WO2006037960A2 - T-cell receptors containing a non-native disulfide interchain bond linked to therapeutic agents - Google Patents

T-cell receptors containing a non-native disulfide interchain bond linked to therapeutic agents Download PDF

Info

Publication number
WO2006037960A2
WO2006037960A2 PCT/GB2005/003752 GB2005003752W WO2006037960A2 WO 2006037960 A2 WO2006037960 A2 WO 2006037960A2 GB 2005003752 W GB2005003752 W GB 2005003752W WO 2006037960 A2 WO2006037960 A2 WO 2006037960A2
Authority
WO
WIPO (PCT)
Prior art keywords
antibody
tcr
therapeutic agent
gly
chain
Prior art date
Application number
PCT/GB2005/003752
Other languages
French (fr)
Other versions
WO2006037960A3 (en
Inventor
Bent Karsten Jakobsen
Torben Bent Andersen
Original Assignee
Avidex Ltd.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from GBGB0421836.8A external-priority patent/GB0421836D0/en
Priority claimed from GB0427584A external-priority patent/GB0427584D0/en
Application filed by Avidex Ltd. filed Critical Avidex Ltd.
Priority to CA002582963A priority Critical patent/CA2582963A1/en
Priority to EP05787358A priority patent/EP1809669A2/en
Priority to AU2005291039A priority patent/AU2005291039A1/en
Priority to MX2007003910A priority patent/MX2007003910A/en
Priority to JP2007534081A priority patent/JP2008514685A/en
Publication of WO2006037960A2 publication Critical patent/WO2006037960A2/en
Publication of WO2006037960A3 publication Critical patent/WO2006037960A3/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503—Immunoglobulin superfamily
    • C07K14/7051—T-cell receptor (TcR)-CD3 complex
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
    • A61K47/64—Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
    • A61K47/6425—Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent the peptide or protein in the drug conjugate being a receptor, e.g. CD4, a cell surface antigen, i.e. not a peptide ligand targeting the antigen, or a cell surface determinant, i.e. a part of the surface of a cell
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00—Drugs for disorders of the respiratory system
    • A61P11/06—Antiasthmatics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00—Drugs for disorders of the urinary system
    • A61P13/12—Drugs for disorders of the urinary system of the kidneys
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00—Drugs for disorders of the muscular or neuromuscular system
    • A61P21/04—Drugs for disorders of the muscular or neuromuscular system for myasthenia gravis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00—Drugs for disorders of the senses
    • A61P27/02—Ophthalmic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00—Drugs for disorders of the blood or the extracellular fluid
    • A61P7/02—Antithrombotic agents; Anticoagulants; Platelet aggregation inhibitors
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00—Drugs for disorders of the blood or the extracellular fluid
    • A61P7/06—Antianaemics
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide

Definitions

  • T cell receptors containing a non-native disulfide interchain bond linked to therapeutic agents include T cell receptors containing a non-native disulfide interchain bond linked to therapeutic agents
  • the present invention relates to T cell receptors (TCRs) containing a non-native disulphide interchain, bond associated with therapeutic agents.
  • novel TCR therapeutic combinations disclosed herein will be of use in the treatment of autoimmune disease, organ rejection, Graft Versus Host Disease (GVHD) and cancer.
  • the TCR portion of the TCR therapeutic agent combinations disclosed herein are targeting moieties.
  • This invention makes available for the first time a dimeric TCR (dTCR) or single- chain TCR (scTCR) associated with a therapeutic agent, wherein said agent is selected from IL-I, IL- l ⁇ , IL-3, IL-4, IL-5, IL-6, IL-7, IL-10, IL-I l, IL-12, IL-13, IL- 15, IL-21, IL-23, TGF- ⁇ , IFN- ⁇ , Lymphotoxin, TNF ⁇ , Anti-CD2 antibody, Anti- CD3 antibody, Anti-CD4 antibody, Anti-CD8 antibody, Anti-CD44 antibody, Anti- CD45RA antibody, Anti-CD45RB antibody, Anti-CD45RO antibody, Anti-Thy 1.2 antibody, Antilympliocyte globulin, Anti- ⁇ TCR antibody, Anti- ⁇ TCR antibody, Anti-CD49a antibody, Anti-CD49b antibody, Anti-CD49c antibody, Anti-CD49d antibody, Anti-CD49e antibody, Anti-CD49f antibody,
  • TCR comprises a first segment constituted by an amino acid sequence corresponding to a T
  • the present invention provides a dimeric TCR (dTCR) or single-chain TCR (scTCIR) associated with a therapeutic agent, wherein said agent selected from one of IL-I, IL- l ⁇ , IL-3, IL-4, IL-5, IL-6, IL-7, IL-10, IL-Il, IL-12, IL-13, IL-15, IL-21, IL-23, TGF- ⁇ , IFN- ⁇ , Lymphotoxin, TNF ⁇ , Anti-CD2 antibody, Anti-CD3 antibody, Anti-CD4 antibody, Anti-CD8 antibody, Anti-CD44 antibody, Anti-CD45RA antibody, Anti- CD45RB antibody, Anti-CD45RO antibody, Anti-Thy 1.2 antibody, Antilymphocyte globulin, Anti- ⁇ TCR antibody, Anti- ⁇ TCR antibody, Anti-CD49a antibody, Anti- CD49b antibody, Anti-CD49c antibody, Anti-CD49d antibody, Anti-CD49e antibody, Anti-CD49f antibody, Anti-TCR
  • Immunomodulators (Linomide, Ling-zhi-8, D-Glucan, Multi-functional protein 14, Ciamexon, Cholera toxin B, Vanadate or Vitamin D3 analogue, small molecule CD80 inhibitors, Androgens, IGF-I, Immunomanipulation (Natural antibodies), Lupus idiotype, Lipopolysaccaride), Sulfatide, Bee venom, Kampo formulation, Silica, Ganglioside, Antiasialo GM-I antibody, Hyaluronidase, Concanavalin A, Anti-Class I MHC antibody, or Anti-Class II MHC antibody, Cyclosporin, FK-506, Azathioprine, Rapamycin or Deoxyspergualin, PE38 Pseudomonas exotoxin, or a functional variant or fragment of any of the foregoing, and wherein said TCR comprises a first segment constituted by an amino acid sequence corresponding to a TCR ⁇ chain variable domain sequence fused to the
  • a dimeric TCR (dTCR) or single-chain TCR (scTCR) associated with an therapeutic agent is understood to refer to a TCR covalently or otherwise linked to an therapeutic agent.
  • the therapeutic agent may either be directly linked to the TCR, or indirectly via a linker moiety.
  • the term "functional variant” is understood to refer to analogues of the disclosed therapeutic agents which have the same therapeutic effect.
