WO2006046352A1

WO2006046352A1 - Novel auxotrophic fission yeast

Info

Publication number: WO2006046352A1
Application number: PCT/JP2005/016039
Authority: WO
Inventors: Takayoshi Kuno; Reiko Sugiura; Mariko Saito; Atsushi Koike
Original assignee: The New Industry Research Organization
Priority date: 2004-10-25
Filing date: 2005-09-01
Publication date: 2006-05-04
Also published as: JPWO2006046352A1

Abstract

It is intended to provide an auxotrophic fission yeast wherein a novel auxotrophic marker gene has been mutated in a fission yeast (Schizosaccharomyces pombe). It is also intended to provide a vector to be used together with this auxotrophic fission yeast. An arginine or asparagine-requiring fission yeast is acquired and subjected to gene analysis. This auxotrophic fission yeast is formed by a mutation in fission yeast arg1+ gene (SPCC777.09c), fission yeast asn1+ gene (SPBC119.10) or fission yeast lys4+ gene (SPBC1105.02c). Thus, a vector usable with it can be constructed.

Description

Specification

New auxotrophic fission yeast

Technical field

[0001] The present invention relates to an auxotrophic fission yeast that does not grow on a minimal medium for fission yeast and can grow by adding arginine, asparagine, or lysine.

This application claims the priority of Japanese Patent Application Nos. 2004-310061 and 2005-005641, which are incorporated herein by reference.

Background art

[0003] Fission yeast (Schizosaccharomvces pombe) is a unicellular eukaryote in the shape of a cylinder, easy to cultivate in large quantities as a characteristic of microorganisms, and has a short intergenerational time. It is also known as a unicellular organism that is extremely easy to apply in the fields of genetics, molecular biology, and cell biology (Non-patent Document 1). Fission yeast is the single-cell model organism that is closest to humans and contains more than 100 human pathogenic genes, with the smallest number of genes possessed by the genome size of any organism that has been genome-decoded. Because of these advantages, fission yeast has long been very suitable for comprehensive gene analysis experiments, and many medically useful data have been obtained.

[0004] In genetic recombination technology, it can be used as a selection criterion for cloning a dieneticin resistance marker (Non-patent Document 2). However, selection with such a marker is not economical because an antibiotic must be added to the medium.

[0005] On the other hand, when an auxotrophic yeast that does not grow on a minimal medium for growing cells such as yeast using a nutrient marker as an index, it can be selected with the minimal medium and is therefore inexpensive. In order to select using this auxotrophic yeast, it is necessary to confirm the yeast nutrition marker. However, fission yeast has limitations in research and industrial production with fewer nutritional markers compared to commonly used budding fermented rice (Saccharomvces cerevisiae). The leul + and ura4 + genes are known as one of the nutritional markers for fission yeast used for gene transfer (Non-patent Document 3, Non-patent Document 4). In addition, there is adenine in the culture medium! / ヽ is known as a nutritional marker to add histidine, Since ade6 + is used for adenine to distinguish between haploid and diploid, and histidine is used for sex differentiation in yeast, there are limits to its use for gene transfer. In addition, many of the fission yeast auxotrophic strains caused by genes other than leul + have a slow growth rate compared to wild strains even in nutrient-rich media, which hinders practical use. It was.

[0006] Non-patent literature 1: Nasim A. et ai. Eds., Molecular biology of the nssion yeast, Academic Press, 1989

Non-Patent Document 2: J Bahler, et al., Yeast, Jul 1998; 14 (10): 943-51.

Non-Patent Document 3: Curr Genet. 1988 Oct; 14 (4): 375-9.

Non-Patent Document 4: Curr Genet. 1987; 12 (7): 527-34.

Disclosure of the invention

Problems to be solved by the invention

[0007] An object of the present invention is to provide a fission yeast having a novel nutritional marker in fission yeast (Schizosaccharomyces pombe) (hereinafter sometimes simply referred to as “S. pombej”). The problem is to provide a vector for use with the mutant fission yeast.

