ANTI-BACTERIAL
VACCINE COMPOSITIONS FIELD OF THE INVENTION
The present invention relates generally to the identification of genes responsible for virulence of streptococci, thereby allowing for production of novel attenuated mutant strains useful in vaccines and identification of new anti-bacterial agents that target the virulence genes and their products.
BACKGROUND OF THE INVENTION
The genus Streptococcus encompasses several significant pathogens that infect a wide variety of animals. There are a large variety of Streptococcus species, many of which cause infections in animals and man. Streptococci are gram positive cocci occurring in pairs and chains. The main groups of streptococcal diseases include upper respiratory infections with lymphadenitis (horses, swine, cats, guinea pigs, humans) neonatal respiratory and septicemic infections (horses, swine, dogs, humans), secondary pneumonias and complications (horses, non-human primates, small carnivores, humans) and pyrogenic infections unrelated to the respiratory tract (human genitourinary tract infections, bovine mastitis).
Little is known about the mechanism of pathogenesis of diseases caused by streptococci. Various cellular components, such as muramidase-released protein (MRP), extracellular factor (EF), and cell-membrane associated proteins, fimbriae, haemagglutinins, and haemolysin, have been suggested as virulence factors. However, the precise role of these protein components in the pathogenesis of the various diseases remains unclear. There is a pressing need therefore to identify additional virulence genes in the streptococci. In addition, there remains a need for safe and effective vaccines for treating and preventing diseases caused by streptococci.
Information Disclosure - Patent Documents US20020055168 Al Streptococcus suis vaccines and diagnostic tests WO2003046183 A2 Streptococcus suis avirulent vaccine and uses in antibiotic design
US20030072769 Al Virulence genes, proteins, and their use
US20040009192 Al Virulence of streptococci
WO2002061070 A2 Environmentally regulated genes, involved in the virulence of
Streptococcus suis.
SUMMARY OF THE INVENTION
In general, the present invention provides materials and methods for production and use of attenutated gram positive bacteria. In one aspect the invention comprises attenuated species in the streptococcal family of bacteria. The attenuated bacteria of the invention have utility as immunogenic compositions and vaccines.
One aspect of the invention provides an attenuated streptococcal bacteria comprising a functional mutation of a virulence gene selected from the group consisting of gtfA, guaB, UnO523, manM, pur A, purD, scrB, scrR, SMU.61, sprl018, spyM3-0908 treR, spO843, endoD, neuB, pgdA, glnQ, and nadR, wherein said functional mutation attenuates the bacteria.
The functionally mutated genes enumerated above may comprise a polynucleotide selected from the group consisting of: a) a polynucleotide sequence selected from group consisting of SEQ ID NOs: 1,3,5,7,9,11,13,15,17,19,21,23, 142,144,146,148,150, and 152; b) a polynucleotide that hybridizes to the complement of a polynucleotide sequence set forth in a) under moderate to highly stringent conditions; and c.) a polynucleotide that encodes a polypeptide that has at least 99%, 98% 97% 96% 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86% 85%, 84%, 83%, 82%, 81% 80%, 79%, 78%, 77%, 76%, 75%, 74%, 73%, 72%, 71% 70%, 69%, 68%, 67%, 66%, 65%, 64%, 63%, 62%, 61%, 60% identity and/or similarity to a polypeptide selected from the group consisting of the polypeptide sequences set forth in SEQ ID NOs:2,4,6,8,10,12,14,16,18,20,22,24,143,145,147,149,151, and l53.
Also contemplated are immunogenic compositions, preferably vaccine compositions, comprising the attenuated bacteria of the invention, optionally comprising a suitable adjuvant and/or a pharmaceutically acceptable diluent or carrier. In order for a modified strain to be effective in a vaccine formulation, the attenuation must be significant enough to prevent the pathogen from evoking severe clinical symptoms, but also insignificant enough to allow limited replication and growth of the bacteria in the host.
The invention also provides polynucleotides encoding gene products that are required for virulence in gram-positive bacteria, particularly streptococci . Polynucleotides of the invention include DNA, such as complementary DNA,
genomic DNA, including complementary or anti-sense DNA, and wholly or partially synthesized DNA; RNA, including sense and antisense strands; and peptide nucleic acids as described, for example in Corey, TIBTECH 75:224-229 (1997).
Virulence gene polynucleotides of the invention include an isolated polynucleotide comprising a polynucleotide sequence selected from the group consisting of:
(a) a polynucleotide sequence set forth in SEQ ID NOs: 1,3,5,7,9,11,13,15,17,19,21, 23, 142,144,146,148,150, and 152;
(b) a polynucleotide that encodes a polypeptide that has at least 99%, 98% 97% 96% 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86% 85%, 84%, 83%, 82%, 81% 80%, 79%, 78%, 77%, 76%, 75%, 74%, 73%, 72%, 71% 70%, 69%, 68%, 67%, 66%, 65%, 64%, 63%, 62%, 61%, 60% identity and or similarity to a polypeptide selected from the group consisting of the polypeptide sequences set forth in SEQ ID NOs:2,4,6,8,10,12,14,16,18,20,22 and 24; (c) a polynucleotide encoding a polypeptide selected from the group consisting of SEQ ID NOs: SEQ ID NOs:2,4,6,8,10,12,14,16,18,20,22, 24,143,145,147,149,151, and 153; (d) a polynucleotide which is the complement of any of (a), (b) or (c)
This of course includes species homologs and clonal variants of SEQ ID NOs: 1,3,5,7,9,11,13,15,17,19,21, 23, 142,144,146,148,150, and 152.
. The invention therefore comprehends gene sequences from other streptococci as well as related gene sequences from other gram-positive bacterial organisms, including naturally occurring (i.e. i.e. clonal variants) and artificially induced variants thereof. Knowledge of the sequence of a polynucleotide of the invention makes readily available every possible fragment of that polynucleotide. The invention therefore provides fragments of a polynucleotide of the invention.
The invention further embraces expression constructs comprising polynucleotides of the invention. Host cells transformed, transfected or electroporated with a polynucleotide of the invention are also contemplated. The invention provides methods to produce a polypeptide encoded by a polynucleotide of the invention comprising the steps of growing a host cell of the invention under conditions that permit, and preferably promote, expression of a gene product encoded by the polynucleotide, and isolating the gene product from the host cell or the medium
of its growth.
Identification of polynucleotides of the invention makes available the encoded polypeptides. The invention therefore comprises an isolated polypeptide comprising a polypeptide that has at least 99%, 98% 97% 96% 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86% 85%, 84%, 83%, 82%, 81% 80%, 79%, 78%, 77%, 76%, 75%, 74%, 73%, 72%, 71% 70%, 69%, 68%, 67%, 66%, 65%, 64%, 63%, 62%, 61%, 60% identity and or similarity to a polypeptide selected from the group consisting of the polypeptide sequences set forth in SEQ ID NOs:2,4,6,8,10,12,14,16,18,20,22, 24,143,145,147,149,151, and 153. Polypeptides of the invention include full length and fragment, or truncated, proteins; variants thereof; fusion, or chimeric proteins; and analogs, including those wherein conservative amino acid substitutions have been introduced into wild-type polypeptides.
Antibodies that specifically recognize polypeptides of the invention are also provided, and include monoclonal and polyclonal antibodies, single chain antibodies, chimeric antibodies, humanized antibodies, human antibodies, and complementary determining region (CDR)-grafted antibodies, as well as compounds that include CDR sequences which specifically recognize a polypeptide of the invention. The invention also provides anti-idiotype antibodies immunospecific for antibodies of the invention.
According to another aspect of the invention, methods are provided for identifying novel anti-bacterial agents that modulate the function of gram-positive bacterial virulence genes or gene products. Methods of the invention include screening potential agents for the ability to interfere with expression or activity of one or more gene products selected from the group consisting of gtfA, guaB, HnO523, manM, purA, purD, scrB, scrR, SMU.61, sprlO18, spyM3-0908, treR spO843, endoD, neuB, pgdA, glnQ, and nadR,
Also contemplated are methods for screening potential agents for the ability to interfere with biological function of a bacterial gene product encoded one or more streptococcal genes selected from the group consisting of gtfA, guaB, HnO523, manM, purA, purD, scrB, scrR, SMU.61, sprlO18, spyM3-0908, treR, spO843, endoD, neuB, pgdA, glnQ, and nadR, followed by identifying agents that provide positive results in such screening assays. In particular, agents that interfere with the expression of
virulence gene products include anti-sense polynucleotides and ribozymes that are complementary to the virulence gene sequences. The invention further embraces methods to modulate transcription of gene products of the invention through use of oligonucleotide-directed triplet helix formation. Agents that interfere with the function of virulence gene products include variants of virulence gene products, binding partners of the virulence gene products and variants of such binding partners, and enzyme inhibitors (where the product is an enzyme).
Novel anti-bacterial agents identified by the methods described herein are provided, as well as methods for treating a subject suffering from infection with gram positive bacteria involving administration of such novel anti-bacterial agents in an amount effective to reduce bacterial presence.
Numerous additional aspects and advantages of the invention will become apparent to those skilled in the art upon consideration of the following detailed description of the invention which describes presently prepared embodiments thereof.
DETAILED DESCRIPTION OF THE INVENTION Some General Definitions
In the discussion below we will often make use of the term "identity" or similarity as applied to the amino acid sequences of polypeptides. Percent amino acid sequence "identity" with respect to polypeptides is defined herein as the percentage of amino acid residues in the candidate sequence that are identical with the residues in the target sequences after aligning both sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. Percent sequence identity is determined by conventional methods. For example, BLASTP 2.2.6 [Tatusova TA and TL Madden, "BLAST 2 sequences- a new tool for comparing protein and nucleotide sequences." (1999) FEMS Microbiol Lett. 174:247-250.]
Briefly, as noted above, two amino acid sequences are aligned to optimize the alignment scores using a gap opening penalty of 10, a gap extension penalty of 0.1, and the "blosum62" scoring matrix of Henikoff and Henikoff (Proc. Nat. Acad. Sci. USA 89:10915-10919. 1992) .
The percent identity is then calculated as:
Total number of identical matches x 100
[length of the longer sequence + number of gaps introduced into the longer sequence to align the two sequences]
Percent sequence "similarity" (often referred to as "homology") with respect to a polypeptide of the invention is defined herein as the percentage of amino acid residues in the candidate sequence that are identical with the residues in the target sequences after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity (as described above), and also considering any conservative substitutions as part of the sequence identity.
Total number of identical matches and conservative substitutions x 100
[length of the longer sequence +number of gaps introduced into the longer sequence to align the two sequences]
Amino acids can be classified according to physical properties and contribution to secondary and tertiary protein structure. A conservative substitution is recognized in the art as a substitution of one amino acid for another amino acid that has similar properties. Exemplary conservative substitutions are set out in Table 1.
Table 1
As used hereinafter "isolated" means altered by the hand of man from the natural state. If an "isolated" composition or substance occurs in nature, it has been changed or removed from its original environment, or both. For example, a polynucleotide or a polypeptide naturally present in a living animal is not "isolated," but the same polynucleotide or polypeptide separated from the coexisting materials of its natural state is "isolated", as the term is employed herein.
This application makes reference to sequences which "hybridize under moderate to highly stringent conditions" to the non-coding strand, or complement, of any one of the polynucleotides of the invention. Exemplary high stringency conditions include a final wash in buffer comprising 0.2X SSC/0.1% SDS, at 65°C to 75°C, while exemplary moderate stringency conditions include a final wash in buffer comprising 2X SSC/0.1% SDS, at 350C to 45°C. It is understood in the art that conditions of equivalent stringency can be achieved through variation of temperature and buffer, or salt concentration as described in Ausubel, et al. (Eds.), Protocols in Molecular Biology, John Wiley & Sons (1994), pp. 6.0.3 to 6.4.10. Modifications in hybridization conditions can be empirically determined or precisely calculated based on the length and percentage of guanosine/cytosine (GC) base pairing of the probe. The hybridization conditions can be calculated as described in Sambrook, et al., (Eds.), Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press: Cold Spring Harbor, New York (1989), pp. 9.47 to 9.51.
"Virulence genes," as used herein, are genes whose function or products are required for successful establishment and/or maintenance of a bacterial population within a host animal. Thus, virulence genes and/or the proteins encoded thereby may be involved in, but not essential for, growth of the organism in the host organism; they may also be involved in pathogenesis in the host organism. We have identified gtfA, guaB, UnO523, manM, purA, purD, scrB, scrR, SMU.61, sprlO18, spyM3-0908 , treR spO843, endoD, neuB, pgdA, glnQ, and nadR,as virulence genes in the streptococci. The activities of the proteins encoded by the virulence genes we have
identified are discussed below.
GuaB encodes an IMP dehydrogenase (EC 1.1.1.205), which converts inosine 5'-phosphate to xanthosine 5'-phosphate. GuaA encodes a GMP synthetase (EC6.3.4.1) which converts xanthosine 5'-phosphate to GMP. These two enzymes function in de novo synthesis of GMP and in the salvage of purine nucleotides. (Neidhart, F.C., Ed. in Chief. Escherichia coli and Salmonella Cellular and Molecular Biology, 2nd Edition. 1996. ASM Press, Washington, D.C.; and Noriega FR., Losonsky G., Lauderbaugh C, Liao FM., Wang JY., and Levine MM. 1996. "Engineered deltaguaB-A delta virG Shigella flexneri 2a strain CVD 1205: construction, safety, immunogenicity, and potential efficacy as a mucosal vaccine." Infect. Immun. 64(8):3055-61.)
PurA encodes adenylosuccinate synthetase (EC6.3.4.4) which converts IMP to ^-(l^-dicarboxyethyty-AMP. This enzyme is used in de novo synthesis of AMP and in the salvage of purine nucleotides. (Neidhart, F.C., Ed. in Chief. Escherichia coli and Salmonella Cellular and Molecular Biology, 2nd Edition. 1996. ASM Press, Washington, D.C.; and Dunstan SJ. Simmons CP. and Strugnell RA. 1998. "Comparison of the abilities of different attenuated Salmonella typhimurium strains to elicit humoral immune responses against a heterologous antigen." Infect. Immun. 66(2):732-40.) PurD encodes GAR synthetase (EC6.3.4.13) which converts 5-phospho-D- ribosylamine + glycine to /^-(S-phospho-D-ribosy^glycinamide. This is an early step in the de novo synthesis of IMP, which can then feed into the GuaBA and PurA enzymatic reactions to produce GMP or AMP, respectively. (Neidhart, F.C., Ed. in Chief. Escherichia coli and Salmonella Cellular and Molecular Biology, 2nd Edition. 1996. ASM Press, Washington, D.C.; and Baumler AJ., Kusters JG., Stojiljkovic L, and Heffron F. 1994. "Salmonella typhimurium loci involved in survival within macrophages." Infect. Immun. 62(5): 1623-30.)
ManM encodes the UC membrane component of a mannose-specific phosphotransferase system that transports across the bacterial membrane and phosphorylates mannose. The phosphotransferase systems in general are implicated in the transport of several carbohydrates for use as carbon sources. (Neidhart, F.C., Ed. In Chief. Escherichia coli and Salmonella Cellular and Molecular Biology, 2nd Edition. 1996. ASM Press, Washington, D.C.; and Cochu A., Vadeboncoeur C,
Moineau S., and Frenette M. 2003. "Genetic and biochemical characterization of the phosphoenolpyruvate:glucose/mannose phosphotransferase system of Streptococcus thermophilus." App.Environ. Micro. 69(9):5423-32; and Lortie LA., Pelletier M., Vadeboncoeur C, and Frenette M. 2000 "The gene encoding IIAB(Man)L in Streptococcus salivarius is part of a tetracistronic operon encoding a phosphoenolpyruvate: mannose/glucose phosphotransferase system." Microbiology. 146 ( Pt 3):677-85.)
