intraperitoneal administration. Two mice were infected for each transposon mutant. The mice were ctiecked daily for a maximum of 5 days and given clinical scores of 1-10, with 1 0 being apparently healthy and 1 being moribund. Those mutants that resulted in both mice having scores of 10 were retested in two additional mice. Mutants rJhat passed through both mouse studies were presumed to be attenuated, as this model results in death of the mouse when using wildtype S. uberis strain UT888. Example 3. Identification of Flanking Sequences
Several techniques were used to identify the DNA sequence flanking the pGh9:ISSl insertion site, including inverse PCR, Vectorette"™ technology, arbitrary
PCR , and single primer PCR. Inverse PCR was performed as described previously [Maguin et. al. 1996]. Briefly, genomic DNA was digested to completion -with a restriction endonuclease. Different restriction endonucleases were used for various mutants, although for some clones, an appropriate enzyme could not be identified. One fragment of the digested DNA will contain the pGh replicon, ISSl, erythromycin resistance marker and the flanking genomic sequence. Following ligation of this fragment and electroporation into E. coli strain TGl (following the protocol for S. uberis electroporation described above), the transformation mixture was plated on BHI/Erm0 5 plates and incubated overnight at 28°C. Plasmid DNA was isolated using a Qiagen Plasmid Miniprep Kit, and used as template for sequencing. The sequencing reactions contained 5μl template, 3μl of 1 μM primer and 5μl Big Dye Terminator 3.1 (Applied Biosystems).
The Vectorette™ method employed the Vectorette II Starter Pack S ECit (Genosys; The Woodlands, TX) to generate Vectorette™ DNA libraries following instructions provided. PCR amplification was carried out using a primer directed to the ISSl known sequence, and a second primer directed to the Vectorette™ cassette sequence. The reaction conditions were as follows: Ix XL buffer II, 0.8μM dNTPs, 0.8 μM Mg(Oac)2, 0.5 μM 5' Vectorette™ primer, 0.5 μM 3' ISSl primer (DEL 2124, SEQ ID NO. or DEL- 2404 were used for BamHl Vectorette™ libraries), lμl Vectorette™ library, and 1 unit τTth DNA polymerase XL. The reactions were carried out in an Applied Biosystems GeneAmp PCR Thermocycler 2400 as follows: 94°C for 1.5 min, followed by 35 cycles of 94°C for 20 sec, 60°C for 45 sec and 72°C for 4 min. After a 72°C, 7 min hold, the reactions were electrophoresed and gel purified from a 0.8% agarose gel using Qiagen's QIAquick gel extraction protocol. The purified material was then used as template for cycle sequencing. The sequencing reactions were set up as previously described using either primer DEL- 2124 or DEL-2404 for the first reaction, and a second reaction using the Vectorette™ primer.
The arbitrary PCR procedure used was a modified version of that previously described by Rossbach et al. [Rossbach et al, Environ. Microbiol. 2(4):373-382 (2000)]. Primer TEF-703 was used to amplify DNA 5' to the ISSl msertiorxal element, while TEF-706 was used for amplification of the region 3' to ISSl - For both amplifications, a mixture of six arbitrary primers was used for the second primer,
including TEF-663, TEF-664, TEF-665, TEF-666, TEF-667, TΕF-668. lμg of genomic DNA template was used. The concentrations of PCR. reagents used were the same as described above. The reactions were carried out in an Applied Biosystems GeneAmp 2700 PCR thermocycler as follows: 2 min at 94 C, 14 cycles of (15 sec at 94°C, 30 sec at 50°C*, 5 min at 72°C), 30 cycles of (15 sec at 94°C, 30 sec at 50°C, 5 min at 72°C), 7 min at 72°C, and held at 4°C. (The * denotes a touchdown step whereby cycle 1 is at 50 C, and each cycle thereafter decreases the temperature at this step by 1°C, until it reaches 37°C at cycle 14.) Secondary amplification of DNA 5' to the ISSl insertion element was performed using nested primers TEF-598 and TEF- 704, and amplification of the area 3' to ISSl was performed using primers TEF-598 and TEF-707. Template consisted of 1 μl of the first round amplification reaction product. Cycle conditions consisted of 1 min at 94°C, 30 cycles of (30 sec at 94°C, 1 min at 60°C, and 5 min at 72°C), and a final hold of 7 min at 72°C. Reaction products were electrophoresed in a 0.8% agarose gel and bands were gel extracted as previously described. Sequencing was performed as described- above, using purified DNA and either primer TEF-705 or TEF-708, depending on th.e primer used for secondary amplification.