Means for solving the problem

[0008] The present inventors isolated three types of fission yeast mutants that grew on a nutrient-rich medium to the same extent as wild strains but could not grow on a minimal medium, and determined the causative gene. As a result, fission yeast having three types of novel nutrient markers, arginine requirement, asparagine requirement, and lysine requirement, was discovered. In addition, vectors that can be introduced into these auxotrophic fission yeasts could be constructed, and the present invention was completed.

That is, the present invention is as follows.

1. An auxotrophic fission yeast in which a novel nutritional marker gene of fission yeast is mutated.

2. An auxotrophic fission yeast mutated in genes related to ortin and Z or arginine biosynthesis.

3. Genbank accession number: AL031532 Asechiruo encoded by the nucleotide sequence set forth in Le - routine aminotransferase gene _(arg l + gene, SPCC777.09C) is § arginine auxotrophic fission yeast mutant. 4. An auxotrophic fission yeast mutated in genes related to asparagine biosynthesis.

5. Genbank accession number: Asparagine-requiring fission yeast mutated in the asparagine synthesis gene (asnl + gene, SPBC119.10) encoded by the nucleotide sequence described in AL022117

6. An auxotrophic fission yeast mutated in a gene related to lysine biosynthesis.

7. A lysine-requiring fission yeast mutated in the lysine synthesis gene (lys4 + gene, SPBC1105.02c) encoded by the nucleotide sequence described in Genbank accession number: AL096851.

8. A vector that can be introduced into fission yeast containing a novel nutritional marker gene for fission yeast.

9. A vector comprising the fission yeast argl + gene (SPCC777.09c) and capable of being introduced into fission yeast according to any one of items 1 to 3 above.

10. A vector comprising a budding yeast ARG8 gene (YOL140W) and capable of being introduced into fission yeast according to any one of 1 to 3 above.

11. A vector comprising a fission yeast asnl + gene (SPBC119.10) and capable of being introduced into the asparagine-requiring fission yeast according to any one of items 1, 4 and 5.

12. A vector comprising a budding yeast ASN1 gene (YPR145W) or an ASN2 gene (YGR124W) and capable of being introduced into fission yeast according to any one of items 1, 4 and 5.

13. A vector comprising a lys4 + gene (SPBC1105.02c) and capable of being introduced into a lysine-requiring fission yeast according to any one of 1, 6, or 7 above.

14. A transformant obtained by incorporating the vector according to item 9 or 10 into the fission yeast according to any one of items 1 to 3.

15. A transformant comprising the fission yeast according to any one of items 1, 4 and 5 incorporated with the vector of item 11 or 12 above.

16. A transformant comprising the fission yeast according to any one of items 1, 6 and 7 incorporated with the vector of item 13 above.

17. A method for producing a protein, comprising culturing the transformant according to any one of 14 to 16 above and collecting the expressed heterologous protein.

The invention's effect

Arginine-requiring fission yeast, asparagine-requiring fission yeast and lysine required for the present invention An auxotrophic yeast does not grow on a minimal medium, but can grow like wild-type fission yeast by adding arginine, asparagine or lysine. In addition, argl +, asnl + and lys4 + ii, which are found as marker genes according to the present invention, are comparatively small, less than 2 kilobases !, Bam HI, Pst I and the like, which are genes and restriction enzymes frequently used in subcloning. This is a very suitable marker gene for the site. That is, the auxotrophic fission yeast and marker gene of the present invention are excellent in that they can be easily used in protein production, gene analysis, and the like by gene recombination techniques.