ScrB encodes a sucrose-6-phosphate hydrolase (EC 3.2.1.26) which catalyzes the hydrolysis of terminal non-reducing β-D-fructofuranoside residues in β-D- fructofuranosides or the breakdown of sucrose-6-phosphate into glucose-6-phosphate and fructose. This is a part of the catabolic pathway for the utilization of sucrose. (Neidhart, F.C., Ed. hi Chief. Escherichia coli and Salmonella Cellular and Molecular Biology, 2nd Edition. 1996. ASM Press, Washington, D. C; and Bogs J. and Geider K. 2000. "Molecular analysis of sucrose metabolism of Erwinia amylovora and influence on bacterial virulence." J. Bact. 182(19):5351-8; and Garsin DA., Sifri CD., Mylonakis E., Qin X., Singh KV., Murray BE., Calderwood SB., and Ausubel FM. 2001. "A simple model host for identifying Gram-positive virulence factors." PNAS. 98(19): 10892-7).
ScrR is a member of the GalR-LacI repressor family and is a regulator of the sucrose regulon, which includes multiple scr genes. ScrR is a repressor that is responsive to intracellular fructose and fructose 1-phosphate. (Neidhart, F.C., Ed. in Chief. Escherichia coli and Salmonella Cellular and Molecular Biology, 2nd Edition. 1996. ASM Press, Washington, D.C.; and Bogs J. Geider K. 2000. "Molecular analysis of sucrose metabolism of Erwinia amylovora and influence on bacterial virulence." J. Bact.. 182(19):5351-8; and Garsin DA., Sifri CD., Mylonakis E., Qin X., Singh KV., Murray BE., Calderwood SB. and Ausubel FM. 2001. "A simple model host for identifying Gram-positive virulence factors." PNAS. 98(19): 10892-7; and Hiratsuka,K., Wang,B., Sato,Y. and Kuramitsu, H. 1998. "Regulation of sucrose- 6-phosphate hydrolase activity in Streptococcus mutans: characterization of the scrR gene." Infect. Immun. 66 (8), 3736-3743.)
GtfA (EC 2.4.1.7) is a sucrose phosphorylase that catalyzes the reaction of sucrose + phosphate to D-fructose + α-D-glucose 1-phosphate. (Narimatsu M. Noiri
Y. Itoh S. Noguchi N. Kawahara T. Ebisu S. 2004. "Essential role for the gtfA gene encoding a putative glycosyltransferase in the adherence of Porphyromonas gingivalis " Infect. Immun. 72(5):2698-702; and Barletta RG., Michalek SM., and Curtiss R HI. 1988. "Analysis of the virulence of Streptococcus mutans serotype c gtfA mutants in the rat model system." Infect. Immun. 56(2): 322-30; and Russell RR, Mukasa H, Shimamura A, Ferretti JJ. 1988. "Streptococcus mutans gtfA gene specifies sucrose phosphorylase." Infect Irnmun. 56(10):2763-5.)
TreR is a transcriptional repressor of the trehalose operon.
SpyM3-0908 is a putative amino acid ABC transporter that has some similarity to glutamine transporters.
SprlO18 is a conserved hypothetical protein with unknown function.
Smu.61 is a conserved hypothetical, putative transcriptional regulator. Lin0523 is a Listeria innocua sequence of unknown function.
SpO843 is a putative deoxyribose-phosphate aldolase.
EndoD is a endo-beta-N-aceytlglucosaminidase.
NeuB is a putative N-acetyl neuramic acid synthetase.
PgdA is a peptidoglycan GIcNAc deacetylase.
GInQ is an ABC transporter involved in glutamine transport, encoding the
ATP-binding protein.
NadR is a transcriptional regulator.
By way of example, the genes enumerated above may comprise a polynucleotide selected from the group consisting of: a) a polynucleotide sequence selected from group consisting of SEQ ID NOs: 1,3,5,7,9,11,13,15,17,19,21, 23, 142,144,146,148,150, and 152; b) a polynucleotide that hybridizes to the complement of a polynucleotide sequence set forth in a) under moderate to highly stringent conditions; or c.) a polynucleotide that encodes a polypeptide that has at least 99%, 98% 97% 96% 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86% 85%, 84%, 83%, 82%, 81% 80%, 79%, 78%, 77%, 76%, 75%, 74%, 73%, 72%, 71% 70%, 69%, 68%, 67%, 66%, 65%, 64%, 63%, 62%, 61%, 60% identity and/or similarity to a polypeptide selected
from the group consisting of the polypeptide sequences set forth in SEQ ID NOs:2,4,6,8,10,12,14,16,18,20,22, 24,143,145,147,149,151, and 153.
"Streptococci", "streptococcal bacteria", and species in the genus Streptococcus include, but are not limited to, S. acidominimus, S. agalactiae, S. bovis, S. equinus, S. canis, S. cricetus, S. downei, S. dysgalactiae, S. entericus, S. equi, S. equinus, S. equisimilis, S. gallinaceus, S. iniae, S. mutans, S. parauberis, S. pluranimalium, S. porcinus, S. pyogenes, S. pneumoniae, S. sobrinus, S. uberis, S. suis, and S. zooepidemicus.
"Lancefield serologic grouping", a step in streptococcal identification, is determined by cell wall polysaccharides (C substance, group antigen) Groups are designated by capital letters. Lancefield group A Streptococcus (GAS, Streptococcus pyogenes), are infections are common among children, causing nasopharyngeal infections and complications, thereof. Cattle are often susceptible to GAS, and they are a frequent causative organism of mastitis. Lancefield group B Streptococcus (GBS) are most often seen in cattle, causing mastitis. However, human infants are susceptible as well, often with fatal consequences. Group B streptococci (GBS) constitute a major cause of bacterial sepsis and meningitis among human neonates born in the United States and Western Europe, and are emerging as significant neonatal pathogens in developing countries as well. Lancefield group C infections, such as those caused by S. equi, S. zooepidemicus, S. dysgalactiae, and others are mainly seen in horses, cattle and pigs, but can also cross the species barrier to humans. Lancefield group D infections are found in all mammals and some birds, sometimes resulting in endocarditis or septicaemia. Lancefield groups E, G, L, P, U and V (S. porcinus, S, canis, S. dysgalactiae) are found in various hosts, causing neonatal infections, nasopharyngeal infections, or mastitis. Within Lancefield groups R, S, and T, (and with ungrouped types) S. suis is found, an important cause of meningitis, septicemia, arthritis, and sudden death in young pigs. S. suis can also cause meningitis in man.There also exists a number of ungrouped streptococcal species, such as S. mutans, causing caries in humans, S. uberis, causing mastitis in cattle, and S. pneumonia, causing major invasive diseases such as pneumonia, bacteremia, and meningitis in humans.
"Signature-tagged mutagenesis (STM)," as used herein, is a method generally described in International Patent Publication No. WO 96/17951, incorporated herein
by reference, and includes, for example, a method for identifying bacterial genes required for virulence in a murine model of bacteremia. In this method, bacterial strains that each have a random mutation in the genome are produced using transposon integration. Each insertional mutation carries a different DNA signature tag which allows mutants to be differentiated from each other. The tags comprise 40 bp variable central regions flanked by invariant "arms" of 20 bp which allow the central portions to be co-amplified by polymerase chain reaction (PCR). Tagged mutant strains are assembled in microtiter dishes, then combined to form the "inoculum pool" for infection studies. At an appropriate time after inoculation, bacteria are isolated from the animal and pooled to form the "recovered pool." The tags in the recovered pool and the tags in the inoculum pool are separately amplified, labeled, and then used to probe filters arrayed with all of the different tags representing the mutants in the inoculum. Mutant strains with attenuated virulence are those which cannot be recovered from, or whose recovery is reduced in, the infected animal, i.e., strains with tags that give strong hybridization signals when probed with tags from the inoculum pool but not when probed with tags from the recovered pool. In a variation of this method, longer tags and non-radioactive detection methods such as chemiluminescence can be used.
Signature-tagged mutagenesis allows a large number of insertional mutant strains to be screened simultaneously in a single animal for loss of virulence.
Screening 30 pools of mutant S. suis strains resulted in the identification of 58 strains with reduced virulence. Of these, mutations in 13 genes results in significantly attenuated S. suis strains. The nucleotide sequence of the open reading frame disrupted by the transposon insertion was determined by sequencing both DNA strands, and an encoded amino acid sequence was deduced. The putative identity of both the polynucleotide and amino acid sequences was determined by comparison of the sequences with DNA and protein database sequences. The sequence information also permitted identification of species homologs or clonal variants in other streptococci by database mining. A "functional mutation" of a particular virulence gene may occur in protein coding regions of a virulence gene of the invention, as well as in regulatory regions or genes that modulate transcription of the virulence gene mRNA. Functional mutations that decrease expression and/or biological activity of a gene product include
insertions, deletions, or point mutations in the protein coding region of the gene itself or in sequences responsible for, or involved in, control of target gene expression, including non-coding regulatory sequences or regulatory genes themselves. Deletion mutants include those wherein all or part of a specific sequence, coding or non- coding, is deleted.
Attenuated Strains and Vaccines
The identification of gram-positive bacterial, and more particularly S. suis, virulence genes provides for microorganisms exhibiting reduced virulence {i.e., attenuated strains), which are useful in vaccines and immunogenic compositions. One aspect of the invention provides an attenuated streptococcal bacteria comprising a functional mutation of a virulence gene selected from the group consisting of gtfA, guaB, linO523, manM, purA, purD, scrB, scrR, SMU.61, sprlO18, spyM3-0908, treR, spO843, endoD, neuB, pgdA, glnQ, and nadR, wherein said functional mutation attenuates the bacteria. The functionally mutated genes enumerated above may comprise a polynucleotide selected from the group consisting of: a) a polynucleotide sequence selected from group consisting of SEQ ID NOs: 1,3,5,7,9,11,13,15,17,19,21, 23, 142,144,146,148,150, and 152; b) a polynucleotide that hybridizes to the complement of a polynucleotide sequence set forth in a) under moderate to highly stringent conditions; or c.) a polynucleotide that encodes a polypeptide that has at least 99%, 98% 97% 96% 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86% 85%, 84%, 83%, 82%, 81% 80%, 79%, 78%, 77%, 76%, 75%, 74%, 73%, 72%, 71% 70%, 69%, 68%, 67%, 66%, 65%, 64%, 63%, 62%, 61%, 60% identity and/or similarity to a polypeptide selected from the group consisting of the polypeptide sequences set forth in SEQ ID NOs:2,4,6,8,10,12,14,16,18,20,22, 24,143,145,147,149,151, and 153.
The worker of ordinary skill in the art will realize that a "functional mutation" may occur in protein coding regions of a virulence gene of the invention, as well as in regulatory regions or genes that modulate transcription of the virulence gene mRNA. Functional mutations result in decreased expression and/or biological activity of a gene product include insertions, deletions, or point mutations. Such functional mutations are easily screened because they result in a reduction in virulence as described herein.
The worker of ordinary skill will also appreciate that attenuated streptococcal strains of the invention include those bearing more than one functional mutation. More than one mutation may result in additive or synergistic degrees of attenuation. Multiple mutations can be prepared by design or may fortuitously arise from a deletion event originally intended to introduce a single mutation. An example of an attenuated strain with multiple deletions is a S. suis strain wherein the gtfA and guaB genes are functionally deleted.
Identification of virulence genes in comprising SEQ ID NOS: 1,3,5,7,9,11,13,15,17,19,21, 23, 142,144,146,148,150, and 152 in S. suis provides information regarding similar genes in other streptococcal species. As an example, identification of any of the genes could potentially lead to identification of conserved genes in a diverse number of streptococcal pathogens, including S. acidominimus, S. agalactiae, S. hovis, S. equinus, S. canis, S. cricetus, S. downei, S. dysgalactiae, S. entericus, S. equi, S. equinus, S. equisimilis, S. gallinaceus, S. iniae, S. mutans, S. parauberis, S. pluranimalium, S. porcinus, S. pyogenes, S. pneumoniae, S. sobrinus, S. uberis, S. suis, and S. zooepidemicus. Using the virulence genes sequences identified in S. suis, similar or homologous genes can be identified in other organisms, particularly within the streptococci, as well as other gram-positive species. Southern hybridization, using the streptococcal genes as probes, can identify related genes in chromosomal libraries derived from other organisms. Alternatively, PCR can be equally effective in gene identification across species boundaries. As still another alternative, complementation of, for example, a S. suis mutant with a chromosomal library from other species can also be used to identify genes having the same or related virulence activity. Identification of related virulence genes can therefore lead to production of an attenuated strain of the other organism which can be useful as still another vaccine formulation. Examples of S. suis genes that have been demonstrated to exist in other species (e.g. S. agalactiae, S. pyogenes, and S. pneumoniae) include genes gtfA, guaB, manM, purA, purD, scrB, scrR and spyM3-0908. It is appreciated also, that even within S. suis that strain variations may exist in the sequences of the virulence genes identified. These variants are easily identified by the ordinarily skilled artisan.
Attenuated S. suis strains identified using STM are insertional mutants wherein a virulence gene has been rendered non-functional through insertion of
transposon sequences in either the open reading frame or regulatory DNA sequences. These insertional mutants still contain all of the genetic information required for bacterial virulence, and can possibly revert to a pathogenic state by deletion of the inserted transposon. Therefore, in preparing a vaccine formulation, it is desirable to take the information gleaned from the attenuated strain and create a deletion mutant strain wherein some, most, or all of the virulence gene sequence is removed, thereby precluding the possibility that the bacteria will revert to a virulent state.
The vaccine properties of an attenuated insertional mutant identified using STM are expected to be the same or similar to those of a bacteria bearing a deletion in the same gene. However, it is possible that an insertion mutation may exert "polar" effects on adjoining gene sequences, and as a result, the insertion mutant may possess characteristic distinct from a mutant strain with a deletion in the same gene sequence. Deletion mutants can be constructed using any of a number of techniques well known and routinely practiced in the art. In one example, a strategy using counterselectable markers can be employed which has commonly been utilized to delete genes in many bacteria. For a review, see, for example, Reyrat, et al, Infection and Immunity 66:4011-4017 (1998), incorporated herein by reference. In this technique, a double selection strategy is often employed, wherein a plasmid is constructed encoding both a selectable and counterselectable marker, with flanking DNA sequences derived from both sides of the desired deletion. The selectable marker is used to select for bacteria in which the plasmid has integrated into the genome in the appropriate location and manner. The counterselecteable marker is used to select for the very small percentage of bacteria that have spontaneously eliminated the integrated plasmid. A fraction of these bacteria will then contain only the desired deletion with no other foreign DNA present. The key to the use of this technique is the availability of a suitable counterselectable marker.
In another technique, the cre-lox system is used for site-specific recombination of DNA. The system consists of 34 base pair lox sequences that are recognized by the bacterial ere recombinase gene. If the lox sites are present in the DNA in an appropriate orientation, DNA flanked by the lox sites will be excised by the ere recombinase, resulting in the deletion of all sequences except for one remaining copy of the lox sequence. Using standard recombination techniques, it is possible to delete
the targeted gene of interest in the streptococcal genome and to replace it with a selectable marker (e.g., a gene coding for kanamycin resistance) that is flanked by the lox sites. Transient expression (by electroporation) of a suicide plasmid containing the ere gene under control of a promoter that functions in streptococcal species of interest of the ere recombinase should result in efficient elimination of the /ox-flanked marker. This process would result in a mutant containing the desired deletion and one copy of the lox sequence.