  • Such trivial variants are included in the scope of this invention.
  • Antibody fragments and variants/analogues which are suitable for use in the compositions and methods described herein include, but are not limited to, the following.
  • Minibodies - These constructs consist of antibodies with a truncated Fc portion. As such they retain the complete binding domains of the antibody from which are derived.
  • Fab fragments These comprise a single immunoglobulin light chain covalently- linked to part of an immunoglobulin heavy chain. As such, Fab fragments comprise a single antigen combining site. Fab fragments are defined by the portion of an IgG that can be liberated by treatment with papain. Such fragments are commonly produced via recombinant DNA techniques. (Reeves et ah, (2000) Lecture Notes on Immunology (4th Edition) Published by Blackwell Science)
  • F(ab') 2 fragments comprise both antigen combining sites and the hinge region from a single antibody.
  • F(ab') 2 fragments are defined by the portion of an IgG that can be liberated by treatment with pepsin. Such fragments are commonly produced via recombinant DNA techniques. (Reeves et al, (2000) Lecture Notes on Immunology (4tth Edition) Published by Blackwell Science)
  • Fv fragments - comprise an immunoglobulin variable heavy domain linked to an immunoglobulin variable light domain.
  • Fv designs have been produced. These include dsFvs, in which the association between the two domains is enhanced by an introduced disulfide bond.
  • scFVs can be formed using a peptide linker to bind the two domains together as a single polypeptide.
  • Fvs constructs containing a variable domain of a heavy or light immunoglobulin chain associated to the variable and constant domain of the corresponding immunoglobulin heavy or light chain have also been produced. FV have also been multimerised to form diabodies and triabodies (Maynard et al., (2000) Annu Rev Biomed Eng 2 339-376)
  • NanobodiesTM - These constructs comprise synthetic single immunoglobulin variable heavy domain derived from a camelid (e.g. camel or llama) antibody.
  • Domantis (Belgium) comprise an affinity matured single immunoglobulin variable heavy domain or immunoglobulin variable light domain.
  • the defining functional characteristic of antibodies in the context of the present invention is their ability to bind specifically to a target ligand. As is known to those skilled in the art it is possible to engineer such binding characteristics into a range of other proteins.
  • Examples of antibody variants and analogues suitable for use in the compositions and methods of the present invention include, but are not limited to, the following.
  • Protein scaffold-based binding polypeptides - This family of binding constructs comprise mutated analogues of proteins which contain native binding loops.
  • Affibodies marketed by Affibody (Sweden), which are based on a three-helix motif derived from one of the IgG binding domains of Staphylococcus aureus Protein A.
  • Evibodies marketed by EvoGenix (Australia) which are based on the extracellular domains of CTLA-4into which domains similar to antibody binding loops are grafted.
  • Cytokine Traps marketed by Regeneron Pharmaceuticals (US), graft cytokine receptor domains into antibody scaffolds.
  • anti-CD3 antibodies can be raised to any of the polypeptide chains from which this complex is formed (i.e. ⁇ , ⁇ , ⁇ , ⁇ , and ⁇ CD3 chains)
  • Antibodies which bind to the ⁇ CD3 chain are the preferred anti-CD3 antibodies for use in the compositions and methods of the present invention.
  • Another aspect of the invention provides a dTCR or scTCR associated with a therapeutic agent, wherein the therapeutic agent is selected from IL-I, IL- l ⁇ , IL-3, IL-5, IL-6, IL-7, IL-Il, IL-12, TGF- ⁇ , Lymphotoxin, TNF ⁇ , Anti-CD2 antibody, Anti-CD4 antibody, Anti-CD8 antibody, Anti-CD44 antibody, Anti-CD45RA antibody, Anti-CD45RB antibody, Anti-CD45RO antibody, Anti-Thy 1.2 antibody, Antilymphocyte globulin, Anti- ⁇ TCR antibody, Anti- ⁇ TCR antibody, Anti-CD49a antibody, Anti-CD49b antibody, Anti-CD49c antibody, Anti-CD49d antibody, Anti- CD49e antibody, Anti-CD49f antibody, Anti-TCR V ⁇ 8 antibody, Anti-CD 16 antibody, Anti-CD28 antibody, CTLA-4-Ig, Anti-B7.2 antibody, Anti-CD40L antibody, Anti-ICAM-1 antibody, ICAM
  • Anti-T cell antibodies or functional fragments or variants/analogues thereof which bind epitopes presented only by T cells or Natural Killer (NK) cells.
  • NK Natural Killer
  • T cells and/or NK cells are targeted by the majority of the above antibodies. Only anti-CD3 antibodies will target all NK cells and T cells.
  • Such antibodies linked to a soluble TCR to form a bifunctional composition of the invention, will cause T cells and/or NK cells to be localised to the cells expressing the cognate peptide-MHC ligand for the soluble TCR. Without wishing to be limited by theory, the binding of these antibodies to the T cells or NK cells may cause these cells to be activated.
  • Another aspect of the invention provides a dTCR or scTCR associated with a therapeutic agent selected from IL-IO, IL-4 or IL-13 or a functional variant or fragment of any of the foregoing.
  • the dTCR or scTCR is tissue-specific.
  • the dTCR or scTCR is specific for a tissue which is a target for auto-reactive T cells in autoimmune disease, organ rejection or Graft Versus Host Disease (GVHD).
  • GVHD Graft Versus Host Disease
  • the dTCR or scTCR islet cell-specific.
  • the NY8.3 T cell clone is specific for a glucose-6-phosphatase catalytic subunit-related protein (IGRP)-derived peptide presented by the murine H2-K d MHC and the G9C8 T cell clone is specific for an insulin-derived peptide presented by the murine H2-K d MHC.
  • IGRP glucose-6-phosphatase catalytic subunit-related protein
  • a fuxther aspect of the invention provides a dTCR or scTCR associated with a therapeutic agent, wherein the therapeutic agent is selected from IL-15, IL-21, IL-23, PE38 Pseudomonas exotoxin, IFN- ⁇ or Anti-CD3 antibody or a functional variant or fragment of any of the foregoing.
  • the TCR associated with a therapeutic agent is a dTCR. In an alternative aspect of the invention the TCR associated with a therapeutic agent is a scTCR.
  • TCR linker There are two classes of linker that are preferred for the association of TCRs and therapeutic agents of the present invention.
  • a TCR of the invention in which the TCR is linked by a polyalkylene glycol chain to the therapeutic agent provides one embodiment of the present aspect.
  • Peptidic linkers are the other class of TCR linkers. These two classes of linker are discussed in detail below in relation to their use in the formation of TCR multimers.