Brief Description of Drawings

[Fig. 1] A diagram showing the phenotype of a mutant strain of fission yeast that grows in the same manner as wild-type strains on 13 nutrient-rich media but cannot grow on minimal media. (Example 1)

FIG. 2 is a diagram showing the phenotype of KP2101. (Example 2)

FIG. 3 shows the phenotype of mutant strains excluding KP2101. (Example 2)

FIG. 4 is a diagram showing the phenotype of KP2124. (Example 3)

FIG. 5 is a diagram of construction of an integration vector. (Example 4)

FIG. 6 shows that a vector containing Sadl-DsRED has been introduced into KP2101. (Example 4)

FIG. 7 shows the phenotype of KP2132. (Example 9)

Explanation of symbols

C fission yeast wild type HM123 strain

1 Fission yeast strain KP2101

2 Fission yeast strain KP2102

3 Fission yeast strain KP2104

4 Fission yeast strain KP2107

5 Fission yeast strain KP2108

6 Fission yeast strain KP2111

7 Fission yeast strain KP2114

8 Fission yeast strain KP2119

9 Fission yeast strain KP2121 10 Fission yeast strain KP2123

11 Fission yeast strain KP2124

12 Fission yeast strain KP2132

13 Fission yeast strain KP2149

BEST MODE FOR CARRYING OUT THE INVENTION

[0013] (Netrotrophic fission yeast)

The “auxotrophic fission yeast in which a novel nutritional marker gene is mutated” of the present invention refers to a fission yeast that does not grow on a minimal medium due to a variation in a nutritional marker gene that is different from a conventionally known nutritional marker gene. An example of a conventionally known auxotrophic fission fermentation mother is a leucine-requiring fission yeast in which the leul gene is mutated. The fission yeast does not grow on a minimal medium, but grows by adding leucine to the minimal medium. can do. As the minimal medium, known EMM medium (Edinburgh minimal medium medium: Gutz, H., heslot, Η, Leupold, U., ana Loprieno, N. (1974) in Handbook of Genetics (King, R. C, ed) , Vol. 1, pp. 395-446, Plenum, New York).

[0014] The "new nutritional marker gene" of the fission yeast of the present invention is a conventionally known nutritional marker gene in fission yeast, such as leul +, ura4 ⁺ , his2 ⁺ , his3 ⁺ , his7 ⁺ , adel +, ade6 + genes栄養 Nutrition marker gene of fission yeast except ヽぅ.

Specifically, the argl + gene (SPCC777.09C) related to the arginine nutrition marker, the asnl + gene (SPBC119.10) related to the assargine nutrition marker or the lys4 + gene (SPBC1105.02C) related to the lysine nutrition marker Each gene is said. The base sequence of the argl + gene (SPCC777.09c), which is the new nutritional force of the present invention, is Genbank accession number: AL031 532, the base sequence of the asnl + gene (SPBC119.10) is Genbank accession number: AL022117, The base sequence of the lys4 + gene (SPBCl 105.02c) is already known as Genbank accession number: AL096851.

[0015] A mutant strain of argl + gene, asnl + gene or lys4 + gene can be obtained by a method of obtaining a mutant strain or by artificially recombining an existing gene. Preferably, it can be obtained by a method of obtaining a mutant strain. For example, a mutant strain that grows in the same manner as a wild strain on a nutrient-rich medium but cannot grow on a minimal medium is screened. Can be obtained. Mutant strains are known methods such as Moreno S., Klar and Nurse P., (1991) Methods Enzymol. 194, p795-823 or The Journal of Biological Chemistry, vol. 275, No. 45, p35600_35606 (2000). Can be obtained by the method described in 1. above.

[0016] The argl + gene mutation that can be used in the present invention may be a mutation that loses the acetylylditin aminotransferase enzyme activity encoded by the argl + gene. However, in order to introduce an integration vector, Point mutation ability Complete deletion mutations are preferred for introducing plasmid vectors.

[0017] The mutation of the asnl + gene that can be used in the present invention may be a mutation that loses the asparagine synthase activity encoded by the asnl + gene. However, in order to introduce an integration vector, a point mutation may be used. A complete deletion mutation is preferred for introducing the vector.