In another approach, it is possible to directly replace a desired deleted sequence in the genome of the streptococcal species of interest with a marker gene, such as green fluorescent protein (GFP), β-galactosidase, or luciferase. In this technique, DNA segments flanking a desired deletion are prepared by PCR and cloned into a suicide (non-replicating) vector for streptococcal species of interest. An expression cassette, containing a promoter active in streptococci and the appropriate marker gene, is cloned between the flanking sequences. The plasmid is introduced into wild-type streptococcal strain. Bacteria that incorporate and express the marker gene (probably at a very low frequency) are isolated and examined for the appropriate recombination event (i.e. replacement of the wild type gene with the marker gene).
The present invention provides combination vaccines suitable for administration to a subject animal. The combination vaccines of the present invention include an attenuated streptococcal strain in combination with at least one other antigen capable of inducing a protective immune response in the subject animal against disease caused by such other antigen. Preferred combination vaccines of the present invention include, but are not limited to, porcine reproductive and respiratory syndrome virus, pseudorabies virus, porcine circovirus type π, swine influenza virus, Salmonella cholerasuis, Salmonella typhimurium, Erysipelothrix rhusiopathiae, Lawsonia intracellularis, Haemophilus parasuis, Bordetella bronchiseptica, Mycoplasma hyopneumoniae, Actinobacillus pleuropneumoniae, Escherichia coli, Pasteurella multocida, and Clostridium perfringens type A and type C.
The reduced virulence of these organisms and their immunogenicity may be confirmed by administration to a subject animal. While it is possible for an avirulent microorganism of the invention to be administered alone, one or more of such mutant microorganisms are preferably administered in a vaccine composition containing suitable adjuvant(s) and pharmaceutically acceptable diluent(s) or carrier(s). The
carrier(s) must be "acceptable" in the sense of being compatible with the avirulent microorganism of the invention and not deleterious to the subject to be immunized. Typically, the carriers will be water or saline which will be sterile and pyrogen-free. The subject to be immunized is one needing protection from a disease caused by a virulent form of streptococci or other pathogenic microorganisms.
Any adjuvant known in the art may be used in the vaccine composition, including oil-based adjuvants such as Freund's Complete Adjuvant and Freund's Incomplete Adjuvant, mycolate-based adjuvants (e.g., trehalose dimycolate), bacterial lipopolysaccharide (LPS), peptidoglycans (i.e., mureins, mucopeptides, or glycoproteins such as N-Opaca, muramyl dipeptide [MDP], or MDP analogs), proteoglycans (e.g., extracted from Klebsiella pneumoniae), streptococcal preparations (e.g., OK432), Biostim™ (e.g., 01K2), the "Iscoms" of EP 109 942, EP 180 564 and EP 231 039, aluminum hydroxide, saponin, DEAE-dextran, neutral oils (such as miglyol), vegetable oils (such as arachis oil), liposomes, Pluronic® polyols, the Ribi adjuvant system (see, for example GB-A-2 189 141), or interleukins, particularly those that stimulate cell mediated immunity. An alternative adjuvant consisting of extracts of Am ycola ta, abacterial genus in the order Actinomycetales, has been described in U.S. Patent No. 4,877,612. Other adjuvants include mineral gels, e.g., aluminum hydroxide; surface active substances such as lysolecithin; glycosides, e.g., saponin derivatives such as Quil A or GPI-0100 (United States Patent No. 5,977,081); cationic surfactants such as DDA, pluronic polyols; polyanions; non- ionic block polymers, e.g., Pluronic F-127 (B.A.S.F., USA); peptides; mineral oils, e.g. Montanide ISA-50 (Seppic, Paris, France), carbopol, Amphigen (Hydronics, Omaha, NE USA), Alhydrogel (Superfos Biosector, Frederikssund, Denmark) oil emulsions, e.g. an emulsion of mineral oil such as BayolF/Arlacel A and water, or an emulsion of vegetable oil, water and an emulsifier such as lecithin; alum, cholesterol, rrnLT, cytokines and combinations thereof. Additionally, proprietary adjuvant mixtures are commercially available. The immunogenic component may also be incorporated into liposomes, or conjugated to polysaccharides and/or other polymers for use in a vaccine formulation.
The adjuvant used will depend, in part, on the recipient organism. The amount of adjuvant to administer will depend on the type and size of animal. Optimal dosages may be readily determined by routine methods.
The vaccine compositions optionally may include vaccine-compatible pharmaceutically acceptable (i.e., sterile and non-toxic) liquid, semisolid, or solid diluents that serve as pharmaceutical vehicles, excipients, or media. Any diluent known in the art may be used. Exemplary diluents include, but are not limited to, polyoxyethylene sorbitan monolaurate, magnesium stearate, methyl- and propylhydroxybenzoate, talc, alginates, starches, lactose, sucrose, dextrose, sorbitol, mannitol, gum acacia, calcium phosphate, mineral oil, cocoa butter, and oil of theobroma.
The vaccine compositions can be packaged in forms convenient for delivery. The compositions can be enclosed within a capsule, caplet, sachet, cachet, gelatin, paper, or other container. These delivery forms are preferred when compatible with entry of the immunogenic composition into the recipient organism and, particularly, when the immunogenic composition is being delivered in unit dose form. The dosage units can be packaged, e.g., in tablets, capsules, suppositories or cachets. The vaccine compositions may be introduced into the subject to be immunized by any conventional method including, e.g., by intravenous, intradermal, intramuscular, intramammary, intraperitoneal, or subcutaneous injection; by oral, sublingual, nasal, anal, or vaginal, delivery. The treatment may consist of a single dose or a plurality of doses over a period of time. The invention also comprehends use of an attenuated bacterial strain of the invention for manufacture of a vaccine medicament to prevent or alleviate bacterial infection and/or symptoms associated therewith. The invention also provides use of inhibitors of the invention for manufacture of a medicament to prevent or alleviate bacterial infection and/or symptoms associated therewith. It will be appreciated that the vaccine of the invention may be useful in the fields of human medicine and veterinary medicine. Thus, the subject to be immunized may be a human or other animal, for example, farm animals including cows, sheep, pigs, horses, goats and poultry (e.g., chickens, turkeys, ducks and geese) companion animals such as dogs and cats, exotic and/or zoo animals, and laboratory animals including mice, rats, rabbits, guinea pigs, and hamsters. Polynucleotides
The invention also provides polypeptides and corresponding polynucleotides required for streptococcal virulence. The invention includes both naturally occurring
and non-naturally occurring polynucleotides and polypeptide products thereof. Naturally occurring virulence products include distinct gene and polypeptide species, as well as corresponding species homologs expressed in organisms other than S. suis. Non-naturally occurring virulence products include variants of the naturally occurring products, such as analogs and virulence products which include covalent modifications.
The invention includes isolated genes gene fragments and gene products from the loci gtfA, guaB, lmO523, manM, purA, purD, scrB, scrR, SMU.61, sprlO18, spyM3- 0908, treR, spO843, endoD, neuB, pgdA, glriQ, and nadR, from S. suis. Preferred DNA sequences are set out in SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15,
17, 19, 21, 23, 142,144,146,148,150, and 152, and species homologs or clonal variants thereof. The worker of skill in the art will readily appreciate that the preferred DNA of the invention comprises a double-stranded molecule, for example, molecules having the sequences set forth in SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 142,144,146,148,150, and 152 and species homologs or clonal variants thereof, along with the complementary molecule (the "non-coding strand" or "complement") having a sequence deducible from the sequence of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 142,144,146,148,150, and 152 according to Watson- Crick base pairing rules for DNA. Also preferred are polynucleotides encoding the gene products encoded by any one of the polynucleotides set out in SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 142,144,146,148,150, and 152 and species homologs or clonal variants thereof.
The invention includes therefore, an isolated polynucleotide comprising a polynucleotide sequence selected from the group consisting of : (a) a polynucleotide sequence set forth in SEQ ID NOs: 1,3,5,7,9,11,13,15,17,19,21, 23, 142,144,146,148,150, and 152; and
(b) a polynucleotide that encodes a polypeptide that has at least 99%, 98% 97% 96% 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86% 85%, 84%, 83%, 82%, 81% 80%, 79%, 78%, 77%, 76%, 75%, 74%, 73%, 72%, 71% 70%, 69%, 68%, 67%, 66%, 65%, 64%, 63%, 62%, 61%, 60% identity and or similarity to a polypeptide selected from the group consisting of the polypeptide sequences set forth in SEQ ID NOs:2,4,6,8,10,12,14,16,18,20,22, 24,143,145,147,149,151, and 153; and
(c) a polynucleotide encoding a polypeptide selected from the group consisting of
SEQ ID NOs: SEQ ID NOs:2,4,6,8,10,12,14,16,18,20,22, 24,143,145,147,149,151, and 153;
(d) a polynucleotide that hybridizes to the complement of a polynucleotide sequence under moderately or highly stringent conditions. (e) a polynucleotide which is the complement of any of (a), (b), (c) or (d).
The present invention provides novel isolated streptococcal polynucleotides (e.g., DNA sequences and RNA transcripts, both sense and complementary antisense strands) encoding the bacterial virulence gene products. DNA sequences of the invention include genomic as well as wholly or partially chemically or enzymatically synthesized DNA sequences. Genomic DNA of the invention comprises the protein coding region for a polypeptide of the invention and includes variants that may be found in other bacterial strains of the same species. "Synthesized," as used herein and is understood in the art, refers to purely chemical, as opposed to enzymatic, methods for producing polynucleotides. "Wholly" synthesized DNA sequences are therefore produced entirely by chemical means, and "partially" synthesized DNAs embrace those wherein only portions of the resulting DNA were produced by chemical means.
The polynucleotide sequence information provided by the invention makes possible the identification and isolation of polynucleotides encoding related bacterial virulence molecules and genes which are species homologues by well known techniques including Southern and/or Northern hybridization, polymerase chain reaction (PCR), and database mining. Examples of polypeptides encoded by polynucleotides related to gtfA, guaB, manM, pur A, purD, scrB, scrR, and spyM3-0908 are set out in Table 5. Vectors and Host Cells Autonomously replicating recombinant expression constructions such as plasmid and viral DNA vectors incorporating virulence gene sequences are also provided. Expression constructs wherein virulence polypeptide-encoding polynucleotides are operatively linked to an endogenous or exogenous expression control DNA sequence and a transcription terminator are also provided. The virulence genes may be cloned by PCR, using streptococcal genomic DNA as the template. For ease of inserting the gene into expression vectors, PCR primers are chosen so that the PCR-amplified gene has a restriction enzyme site at the 5' end preceding the initiation codon, and a restriction enzyme site at the 3' end after the
termination codon. If desirable, the codons in the gene are changed, without changing the amino acids, according to the codon preference of the organism being used for expression. Optimization of codon usage may lead to an increase in the expression of the gene product in the expression system. If the gene product is to be produced extracellularly, either in the periplasm of E. coli or other bacteria, or into the cell culture medium, the gene is cloned without its initiation codon and placed into an expression vector behind a signal sequence.
According to another aspect of the invention, host cells are provided, including procaryotic and eukaryotic cells, either stably or transiently transformed, transfected, or electroporated with polynucleotide sequences of the invention in a manner which permits expression of virulence polypeptides of the invention. Expression systems of the invention include bacterial, yeast, fungal, viral, invertebrate, and mammalian cells systems. Host cells of the invention are a valuable source of immunogen for development of antibodies specifically immunoreactive with the virulence gene product. Host cells of the invention are conspicuously useful in methods for large scale production of virulence polypeptides wherein the cells are grown in a suitable culture medium and the desired polypeptide products are isolated from the cells or from the medium in which the cells are grown by, for example, immunoaffinity purification or any of the multitude of purification techniques well known and routinely practiced in the art. Any suitable host cell may be used for expression of the gene product, such as E. coli, other bacteria, including Bacillus and S. aureus, yeast, including Pichia pastoris and Saccharomyces cerevisiae, insect cells, or mammalian cells, including CHO cells, utilizing suitable vectors known in the art. Proteins may be produced directly or fused to a peptide or polypeptide, and either intracellularly or extracellularly by secretion into the periplasmic space of a bacterial cell or into the cell culture medium. Secretion of a protein requires a signal peptide (also known as pre-sequence). A number of signal sequences from prokaryotes and eukaryotes are known to function for the secretion of recombinant proteins. During the protein secretion process, the signal peptide is removed by signal peptidase to yield the mature protein. Polypeptides
The invention also provides isolated streptococcal virulence polypeptides encoded by a polynucleotide of the invention. Presently preferred are polypeptides
comprising the amino acid sequences encoded by any one of the polynucleotides set out in SEQ ID NOs : 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 142,144,146,148,150, and 152 or the polypeptides set forth in SEQ ID NOs: 2,4,6,8,10,12, 14,16,18,20,22, 24,143,145,147,149,151, and 153, and species homologs or clonal variants thereof. The invention embraces virulence polypeptides encoded by a DNA selected from the group consisting of : a) the DNA sequence set out in any one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 142,144,146,148,150, and 152, and species homologs or clonal variants thereof, and b) a DNA molecule, encoding a virulence gene product, that hybridizes under moderately stringent conditions to the DNA of (a). The invention also embraces polypeptides that have at least about 99%, 98% 97% 96% 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86% 85%, 84%, 83%, 82%, 81% 80%, 79%, 78%, 77%, 76%, 75%, 74%, 73%, 72%, 71% 70%, 69%, 68%, 67%, 66%, 65%, 64%, 63%, 62%, 61%, 60%, identity and/or homology to the preferred polypeptides of the invention. Variant virulence products of the invention include mature virulence gene products, i.e., wherein leader or signal sequences are removed, or having additional amino terminal residues. Virulence gene products having an additional methionine residue at position -1 are contemplated, as are virulence products having additional methionine and lysine residues at positions -2 and -1. Variants of these types are particularly useful for recombinant protein production in bacterial cell types. Variants of the invention also include gene products wherein amino terminal sequences derived from other proteins have been introduced, as well as variants comprising amino terminal sequences that are not found in naturally occurring proteins.
The invention also embraces variant polypeptides having additional amino acid residues which result from use of specific expression systems. For example, use of commercially available vectors that express a desired polypeptide as a fusion protein with glutathione-S-transferase (GST) provide the desired polypeptide having an additional glycine residue at position -1 following cleavage of the GST component from the desired polypeptide. Variants which result from expression using other vector systems are also contemplated.