  • Example 6 herein provides two examples of peptidic linkers which may be used to form the association between the TCR and therapeutic agent. As is known to those skilled in the art a variety of peptide linkers may be suitable to link the TCR ⁇ chains to the required therapeutic agents. The following are additional examples linker sequences which may be used for this purpose
  • ggcggtccg which encodes a Gly-Gly-Pro linker.
  • cccggg which encodes a Pro-Gly linker including a Xmal restriction enzyme site
  • the TCR portions of the TCR therapeutic agent combinations disclosed herein are targeting moieties.
  • the TCRs of the invention target TCR ligands such as peptide-MHC or CDl -antigen complexes. As such, it would be desirable if these TCR had a higher affinity and/or a slower off-rate for the TCR ligands than native TCRs specific for that ligand.
  • the inventors co-ending application WO 2004/044004 details methods of producing TCR having a higher affinity and/or a slower off-rate for the TCR ligand than native TCRs specific for that ligand.
  • the affinity (K D ) of the TCR for the TCR ligand is higher than 1 ⁇ M, and/or the off-rate (ko FF ) is slower than 1 x 10 "3 S "1 . More preferably, the affinity (K D ) of the TCR for the TCR ligand is higher than 1OnM, and/or the off-rate (k off ) is slower than 1 x 10 "4 S "1 . Most preferably, the affinity (K D ) of the TCR for the TCR ligand is higher than InM, and/or the off-rate (k off ) is slower than 1 x 10 "5 S " .
  • the affinity (K D ) and/or off-rate (k Off ) measurement can be made by any of the known methods.
  • a preferred method is the Surface Plasmon Resonance (Biacore) method of Example 3.
  • the TCRs of the invention are in the form of either single chain TCRs (scTCRs) or dimeric TCRs (dTCRs) as described in WO 04/033685 and WO 03/020763.
  • a suitable scTCR form comprises a first segment constituted by an amino acid sequence corresponding to a TCR ⁇ chain variable domain, a second segment constituted by an amino acid sequence corresponding to a TCR ⁇ chain variable domain sequence fused to the N terminus of an amino acid sequence corresponding to a TCR ⁇ chain constant domain extracellular sequence, and a linker sequence linking the C terminus of the first segment to the N terminus of the second segment.
  • the first segment may be constituted by an amino acid sequence corresponding to a TCR ⁇ chain variable domain
  • the second segment may be constituted by an amino acid sequence corresponding to a TCR ⁇ chain variable domain sequence fused to the N terminus of an amino acid sequence corresponding to a TCR ⁇ chain constant domain extracellular sequence
  • the first segment may be constituted by an amino acid sequence corresponding to a TCR ⁇ chain variable domain sequence fused to the N terminus of an amino acid sequence corresponding to a TCR ⁇ chain constant domain extracellular sequence
  • the second segment may be constituted by an amino acid sequence corresponding to a TCR ⁇ chain variable domain fused to the N terminus of an amino acid sequence corresponding to TCR ⁇ chain constant domain extracellular sequence
  • a disulfide bond may be provided between the first and second chains, said disulfide bond being one which has no equivalent in native ⁇ T cell receptors.
  • the linker sequence may link the C terminus of the first segment to the N terminus of the second segment, and may have the formula -PGGG- (SGGGG) 5 -P- (SEQ ID NO: 1) or -PGGG-(SGGGG) 6 -P- (SEQ ID NO: 2) wherein P is proline, G is glycine and S is serine.
  • a suitable dTCR form of the TCRs of the present invention comprises a first polypeptide wherein a sequence corresponding to a TCR ⁇ chain variable domain sequence is fused to the N terminus of a sequence corresponding to a TCR ⁇ chain constant domain extracellular sequence, and a second polypeptide wherein a sequence corresponding to a TCR ⁇ chain variable domain sequence fused to the N terminus a sequence corresponding to a TCR ⁇ chain constant domain extracellular sequence, the first and second polypeptides being linked by a disulfide bond which has no equivalent in native ⁇ T cell receptors.
  • the first polypeptide may comprise a TCR ⁇ chain variable domain sequence is fused to the N terminus of a sequence corresponding to a TCR ⁇ chain constant domain extracellular sequence, and a second polypeptide wherein a sequence corresponding to a TCR ⁇ chain variable domain sequence is fused to the N terminus a sequence corresponding to a TCR ⁇ chain constant domain extracellular sequence, the first and second polypeptides being linked by a disulfide bond between cysteine residues substituted for Thr 48 of exon 1 of TRAC*01 and Ser 57 of exon 1 of TRBC1*O1 or TRBC2*01 or the non-human equivalent thereof.
  • TR-AC etc. nomenclature herein as per T cell receptor Factsbook, (2001) LeFranc and LeFranc, Academic Press, ISBN 0-12-441352-8)
  • the dTCR or scTCR form of the TCRs of the invention may have amino acid sequences corresponding to human ⁇ TCR extracellular constant and variable domain sequences, and a disulfide bond may link amino acid residues of the said constant domain sequences, which disulfide bond has no equivalent in native TCRs.
  • the disulfide bond is between cysteine residues corresponding to amino acid residues whose ⁇ carbon atoms are less than 0.6 nm apart in native TCRs, for example between cysteine residues substituted for Thr 48 of exon 1 of THAC*01 and Ser 57 of exon 1 of TRBCl*01 or TRBC2*01 or the non-human equivalent thereof.
  • Other sites where cysteines can be introduced to form the disulfide bond are the following residues in exon 1 of TRAC*01 for the TCR ⁇ chain and TRBCl*01 or TRBC2*01 for the TCR ⁇ chain:
  • the dTCR_ or scTCR form of the TCRs of the invention may include a disulfide bond between residues corresponding to those linked by a disulfide bond in native TCRs.
  • the dTCR or scTCR form of the TCRs of the invention preferably does not contain a sequence corresponding to transmembrane or cytoplasmic sequences of native TCRs.
  • One embodiment of the invention provides a TCR associated with a therapeutic agent, wherein said therapeutic agent is a PE38 exotoxin.
  • PE38 exotoxin is a truncated form of a Pseudomonas exotoxin.
  • the native polypeptide is a 66kDa protein consisting of domains IA, II, IB and III.
  • the PE38 derivative consists of domain II, amino acids 380-399 of domain IB and domain III.
  • other truncated forms of Pseudomonas exotoxin may be of use in the present invention.
  • the preferred variant of PE38 for use in the present invention contains mutations in trie domain III thereof such that the C-terminus amino acids are KDEL. These C -terminal mutations have previously been shown to increase the toxicity of the Pseudomonas exotoxin. (Kreitman et al (1995) JBiochem 307 29-37)
  • said TCR associated with a PE38 exotoxin comprises the amino acid sequences of (SEQ ED NO: 73) and (SEQ ID NO: 71). ( Figures 29b and 28b respectively).