[0018] The mutation of the lys4 + gene that can be used in the present invention may be a mutation that loses the lysine synthase activity encoded by the lys4 + gene. However, in order to introduce an integration vector, a point mutation is required. In order to introduce a plasmid vector, a complete deletion mutation is preferred.

[0019] (Vector that can be introduced into auxotrophic fission yeast)

In the present invention, it is possible to provide a fission yeast vector that can be introduced into an auxotrophic fission yeast in which the above-mentioned novel nutritional marker gene is mutated. For example, when a vector containing a normal argl + gene is introduced into an arginine-requiring fission yeast in which the argl + gene is mutated, a transformant capable of growing on a minimal medium without arginine can be obtained. By constructing a vector containing the novel vegetative marker gene of the present invention and introducing it into the auxotrophic fission yeast of the present invention, a transformant capable of growing in a minimal medium can be obtained. In the present invention, the vector that can be introduced into the auxotrophic fission yeast refers to a vector containing the novel nutritional marker gene of the present invention.

For example, when a vector containing a budding yeast nutrient marker gene is introduced into an auxotrophic fission mother, a transformant capable of growing on a minimal medium can be obtained. Therefore, vectors that can be introduced into the auxotrophic fission yeast of the present invention can further include vectors containing a budding yeast-derived nutrient marker gene. [0020] Nutritional marker genes that can be introduced into the auxotrophic fission yeast vector of the present invention include fission yeast argl + gene (SPCC777.09c), fission yeast asnl + gene (SPBC119.10), fission yeast lys4 + gene (SPBC1105. 02c). In addition, the ARG8 gene (YOL140W, Genbank accession number: Z74882) derived from the budding yeast gene as a nutritional marker gene that can be introduced into a vector for arginine-requiring fission yeast, is a vector for asparagine-requiring fission yeast. There is an ASN1 gene (YPR145W, Genbank accession number: Z48675) derived from the budding fermentation mother gene as a nutritional marker gene that can be introduced into ASN2 gene (YGR124W, Genbank accession number: Z72909). Furthermore, as a nutritional marker gene that can be introduced into a vector for lysine-requiring fission yeast, the LYS21 gene (YDL131W, Genbank accession number: Z74179) derived from the budding fermentation mother gene can be mentioned.

[0021] (Vector preparation method)

Vectors that can be introduced into auxotrophic fission yeast are essential for vectors such as MCS of known vectors with MCS (multi cloning site) such as BlueScript (Stratagene), replication origin, or antibiotic marker. It can be constructed by introducing each of the above-mentioned genes in a place other than the above sequence. The introduction of each gene can be carried out by normal operations after amplifying each gene by a known technique such as PCR.

For example, in order to construct a plasmid vector, an autonomous replicative sequence (ARS) may be introduced so that it can replicate autonomously in fission yeast. The integration vector is integrated into the fission yeast chromosome and grows with the fission yeast, so there is no need to introduce ARS.

The above vector can also be used as a shuttle vector by allowing the self-replicating sequence (ori) of Escherichia coli and the self-replicating sequence (ARS) of yeast to exist.

[0022] For example, by incorporating information on a protein to be synthesized into a vector containing the above-described nutritional marker gene and allowing it to grow in the auxotrophic fission yeast of the present invention, a desired protein can be synthesized in a minimal medium. it can.

Example

[0023] In the following, in order to make the understanding of the present invention more reliable, examples will be shown and described. Ming is not limited to these examples at all.