To simplify the protein purification or isolation process, a purification tag may be added either at the 5 ' or 3' end of the gene coding sequence. Commonly used purification tags include a stretch of six histidine residues (U.S. Patent Nos. 5,284,933
and 5,310,663), a streptavidin-affinity tag described by Schmidt and Skerra, Protein Engineering, 6:109-122 (1993), a FLAG peptide [Hopp et al, Biotechnology, (5: 1205- 1210 (1988)], glutathione S-transferase [Smith and Johnson, Gene, 67:31-40 (1988)], and thioredoxin [LaVallie et al, Bio/Technology, 11: 187-193 (1993)]. To remove these peptides or polypeptides, a proteolytic cleavage recognition site may be inserted at the fusion junction. Commonly used proteases are factor Xa, thrombin, and enterokinase. Antibodies
Also contemplated by the present invention are antibodies (e.g., monoclonal and polyclonal antibodies, single chain antibodies, chimeric antibodies, humanized, human, and CDR-grafted antibodies, including compounds which include CDR sequences which specifically recognize a polypeptide of the invention) and other binding proteins specific for virulence gene products or fragments thereof. The term "specific for" indicates that the variable regions of the antibodies of the invention recognize and bind a virulence polypeptide exclusively {i.e., are able to distinguish a single virulence polypeptides from related virulence polypeptides despite sequence identity, homology, or similarity found in the family of polypeptides), but may also interact with other proteins (for example, S. aureus protein A or other antibodies in ELISA techniques) through interactions with sequences outside the variable region of the antibodies, and in particular, in the constant region of the molecule. Screening assays to determine binding specificity of an antibody of the invention are well known and routinely practiced in the art. For a comprehensive discussion of such assays, see Harlow et al. (Eds), Antibodies A Laboratory Manual; Cold Spring Harbor Laboratory; Cold Spring Harbor , NY (1988), Chapter 6. Antibodies that recognize and bind fragments of the virulence polypeptides of the invention are also contemplated, provided that the antibodies are first and foremost specific for, as defined above, a virulence polypeptide of the invention from which the fragment was derived.
Modulation or Manipulation of Expression of the Nuceic Acids and Polypeptides of the Invention
The DNA and amino acid sequence information provided by the present invention also makes possible the systematic analysis of the structure and function of the virulence genes and their encoded gene products. Knowledge of a polynucleotide
encoding a virulence gene product of the invention also makes available anti-sense polynucleotides which recognize and hybridize to polynucleotides encoding a virulence polypeptide of the invention. Full length and fragment anti-sense polynucleotides are provided. The worker of ordinary skill will appreciate that fragment anti-sense molecules of the invention include (i) those which specifically recognize and hybridize to a specific RNA (as determined by sequence comparison of DNA encoding a virulence polypeptide of the invention to DNA encoding other known molecules), as well as (ii) those which recognize and hybridize to RNA encoding variants of the family of virulence proteins. Antisense polynucleotides that hybridize to RNA encoding other members of the virulence family of proteins are also identifiable through sequence comparison to identify characteristic, or signature, sequences for the family of molecules.
The invention further contemplates methods to modulate gene expression through use of ribozymes. For a review, see Gibson and Shillitoe, MoI. Biotech. 7: 125-137 (1997). Ribozyme technology can be utilized to inhibit translation of mRNA in a sequence specific manner through (i) the hybridization of a complementary RNA to a target mRNA and (ii) cleavage of the hybridized mRNA through nuclease activity inherent to the complementary strand. Ribozymes can be identified by empirical methods but more preferably are specifically designed based on accessible sites on the target mRNA [Bramlage, et al, Trends in Biotech 16:434- 438 (1998)]. Delivery of ribozymes to target cells can be accomplished using either exogenous or endogenous delivery techniques well known and routinely practiced in the art. Exogenous delivery methods can include use of targeting liposomes or direct local injection. Endogenous methods include use of viral vectors and non- viral plasmids.
Ribozymes can specifically modulate expression of virulence genes when designed to be complementary to regions unique to a polynucleotide encoding a virulence gene product. "Specifically modulate" therefore is intended to mean that ribozymes of the invention recognizes only a single polynucleotide. Similarly, ribozymes can be designed to modulate expression of all or some of a family of proteins. Ribozymes of this type are designed to recognize polynucleotide sequences conserved in all or some of the polynucleotides which encode the family of proteins. The invention further embraces methods to modulate transcription of a
virulence gene of the invention through use of oligonucleotide-directed triplet helix formation. For a review, see Lavrovsky, et al, Biochem. MoI. Med. 62:11-22 (1997). Triplet helix formation is accomplished using sequence specific oligonucleotides which hybridize to double stranded DNA in the major groove as defined in the Watson-Crick model. Hybridization of a sequence specific oligonucleotide can thereafter modulate activity of DNA-binding proteins, including, for example, transcription factors and polymerases. Preferred target sequences for hybridization include transcriptional regulatory regions that modulate virulence gene product expression. Oligonucleotides which are capable of triplet helix formation are also useful for site-specific covalent modification of target DNA sequences.
Oligonucleotides useful for covalent modification are coupled to various DNA damaging agents as described in Lavrovsky, et al. [supra]. Methods of Identifying Anti-Bacterial Agents.
The identification of streptococcal virulence genes renders the genes and gene products useful in methods for identifying anti-bacterial agents. Such methods include assaying potential agents for the ability to interfere with expression of virulence gene products represented by the DNA sequences set forth in any one of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 142,144,146,148,150, and 152, and species homologs or clonal variants thereof (i.e., the genes represented by DNA sequences of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23,
142,144,146,148,150, and 152 encode the virulence gene product, or the DNA sequences of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 142,144,146,148,150, and 152 are adjacent the gene encoding the virulence gene product, or are involved in regulation of expression of the virulence gene product), or assaying potential agents for the ability to interfere with the function of a bacterial gene product encoded in whole or in part by a DNA sequence set forth in any one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 142,144,146,148,150, and 152, species homologs or clonal variants thereof, or the complementary strand thereof, followed by identifying agents that are positive in such assays. Polynucleotides and polypeptides useful in these assays include not only the genes and encoded polypeptides as disclosed herein, but also variants thereof that have substantially the same activity as the wild-type genes and polypeptides.
The virulence gene products produced by the methods described above are
used in high throughput assays to screen for inhibitory agents. The sources for potential agents to be screened are chemical compound libraries, fermentation media of Streptomycetes, other bacteria and fungi, and cell extracts of plants and other vegetations. For proteins with known enzymatic activity, assays are established based on the activity, and a large number of potential agents are screened for ability to inhibit the activity. For proteins that interact with another protein or nucleic acid, binding assays are established to measure such interaction directly, and the potential agents are screened for ability to inhibit the binding interaction.
The use of different assays known in the art is contemplated according to this aspect of the invention. When the function of the virulence gene product is known or predicted by sequence similarity to a known gene product, potential inhibitors can be screened in enzymatic or other types of biological and/or biochemical assays keyed to the function and/or properties of the gene product. When the virulence gene product is known or predicted by sequence similarity to a known gene product to interact with another protein or nucleic acid, inhibitors of the interaction can be screened directly in binding assays. The invention contemplates a multitude of assays to screen and identify inhibitors of binding by the virulence gene product. In one example, the virulence gene product is immobilized and interaction with a binding partner is assessed in the presence and absence of a putative inhibitor compound. In another example, interaction between the virulence gene product and its binding partner is assessed in a solution assay, both in the presence and absence of a putative inhibitor compound. In both assays, an inhibitor is identified as a compound that decreases binding between the virulence gene product and its binding partner. Other assays are also contemplated in those instances wherein the virulence gene product binding partner is a protein. For example, variations of the di-hybrid assay are contemplated wherein an inhibitor of protein/protein interactions is identified by detection of a positive signal in a transformed or transfected host cell as described in PCT publication number WO 95/20652, published August 3, 1995.
Candidate inhibitors contemplated by the invention include compounds selected from libraries of potential inhibitors. There are a number of different libraries used for the identification of small molecule modulators, including: (1) chemical libraries, (2) natural product libraries, and (3) combinatorial libraries comprised of random peptides, oligonucleotides or organic molecules. Chemical
libraries consist of structural analogs of known compounds or compounds that are identified as "hits" or "leads" via natural product screening. Natural product libraries are collections of microorganisms, animals, plants, or marine organisms which are used to create mixtures for screening by: (1) fermentation and extraction of broths from soil, plant or marine microorganisms or (2) extraction of plants or marine organisms. Natural product libraries include polyketides, non-ribosomal peptides, and variants (non-naturally occurring) thereof. For a review, see Science 282:63-68 (1998). Combinatorial libraries are composed of large numbers of peptides, oligonucleotides, or organic compounds as a mixture. They are relatively easy to prepare by traditional automated synthesis methods, PCR, cloning, or proprietary synthetic methods. Of particular interest are peptide and oligonucleotide combinatorial libraries. Still other libraries of interest include peptide, protein, peptidomimetic, multiparallel synthetic collection, recombinatorial, and polypeptide libraries. For a review of combinatorial chemistry and libraries created therefrom, see Myers, Curr. Opin. Biotechnol. 8:101-701 (1997). Identification of modulators through use of the various libraries described herein permits modification of the candidate "hit" (or "lead") to optimize the capacity of the "hit" to modulate activity.
Still other candidate inhibitors contemplated by the invention can be designed and include soluble forms of binding partners, as well as binding partners as chimeric, or fusion, proteins. Binding partners as used herein broadly encompasses antibodies, antibody fragments, and modified compounds comprising antibody domains that are immunospecific for the expression product of the identified virulence gene.
Other assays may be used when a binding partner (i.e., ligand) for the virulence gene product is not known, including assays that identify binding partners of the target protein through measuring direct binding of test binding partner to the target protein, and assays that identify binding partners of target proteins through affinity ultrafiltration with ion spray mass spectroscopy/HPLC methods or other physical and analytical methods. Alternatively, such binding interactions are evaluated indirectly using the yeast two-hybrid system described in Fields and Song, Nature, 340:245-246 (1989), and Fields and Sternglanz, Trends in Genetics, 70:286- 292 (1994), both of which are incorporated herein by reference. The two-hybrid system is a genetic assay for detecting interactions between two proteins or polypeptides. It can be used to identify proteins that bind to a known protein of
interest, or to delineate domains or residues critical for an interaction. Variations on this methodology have been developed to clone genes that encode DNA-binding proteins, to identify peptides that bind to a protein, and to screen for drugs. The two- hybrid system exploits the ability of a pair of interacting proteins to bring a transcription activation domain into close proximity with a DNA-binding domain that binds to an upstream activation sequence (UAS) of a reporter gene, and is generally performed in yeast. The assay requires the construction of two hybrid genes encoding (1) a DNA-binding domain that is fused to a first protein, and (2) an activation domain fused to a second protein. The DNA-binding domain targets the first hybrid protein to the UAS of the reporter gene; however, because most proteins lack an activation domain, this DNA-binding hybrid protein does not activate transcription of the reporter gene. The second hybrid protein, which contains the activation domain, cannot by itself activate expression of the reporter gene because it does not bind the UAS. However, when both hybrid proteins are present, the noncovalent interaction of the first and second proteins tethers the activation domain to the UAS, activating transcription of the reporter gene. When the virulence gene product (the first protein, for example) is already known to interact with another protein or nucleic acid, this assay can be used to detect agents that interfere with the binding interaction. Expression of the reporter gene is monitored as different test agents are added to the system; the presence of an inhibitory agent results in lack of a reporter signal.
When the function of the virulence gene product is unknown and no ligands are known to bind the gene product, the yeast two-hybrid assay can also be used to identify proteins that bind to the gene product. In an assay to identify proteins that bind to the first protein (the target protein), a large number of hybrid genes each encoding different second proteins are produced and screened in the assay. Typically, the second protein is encoded by a pool of plasmids in which total cDNA or genomic DNA is ligated to the activation domain. This system is applicable to a wide variety of proteins, and it is not even necessary to know the identity or function of the second binding protein. The system is highly sensitive and can detect interactions not revealed by other methods; even transient interactions may trigger transcription to produce a stable mRNA that can be repeatedly translated to yield the reporter protein.
Other assays may be used to search for agents that bind to the target protein. One such screening method to identify direct binding of test ligands to a target protein
is described in U.S. Patent No. 5,585,277, incorporated herein by reference. This method relies on the principle that proteins generally exist as a mixture of folded and unfolded states, and continually alternate between the two states. When a test ligand binds to the folded form of a target protein (i.e., when the test ligand is a ligand of the target protein), the target protein molecule bound by the ligand remains in its folded state. Thus, the folded target protein is present to a greater extent in the presence of a test ligand which binds the target protein, than in the absence of a ligand. Binding of the ligand to the target protein can be determined by any method which distinguishes between the folded and unfolded states of the target protein. The function of the target protein need not be known in order for this assay to be performed. Virtually any agent can be assessed by this method as a test ligand, including, but not limited to, metals, polypeptides, proteins, lipids, polysaccharides, polynucleotides and small organic molecules.
Another method for identifying ligands for a target protein is described in Wieboldt et al, Anal. Chem., 69: 1683-1691 (1997), incorporated herein by reference. This technique screens combinatorial libraries of 20-30 agents at a time in solution phase for binding to the target protein. Agents that bind to the target protein are separated from other library components by centrifugal ultrafiltration. The specifically selected molecules that are retained on the filter are subsequently liberated from the target protein and analyzed by HPLC and pneumatically assisted electrospray (ion spray) ionization mass spectroscopy. This procedure selects library components with the greatest affinity for the target protein, and is particularly useful for small molecule libraries.
The inhibitors/binders identified by the initial screens are evaluated for their effect on virulence in in vivo mouse models of streptococcal infections. Models of bacteremia, endocarditis, septic arthritis, soft tissue abscess, or pneumonia may be utilized. Models involving use of other animals are also comprehended by the invention. For example, rabbits can be challenged with a wild type streptococcal strain before or after administration of varying amounts of a putative inhibitor/binder compound. Control animals, administered only saline instead of putative inhibitor/binder compound provide a standard by which deterioration of the test animal can be determined. Other animal models include those described in the Animal and Plant Health Inspection Sevice, USDA, January 1, 1994 Edition,
§§113.69-113.70; Panciera and Corstvet, Am. J. Vet. Res. 45:2532-2537; Ames, et al, Can. J. Comp. Med. 49:395-400 (1984); and Mukkur, Infection and Immunity 78:583- 585 (1977). Inhibitors/binders that interfere with bacterial virulence are can prevent the establishment of an infection or reverse the outcome of an infection once it is established.
The present invention is illustrated by the following examples. Example 1 describes constructions of S. suis mutants. Example 2 relates to screening for S. suis mutants. Example 3 addresses methods used to identify the copy number for signature tags. Example 4 describes evaluation of candidate mutants for virulence in mice. Example 5 addresses identification of genes related to virulence. Example 6 describes the murine efficacy model. Example 7 addresses screening for virulence in pigs. Example 8 relates to porcine vaccine efficacy studies. The Examples make reference to primer sequences. The sequences of primers used are included below as Table 2.
Table 2. Sequences of oligonucleotide primers
*Indicates oligo labeled with biotin at 5' end
N = A, G, C or T
Example 1. Construction of 5. suis Library Containing Transposon-Tagged Mutants
A library of Streptococcus suis serotype 2 #R735 (reference strain) for signature tagged-mutants was constructed using the suicide vector pGh9:ISSl [Maguin, et at, JBacteriol. 178:931-935 (1996)]. The ISSl elements of the vector allow integration of the plasmid vector into the chromosome while encoding for erythromycin resistance. Moreover, the replicon of pGh9:ISSl is thermosensitive that permits replication at 28°C but is lost at 37°C. Plasmid pGh9:ISSl was modified to include sequence tags that contained a semi-random [NK]35 sequence corresponding to the tags used in "Antibacterial Vaccine Applications" (US20040110268 Al). Briefly, sequence tags were PCR amplified using TEF326-327, digested with EcoRI
and ligated into the EcoRϊ site of pGh9:ISS 1. These modified plasmids were used for the mutagenesis of S. suis as described below.