Single primer PCR was performed as described previously [Karlyshev et al, Biotechniques, 28:1078-1082 (2000)], followed by a second round of amplification using nested primers to decrease background. Primary amplification of DNA flanking the ISSl region was performed using primer TEF-703, TEF-7O6 or TEF-708. The concentrations of PCR reagents per reaction were as described previously. Template consisted of 5μl of a 5ml overnight broth culture. Reactions Λ^ere carried out in an Applied Biosystems GeneAmp PCR System 2700 thermocycler as follows: 1 min at 94°C, 20 cycles of (30 sec at 94°C, 30 sec at 50°C, 3 min at 72°C), 30 cycles of (30sec at 94°C, 30 sec at 30°C, 2 min at 72°C), and 7 min at 72°C. PCR reactions were electrophoresed in a 0.8% agarose gel, and unique bands were gel extracted and used as template for sequencing. Primers used for sequencing were as follows: TEF-705 was used for those PCR reactions amplified using primer,TEF-703; likewise, TEF- 708 was used for reactions amplified by TEF-706, and DEL-2-403 was used for reactions amplified by TEF-708. Table 3 details the individual mutants and the identity of the disrupted open reading frames. Nucleotide and deduced amino acid sequences are shown in the sequence listings.
Table 3. S. uberis Attenuated STM Mutants
Identification of species homologues
Amino acid sequences for the S. uberis genes were aligned with the homologous sequences identified in other streptococcal species. % identity and % similarity were calculated using BLASTP 2.2.6 [Tatusova TA and TL Madden, "BLAST 2 sequences- a new tool for comparing protein and nucleotide sequences." (1999) FEMS Microbiol Lett. 174:247-250.], and are reported in Figure 1. Example 4. Safety Screening of Transposon Mutants in Goats Viability of the mutants in the mammary gland over time was determined for each mutant via intramammary (IMM) administration to dairy cattle. Mutants were "scored" for safety by how rapidly they were cleared from the udder, and the severity of clinical mastitis induced as determined by rectal temperature, somatic cell counts (SCC), clinical impression (hardness/tenderness of udder quarter), milk appearance, and milk production. During this study it was noted that some cows developed acute clinical mastitis manifested by hard swollen sensitive quarters with thick/watery milk,
and increased SCC. These results suggest that IMM challenge could be an efficient way to clinically screen mutants for safety in a dairy goat model. Goats were challenged concomitantly with some of the same mutants used in the cows. Each mutant was screened in 3 animals, and scoring was performed using the same parameters as were used in cows, except that milk fat percentage was assessed in lieu of milk appearance. Animals were scored on 6 days during a 2 week period. The results of this study are reported in Table 4 below. For those mutants assessed in both species, the results were similar. Table 4. Safety Evaluation oϊS.uberis Transposon Mutants in Goats
Bact. Phys Group Avg
Mutant TempA Count13 % Milk Fatc Milk ProdnD AttitudeE SCCF examG Score"
P14B5
Total 5 70.2 0 4 1 113.3 6.0
Avg 17 3,9 0 13 0.3 6,3 2.0 15.5
P16B7
Total 2 82.8 3 7 0 121.7 31.0
Avg OJ 4.6 1 2.3 0 6.8 10.3 25.7
P14H7
Total 0 25.6 4 0 0 110.8 1.0
Avg 0 1.4 1.3 0 0 8,2 0.3 9,2
P2B5
Total 4 92.5 1 11 0 119.8 27.0
Avg 13 5.1 0.3 3.7 0 6.7 9.0 26.1
A Sum total days per group (Total) for which a rectal temperature above 39.5°C was recorded;
Total/3 goats per group (Avg).