[Example 1] Construction of auxotrophic fission yeast

A fission yeast wild strain (haploid leucine-requiring yeast HM123 (h- leul)) is added to nutrient-rich YPD medium (1% yeast extract, 2% Peptone, 2% glucose) for 30 minutes, and the treated fission yeast was diluted with YPD medium so that the number of cells was 500-1000 per plate, and cultured in YPD medium. The obtained fission yeast colonies were prepared by adding 1 mg of leucine to 20 mL of YPD medium and EMM medium (Edinburgh minimal medium medium) as a minimal medium (hereinafter simply referred to as “EMM + leu medium”). Replicated to two media and cultured at 30 ° C for 2 days. Ability to grow on YPD medium We obtained 23 strains that did not grow on EMM + leu medium. In order to exclude these adenine, uracil, and histidine-requiring strains, these were added to the medium and examined for their growth. Six of these strains grew when histidine was added to the medium. I found out that Next, genetic loci were determined by random spore analysis. For convenience, mutant strains are managed by serial number KP (abbreviation of Kobe pombe), but analysis revealed that KP2104, KP2113, and KP2117 have mutations at the same gene locus. In other words, out of the remaining 17 strains, a total of 15 strains, excluding 2 strains that joined together, were classified into the following 13 different loci groups (KP2101, KP2102, KP2104, KP2107, KP2108, KP2111, KP2114). , KP2119, KP2121, KP2123, KP2124, KP2132 and KP2149).

[Example 2] Arginine-requiring fission yeast

1) Confirmation of mutation position

Among the 13 mutant strains obtained in Example 1, the position of the mutation was confirmed for KP2101 strain fission yeast (hereinafter simply referred to as “ΚΡ2101”).

The plasmid was also isolated by transforming yeast strains that were transformed into KP2101 and were able to grow on a minimal medium. The plasmid was digested with the restriction enzyme Hind III and shortened, and further introduced into KP2101 for transformation. Subsequently, a plasmid was isolated from a transformant yeast that had become capable of growing in a minimal medium, sequenced PCR was performed using the plasmid DNA as a saddle, and the nucleotide sequence was determined by sequencing. It turned out to be a fragment. Among the introduced genes, only the argl + gene (S PCC777.09c), which is a gene related to acetylol-tin aminotransferase, is related to auxotrophy. Again, only argl + was amplified by PCR and introduced into KP2101, allowing growth in a minimal medium (Fig. 2).

As a result, it was confirmed that KP2101 has a mutation in the argl + gene (SPCC777.09c), which is a gene related to acetylol-tin aminotransferase. KP2101 was deposited with the National Institute of Advanced Industrial Science and Technology Patent Biological Deposit Center (T305-8566 Ibaraki Pref. 1-1-1 Chuo No. 6) (International Receipt No. FERM ABP-10359).

[0026] The following primers were used to amplify the argl + gene by PCR. (SEQ ID NO: 1)

argl antisense (Oligo 770) AAACTGCAGGATCCATTCAATGACCAAGTC (SEQ ID NO: 2)

[0027] 2) Confirmation of arginine requirement

Since KP2101 was confirmed to have a mutated argl + gene, growth was observed when cultured in EMM + leu + arg medium supplemented with 1 mg of arginine in 20 mL of EMM + leu medium. KP2101 did not grow on EMM + leu medium, whereas it grew on EMM + leu + arg medium, confirming that it was an arginine-requiring fission yeast. This confirmed that the argl + gene (SPCC777.09C) is a novel nutritional marker for fission yeast.

Similarly, as a result of confirming the auxotrophic fission yeast obtained in Example 1 by streak, the KP2104 strain, KP2107 strain, KP2108 strain, KP2119 strain, KP2121 strain, KP2119 strain, KP2123 strain, KP2149 strain were arginine auxotrophic. It was confirmed that it was a fission yeast (Fig. 3). However, since these did not work with mutations in the argl + gene, it seemed that other arginine synthases had mutations.

[0028] (Example 3) Asparagine-requiring fission yeast

1) Confirmation of mutation position

Of the auxotrophic fission yeast obtained in Example 1, KP2124 strain fission yeast (hereinafter simply referred to as “ It is called KP2124J. ) For the position of the mutation.