Electroporation-competent S. suis serotype 2 #R735 cells were prepared essentially as described by Takamatsu, et al. ( "Construction and Characterization of Streptococcus suis-Escherichia coli Shuttle Cloning Vectors." Plasmid. 45:101-113 2001) with minor modifications. Briefly, freshly grown S. suis serotype 2 #R735 wild-type colonies were used to inoculate 100 mis Todd Hewitt Yeast Extract broth (THY). The initial OD6oo of this culture, measured with a 300 mis side arm flask and a Bausch and Lomb Spectronic 70, was below 0.1. The broth culture was incubated at 37°C with shaking until the OD6O0 was between 0.3 and 0.5, and then distributed into two pre-chilled, sterile, 50 ml Corning tubes. While at 40C, the cells were centrifuged at 4600 rpm for 10 minutes in an Eppendorf Centrifuge 5804 R. The cells were washed with 25 mis of pre-chilled CTB (Chemical Transformation Buffer, 55 mM MnCl2, 15 mM CaCl2, 250 mM KCl, and 10 mM PIPES [piperazine-JV>'-bis(2- ethanesulfonic acid) pH 6.7]), resuspended in 25 mis of pre-chilled CTB, and incubated on ice for 30 minutes. The cells were again centrifuged at 4600 rpm for 10 minutes at 4°C. The pellet was washed twice with 25 mis of pre-chilled EB (Electroporation Buffer, 0.3 M sucrose and 2 mM K2HPO4, pH 8.4). The cells were resuspended in 1 ml of pre-chilled EB containing 15% glycerol. Aliquots of 100 μl were immediately distributed into microcentrifuge tubes in a dry ice/ethanol bath. Electroporation-competent cells were stored at -70°C.
S. suis serotype 2 #R735 competent cells were electroporated with pGh9:ISSl plasmids containing sequence tags as described as follows. Frozen 100 μl aliquots of cells were thawed on ice and combined with 5 μl plasmid DNA in pre-chilled 0.2 cm sterile electroporation cuvette. The cells and DNA mixture was pulsed immediately at 2.5 kV, 200Ω, and 25μF. The mixture was diluted with 400 μl THY broth containing 10% sucrose and 10 mM MgCl2. The broth culture was incubated at 28°C for 2 hours with shaking. The entire 500 μl solution was spread on THY agar containing 0.5mg/ml erythromycin and incubated at 28°C with 5% CO2 for 48 hours. Electroporations were performed for every pGh9:ISS 1 plasmid containing different sequence tags. This resulted in 87 different S. suis serotype 2 #R735 strains, each containing a different sequence tag. A 96-well master plate was created with glycerol
cultures and stored at -70°C.
The presence of pGh9:ISSl within erythromycin-resistant colonies was verified by PCR. Template for PCR consisted of 1 μl from a suspension of one bacterial colony in 60 μl of sterile, ddH2O. Primers used were DEL2121 and DEL2126. The concentrations of PCR reagents per reaction were as follows: IX XL Buffer H, 0.8 rnM dNTP blend, 1.5 mM Mg(OAc)2, 0.5 μM DEL2121, 0.5 μM DEL2126, and 1 Unit vTth DNA Polymerase. Thermocycling was performed on an Applied Biosystems GeneAmp PCR System 2700 as follows: 94°C for 2 minutes, 30 cycles of (95°C for 30 seconds, 550C for 1 minute, 72°C for 1.5 minutes), 72°C for 10 minutes, and held at 4°C. Confirmation of pGh9:ISS 1 resulted from a PCR product of approximately 1 kb as determined by agarose gel electrophoresis.
The pGh9:ISSl plasmids were forced to integrate into the S. suis chromosomal DNA. This was accomplished by growing overnight broth cultures, each culture containing S. suis serotype 2 #R735 with a different sequence tag inserted into pGh9:ISS 1. The broth cultures were diluted 1000-fold ( 100 μl total volume in a 96- well plate), plated onto BHI (Brain Heart Infusion) agar plates containing 0.5mg/ml erythromycin (Em05), and incubated overnight at 37°C with 5% CO2. The resultant plates contained several hundred CFU (colony-forming units). Pools were constructed by inoculating 100 μl BHITEm0'5 broth in 96-well plates. Well Al of pool one was inoculated with a colony of erythromycin-resistant S. suis serotype 2 #R735 containing pGh9:ISS 1 with sequence tag one using a sterile toothpick. AU of the wells of the plate were inoculated with the strain containing the appropriate sequence tag, until the entire plate was inoculated. This was continued for 30 plates, thus, creating 30 pools with 87 different S. suis serotype 2 #R735 signature-tagged mutants in each pool.
Example 2. Murine Screening of S. suis Serotype 2 #R735 STM Pools Thirty pools were screened through murine models to identify attenuated candidates. Frozen pools of Streptococcus suis serotype 2 #R735 signature tagged mutants were removed from -70°C storage and subcultured, using a sterile 96-nail stamp, to a new 96-well round bottom plate (Corning Costar; Cambridge, MA) containing 200 μl of Todd Hewitt broth (Becton Dickinson; Cockeysville, MD) with 0.5mg/ml erythromycin (TH/Em05) per well. Plates were incubated without shaking
overnight at 37°C with 5% CO2. AU 200 μl from each well of one plate was combined into a 50 ml, sterile Falcon tube and vortexed. One ml of this pooled solution was combined with 49 mis of sterile TH/Em05. The cells from the remaining pooled solution were pelleted and stored at 4°C. The pelleted cells were used as the source of input pool total DNA. The diluted, pooled solution was incubated at 370C with 5% CO2 while shaking at 100 rpm. At an OD550 of approximately 0.05, CF-I mice were infected with 1 ml of culture (approximately 1 x 107 CFU/ml) by intraperitoneal administration. Five mice were infected for each pool. After 24 hours post-infection, the mice were sacrificed and spleens harvested. The five spleens infected with the same pool were combined, homogenized, and plated on TH/Em05 agar plates. Plates were incubated at 37°C with 5% CO2 overnight. The following day, 10 mis of TH/Em0'5 broth was added to the surface of the plates. The resulting colonies were gently scraped from the surface of the plate and homogenized by repeat pipetting. A 700 μl aliquot of this was used as the source of recovery pool total DNA. Genomic DNA from the STM input and recovery pools was isolated using traditional or commercial techniques. For both techniques, 700 μl of cells was combined with 67 μl of lysozyme (at 42mg/ml) and incubated at 37°C for 30 minutes. DNA was isolated from this solution by either phenol:chloroform extraction or by utilizing the Wizard Genomic DNA Purfication Kit (Promega; Madison, WI). Example 3. Multiplexed Quantification of Genetic Sequences from Pools of Genomic DNA
The quantification of the copy number for every signature tag in each pool was determined utilizing microsphere fluorescence and fluidics with the Luminex xMAP technology (Luminex; Austin TX). Since each microsphere is specific for one oligonucleotide sequence, the relative amount of every signature tag in each pool was determined. To prepare the assay, the sequence of the signature tag for all 96 pGH9:ISSl plasmid was determined. AU templates were sequenced with the BigDye™ Dye Terminator v. 3.0 Chemistry kit from PE Applied Biosystems (Foster City, CA, U.S.A.) and cleaned using either the Performa ® DTR 96-well standard plate kit (Edge BioSystems; Gaithersburg, MD) or CentriSep Spin Columns (Princeton Separations; Adelphia, NJ). Samples were run on an ABI Prism 377 or ABI 3700 DNA Sequencer. Sequencher 3.0 software (Genecodes, Corp.; Ann Arbor, MI, U.S.A.) was used to assemble and analyze sequence data.
Oligonucleotides (oligos STMOl through STM96) , 20 bp in length and modified at the 5' end with an amino-linker (AC12), were synthesized by Sigma- Genosys Biotechnologies (The Woodlands, TX, U.S.A.) and are shown in Table 3. These oligomers are complementary to the DNA sequence tags in the pGH9:ISSl transposon arrays. Table 3. Sequences of Oligonucleotide Probes.
Oligo Name Sequence (5' to 3' ) SEQ ID NO
STM-01 TGGTGAGAGTGACCGCTAGG SEQ ID NO:46
STM-02 GGATGTAGCGGTCTTTCTGG SEQ ID NO:47
STM-03 GGCGATGTATGGCTAGGTTT SEQ ID NO:48
STM-04 GTGGGGCTCTGTGTTTGGTG SEQ ID NO:49
STM-05 GGTGGGGTGTCGGGGTGGGG SEQ ID NO:50
STM-06 GTTGCGGTATCGCTATTTGT SEQ ID NO:51
STM-07 TGGCGGGGTTGCGAGTTCTA SEQ ID NO:52
STM-08 GGTTTAGCGATTTTGGGGGA SEQ ID NO:53
STM-09 GGAGCTGGGTGTATAGATGG SEQ ID NO:54
STM-10 AGGGGGTGTGGTGTGGGGAT SEQ ID NO:55
STM-Il AGTGATGGGTCGGGGTTGTG SEQ ID NO:56
STM-12 GGCGCTAGTAGGTTTGGTGT SEQ ID NO:57
STM-13 TGTGCGATGGGTTGTTGGGG SEQ ID NO:58
STM-14 ATGGGGCGGTCGGGATATGT SEQ ID NO:59
STM-15 TGGGGTTATAGTGATTTTGG SEQ ID NO:60
STM-16 GTATATGGAGAGCTGTGTAG SEQ ID NO:61
STM-17 GTGGCATGTTTGTGTGAGGG SEQ ID NO:62
STM-18 GGGGTGCGGTTTGGTTATTG SEQ ID NO:63
STM-19 AGGTGCGAGCTCGGTCTGTA SEQ ID NO:64
STM-20 ATCTCGGGGTCGGGGGATGG SEQ ID NO:65
STM-21 GCGTGGTGTGCGGTCTATTT SEQ ID NO:66
STM-22 TGTGGTTGGTGTGTAGAGTG SEQ ID NO:67
STM-23 CGTGTGTGGTGTTTGGGGGT SEQ ID NO:68
STM-24 GTGGGTGATGTGTGGATGGC SEQ ID NO:69
STM-25 AGTGGGTTGTTGTGTCGAGA SEQ ID NO:70
STM-26 GGTCGCGGGTGTTTCTGGGG SEQ ID NO:71
STM-27 GGCGGGGTTGTTAGGGGTCG SEQ ID NO:72
STM-28 GGTGGGCGCGGGGGCTGGGG SEQ ID NO:73
STM-29 GGAGGGTTTGTTTGGGCGTT SEQ ID NO:74
STM-30 ATCGGGGGAGGGGTTGCGCT SEQ ID NO:75
STM-31 CGGGGTGTGGGGATAGTGGT SEQ ID NO:76
STM-32 CTTTGGAGGGATGTTTTGAG SEQ ID NO:77
STM-33 CTCTTTGCGCTTTTTAGTGG SEQ ID NO:78
STM-34 TGGAGTGGTATGGCTCGCGG SEQ ID NO:79
STM-35 TAGTTGCTGGTGGTTTGTGT SEQ ID NO:80
STM-36 GTGCGCTCGCGATCGATGTC SEQ ID NO:81
STM-37 AGGGCTTGGGATTGGGAGTG SEQ ID NO:82
STM-38 GGATGTAGCGGTCTTTCTGG SEQ ID NO:83
STM-39 CGGGTGTGGTCGCTCTGTTT SEQ ID NO:84
STM-40 GGTGGGCGCGGGGGCTGGGG SEQ ID NO:85
STM-41 CGTGGGGTGGTGGGCGATTT SEQ ID NO:86
STM-42 TGCGCGAGTGGGTTAGTGGG SEQ ID NO:87
STM-43 AGGTCTCGAGATGTCTGTCT SEQ ID NO:88
STM-44 AGTGCGCGGGTTTTGGGTGT SEQ ID NO: 89
STM-45 ATGGGTGAGGGAGTGAAGAG SEQ ID NO:90
STM-46 GGTGAGTGGTAGAGGGGTCG SEQ ID NO:91
STM-47 GJGTGTGTTCCGGGTCGTGTT SEQ ID NO:92
STM-48 AGAGTGTGCTTTGATGTGTG SEQ ID NO:93
STM-49 GTATCGGTCGCGGGAATAGC SEQ ID NO: 94
STM-50 AGAGCGTGAGTTCTTTCGTG SEQ ID NO:95
STM-51 ATGGATGGCGCGGTAGGTTG SEQ ID NO: 96
STM-52 GTGGAGGGTTCGGTTGTTCG SEQ ID NO:97
STM-53 GGGTATGTTGGGGTAGAGGA SEQ ID NO:98
STM-54 GGTCGATTCTCGTGGGTGAT SEQ ID NO:99
STM-55 GGTGGGAGCGTTTGCGGGCG SEQ ID NO:100
STM-56 GGCTTTAGTTATGGGGAGTG SEQ ID NO:101
STM-57 GGGGTGCTGGCTGTCTGGTT SEQ ID NO:102
STM-58 GGGTTTTGTGGGGTGTGGCG SEQ ID NO: 103
STM-59 TGGCGCGGGGTGTTGTTTTC SEQ ID NO:104
STM-60 GGGTTGGTAGGGTTGGGTCT SEQ ID NO:105
STM-61 GTGATGGGTGCGATCAGTGC SEQ ID NO:106
STM-62 AGTGGTGTTTAGCGAGGTAT SEQ ID NO:107
STM-63 ATGGGGATTTCGTGTTTTGG SEQ ID NO:108
STM-64 ΓGGGCGGTGTCTAGATAGAG SEQ ID NO:109
STM-65 AGGGTGGTTGGGCGAGGGCT SEQ ID NO:110
STM-66 GGGGTGAGTGATGGTGGTCG SEQ ID NO:111
STM-67 GCTTGGGCGGGCTATAGGGC SEQ ID NO:112
STM-68 GAGCTGGTGGGTTGGGGTTT SEQ ID NO:113
STM-69 GGGAGTTTGGGCGCTGGGTT SEQ ID NO:114
STM-70 CGTGATGTTGGGAGGGTTAG SEQ ID NO:115
STM-71 GGCTTTGGTTGGTGGTGGAG SEQ ID NO:116
STM-72 GTATTTGTCTGGCTGTGTTG SEQ ID NO:117
STM-73 &GAGGGCGTGCGTGAGTGGA SEQ ID NO:118
STM-74 GGAGCGGGTTAGGGCGGTGT SEQ ID NO:119
STM-75 TGTGTGGATCTCTCGGTGCT SEQ ID NO:120
STM-76 TTTGTTATGGGGCTGCGTGA SEQ ID NO:121
STM-77 CGGGAGTGGGATGGGTTTTG SEQ ID NO:122
STM-78 GATTGTGGTAGGTGGCGGTA SEQ ID NO:123
STM-79 GGGTGTGTATTTGGCTTGGG SEQ ID NO:124
STM-80 GGGCGGGTTAGATATTGGGA SEQ ID NO:125
STM-81 GCTCGCTTGGCGCTATGGGG SEQ ID NO:126
STM-82 GGTGGAGTGTGGTCGGTCTT SEQ ID NO:127
STM-83 A.TGTAGTGTTATGGCTGGAT SEQ ID NO:128
STM-84 CGGTCGCGTGATATGGTGTT SEQ ID NO:129
STM-85 TGTTGGTGGAGCTTTTGATT SEQ ID NO:130
STM-86 GGGTATCGCTGGGGAGATTG SEQ ID NO:131
STM-87 GGTTCGAGTTGTTGAGCTTG SEQ ID NO: 132
STM-88 ATCGGGCTGGTGATAGATGG SEQ ID NO:133
STM-89 A.GTTGGGTCGGGAGCTTGCG SEQ ID NO:134
STM-90 GGATTGATTGCTGGGTGGCG SEQ ID NO:135
STM-91 GGGTGGGTGTCTGGCTGGGA SEQ ID NO:136
STM-92 CTGTGTGGGGTTGTCTCTCG SEQ ID NO:137
STM-93 TGGGTCTGGTTGTCGGGTTA SEQ ID NO:138
STM-94 TTAGTTGCTCGTTTGGTGTA SEQ ID NO:139
STM-95 CTCGTTATTTTAGGTTGGTC SEQ ID NO: 140
STM-96 TTGAGGTATGGTTAGATGTG SEQ ID NO:141
Synthetic oligonucleotides complimentary to 20 bp of the 96 STM tags were covalently coupled to carboxylated microspheres as recommended by the manufacturer. Each bead was coupled to the corresponding oligonucleotide (bead set 01 coupled to oligonucleotide 01, etc.). A fresh aliquot of -20°C, desiccated EDC powder was brought to room temperature. The amine-modified oligo was resuspended in ddH2O for a final concentration of 0.1 mM (O.lnmole/μl). The microspheres were resuspended according to manufacturer's recommendations. An aliquot of 5.OxIO6 microspheres was transferred to a sterile microcentrifuge tube and pelleted by centrifugation at 8000 x g for 1 minute. The supernatant was carefully discarded and the microspheres were resuspended in 50 μl 0.1 M MES by vortexing and sonication. 0.2 nmole of amine-modified oligo was added to the microsphere solution and then vortexed. A fresh aliquot of 10 mg/ml EDC in ddH2O was prepared, and 2.5 μl of fresh 10 mg/ml EDC was immediately added to the microspheres and then vortexed. The microsphere/oligonucleotide solution was incubated for 30 minutes at room temperature in the dark. A second solution of 10 mg/ml EDC was prepared, and another 2.5 μl aliquot of fresh EDC was added to the microspheres. The solution was vortexed and again incubated 30 minutes at room temperature in the dark. After the final incubation, the microspheres were washed with 1.0 ml of 0.02% Tween-20, followed by a second wash step with 1.0 ml of 0.1 % SDS. The microspheres were finally resuspended in 100 μl TE, pH 8.0, and stored at 2-80C in the dark.