  • a TCR associated with a therapeutic agent of the invention is associated with at least one polyalkylene glycol chain(s). This association may be cause in a number of ways known to those skilled in the art. Bi a preferred embodiment the polyalkylene chain(s) is/are covalently linked to the TCR. In a further embodiment the polyethylene glycol chains of the present aspect of the invention comprise at least two polyethylene repeating units. Multivalent TCR Complexes
  • One aspect of the invention provides a multivalent TCR complex comprising at least two TCRs associated with a therapeutic agent.
  • at least two TCR molecules are linked via linker moieties to form multivalent complexes.
  • Such multivalent TCR complexes may be linked by either a non-peptidic polymer chain or a peptidic linker sequence.
  • the complexes are water soluble, so the linker moiety should be selected accordingly.
  • the linker moiety should be capable of attachment to defined positions on the TCR molecules, so that the structural diversity of the complexes formed is minimised.
  • One embodiment of the present aspect is provided by a TCR complex of the invention wherein the polymer chain or peptidic linker sequence extends between amino acid residues of each TCR which are not located in a variable region sequence of the TCR.
  • the linker moieties should be chosen with due regard to their pharmaceutical suitability, for example their immunogenicity.
  • linker moieties which fulfil the above desirable criteria are known in the art, for example the art of linking antibody fragments.
  • a TCR complex of the invention in which the TCRs are linked by a polyalkylene glycol chain provides one embodiment of the present aspect.
  • hydrophilic polymers such as polyalkylene glycols.
  • the most commonly used of this class are based on polyethylene glycol or PEG, the structure of which is shown below.
  • n is greater than two.
  • suitable, optionally substituted, polyalkylene glycols include polypropylene glycol, and copolymers of ethylene glycol and propylene glycol.
  • Such polymers may be used to treat or conjugate therapeutic agents, particularly polypeptide or protein therapeutics, to achieve beneficial changes to the PK profile of the therapeutic.
  • therapeutic agents particularly polypeptide or protein therapeutics
  • Such improvements in the PK profile of the PEG-therapeutic conjugate are believe to result from the PEG molecule or molecules forming a 'shell' around the therapeutic which sterically hinders the reaction with the immune system and reduces proteolytic degradation.
  • the size of the hydrophilic polymer used my in particular be selected on the basis of the intended therapeutic use of the TCR complex.
  • the polymer used can have a linear or branched conformation.
  • Branched PEG molecules, or derivatives thereof, can be induced by the addition of branching moieties including glycerol and glycerol oligomers, pentaerythritol, sorbitol and lysine.
  • the polymer will have a chemically reactive group or groups in its structure, for example at one or both termini, and/or on branches from the backbone, to enable the polymer to link to target sites in the TCR.
  • This chemically reactive group or groups may be attached directly to the hydrophilic polymer, or there may be a spacer group/moiety between the hydrophilic polymer and the reactive chemistry as shown below:
  • Reactive chemistry-Hydrophilic polymer-Reactive chemistry Reactive chemistry-Spacer-Hydrophilic polymer-Spacer-Reactive chemistry
  • spacer used in the formation of constructs of the type outlined above may be any organic moiety that is a non-reactive, chemically stable, chain, Such spacers include, by are not limited to the following:
  • n 2 to 5 -(CH 2 ) 3 NHCO(CH 2 ) 2
  • a multivalent TCR complex of the invention in which a divalent alkylene spacer radical is located between the polyalkylene glycol chain and its point of attachment to a TCR associated with a therapeutic agent provides a further embodiment of the present aspect.
  • a multivalent TCR complex of the invention in which the polyalkylene glycol chain comprises at least two polyethylene glycol repeating units provides a further embodiment of the present aspect.
  • a wide variety of coupling chemistries can be used to couple polymer molecules to protein and peptide therapeutics.
  • the choice of the most appropriate coupling chemistry is largely dependant on the desired coupling site.
  • N- maleimide, Vinyl sulfone, Benzotriazole carbonate, Succinimidyl proprionate, Succinimidyl butanoate, Thio-ester, Acetaldehyde, Acrylate, Biotin and Primary amine coupling chemistries have been used attached to one or more of the termini of PEG molecules (Source: Nektar Molecular Engineering Catalogue 2003):
  • non-PEG based polymers also provide suitable linkers for multimerising the TCRs of the present invention.
  • linkers for multimerising the TCRs of the present invention.
  • moieties containing maleimide termini linked by aliphatic chains such as BMH and BMOE (Pierce, products Nos. 22330 and 22323) can be used.
  • Peptidic linkers are the other class of TCR linkers. These linkers are comprised of chains of amino acids, and function to produce simple linkers or multimerisation domains onto which TCR molecules can be attached.
  • the biotin / streptavidin system has previously been used to produce TCR tetramers (see WO/99/60119) for in-vitro binding studies.
  • strepavidin is a microbially-derived polypeptide and as such not ideally suited to use in a therapeutic.
  • a TCR complex of the invention in which the TCRs are linked by a peptidic linker derived from a human multimerisation domain provides a further embodiment of the present aspect.
  • a number of human proteins that contain a multimerisation domain that could be used in the production of multivalent TCR complexes.
  • the tetramerisation domain of p53 which has been utilised to produce tetramers of scFv antibody fragments which exhibited increased serum persistence and significantly reduced off-rate compared to the monomelic scFV fragment.
  • Haemoglobin also has a tetramerisation domain that could potentially be used for this kind of application.
  • Soluble TCRs or multivalent TCR complexes of the invention may be linked to an enzyme capable of converting a prodrug to a drug. This allows the prodrug to be converted to the drug only at the site where it is required (i.e. targeted by the sTCR).
  • the invention also provides a method for delivering a therapeutic agent to a target cell, which method comprises contacting potential target cells with a TCR or multivalent TCR complex in accordance with the invention under conditions to allow attachment of the TCR or multivalent TCR complex to the target cell, said TCR or multivalent TCR complex being specific for a given peptide-MHC complex.
  • the soluble TCR or multivalent TCR complex of the present invention can be used to deliver therapeutic agents to the location of cells presenting a particular antigen. This would be useful in many situations, for example, against tumours or sites of autoimmune disease. A therapeutic agent could be delivered such that it would exercise its effect locally but not only on the cell to which it binds.
  • one particular strategy envisages immunostimulatory molecules linked to TCRs or multivalent TCR complexes according to the invention specific for tumour antigens. For cancer treatment, the localisation in the vicinity of tumours or metastasis would enhance the effect of toxins or immunostimulants.
  • the soluble TCR or multivalent TCR complex of the present invention can be used to deliver immunoinhibitory agents to the location of cells presenting a particular antigen related to an autoimmune disease.