Similar to the confirmation of the position of the mutation in Example 2, KP2124 was transformed with a genomic library, and a transformant yeast power plasmid that became capable of growing in a minimal medium was isolated. The plasmid was shortened by digestion with the restriction enzyme Hind III, further introduced into KP2124, and transformed. After that, a transformant yeast power plasmid that was able to grow on the minimum medium was isolated, and the PCR was performed using the plasmid DNA as a cocoon, and the nucleotide sequence was determined by sequencing. As a result, a fragment containing multiple genes was obtained. That happened. Among the introduced genes, only the asnl + gene (SPBC119.10), which is a gene related to asparagine biosynthetic enzyme, is related to auxotrophy. Again, only the asnl + gene was amplified by PCR and introduced into KP2124, allowing growth on a minimal medium.

As a result, it was confirmed that KP2124 has a mutation in the asnl + gene (SPB C119.10), a gene related to asparagine biosynthetic enzyme. KP2124 was deposited at the National Institute of Advanced Industrial Science and Technology, Patent Biological Deposit Center (Chuo 6-1-1, Tsukuba, Ibaraki Prefecture, 1-16-1) (International Receipt No. FERM ABP-10358).

[0029] In order to amplify the asnl + gene by PCR, the following primers were used.

asnl sense (Oligo 815) CGGGATCCTGAACTGATTGTTGGCTCAG (SEQ ID NO: 3) No. 4)

[0030] 2) Confirmation of asparagine requirement

Similarly, as for KP2124 obtained in Examples 1 and 2, it was confirmed that the asnl + gene of asparagine biosynthetic enzyme was mutated, so EMM + 1 mg of asparagine was added to 20 mL of EMM + leu medium. Growth was observed when cultured in + leu + asn medium (Fig. 4). KP2124 did not grow on EMM + leu medium, but grew on EMM + leu + asn medium, confirming that it was a fission yeast requiring asparagine. This confirmed that the asparagine biosynthetic enzyme-related gene identified this time was a novel nutritional marker for fission yeast.

(Example 4) Construction of a vector containing argl + gene (SPCC777.09c) and confirmation thereof 1) The BamH I restriction enzyme site of the argl + gene with both ends is amplified by PCR and introduced into the Bgl II restriction enzyme site at the fl origin of the BlueScript plasmid (Stratagene). A Chillon vector was constructed.

2) Confirmation

Sadl-DsRED, a marker emitting red fluorescence, was introduced into the BlueScript multicloning site in the integration plasmid constructed in 1) above. The vector containing Sadl-Ds RED was introduced into KP2101, and it was confirmed whether the integration vector could function with KP2101. Sadl-DsRED is a well-known Sadl-DsRED constructed by fusing a gene localized at a point on the nuclear membrane called Sadl with a marker emitting red fluorescence called DsRED.

The chromosome of KP2101 into which an integration vector containing Sadl-DsRED was introduced was confirmed by Southern blotting. As a result, the chromosome into which the integration vector was introduced was observed at a position having a higher molecular weight than the chromosome of the wild-type fission yeast because Sadl-DsRED was introduced.

Next, KP2101 in which the introduction of the integration vector was confirmed was observed with a microscope. As a result, a protein in which DsRED was fused to the introduced Sadl gene product was produced, and the dots on the nuclear membrane were stained red. As it was easy to confirm that SacQ-DsRED was present on the nuclear membrane, the nucleus was further stained blue with Hoechst staining. The result is shown in FIG.

This suggests that the wild-type argl + gene on the integration vector had undergone homologous recombination with the argl mutant gene on the KP2101 chromosome, and was incorporated into the KP2101 chromosome together with Sadl-DsRED.

(Example 5) Construction of a vector containing the budding yeast ARG8 gene (YOL140W)

Similar to the method described in Example 4, the budding yeast ARG8 gene was amplified by PCR using the budding yeast chromosomal DNA as a saddle, and introduced into the Nae I restriction enzyme site at the fl origin of the BlueScript plasmid (Stratagene). An integration vector was constructed.

The following primers were used to amplify the ARG8 gene by PCR.