The genomic DNA isolated from the STM pools was used as a template in PCR for the amplification of the sequence tags. Primers used for amplification annealed to common sequences flanking the unique sequence tags in all mutants. The primers used were TEF-327 and biotinylated TEF-498. The concentrations of PCR reagents per reaction were as follows: IX XL Buffer JI, 0.8mM dNTP blend, 1.5mM Mg(OAc)2, 0.5μM TEF327, 0.5μM TEF498, and 1 Unit xTth DNA Polymerase. The
reaction conditions were as follows: 94°C for 2 minutes, 30 cycles of (95°C for 30 seconds, 550C for 1 minute, 72°C for 1.5 minutes), 72°C for 10 minutes, and held at 4°C.
The amplified sequence tags were then hybridized to the appropriate microspheres. At all times, care was taken to assure minimized exposure of the microspheres to light. Microspheres previously coupled with amine-modified oligonucleotides were resuspended by vortexing for 30 seconds and sonication for 1 minute. A 1.0 ml Working Microsphere Mixture was created by diluting the coupled microsphere stocks in 1.5X TMAC Hybridization Buffer, to a final concentration for each bead set of 150 microspheres/μl. The Working Microsphere Mixture was vortexed for 30 seconds and sonicated for 1 minute. Aliquots of 33 μl of the Working Microsphere Mixture (containing approximately 5000 microspheres of each set) were added to each sample well or background well of a 96-well PCR plate. Five microliters of biotinylated PCR product was added to each sample well; 5 μl of TE buffer, pH 8.0, was added to the background well. The volume of the final solution in the well was brought up to 17 μl with TE buffer, pH 8.0. The samples were gently mixed by repeated pipetting. The plate was sealed with aluminum tape to prevent evaporation and light exposure. Using an Applied Biosystems GeneAmp PCR System 2700, the plate was incubated under the following conditions: 10 minutes at 95°C, followed by a hold at 45°C for a minimum of 15 minutes. The microspheres were pelleted by centrifugation at 2,500 x rpm in a Beckman GS-6R centrifuge for 10 minutes, and 25 μl of the supernatant was carefully removed with a pipette. For each reaction, 75 μl of fresh reporter mix, and 4 ng/μl of streptavidin, R-phycoerythrin in IX TMAC hybridization buffer, was added to each well. The samples were gently mixed by repeated pipetting, and transferred to a 96-well plate designed to fit onto the Luminex XYP platform. With the XYP platform of the Luminex xMAP™ system held at 45°C, the samples were analyzed according to the manufacturer's recommendations.
The input and recovery DNA from 30 pools was analyzed for possible attenuated mutants using the Luminex xMAP™ system. If the growth of a mutant was inhibited in the murine host, the recovered signal was lower compared to the input signal, and resulted in a high inputrecovered ratio.
Example 4. Evaluation of Candidate Mutants for Virulence
Luminex analysis resulted in 97 potentially attenuated mutants that exhibited reduced growth in the recovery pool relative to the input pool. These mutants were isolated from frozen stock of original cultures and analyzed individually to verify attenuation. Individual candidate mutants were grown overnight in 400 μl of TH/Em05 broth at 37°C with 5% CO2. The cultures were refreshed into 4 mis of TH/Em05 and incubated at 37°C with 5% CO2 while shaking at 100 rpm until the OD55O reached approximately 0.7. Three CF-I mice per mutant were infected, each with 1 ml of culture by intraperitoneal administration. Attenuation was determined by comparing mortality and health after 72 hours relative to the wild-type positive control and TH/Em05 negative control.
Results indicated that 58 of 97 potential transposon mutants produced some level of attenuation, having at least 1 out of 3 mice surviving compared to the wild- type, where 0 of 3 mice survived. Example 5. Identification of Genes Tagged by Transposon Required for Virulence
The identity of the open reading frames disrupted by the transposon was determined by arbitrary PCR or single primer PCR techniques. These techniques allowed for the amplification of DNA flanking the transposon insertional element. The arbitrary PCR procedure consisted of a protocol modified from that previously described by Rossbach et al. (Rossbach et al., Environmental Microbiology. 2(4): 373-382 2000). Primary amplification of DNA left of the ISSl insertional element was performed using TEF-705. Primary amplification of the DNA right of the ISS 1 element was performed using TEF-708. For both amplifications, a mix of up to 8 arbitrary primers was used. These included TEF-597, TEF-599, TEF-663, TEF- 664, TEF-665, TEF-666, TEF-667, TEF-668. The concentrations of PCR reagents per reaction were as described previously. Template consisted of 5 μl of 5 ml overnight broth culture, or up to 5μl of genomic DNA preparation. Thermocycling was performed as follows: 2 minutes at 94°C, 14 cycles of (15 seconds at 94°C, 30 seconds touchdown starting at 50°C, 5 minutes at 72°C), 30 cycles of 15 seconds at 94°C, 30 seconds at 50°C, 5 minutes at 72°C), 7 minutes at 72°C, and held at 4°C. Secondary amplification of the DNA left of the ISS 1 element was performed using nested primer DEL-2122. Secondary amplification of the DNA right of the ISS 1
element was performed using nested primer DEL-2403. For both amplifications, another nested primer, TEF-598, was used. The concentrations of PCR reagents per reaction were as described above. Template consisted of 1 μl of primary amplification product. Single primer PCR was performed essentially as described by Karlyshev et al.
(Karlyshev et al, BioTechniques. 28:1078-1082 2000), followed by an second round of amplification using nested primers to improve product concentration with limited background. As described above, primary amplification of DNA flanking the left or right of the ISSl insertional element used primers TEF-705 or TEF-708, respectively. The concentrations of PCR reagents per reaction were as described previously.
Template consisted of 5 μl of 5 ml overnight broth culture, or up to 5μl of genomic DNA preparation. Thermocycling was performed as follows: 1 minute at 94°C, 20 cycles of (30 seconds at 94°C, 30 seconds at 50°C, 3 minutes at 72°C), 30 cycles of (30 seconds at 94°C, 30 seconds at 30°C, 2 minutes at 72°C), 30 cycles of (30 seconds at 94°C, 30 seconds at 50°C, 2 minutes at 720C), 7 min at 72°C, and held at 4°C. Secondary amplification of the DNA left of the ISS 1 element was performed using nested primers TEF-705 and DEL-2122. Secondary amplification of the DNA right of the ISSl element was performed using nested primers TEF-708 and DEL-2403. The concentrations of PCR reagents per reaction were as described previously. Template consisted of 1 μl of primary amplification product.
AU PCR products were analyzed by electrophoresis of the entire reaction in a 1% agarose gel. Desired products were excised from the gel. DNA was recovered from the agarose slice via QIAquick® Gel Extraction Kit according to the manufacturer's recommendations (Qiagen Inc.). Sequencing reactions of the PCR products were performed using primers DEL-2122 or DEL-2403 as specified above. Table 2 details the individual mutants and the identity of the disrupted open reading frames.
Table 4. S. suis #R375 Attenuated* STM Mutants
*A11 STM strains below resulted in 3/3 or 2/3 mice survivin the attenuation stud
*** = No Hits using BLASTN of 200bp flanking ISSl, but definite match using BLASTN with entire ORF ****__θnly 26aa of Arb PCR product match to fused-ccdB, but ORF match to gftA
SEQ ID NO:1 and 2 atgaaaattaaaaatcaagctatgttaattacctattcggatagtttaggcaagaatctt
M K I K N Q A M L I T Y S D S L G K N L aaggatttgaaaaaagttcttgaggggccgttaaaggatgttgtgggaggtatccatatt
K D L K K V L E G P L K D V V G G I H I ctgccgtttttcccatcatcaggtgaccgtgggtttgcgccaatggattatacaaaggtg
L P F F P S S G D R G F A P M D Y T K V gaccctgcatttggagattggtcagatattgaagcactaagcaaagactattacctcatg
D P A F G D W S D I E A L S K D Y Y L M tttgattttatgatcaatcatatttcagcaaaatctccttatttccttgattttcttgaa
F D F M I N H I S A K S P Y F L D F L E aagaaagatgaatcagcttatgcggatttgtttattcgttataaaaacttttggccaaat
K K D E S A Y A D L F I R Y K N F W P N ggtgagccaacgcaagaagatgttgatttgatttataagcgtaaacctcgcgcaccttat
G E P T Q E D V D L I Y K R K P R A P Y cgaattgcaacatttgctgatggtagtgaagagaaggtgtggtgtacctttgatgaacag
R I A T F A D G S E E K V W C T F D E Q cagattgatttagatgtgacaacggagacaacccgtcgtttcatccaagaaaatttggaa
Q I D L D V T T E T T R R F I Q E N L E cagttggcagagcatggtgcttcgattattcgtttggacgcctttgcttatgccaataaa
Q L A E H G A S I I R L D A F A Y A N K aaaatcggaaccaattgtttctttgtggagcctgatatttgggaaatgctccattttcca
K I G T N C F F V E P D I W E M L H F P cgtcagttattggcaccaaaagatgtagaaatcttaccagaaattcatgaacactacacc
R Q L L A P K D V E I L P E I H E H Y T attcagcagaaaattgccgagcaagattattatgtttatgattttgccttgccaatgcta
I Q Q K I A E Q D Y Y V Y D F A L P M L gttctccacgctttgtattctggtcatgtcaatcgcctggttcactggatggagatttgc
V L H A L Y S G H V N R L V H W M E I C cctcgcaagcaatttacaactcttgatacacatgatggaatcggtgttgtggatgttaag
P R K Q F T T L D T H D G I G V V D V K gatttgctgacggatgaggagacagaggagacccgtgaagccttgtatgcacaaggtgcc
D L L T D Ξ E T E E T R E A L Y A Q G A aatgtgaagaaaatttatagtacagaagcctataataatttggatatttatcagattaac
N V K K I Y S T E A Y N N L D I Y Q I N tgtacttattattctgctcttggcaataatgatcaagcttatctattggcgcgtgttctc
C T Y Y S A L G N N D Q A Y L L A R V L caatgctttgcaccaggtattccacagatttattatgttggtttactagcaggσgaaaat
Q C F A P G I P Q I Y Y V G L L A G E N gatattgaacttttagaatcaagtaaggaagggcgcaatatcaatcgccattactatgat
D I E L L E S S K E G R N I N R H Y Y D ttggaagaaattgagcaggaagtgcaacggccagttgtacaatccttgttcaaactcctt
L E E I E Q E V Q R P V V Q S L F K L L aaattccgcaatacaagtccagctttcgacggggagttctctgttaagatgttggatgaa
K F R N T S P A F D G E F S V K M L D E acaagtatggaaattttctggaataatcaagatgcaggggtgtctgcccgtctaacagca
T S M E I F W N N Q D A G V S A R L T A aacctaaaagaaaaatcctttgaaattgttgaaattgaagagggaaaaattaccacaatt
N L K E K S F E I V E I E E G K I T T I gagttataa
E L -
SEQ XD NO:3 and 4 atgtcaaactgggacactaaatttttgaaaaaaggctttactttcgacgatgtattactt
M S N W D T K F L K K G F T F D D V L L attccggctgaaagtcatgtattaccacatgatattgatttaaaaacacaattagcacca
I P A E S H V L P H D I D L K T Q L A P aatttgacccttaatcttccgattatttctgctgccatggatacagtaacagatagcaaa
N L T L N L P I I S A A M D T V T D S K atggctatcgctatggcgcgtgcaggtggtttgggcgtcatccataagaacatgtctatc
M A I A M A R A G G L G V I H K N M S I gcggagcaggcagatgaggtgcgtaaggtaaaacgttctgaaaatggtgtcattatcgat
A E Q A D E V R K V K R S E N G V I I D ccattcttcttaacaccagaacacaccattgctgaagctgagaaattgatggctacttat
P F F L T P E H T I A E A E K L M A T Y cgtatttccggtgtgccaatcgttgaaacattggaaaatcgtaagttggtcggtattatc
R I S G V P I V E T L E N R K L V G I I accaaccgcgatatgcgtttcatttcagattactcacagccaatttcgaccaacatgaca
T N R D M R F I S D Y S Q P I S T N M T agcgatgaattggtgacagcgccagttggaacagatcttgcgactgcggaggctattctt
S D E L V T A P V G T D L A T A E A I L cacaagcatcgtattgaaaaattgccattggttgatgaaaatggtcgtttgtcaggcttg
H K H R I E K L P L V D E N G R L S G L attaccatcaaagatattgagaaagtgattgagttcccaaatgctgcgaaggatgaattt
I T I K D I E K V I E F P N A A K D E F ggtcgtctcttggttgcgggtgctgttggtgttacatctgatacttttgaacgtgcagaa
G R L L V A G A V G V T S D T F E R A E gccctttttgaagcgggtgcagacgcgattgtcatcgatacagctcacggtcactcagca
A L F E A G A D A I V I D T A H G H S A ggcgttcttcgcaagattaaagaaatccgtgaccacttcccaactcgtaccttgattgcc
G V L R K I K E I R D H F P T R T L I A ggcaacattgccacagctgaaggagctcgtgctctttatgaagctggtgttgatgttgtg