  • an Islet cell-specific TCR could be used to deliver an immunoinhibitory agent, such as IL-IO, IL-4 or IL- 13 or a functional variant or fragment of any of the foregoing to the Islet cells of a patient suffering from diabetes.
  • the vaccine antigen could be localised in the vicinity of antigen presenting cells, thus enhancing the efficacy of the antigen.
  • an interferon such as IFN- ⁇
  • the administration of an interferon (IFN) to a patient prior to, and/or simultaneously with, the administration of the TCR associated with a therapeutic agent may increase levels of peptide-MHC expression on the target cells. This may be of particular benefit in the treatment of cancer.
  • IFN interferon
  • compositions comprising a TCR associated with a therapeutic agent or a multivalent TCR complex thereof together with a pharmaceutically acceptable carrier.
  • the invention also provides a method of treatment of cancer comprising administering to a subject suffering such cancer disease an effective amount of a TCR associated with a therapeutic agent or a multivalent TCR complex thereof.
  • the invention provides for the use of a TCR associated with a therapeutic agent or a multivalent TCR complex thereof, in the preparation of a composition for the treatment of cancer.
  • IL-15, IL-21 or Anti-CD3 antibody or a functional variant or fragment of the foregoing are particularly preferred therapeutic agents for use in the treatment of cancer.
  • the invention also provides a method of treatment of autoimmune disease, organ rejection or GVHD comprising administering to a subject suffering such an autoimmune disease, organ rejection or GVHD an effective amount of a TCR associated with a therapeutic agent or a multivalent TCR complex thereof.
  • the invention provides for the use of a TCR associated with a therapeutic agent or a multivalent TCR complex thereof, in the preparation of a composition for the treatment of autoimmune disease, organ rejection or GVHD.
  • Preferred therapeutic agents for use in the treatment of autoimmune disease, organ rejection or GVHD are IL-IO, IL-4 and IL- 13 or a functional variant or fragment of any of the foregoing.
  • the dTCR or scTCR of the invention is tissue-specific, hi further related embodiment the dTCR or scTCR is specific for a tissue which is a target for auto-reactive T cells in autoimmune disease, organ rejection or Graft Versus Host Disease (GVHD).
  • the invention provides a method of treating diabetes, wherein the dTCR or scTCR is islet cell-specific.
  • Cancers which may benefit the methods of the present invention include: leukaemia, head, neck, lung, breast, colon, cervical, liver, pancreatic, ovarian and testicular)
  • Auto-immune diseases which may benefit the methods of the following invention include:
  • Systemic necrotizing vasculitides Systemic sclerosis (scleroderma)
  • compositions in accordance with the invention will usually be supplied as part of a sterile, pharmaceutical composition which will normally include a pharmaceutically acceptable carrier.
  • This pharmaceutical composition may be in any suitable form, (depending upon the desired method of administering it to a patient). It may be provided in unit dosage form, will generally be provided in a sealed container and may be provided as part of a kit. Such a kit would normally (although not necessarily) include instructions for use. It may include a plurality of said unit dosage forms.
  • the pharmaceutical composition may be adapted for administration by any appropriate route, for example parenteral, transdermal or via inhalation, preferably a parenteral (including subcutaneous, intramuscular, or, most preferably intravenous) route.
  • Such compositions may be prepared by any method known in the art of pharmacy, for example by mixing the active ingredient with the carrier(s) or excipient(s) under sterile conditions.
  • Dosages of the substances of the present invention can vary between wide limits, depending upon the disease or disorder to be treated, the age and condition of the individual to be treated, etc. and a physician will ultimately determine appropriate dosages to be used.
  • a scTCR or dTCR associated with a therapeutic agent may be provided in substantially pure form, or as a purified or isolated preparation. For example, it may be provided in a form which is substantially free of other proteins.
  • Figures Ia and Ib show respectively the nucleic acid sequences of the ⁇ and ⁇ chains of a soluble A6 TCR, mutated so as to introduce a cysteine codon. The shading indicates the introduced cysteine codon;
  • Figure 2a shows the A6 TCR ⁇ chain extracellular amino acid sequence, including the T 48 — » C mutation (underlined) used to produce the novel disulphide inter-chain bond, and
  • Figure 2b shows the A6 TCR ⁇ chain extracellular amino acid sequence, including the S 57 — » C mutation (underlined.) used to produce the novel disulphide inter-chain bond;
  • Figure 3 a shows the A6 TCR ⁇ chain sequence including novel cysteine residue mutated to incorporate a BamHl restriction site. Shading indicates the mutations introduced to form the BamHl restriction site.
  • Figures 3b and 3 c show the DNA sequence of ⁇ and ⁇ chain of the JM22 TCR mutated to include additional cysteine residues to form a non-native disulphide bond;
  • Figures 4a and 4b show respectively the J1VI22 TCR ⁇ and ⁇ chain extracellular amino acid sequences produced from the DNA sequences of Figures 3b and 3c;
  • Figures 5 a and 5b show respectively the DNA sequences of the ⁇ and ⁇ chains of a soluble AH- 1.23 TCR 5 mutated so as to introduce a novel cysteine codon (indicated by shading).
  • Figures 6a and 6b show respectively the AH-1.23 TCR ⁇ and ⁇ chain extracellular amino acid sequences produced from the DNA sequences of Figures 5a and 5b;
  • Figure 7a DNA sequence of mature human IL- 10.
  • Figure 7b Amino acid sequence of mature human IL-10.
  • Figure 8a DNA sequence of AHl .23 TCR ⁇ chain containing a non-native cysteine involved in the formation of a novel interchain bond linked to mature human IL-10 via a Pro-Gly linker.
  • the introduced cysteine is indicated by shading.
  • the DNA sequence encoding the Pro-Gly linker is underlined.
  • Figure 8b Amino acid sequence of AH 1.23 TCR ⁇ chain corxtaining a non-native cysteine codon involved in the formation of a novel interchain bond linked to mature human IL-10 via a Pro-Gly linker.
  • the introduced cysteine is indicated by shading.
  • the Pro-Gly linker is underlined.
  • Figure 9a DNA sequence of AHl.23 TCR ⁇ chain containing a non-native cysteine involved in the formation of a novel interchain bond linked to mature human IL-10 via a Gly-Ser-Gly-Gly-Pro linker.
  • the introduced cysteine is indicated by shading.
  • the DNA sequence encoding the Gly-Ser-Gly-Gly-Pro linker is underlined.
  • Figure 9b Amino acid sequence of AH 1.23 TCR ⁇ chain containing a non-native cysteine codon involved in the formation of a novel interchain bond linked to mature human IL-10 via a Gly-Ser-Gly-Gly-Pro linker.
  • the introduced cysteine is indicated by shading.
  • the Gly-Ser-Gly-Gly-Pro linker is underlined.
  • the introduced cysteine is indicated by shading.