ARG8 sense (Oligo 783) GCTCCAGCACCCCTTATTTC (SEQ ID NO: 5)

ARG8 antisense (Oligo 811) GGAATTCTTAAGCGTAAACCGCTTC (SEQ ID NO: 6) (Example 6) Construction of a fission yeast vector containing the asnl + gene (SPBC119.10) In the same manner as in Example 4, the BamHI restriction enzyme sites of the _aS nl ⁺ gene were attached to both ends. The digested product was amplified by PCR and introduced into the Bgl II restriction enzyme site at the fl origin of the BlueScript plasmid (Stratagene) to construct an integration vector.

(Example 7) Construction of a vector for fission yeast containing the budding yeast ASN1 gene (YPR145W) In the same manner as in Example 4, the budding yeast ASN1 gene was amplified by PCR using budding yeast chromosomal DNA as a saddle type. Then, it was introduced into the Bgl Π restriction enzyme site at the fl origin of BlueScript plasmid (Stratagene) to construct an integration vector.

The following primers were used to amplify the above ASN1 gene by PCR. ASN1 sense gCgCATTTATAgATACgCATATATAACCC (SEQ ID NO: 7) ASN1 antisense CTATAAAAATATCTATAAgATTAATCC (SEQ ID NO: 8) [0035] (Experimental example 8) Construction of a vector for fission yeast ASN2 gene (YGR124W) As in the method described in Example 4, Saccharomyces cerevisiae ASN2 gene was amplified by PCR using budding yeast chromosomal DNA as a saddle, and introduced into the Nae I restriction enzyme site at the fl origin of the BlueScript plasmid (Stratagene) to construct an integration vector.

The following primers were used to amplify the ASN2 gene by PCR. ASN2 sense gggTgCCgCACggCgCgggTTTTTgC (SEQ ID NO: 9)

ASN2 antisense CCgTTTgTATCACCgCATTTCTTggTTC (SEQ ID NO: 10)

[Example 9] Lysine-requiring fission yeast

1) Confirmation of mutation position

Among the 13 mutant strains obtained in Example 1, the position of the mutation was confirmed for KP2132 strain fission yeast (hereinafter simply referred to as “KP2 132”).

A plasmid was also isolated from the transformed yeast strain that was transformed into KP2132 and became capable of growing in a minimal medium. The plasmid was digested with the restriction enzyme Hind III and shortened, and further introduced into KP2132 for transformation. Subsequently, a plasmid was isolated from a transformant yeast that had become capable of growing in a minimal medium, sequenced PCR was performed using the plasmid DNA as a saddle, and the nucleotide sequence was determined by sequencing. I found out that Among the introduced genes, it is related to auxotrophy The lys4 + gene (SPBC1105.02c), which is a gene related to lysine synthase. As a result, it was confirmed that KP2132 has a mutation in the lys4 + gene (SPBC1105.02c). KP2132 was deposited at the National Institute of Advanced Industrial Science and Technology, Patent Biological Deposit Center (Chuo 6-1-1, Tsukuba 1-1-1, Tsukuba, Ibaraki Prefecture) (International receipt number receipt number FERM ABP-10373).

[0037] The following primers were used to amplify the lys4 + gene by PCR.

lys4 sense (oligo) CGGGATCCACTTCCAATTTAAGCAGACGCTTC (sequence number 11)

lys4 antisense (oligo) CGGGATCCATACATACGTGCATCCTTGCTC (sequence number 12)

[0038] 2) Confirmation of lysine requirement

Since KP2132 was confirmed to have a lys4 + gene mutation, growth was observed when cultured in EMM + leu + lys medium supplemented with 1 mg of lysine in 20 mL of EMM + leu medium (Fig. 7). ). KP2132 did not grow on EMM + leu medium, but grew on EMM + leu + lys medium, confirming that it was an arginine-requiring fission yeast. This confirmed that the lys4 + gene (SPBC1105.02c) is a novel nutritional marker for fission yeast.