G N I A T A E G A R A L Y E A G V D V V aaggtcggtattggaccaggttcaatctgtacaacacgtgttatcgcaggtgtcggtgta
K V G I G P G S I C T T R V I A G V G V ccacaagtgacagctatctatgatgcagctggtgttgcgcgtgaatatggtaaaacgatt
P Q V T A I Y D A A G V A R E Y G K T I atcgctgatggtggtatcaagtattcaggagatattgtcaaggcacttgccgctggtggt
I A D G G I K Y S G D I V K A L A A G G catgccgttatgcttggttctatgtttgcaggaactgatgaagcaccaggtgagacagaa
H A V M L G S M F A G T D E A P G Ξ T E atcttccaaggtcgtaagttcaagacctatcgtggtatgggctctatcgctgccatgaaa
I F Q G R K F K T Y R G M G S I A A M K caaggttcaaaagaccgttacttccaagcatctgtcaatgaagccaacaaacttgttcca
Q G S K D R Y F Q A S V N E A N K L V P gaaggaattgaaggacgtgtagcctataaaggttctgttgcagatatgattttccaaatg
E G I E G R V A Y K G S V A D M I F Q M gttggtggacttcgctcaggtatgggctatgtaggtgctggtaacttgactgaattgcat
V G G L R S G M G Y V G A G N L T E L H gaaaatgcacaattcatcgaaatgtcaggtgctggtttgaaagaaagccatccacacgat
E N A Q F I E M S G A G L K E S H P H D gttcaaatcacaaacgaagctccaaactattcagttcagtaa
V Q I T N E A P N Y S V Q -
SΞQ ID NO:5 and 6 atgacaaaagaaaaatcaaccgtaccacgattgcgcttccccggattcacggacgcttgg
M T K E K S T V P R L R F P G F T D A W aaacagcgtaagttgggggaggtggcggacttttccataaaaacaaactcactttctaga
K Q R K L G E V A D F S I K T N S L S R gataagttatcatcgtatttttatgaagttcagaacattcattatggggatattttaaca
D K L S S Y F Y E V Q N I H Y G D I L T aaatatgatgctattttagatgtatgtaacaaagaacttccatcaattattggaagtacg
K Y D A I L D V C N K E L P S I I G S T atttcagactttgcagatgctttacttagtgaaggagatattgttttcgcggatgcggca
I S D F A D A L L S E G D I V F A D A A gaagactcgactgttgggaaagctattgaagttcgaaattttaagggtaagaatgttgtt
E D S T V G K A I E V R N F K G K N V V tctggtttacatacgatagttgctaggccgaaagtttcttatgccccctactatttaggt
S G L H T I V A R P K V S Y A P Y Y L G tatctaattaattcaactgcataccataatcaaattttacctttaatgcaggggacaaaa
Y L I N S T A Y H N Q I L P L M Q G T K gtgagctcaattagtaaggctaatttaaaatccacgacagtagtgttccccaccctccct
V S S I S K A N L K S T T V V F P T L P gaacaagaagccatcggcagcttcttctccgacctagatcagcttattactcttcatcag
E Q E A I G S F F S D L D Q L I T L H Q cgaaaattagatgatgttaaagaattgaagaaggctttgttacagaaaatgtttccgaaa
R K L D D V K E L K K A L L Q K M F P K gggaatggaaacgattttcctgagctaagattcccagaatttacggacgcttggaaacag
G N G N D F P E L R F P E F T D A W K Q cgtaagttgggggagtttatgaaagaaagtaaaattttaggtagtaaaggagatatagca
R K L G Ξ F M K E S K I L G S K G D I A aggaagttaactgtaagattatgggggagaggagttgtttccaagaaagaaatttatagt
R K L T V R L W G R G V V S K K E I Y S ggtagttcagctacacagtattatataagaaaatcaggccagtttatatatgggaaatta
G S S A T Q Y Y I R K S G Q F I Y G K L gactttttaaatcaagcttttggaattattccaccagaacttgatggttatgaatcaact
D F L N Q A F G I I P P E L D G Y E S T cttgattcgcctgcttttgatttattgaaagggataaacgggcaatttctgttagaattt
L D S P A F D L L K G I N G Q F L L E F gtatctcgcaaagaattttattattatcaaggaaatattgcaaatggctctagaaaagct
V S R K E F Y Y Y Q G N I A N G S R K A aaaagaatccacacagaaacttttcttggcatgcctatctccctccccaccctccctgaa
K R I H T E T F L G M P I S L P T L P E caagaagccatcggtagcttcttttccgacctagatcagcttattactcttcatcagcga
Q E A I G S F F S D L D Q L I T L H Q R aaatga
K -
SEQ ID NO:7 and 8 atgcttggtggttctctacaaatgattgcacttggttgggcaaacattggtgcagctgtt
M L G G S L Q M I A L G W A N I G A A V gcacctgacgctgctcttgcttctgtagctgctgcaatcatcatgatcaaaggtggcgac
A P D A A L A S V A A A I I M I K G G D ttctcaactgaaggtattgccgttgcaacaacaactgctatccctcttgccgtagctggt
F S T E G I A V A T T T A I P L A V A G cttttccttacaatgatcgttcgtactatctcagtcggtcttgtacacggtgctgacaat
L F L T M I V R T I S V G L V H G A D N gctgctaaagatgcaaacttcgctgctgtagaacgttaccacttgtttgctcttctcctt
A A K D A N F A A V E R Y H L F A L L L caaggtttgcgtatcgcagttcctgcggctcttcttcttgcaattcctgcagaagctgtt
Q G L R I A V P A A L L L A I P A E A V caagcagttcttgaatctatgccagcttggttgtcaggtggtatggccgttggtggtggt
Q A V L E S M P A W L S G G M A V G G G atggttgttgccgtaggttatgctatggttatcaacatgatggcaactcgtgaagtatgg
M V V A V G Y A M V I N M M A T R E V W ccattcttcgcacttggttttgcatttgctgctatcagcaaattgacacttatcgcactt
P F F A L G F A F A A I S K L T L I A L ggtgttatcggtgttgcaatcgctcttatctacctcaacttgtcaaaacaaggcggatca
G V I G V A I A L I Y L N L S K Q G G S ggtaacggtggtgcttcatctaacgccccaatcggcgacatccttgaagactactaa
G N G G A S S N A P I G D I L E D Y -
SEQ ID NO:9 and 10 atgacatcagtagttgttgtaggaacccagtggggcgacgaaggtaagggtaaaattaca
M T S V V V V G T Q W G D E G K G K I T gacttcttgtctgctaatgctgaagtaatcgcacgttatcaaggtggtgataacgctgga
D F L S A N A E V I A R Y Q G G D N A G cacactatcgttatcgatggcacgaagtataaattgcacttgattccgtcaggaatcttc
H T I V I D G T K Y K L H L I P S G I F ttcccagaaaagatttctgtaatcggtaatggtgtggttgtcaatccaaaatctttggtg
F P E K I S V I G N G V V V N P K S L V aaggaaatcaactatctccatgattcaggtgtgacaacagataatttgcggatttcagac
K E I N Y L H D S G V T T D N L R I S D cgcgcacatgtcatcttgccttatcacatcaaattggaccagttgcaagaagagtctaaa
R A H V I L P Y H I K L D Q L Q E E S K ggtgagaataagattggtacaaccaacaagggtatcggtccagcctacatggacaaggct
G E N K I G T T N K G I G P A Y M D K A gcgcgtgttggtatccgtattgcagacctcttggacaaggagatttttgcggagcgtttg
A R V G I R I A D L L D K E I F A E R L agaacaaacttggctgagaaaaaccgcttgtttgagaagatgtatgagtcaactccgatt
R T N L A E K N R L F E K M Y E S T P I gagtttgacgaaatctttgaagaatactatgcttacggtcaagaaatcaaaaagtatgta
E F D E I F Ξ E Y Y A Y G Q E I K K Y V acagacacatctgttattttgaacgatgccctcgaccaaggcaagcgtgtcttgtttgaa
T D T S V I L N D A L D Q G K R V L F E ggtgcgcaaggagttatgttggatattgaccaaggtacctatccattcgttacttcttca
G A Q G V M L D I D Q G T Y P F V T S S aacccagttgctggtggtgtgacgatcggtagcggtgtcggcccaagcaagattgacaag
N P V A G G V T I G S G V G P S K I D K gttgttggtgtatgtaaggcctacactagccgtgttggtgacggaccatttccgactgaa
V V G V C K A Y T S R V G D G P F P T E ttgcacgatgaaatcggagaccgtatccgcgaaatcggtaaagagtacggtacgacaact
L H D E I G D R I R E I G K E Y G T T T ggccgtccacgccgtgtcggttggtttgactcagtggtgatgcgccatagccgccgtgtg
G R P R R V G W F D S V V M R H S R R V tcaggtattaccaacttgtccctcaactcgattgacgtcttgtcaggtcttgggaccttg
S G I T N L S L N S I D V L S G L G T L aaaatctgcgtggcttatgacttggatggtgagcgtattgaccactacccagcaagtttg
K I C V A Y D L D G E R I D H Y P A S L gagcaactcaaacgttgcaaaccaatctacgaagaaatgccaggttggtctgaagacatc
E Q L K R C K P I Y E E M P G W S E D I acaggtgtacgtagcctggatgaattgccagaagcggctcgcaactatgttcgtcgtatc
T G V R S L D E L P E A A R N Y V R R I agcgaattggtaggcgttcgtatctcaaccttctcagtaggacctggtcgtgaacagacc
S E L V G V R I S T F S V G P G R E Q T aacatccttgagagtgtatggagcgcaaaatag
N I L Ξ S V W S A K -
SEQ ID NO:11 and 12 atgaaacttttggttgtcgggtctggtggtcgtgaacatgctatcgcaaagaaattgtta
M K L L V V G S G G R E H A I A K K L L gagtctgagcaggtagagcaggtctttgttgctcctggaaatgacggaatgactttagat
E S E Q V E Q V P V A P G N D G M T L D ggtatcgagttagtcaatatcgggatctccgaacattctgctataatcaactttgctaag
G I E L V N I G I S E H S A I I N F A K gaaaatgacgttgcttggacttttgtgggtccagacgatgctctggcagcaggaatcgtt
E N D V A W T F V G P D D A L A A G I V gatgattttgaacaggcgggacttaaagcttttggccctagtcgtctagccgcggagcta
D D F E Q A G L K A F G P S R L A A E L gagtggtcaaaagactttgccaaacaaatcatggtcaaatacggcattccaacagcagcc
E W S K D F A K Q I M V K Y G I P T A A tttggcacattttccaacttcgaagaagccaaagcctacatcgaagagcagggtgcacca
F G T F S N F E E A K A Y I E E Q G A P atcgtggtcaaggcggacggcttggcactgggcaagggcgtggtcgtggcggaaaccgtc
I V V K A D G L A L G K G V V V A E T V gagcaggcggtcgaagcggcacgggagatgctcttggacaacaagttcggcgactcgggt
E Q A V E A A R E M L L D N K F G D S G gcccgcgtggtcatcgaggagttcttggcgggtgaggagttttccctctttgctctggtc
A R V V I E E F L A G E E F S L F A L V aatggcgaccaattttacattctgccgacagcccaggaccacaagcgtgcctttgacggc
N G D Q F Y I L P T A Q D H K R A F D G gaccaaggtcccaacacaggtggtatgggggcttacgctcctgttccccacctgcctcaa
D Q G P N T G G M G A Y A P V P H L P Q agcgtggtggacacagcggttgacaccattgtcaagccgattcttgagggcatgattgcg
S V V D T A V D T I V K P I L E G M I A gacggccggtcttatctgggcgtgctctatgctggcttgattctgaccgaccaaggtccc
D G R S Y L G V L Y A G L I L T D Q G P aaggtcatcgagttcaacgcccgttttggcgacccagaaacccagattatcctgcctcgc
K V I E F N A R F G D P E T Q I I L P R ctgacctctgactttgctcagaacatcgacgacatcctccacaaacgcccgacacagctg
L T S D F A Q N I D D I L H K R P T Q L acttggctggatagtggcgtgacgctgggtgttgtcgtggcatcaaacggctaccctctg
T W L D S G V T L G V V V A S N G Y P L gactacgaaaaaggcgtagagttgccagcaaagaccgagggcgacatcacgacctactat
D Y E K G V E L P A K T E G D I T T Y Y gcaggggctcgttttgcggaaaatagcagagcactgctttcaaacggcggtcgggtttat
A G A R F A E N S R A L L S N G G R V Y atgctagtcaccacagcagacaccgtccaagacgcccaagaaaaaatttactcggagctg
M L V T T A D T V Q D A Q E K I Y S E L aaaaatcaagataccacaggcctcttttatcggacagatattggaagtaaggcagtaaaa
K N Q D T T G L F Y R T D I G S K A V K taa
SEQ ID NO:13 and 14 atgtcaaacgtttatcacattttgtttcaattttatcaaaaaacattgttaaaacttgat
M S N V Y H I L P Q F Y Q K T L L K L D ttttcgcaagaaaacgtttactatattaatgaaaaactagaaaatttggagaaaattatg
F S Q E N V Y Y I N E K L E N L E K I M gcatttacaacaggggagcgttacagagcttatgctgactggacacccgaatacattgaa
A F T T G E R Y R A Y A D W T P E Y I E aaaataaagaagaatacagagagttctccttggaggacaaatttccatattgaaacacca
K I K K N T E S S P W R T N F H I E T P catggactgttaaatgatccaaatggattttcttattttaatggaaagtggactcttttt
H G L L N D P N G F S Y F N G K W T L F taccaatacttcccattcggtgctgcgcacggattgaaatcgtgggtccatacagaatca
Y Q Y F P F G A A H G L K S W V H T E S acagatttggtccattttgaagaaactggtacggttatgtacccagatacaccacttgat
T D L V H F E E T G T V M Y P D T P L D agccatggtgcctactctggatctgccatggaatttggcgacaagctcttcctcttctac
S H G A Y S G S A M E F G D K L F L F Y actggaaatgtccgcgatgaaaattgggttcgccatccataccaaatcggtgccttgatg
T G N V R D E N W V R H P Y Q I G A L M gataaagatggtaagattgaaaagattgataaagtcttgattgagcaaccagaagatacc
D K D G K I E K I D K V L I E Q P E D T accgaccatttccgtgatccacaaattttcaactataaagggcaatattacgctattgtc
T D H F R D P Q I F N Y K G Q Y Y A I V ggtggacaaaatctggataaaaagggaattgtcaaactttataaagctgaaaataacgac
G G Q N L D K K G I V K L Y K A E N N D tacctcaactggtcctatgttggtgaccttgattttgccaatgatatgaccgcttatatg
Y L N W S Y V G D L D F A N D M T A Y M atggaatgcccaaatattgcgttcgtcggtgagcaacccatccttctctattgtccacaa
M Ξ C P N I A F V G E Q P I L L Y C P Q ggtttggacaaagaggtattggactatggcaatatctatccaaatatgtacaagattggt
G L D K E V L D Y G N I Y P N M Y K I G cagagtttcgttcctgaaacagcaagcattgtcgaaccgagcgaattgatcaatctggac
Q S F V P Ξ T A S I V E P S E L I N L D tatggttttgagtgctatgcaacccaggcctttaatgcaccagacggtcgaactctatct
Y G F E C Y A T Q A F N A P D G R T L S gttagctggttggcacttccagatgtggaatacccaaccgatgcttatgactaccaaggc
V S W L A L P D V E Y P T D A Y D Y Q G tgtctgtcattggttaaagaattaaccatcaaggacggtaagctctaccaatatccagtc
C L S L V K E L T I K D G K L Y Q Y P V gatgcgattaccagtcttcgtaaagaagctcagccattttcagcccaaaaagaaaccaat
D A I T S L R K E A Q P F S A Q K E T N aatgtttacgaattggaacttgatttttcagcgagcacgaagcacgaaatcgtattgttc
N V Y E L E L D F S A S T K H E I V L F gcaaatgaagcagaaaaaggcttggtcttgtctgtagacactgaacaaggccagafctaca
A N E A E K G L V L S V D T E Q G Q I T ttggaccgtggcaactgtggtcagccattcgcactcgatttcggcacaagtcgctcttgc
L D R G N C G Q P F A L D F G T S R S C gagatttctccaggagctcttacagccaatatσttcatcgacaaatctgtctttgaaatc
E I S P G A L T A N I F I D K S V F E I tttatcaataaaggagagaaagtattttctggtcgtgtcttccctgatgcggatcagtct
F I N K G E K V F S G R V F P D A D Q S ggtatagtcattacgactggtaatccgaccggaacctactaccatttagattatggtcgc
G I V I T T G N P T G T Y Y H L D Y G R aaaactaactga
K T N -
SEQ ID NO:15 and 16 atggtcgcaaaactaactgatgtcgcacagttagctggggtcagcccaacaactgtctcg
M V A K L T D V A Q L A G V S P T T V S cgcgttatcaataaaaaaggatacctatctgaaaaaaccattcgcaatgtcgaagaggct
R V I N K K G Y L S E K T I R N V E Ξ A atgcgtgaactaggctacaaacctaataatttagctcgtagtttgcaaggtaaatctgca