B Sum of the logarithms (base 10) of all bacterial counts per group (Total); Geometric mean of the logarithms (Avg). c Sum total days per group (Total) for which the percentage of milk fat was >3%; Total/3 goats per group (Avg).
D Sum total days per group (Total) for which milk production was <0.5 liters; Total/3 goats per group (Avg).
E Sum total scoring per group (Total) of attitude of animals, where 0 is normal; 1 ,2, 3= mild, moderate, severe depression; 4= moribund; and 5= dead; Total/3 goats per group (Avg).
F Sum of the logarithms (base 10) of all somatic cell counts (SSC) per group (Total);
Geometric mean of the logarithms (Avg).
G Sum total scoring per group (Total) of udder swelling, where 0 is normal; 1,2, 3= slight, moderate, severe swelling; 4= scarring; and 5= edema; Total/3 goats per group (Avg). H Sum of the averages for all parameters measured for each mutant.
Example 5. Evaluation of Efficacy of An S. uberis Transposon Mutant as a
Modified-Live Vaccine Candidate in Goats
The purpose of this study was to evaluate the efficacy of a single subcutaneous (SC) administration of a transposon mutant in the goat challenge model. Each goat was vaccinated once with 1 x 109 CFU of a frozen S. uberis mutant P2B5, or saline. Each goat was challenged 3 weeks later by intramammary infusion of approximately 5000 CFU of S. uberis strain UT888. Goats were evaluated clinically for 2 weeks post-challenge, and scores were recorded. Goats vaccinated with P2B5 had much better clinical scores for body temperature, milk production, physical examination, milk appearance, and number of bacteria recovered from the milk than those vaccinated with saline (Figure 2).
Example 6. Evaluation of Safety of S. uberis Transposon Mutants Following
Intramammary Administration to Dairy Cattle
The purpose of this study was to determine the safety of S. uberis transposon mutants in the mammary gland of dairy cattle. Twenty-nine dairy cows were used in a study to assess the virulence of 10 transposon mutants in the mammary glands of cattle. Each quarter was infused with 2500-10,000 CFU of an S. uberis strain transposon mutant. Clinical data was collected every 2 days for 2 weeks following challenge. Clinical and composite scores were calculated as done previously. The higher the composite score, the more virulent (less safe) the mutant was for the bovine udder. Composite scores are presented in Table 5. A second study was done with 3 mutants using the same composite scoring system, but in cows from another source. There was variation in the scores between transposon mutants. However, these results were consistent across studies, indicating that some mutants are more highly attenuated for the mammary gland than others.
Table 5. Composite Scores for S. uberis Transposon Mutants Following EMM
Administration to Dairy Cows
Mutant Trial #1 Score Cow Rank Trial #2 score Cow fcaiik
P4B9 15.7 4 ; 17.3 ' 1
P5E6 11.9 K ND ND ; \
P7E10 13.2 ND
ND= Not Determined
Example 7. Evaluation of Efficacy of S. uberis Transposon Mutants in Dairy Cattle
In this study, the efficacy of transposon mutants are evaluated in dairy cattle. Each cow receives two subcutaneous (SC) vaccinations, 3 weeks apart, with approximately 1 x 109 CFU of a S. uberis mutant. At approximately 28 days following the second vaccination, one quarter of each cow is infused intramammarily via the teat duct with approximately 10,000-20,000 CFU/ml of S. uberis UT 888 (5 ml vol total). Rectal temperatures are taken and recorded, quarter samples of milk are obtained for microbiological examination and somatic cell count determination, and clinical assessments of each quarter of the mammary gland (both milk and gland) are conducted daily for 14 days following challenge. Approximately 14 days following challenge, a milk sample is collected for antibody determination.
Numerous modifications and variations in the invention as set forth in the above illustrative examples are expected to occur to those skilled in the art. Consequently only such limitations as appear in the appended claims should be placed on the invention.