(Example 10) Construction of a vector containing lys4 + gene (SPBC1105.02c) and confirmation thereof

Similar to the method described in Example 4, the BlyH restriction enzyme site of the lys4 + gene was amplified by PCR, and the Bgl II restriction at the fl origin of the BlueScript plasmid (Stratagene) was amplified. An integration vector was constructed by introducing into the enzyme site.

Industrial applicability

[0040] As described above, when an auxotrophic strain by mutation of the novel nutritional marker gene of the present invention is used, proteins and the like can be synthesized by genetic recombination using an inexpensive minimal medium. In addition, by replacing the gene to be analyzed with the nutrient marker gene for the gene disruption technique, the function of the disrupted gene can be confirmed. These auxotrophic fission yeasts can be used for industrial production because they are easy to store and grow. Copy on paper (Caution Electronic data is the original)

The papers in the list do not form part of the international output and are not counted in the number of papers for international applications]

Replacement bowl (Rule 26) 6039

15 Paper copy (as electronic data is the original)

[This form constitutes part of the international appearance ¾ and is not included in the number of papers for international applications]

-4 This form was accepted along with the international application

(Yes, No>

-4-1 Authorized staff

-5 Date when this form was received by the International Bureau

-5-1 Authorized staff

Replacement paper (Rule 26)

Claims

The scope of the claims

[I] An auxotrophic fission yeast in which a novel nutritional marker gene of fission yeast is mutated.

[2] An auxotrophic fission fermentation mutated in genes related to ornithine and / or arginine biosynthesis.

[3] Genbank accession number: Arginine-requiring fission yeast mutated in a ~ i thioleonore nitrin aminotransferase gene (argl ⁺ gene, SPCC777.09C) encoded by the nucleotide sequence described in AL031532.

[4] An auxotrophic fission yeast in which a gene related to asparagine biosynthesis is mutated.

[5] Genbank accession number: Asparagine-requiring fission yeast in which the asparagine synthetic herb (asnl ⁺ gene, SPBC119.10) encoded by the nucleotide sequence described in AL022117 is mutated.

[6] An auxotrophic fission yeast with a mutated gene related to lysine biosynthesis.

[7] A lysine-requiring fission yeast in which the lysine synthetic gene (lys4 ⁺ gene, SPBC1105.02c) encoded by the nucleotide sequence described in Genbank accession number: AL096851 is mutated.

[8] A vector that can be introduced into fission yeast containing a novel nutritional marker gene for fission yeast.

[9] A vector comprising the fission yeast argl ⁺ gene (SPCC777.09c) and capable of being introduced into fission yeast according to claims 1 to 3 in claim 1 (3).

[10] The vector which also contains the budding yeast ARG8 gene (YOL140W) and can be introduced into fission yeast according to any one of claims 1 to 3.

[II] A vector comprising a fission yeast asnl + gene (SPBC119.10) and capable of being introduced into the asparagine-requiring fission yeast according to any one of claims 1, 4 or 5.

[12] Saccharomyces cerevisiae ASN1 gene (YPR145W) or ¾ASN2 gene (YGR124W) is included, and claims 1 or 4 or 5! /, Vector that can be introduced into fission yeast according to any one of

[13] A vector comprising a fission yeast lys4 + gene (SPBC1105.02c) and capable of being introduced into a lysine-requiring fission yeast according to claim 1, 6 or 7, V, or any one of the above.

[14] A transformant obtained by incorporating the vector according to claim 9 or 10 into the fission yeast according to any one of claims 1 to 3.

[15] Claims to the fission fermentation * as described in any one of claims 1, 4 or 5

Replacement paper (Rule 2S) A transformant incorporating the vector according to item 11 or 12.

[16] A transformant obtained by incorporating the vector according to claim 13 into the fission yeast according to any one of claims 1, 6, or 7.

[17] A method for producing a protein, comprising culturing the transformant according to any one of claims 14 to 16 and collecting the expressed heterologous protein.

Replacement paper (Rule 26)