  • the DNA sequence encoding the Gly-Ser-Gly-Gly-Gly-Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly-Gly-Ser-Gly-Gly-Pro linker is underlined.
  • Figure 10b Amino acid sequence of AHl.23 TCR ⁇ chain containing a non-native cysteine codon involved in the formation of a novel interchain bond linked to mature human IL-10 via a Gly-Ser-Gly-Gly-Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly-Gly-Ser-Gly-Gly-Pro linker.
  • the introduced cysteine is indicated by shading.
  • the Gly-Ser-Gly-Gly- Gly-Gly-Ser-Gly-Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly-Pro linker is xmderlined.
  • Figure 11 a - DNA sequence of mature human IL-4.
  • Figure 1 Ib Amino acid sequence of mature human IL-4.
  • Figure 12a DNA sequence of AHl.23 TCR ⁇ chain containing a non-native cysteine involved in the formation of a novel interchain bond linked to mature human IL-4 via a Pro-Gly linker. The introduced cysteine is indicated by shading. The DNA sequence encoding the Pro-Gly linker is underlined.
  • Figure 12b Amino acid sequence of AH 1.23 TCR ⁇ chain containing a non-native cysteine codon involved in the formation of a novel interchain bond linked to mature human IL-4 via a Pro-Gly linker.
  • the introduced cysteine is indicated by shading.
  • the Pro-Gly linker is underlined.
  • Figure 13a DNA sequence of AH 1.23 TCR ⁇ chain containing a non-native cysteine involved in the formation of a novel interchain bond linked to mature human IL-4 via a GIy-S er-Gly-Gly-Pro linker.
  • the introduced cysteine is indicated by shading.
  • the DNA sequence encoding the GIy-S er-Gly-Gly-Pro linker is underlined.
  • Figure 13b Amino acid sequence of AHl .23 TCR ⁇ chain containing a non-native cysteine codon involved in the formation of a novel interchain bond linked to mature human IL-4 via a Gly-Ser-Gly-Gly-Pro linker.
  • the introduced cysteine is indicated by shading.
  • the Gly-Ser-Gly-Gly-Pro linker is underlined.
  • Figure 14a DNA sequence of AH 1.23 TCR ⁇ chain containing a non-native cysteine involved in the formation of a novel interchain bond linked to mature human IL-4 via a Gly-Ser-Gly-Gly-Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly-Gly-Ser-Gly-Gly-Pro linker.
  • the introduced cysteine is indicated by shading.
  • the DNA sequence encoding the GIy- Ser-Gly-Gly-Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly-Gly-Ser-Gly-Gly-Pro linker is underlined.
  • Figure 14b Amino acid sequence of AHl.23 TCR ⁇ chain containing a non-native cysteine codon involved in the formation of a novel interchain bond linked to mature human IL-4 via a Gly-Ser-Gly-Gly-Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly-Gly-Pro linker.
  • the introduced cysteine is indicated by shading.
  • the Gly-Ser-Gly-Gly- Gly-Gly-Ser-Gly-Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly-Pro linker is underlined.
  • Figure 15a DNA sequence of mature human IL-13.
  • Figure 15b Amino acid sequence of mature human IL-13.
  • Figure 16a DNA sequence of AH1.23 TCR ⁇ chain containing a non-native cysteine involved in the formation of a novel interchain bond linked to mature human IL-13 via a Pro-Gly linker.
  • the introduced cysteine is indicated by shading.
  • the DNA sequence encoding the Pro-Gly linker is underlined.
  • Figure 16b Amino acid sequence of AHl .23 TCR ⁇ chain containing a non-native cysteine codon involved in the formation of a novel interchain bond linked to mature human IL-13 via a Pro-Gly linker.
  • the introduced cysteine is indicated by shading.
  • the Pro-Gly linker is underlined.
  • Figure 17a DNA sequence of AHl .23 TCR ⁇ chain containing a non-native cysteine involved in the formation of a novel interchain bond linked to mature human IL-13 via a Gly-Ser-Gly-Gly-Pro linker.
  • the introduced cysteine is indicated by shading.
  • the DNA sequence encoding the Gly-Ser-Gly-Gly-Pro linker is underlined.
  • Figure 17b Amino acid sequence of AH 1.23 TCR ⁇ chain containing a non-native cysteine codon involved in the formation of a novel interchain bond linked to mature human IL-13 via a Gly-Ser-Gly-Gly-Pro linker.
  • the introduced cysteine is indicated by shading.
  • the Gly-Ser-Gly-Gly-Pro linker is underlined.
  • Figure 18 a- DNA sequence of AH1.23 TCR ⁇ chain containing a non-native cysteine involved in the formation of a novel interchain bond linked to mature human IL-13 via a Gly-Ser-Gly-Gly-Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly-Gly-Ser-Gly-Gly-Pro linker.
  • the introduced cysteine is indicated by shading.
  • the DNA sequence encoding the Gly-Ser-Gly-Gly-Gly-Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly-Gly-Gly-Pro linker is underlined.
  • Figure 18b Amino acid sequence of AHl.23 TCR ⁇ chain containing a non-native cysteine codon involved in the formation of a novel interchain bond linked to mature human IL-13 via a Gly-Ser-Gly-Gly-Gly-Gly-Ser-Gry-Gly-Ser-Gly-Gly-Ser-Gly-Gly- Pro linker.
  • the introduced cysteine is indicated by shading.
  • the Gly-Ser-Gly-Gly- Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly-Pro linker is underlined.
  • Figure 19 details the DNA sequence of the pEX821 plasmid.
  • Figure 20 provides a plasmid map of the pEX821 vector, the DNA sequence of which is provided by Figure 19.
  • Figure 21 details the DNA sequence of the pEX954 plasmid.
  • Figure 22 provides a plasmid map of the pEX954 plasmid, the DNA sequence of which is provided by Figure 21.
  • Figure 23 a details the DNA sequence encoding the high affinity c61 NY-ESO MTCR beta chain and Figure 23b details the AA sequence encoded by the DNA sequence of Figure 23 a.
  • Figure 24a details the DNA sequence encoding the high affinity c61 NY-ESO MTCR beta chain linked at the C-terminus thereof via a peptide linker to IL-18.
  • Figure 24b details the AA sequence of this fusion protein, the peptide linker is underlined.
  • Figure 25 a details the DNA sequence encoding IL- 18 pro-protein linked at the C- terminus thereof via a peptide linker to the high affinity c61 NY-ESO MTCR beta chain.
  • the pro-IL-18 DNA has been altered to encode a Factor X cleavage site.
  • Figure 25b details the AA sequence of this fusion protein, the peptide linker is underlined.
  • Figure 26a details the DNA sequence encoding the high affinity c61 NY-ESO MTCR beta chain linked at the C-terminus thereof via a peptide linker to IL-IO.