M R E L G Y K P N N L A R S L Q G K S A aaattagttggtctcatcttcccaacaataaacaatattttttattctgaattgattagc
K L V G L I P P T I N N I F Y S E L I S catttagaaaaagagctttttgatcgaggctataaaaccattatttgcaatagccagcac
H L E K E L F D R G Y K T I I C N S Q H gagtccgataaggaacgtgagtatctagaaatgttagcagctaaccaagtagatgggatt
E S D K E R E Y L E M L A A N Q V D G I atctcgggcagtcacaatctcggtatccaagactacgaccgtgtcgtagctccaattatc
I S G S H N L G I Q D Y D R V V A P I I gcttttgaccgcaacctatctccttccattcccattgtctcttccgataattttgctggc
A F D R N L S P S I P I V S S D N F A G ggggtattagctgcccaaaccttacaaaaagcgggatgtcacaatccattaatgattacg
G V L A A Q T L Q K A G C H N P L M I T gggaacgatgattccaattcacctaccggccttcgccaagtaggttttacatctattttg
G N D D S N S P T G L R Q V G F T S I L aacaaagccgaagtttttcatatctccagtgatttctcacctgtgcgtaaggagatggaa
N K A E V F H I S S D F S P V R K E M E atccgagccattcttgaaaagcaaaaaccaaatggtatctttgtatctggcgatgcaacg
I R A I L E K Q K P N G I F V S G D A T gctatgctggtatggaacgtcattcgttcaatgaaactgtctattccagaagatattaaa
A M L V W N V I R S M K L S I P E D I K ttgattggttatgatggaaccagtttcatcgaaaactactaccctcaactgacaactatc
L I G Y D G T S F I E N Y Y P Q L T T I aagcaaccattaaccgaaatagctcgcctgctggttgaactattagttgataaaatcgaa
K Q P L T E I A R L L V E L L V D K I E ggaaaaaaactgacaaaaacagactatatcctgccgattagcctactagcaggagctagt
G K K L T K T D Y I L P I S L L A G A S atataa
I -
SEQ ID NO:17 and 18 atgaacgataaggaatttggacagcgtgtacgtcaattacgagaatctgctagtatgaca
M N D K E F G Q R V R Q L R E S A S M T cgtgaacagttttgtgacgatgaactggaactctctgtgcgccaattaactcgtattgaa
R E Q F C D D E L E L S V R Q L T R I E gcaggtgcttccaagccgactttttcaaagattcagtatattgcaactcgtttaggtatg
A G A S K P T F S K I Q Y I A T R L G M ggactttacgagcttatgccagattatgtatctttacccgaaagatattccaagctgaag
G L Y E L M P D Y V S L P E R Y S K L K tttgatgtgcttcgcaccccaacttatggtaatgaagatttggcggaaaagcgagatgcc
F D V L R T P T Y G N E D L A E K R D A atgatgacagaaatctatgacgattattatgatgaattgcctgaggaggagaagatagca
M M T E I Y D D Y Y D E L P E E E K I A atagatgcgattcaatcacgaattgatactttagagtcaggtacagcaggctttggaaaa
I D A I Q S R I D T L E S G T A G F G K gagatactggaagactactttgaacaaatttttcgcaaacgaaagtatgaattgaatgat
E I L E D Y F E Q I F R K R K Y E L N D ttgttgattgttaggctccatcttgaatatgttaggttatctagctgtgattcagaaata
L L I V R L H L E Y V R L S S C D S E I tttagacagtttttgaaaattatagagcatttacatgagcaaatcaatatcatcaactca
F R Q F L K I I Ξ H L H E Q I N I I N S aatgatttatttgttttacgagacacgctattatcttgtgtaaatatattaggaagtaaa
N D L F V L R D T L L S C V N I L G S K aaatattacgaaccaataccaaagatatttgacagtgtagataagattatacagtcgaca
K Y Y E P I P K I F D S V D K I I Q S T caagattttcagaaaaagcccattgttagtgtattaaaatggaaatatgcactttttgtg
Q D F Q K K P I V S V L K W K Y A L F V gataaggatcgggatgaggcagaaaagcattatctagatgcggtgctatttgcaaaattg
D K D R D E A E K H Y L D A V L F A K L atagaaaatagagagttagaacagaagattgaagaagattggagagttgacaatcaataa
I E N R E L E Q K I E E D W R V D N Q -
SEQ ID NO:19 and 20 atggttcgtttgaaaaatattttacttattttgcttggtgcagggctatttgcctttggg
M V R L K N I L L I L L G A G L F A F G ctaaattatttaatcatgcccaatcgtctattcgagggtggcgcaactggattgacgctg
L N Y L I M P N R L F E G G A T G L T L attatttactacctttttcatattcaaccttggataatgaacattgtgattaatattcca
I I Y Y L F H I Q P W I M N I V I N I P ttgttcatcctcgggtggaaaatactcggaaagaagactctctatctcagtatcttagga
L F I L G W K I L G K K T L Y L S I L G acctttagcgttaccttttggttggccatttttgaaaaaatccatttttcaatcaatcta
T F S V T F W L A I F E K I H F S I N L caacaagatttgatactcgttagtatcctgggtgggattcttatgggactaggattagga
Q Q D L I L V S I L G G I L M G L G L G accatcttccgtgctggcggaacgactgggggaagcgatattattgctcgtataggtcat
T I F R A G G T T G G S D I I A R I G H aaattcctaccttactccattggacaaatcattcttgcagttgacatcctcatcctaact
K F L P Y S I G Q I I L A V D I L I L T ctgattgttattgtttttaaagacctccgaacagttctctatactttaatgatggttgct
L I V I V F K D L R T V L Y T L M M V A attgcttccaaggttattgattttgtcacggagggcggatatggtagcaagggtgttatg
I A S K V I D F V T E G G Y G S K G V M attgtttctcaaaaatctgaccaattggctcaggctattgattgtgaaatcgagcgtggt
I V S Q K S D Q L A Q A I D C E I E R G gtcacctttatcaaagcacaaggtttctacagcaaagccgatgtcaacatgatttactcg
V T F I K A Q G F Y S K A D V N M I Y S gtcatatataagagccaactccaagagatgaaggagcttattcatcgtattgacccccac
V I Y K S Q L Q E M K E L I H R I D P H gcatttatcaccattacagacgcacatgaagtactcggtgagggatttactttagatcga
A F I T I T D A H E V L G E G F T L D R gataaaaaaccaatagaacgccattaa
D K K P I E R H -
SEQ ID NO:21 and 22 atgcgaggaacccccttacttttacaattaatttttgtttattacgtcttaccaagtgtg
M R G T P L L L Q L I F V Y Y V L P S V ggtattacatttgaccgaatgcctgctgtgattctggcctttacgctcaactatgcggcc
G I T F D R M P A V I L A F T L N Y A A tatttctctgaaattttccgtggtggtattgaagctattccaaaaggtcagtatgaagct
Y F S E I F R G G I E A I P K G Q Y E A gctaaggtattgaaatttacccctgttcagaccattcgctacattgtcttaccacaggtt
A K V L K F T P V Q T I R Y I V L P Q V gtgaaaattgttctgccaagtgttttcaatgaagtcatgactttggtaaaggatacttct
V K I V L P S V F N E V M T L V K D T S ttggtctatgcacttggggttagcgatttgttgttggctagtcgtactgcggccaatcgt
L V Y A L G V S D L L L A S R T A A N R gatgccagcttggcacctatgtttatcgcaggtgcaatctacctattgatgatcggtgcg
D A S L A P M F I A G A I Y L L M I G A gtaacactgatttctaaacaagtagaaaagaaatttgattattatagatag
V T L I S K Q V E K K F D Y Y R -
SEQ ID NO:23 and 24 atgagtaagtataaaaaagtttatcaagatattaagaaaaaaatcgaagagcaggtttgg
M S K Y K K V Y Q D I K K K I E E Q V W tcaactggacaggccctaccgacagaaaatgaattaatggaagtgtattcctactccaag
S T G Q A L P T E N E L M E V Y S Y S K gacaccattcgcaaagcactatctcttcttgaaatggatggttatattcaaaagaaacag
D T I R K A L S L L E M D G Y I Q K K Q gggaaatcttctattgttatcgaacatggtctaatgaaggaccaatatctttctgaaatt
G K S S I V I E H G L M K D Q Y L S E I aaaacagcgggcgaattgaacaaaagatcacagcaccaaattcagacccagcttacttcg
K T A G E L N K R S Q H Q I Q T Q L T S ctttatattattcaaggtcaagaagatttaatgtcaactttcgaagttgatgataaggta
L Y I I Q G Q E D L M S T F E V D D K V gatttctatcgagtgagtcgggtacggacaattgacggtgagcggttggaatatgacatt
D F Y R V S R V R T I D G E R L E Y D I tcctattttgaccgtagggtcgtcccttatctcagcaaagaaattgccgaaagctctatt
S Y F D R R V V P Y L S K E I A E S S I taccgctacttagaagaagaactccatttaacaatttctcattccagacgtgaaatttcc
Y R Y L E E E L H L T I S H S R R E I S ttccgttttgcaaacgaagaagaaaaacaattgatggacttaggagactatgacatggtc
F R F A N E E E K Q L M D L G D Y D M V gtcgtggtcactagcatcacctatctttcaaatggtcaagctttccagtatggaacaatt
V V V T S I T Y L S N G Q A F Q Y G T I agttaccgtccagacaaagttagctttgtatcaatggcgaaacggtaa
S Y R P D K V S F V S M A K R -
Amino acid sequences for the S. suis genes were aligned with the homologous sequences identified in other streptococcal species. % identity and % similarity were calculated using BLASTP 2.2.6 [Tatusova TA and TL Madden, "BLAST 2 sequences- a new tool for comparing protein and nucleotide sequences." (1999) FEMS Microbiol Lett.174:247-250.], and are shown in Table 5.
Table 5. Homologues Identified in Other Streptococcal Species
The attenuated mutants were further evaluated by Southern blot analysis to verify that the mutation resulted from a single insertion of the pGh9:ISSl plasmid. DNA from each mutant was isolated as described previously and digested with the restriction enzyme HindIH (New England Biolabs; Beverly, MA) according to the manufacturer's suggested protocol. Digested DNA products were analyzed for completion of digestion via agarose electrophoresis and transferred to Hybond™-N+ nucleic acid transfer membrane (Amersham Biosciences; Piscataway, NJ). Separately, a probe containing a 0.6 kb fragment of ISSl was created by amplification of the DNA sequence from pGh9:ISSl as follows. The concentrations of PCR reagents per reaction were as described previously. The primers used were DEL-2456 and DEL-2403. Template consisted of 1 μl of pGh9:ISSl miniprep product. Thermocycling was performed as follows: 2 minutes at 94°C, 20 cycles of (30 seconds at 95°C, 1 minute at 55°C, 1.5 minutes at 72°C), 10 minutes at 72°C, and held at 4°C. The PCR product was analyzed via agarose gel electrophoresis, and a 0.6 kb band was excised from the gel. The DNA was eluted from the agarose slice using the QIAquick® Gel Extraction Kit according to the manufacturer's suggested protocol. The eluted 0.6 kb DNA product was DIG-labeled with the DIG-High Prime Kit according to the manufacturer's recommendations (Roche; Mannheim, Germany). The DIG-labeled ISSl fragment probe was hybridized to the Hmdm digested STM DNA and developed with colorimetric detection using NBT and BCIP. The resulting membrane was analyzed for determination of multiple insertions of pGh9:ISSl into the S. suis serotype 2 #R735 STM mutants.
Example 6. Murine Efficacy Model
S. suis serotype 2 #R735 STM mutants that were shown to be attenuated in the murine model and had, by Southern blot confirmation, a single insertion of pGh9:ISSl disrupting one open reading frame are to be further tested in mice for the ability to vaccinate against wild type. Briefly, approximately 1x10 CFU per dose of each mutant will be used to vaccinate a group of CF-I mice by intraperitoneal administration. A second vaccination may also be administered in the same manner. Approximately 3 weeks following the vaccination, mice will be challenged with IxIO9 CFU of the wildtype organism. After 7 days, mortality will be recorded and used to determine the vaccine efficacy.
Example 7. Porcine Screening of S. suis Serotype 2 #R735 STM Pools
The S. suis serotype 2 #R735 STM pools that were screened in mice will also be screened in a pig model. The frozen pools will be retrieved from -700C storage and refreshed as described above. Intravenous administration of freshly grown culture, at IxIO9 CFU/dose, will be given to CDCD (cesarean-derived, colostrum- deprived) pigs. After 24 hours post-administration, the pigs will be euthanized. Attempts will be made to recover the S. suis serotype 2 #R735 STM mutants from the blood, liver, spleen, lung, brain, and joints. Tissues will be macerated, and the fluid from these tissues as well as fluid collected in the joints will be plated on TH/Em05 agar plates, incubated overnight at 37°C with 5% CO2 . DNA from recovered mutants will be isolated as described above. Molecular analysis of input and recovered DNA will be performed using the with the Luminex xMAP technology (Luminex; Austin TX) as described above.
Example 8. Porcine Screening of Individual S. suis Serotype 2 Attenuated Mutants Potential attenuated mutants derived from the porcine screening of pools will be used to individually inoculate pigs either intravenously, intranasally, orally or intramuscularly. Mutants will be deemed attenuated if there is a reduction in mortality and/or clinical signs, as compared to inoculation with the wild-type S. suis organism. Example 9. Porcine Vaccine Efficacy Studies
S. suis mutants that show a reduction in virulence, as described above, will be evaluated for their ability to stimulate immunity against further infection by wild-type
S. suis. Animals will be vaccinated once or twice with an appropriate amount of each mutant through a desired route, preferably intramuscularly. Subsequently animals will be challenged with a wild-type strain of S. suis, along with unvaccinated controls. Mutants that afford a reduction in mortality and/or clinical signs, as compared to unvaccinated controls, will be deemed efficacious.
Numerous modifications and variations in the invention as set forth in the above illustrative examples are expected to occur to those skilled in the art. Consequently only such limitations as appear in the appended claims should be placed on the invention.