  • Figure 26b details the AA sequence of this fusion protein, the peptide linker is underlined.
  • Figure 27a details the DNA sequence encoding the high affinity c61 NY-ESO MTCR beta chain linked at the C-terminus thereof via a peptide linker to IL-13.
  • Figure 27b details the AA sequence of this fusion protein, the peptide linker is underlined.
  • Figure 28a details the DNA sequence encoding the high affinity c61 NY-ESO MTCR beta chain linked at the C-terminus thereof via a peptide linker to the "KDEL" variant of the PE38 exotoxin.
  • Figure 28b details the AA sequence of this fusion protein, the peptide linker is underlined.
  • Figure 29a details the DNA sequence encoding the high affinity c58 NY-ESO MTCR alpha chain and Figure 29b details the AA sequence encoded by the DNA sequence of Figure 29a.
  • Example 1 Design of primers and mutagenesis ofA6 Tax TCR a and ⁇ chains
  • Expression plasmids containing the genes for the A6 Tax TCR ⁇ or ⁇ chain were mutated using the ⁇ -chain primers or the ⁇ -chain primers respectively, as follows. 100 ng of plasmid was mixed with 5 ⁇ l 10 mM dNTP, 25 ⁇ l lOxPfu-buffer (Stratagene), 10 units Pfu polymerase (Stratagene) and the final volume was adjusted to 240 ⁇ l with H 2 O. 48 ⁇ l of this mix was supplemented with primers diluted to give a final concentration of 0.2 ⁇ M in 50 ⁇ l final reaction volume.
  • the reaction mixture was subjected to 15 rounds of denaturation (95 0 C, 30 sec), annealing (55°C, 60 sec), and elongation (73°C, 8 min.) in a Hybaid PCR express PCR machine.
  • the product was then digested for 5 hours at 37°C with 10 units of Dpnl restriction enzyme (New England Biolabs). 10 ⁇ l of the digested reaction was transformed into competent XLl -Blue bacteria and grown for 18 hours at 37 0 C.
  • Plasmid DNA was purified on a Qiagen mini-prep column according to the manufacturer's instructions and the sequence was verified by automated sequencing. The respective mutated nucleic acid and amino acid sequences are shown in Figures Ia and 2a for the ⁇ chain and Figures Ib and 2b for the ⁇ chain.
  • the expression plasmids containing the mutated ⁇ -chain and ⁇ -chain respectively were transformed separately into E.coli strain BL21pLysS, and single ampicillin- resistant colonies were grown at 37°C in TYP (ampicillin lOO ⁇ g/ml) medium to OD 600 of 0.4 before inducing protein expression with 0.5mM IPTG.
  • Cells were harvested three hours post-induction by centrifugation for 30 minutes at 4000rpm in a Beckman J-6B. Cell pellets were re-suspended in a buffer containing 5OmM Tris- HCI, 25% (w/v) sucrose, ImMNaEDTA, 0.1% (w/v) NaAzide, 1OmM DTT, pH 8.0.
  • re-suspended cells were sonicated in 1 minute bursts for a total of around 10 minutes in a Milsonix XL2020 sonicator using a standard 12mm diameter probe. Inclusion body pellets were recovered by centrifugation for 30 minutes at 13000rpm in a Beckman J2-21 centrifuge. Three detergent washes were then carried out to remove cell debris and membrane components.
  • the inclusion body pellet was homogenised in a Triton buffer (5OmM Tris-HCL 0.5% Triton-XIOO, 20OmM NaCI, 1OmM NaEDTA, 0.1% (w/v) NaAzide, 2mM DTT, pH 8.0) before being pelleted by centrifugation for 15 minutes at 13000rpm in a Beckman J2-21. Detergent and salt was then removed by a similar wash in the following buffer: 5OmM Tris-HCl, ImM NaEDTA, 0.1% (w/v) NaAzide, 2mM DTT, pH 8.0. Finally, the inclusion bodies were divided into 30 mg aliquots and frozen at -70°C. Inclusion body protein yield was quantitated by solubilising with 6M guanidine-HCl and measurement with a Bradford dye-binding assay (PerBio).
  • Triton buffer 5OmM Tris-HCL 0.5% Triton-XIOO, 20OmM NaCI, 1OmM NaED
  • Denaturation of soluble TCRs 30mg of the solubilised TCR ⁇ -chain inclusion body and 60mg of the solubilised TCR ⁇ -chain inclusion body was thawed from frozen stocks.
  • the inclusion bodies were diluted to a final concentration of 5mg/ml in 6M guanidine solution, and DTT (2M stock) was added to a final concentration of 1OmM. The mixture was incubated at 37°C for 30 min.
  • Refolding of soluble TCRs 1 L refolding buffer was stirred vigorously at 5 0 C ⁇ 3 0 C.
  • the redox couple (2-mercaptoethylamine and cystamine (to final concentrations of 6.6mM and 3.7mM, respectively) were added approximately 5 minutes before addition of the denatured TCR chains.
  • the protein was then allowed to refold for approximately 5 hours ⁇ 15 minutes with stirring at 5 0 C ⁇ 3 0 C.
  • Dialysis of refolded soluble TCRs The refolded TCR was dialysed in Spectrapor 1 membrane (Spectrum; Product No. 132670) against 10 L 10 mM Tris pH 8.1 at 5°C ⁇ 3 0 C for 18-20 hours. After this time, the dialysis buffer was changed to fresh 10 mM Tris pH 8.1 (10 L) and dialysis was continued at 5 0 C ⁇ 3°C for another 20-22 hours.
  • a surface plasmon resonance biosensor (BIAcore 3000TM ) was used to analyse the binding of a sTCR to its peptide-MHC ligand. This was facilitated by producing single pMHC complexes (described below) which were immobilised to a streptavidin- coated binding surface in a semi-oriented fashion, allowing efficient testing of the binding of a soluble T-cell receptor to up to four different pMHC (immobilised on separate flow cells) simultaneously. Manual injection of HLA complex allows the precise level of immobilised class I molecules to be manipulated easily. Such immobilised complexes are capable of binding both T-cell receptors and the coreceptor CD8 ⁇ , both of which may be injected in the soluble phase.
  • TCR Specific binding of TCR is obtained even at low concentrations (at least 40 ⁇ g/ml), implying the TCR is relatively stable.
  • the pMHC binding properties of sTCR are observed to be qualitatively and quantitatively similar if sTCR is used either in the soluble or immobilised phase. This is an important control for partial activity of soluble species and also suggests that biotinylated pMHC complexes are biologically as active as non-biotinylated complexes.
  • Biotinylated class I HLA- A2 - peptide complexes were refolded in vitro from bacterially-expressed inclusion bodies containing the constituent subunit proteins and synthetic peptide, followed by purification and in vitro enzymatic biotinylation (O'Callaghan et al. (1999) Anal. Biochem. 266: 9-15).
  • HLA-heavy chain was expressed with a C-terminal biotinylation tag which replaces the transmembrane and cytoplasmic domains of the protein in an appropriate construct.
  • Inclusion body expression levels of ⁇ 75 mg/litre bacterial culture were obtained.
  • the HLA light- chain or ⁇ 2-microglobulin was also expressed as inclusion bodies in E.coli from an appropriate construct, at a level of ⁇ 500 mg/litre bacterial culture.
  • E. coli cells were lysed and inclusion bodies are purified to approximately 80% purity. Protein from inclusion bodies was denatured in 6 M guanidine-HCl, 50 niM Tris pH 8.1, 100 rnM NaCl, 10 mM DTT, 10 mM EDTA, and was refolded at a concentration of 30 mg/litre heavy chain, 30 mg/litre ⁇ 2m into 0.4 M L-Arginine-HCl, 100 mM Tris pH 8.1, 3.7 mM cystamine, mM cysteamine, 4 mg/ml peptide (e.g. tax 11-19), by addition of a single pulse of denatured protein into refold buffer at ⁇ 5°C. Refolding was allowed to reach completion at 4 0 C for at least 1 hour.
  • Buffer was exchanged by dialysis in 10 volumes of 10 mM Tris pH 8.1. Two changes of buffer were necessary to reduce the ionic strength of the solution sufficiently.
  • the protein solution was then filtered through a 1.5 ⁇ m cellulose acetate filter and loaded onto a POROS 50HQ anion exchange column (8 ml bed volume). Protein was eluted with a linear 0-500 mM NaCl gradient. HLA- A2 -peptide complex eluted at approximately 250 rtiM NaCl, and peak fractions were collected, a cocktail of protease inhibitors (Calbiochem) was added and the fractions were chilled on ice.
  • Biotinylation tagged HLA complexes were buffer exchanged into 10 niM Tris pH 8.1, 5 mM NaCl using a Pharmacia fast desalting column equilibrated in the same buffer. Immediately upon elution, the protein-containing fractions were chilled on ice and protease inhibitor cocktail (Calbiochem) was added. Biotinylation reagents were then added: 1 mM biotin, 5 mM ATP (buffered to pH 8), 7.5 mM MgC12, and 5 ⁇ g/ml BirA enzyme (purified according to O'Callaghan et al. (1999) Anal. Biochem. 266: 9- 15). The mixture was then allowed to incubate at room temperature overnight.
  • Biotinylated HLA complexes were purified using gel filtration chromatography. A Pharmacia Superdex 75 HR 10/30 column was pre-equilibrated with filtered PBS and 1 ml of the biotinylation reaction mixture was loaded and the column was developed with PBS at 0.5 ml/min. Biotinylated HLA complexes eluted as a single peak at approximately 15 ml. Fractions containing protein were pooled, chilled on ice, and protease inhibitor cocktail was added. Protein concentration was determined using a Coomassie-binding assay (PerBio) and aliquots of biotinylated HLA complexes were stored frozen at -2O 0 C. Streptavidin was immobilised by standard amine coupling methods.
  • PerBio Coomassie-binding assay
  • the assay was then performed by passing sTCR over the surfaces of the different flow cells at a constant flow rate, measuring the SPR response in doing so. Initially, the specificity of the interaction was verified by passing sTCR at a constant flow rate of 5 ⁇ l min-1 over two different surfaces; one coated with -5000 RU of specific peptide-HLA complex, the second coated with -5000 RU of non-specific peptide-HLA complex . Injections of soluble sTCR at constant flow rate and different concentrations o ⁇ ver the peptide-HLA complex were used to define the background resonance.
  • the Kd value obtained (1.8 ⁇ M) is close to that reported for the interaction between A6 Tax sTCR without the novel di-sulphide bond and pMHC (0.91 ⁇ M - Ding et al, 1999, Immunity 11:45-56).
  • Example 4 Production of soluble JM22 TCR containing a novel disulphide bond.
  • the ⁇ chain of the soluble A6 TCR prepared in Example 1 contains in the native sequence a BgIII restriction site (AAGCTT) suitable for use as a ligation site.
  • AAGCTT BgIII restriction site
  • PCR mutagenesis was carried as detailed below to introduce a BamHl restriction site (GGATCC) into the ⁇ chain of soluble A6 TCR 5 , 5' of the novel cysteine codon.
  • GGATCC BamHl restriction site
  • plasmid 100 ng of plasmid was mixed with 5 ⁇ l 10 niM dNTP, 25 ⁇ l lOxPfu-buffer (Stratagene), 10 units PfU polymerase (Stratagerie) and the final volume was adjusted to 240 ⁇ l with H 2 O. 48 ⁇ l of this mix was supplemented with primers diluted to give a final concentration of 0.2 ⁇ M in 50 ⁇ l final reaction volume. After an initial denaturation step of 30 seconds at 95°C, the reaction mixture was subjected to 15 rounds of denaturation (95 0 C, 30 sec), annealing (55°C, 60 sec), and elongation (73 °C, 8 min.) in a Hybaid PCR express PCR machine.
  • A6 TCR plasmids containing the ⁇ chain BamHl and ⁇ chain BgIII restriction sites were used as templates.
  • the following primers were used:
  • JM22 TCR ⁇ and ⁇ -chain constructs were obtained by PCR cloning as follows. PCR reactions were performed using the primers as shown above, and templates containing the JM22 TCR chains. The PCR products were restriction digested with the relevant restriction enzymes, and cloned into pGMT7 to obtain expression plasmids. The sequence of the plasmid inserts were confirmed by automated DNA sequencing.
  • Figures 3b and 3c show the DNA sequence of the mutated ⁇ and ⁇ chains of the JM22 TCR respectively, and Figures 4a and 4b show the resulting amino acid sequences.
  • TCR chains were expressed, co-refolded and purified as described in Examples 1 and 2.
  • cDNA encoding AH- 1.23 TCR was isolated from T cells supplied by Hill Gaston (Medical School, Addenbrooke's Hospital, Cambridge) according to known techniques. cDNA encoding NY-ESO TCR was produced by treatment of the HiRNA with reverse transcriptase.
  • TCR plasmids containing the ⁇ chain BamHI and ⁇ chain BgIII restriction sites were used as a framework as described in Example 4. The following primers were used:
  • TCR chains were expressed, co-refolded and purified as described in Example 2.
  • Example 6 Production of a soluble AH- 1.23 TCR - IL-IO fusion protein.
  • Synthetic genes including the mature human IL-10 DNA sequence detailed in Figure 7a and one of a number of DNA extensions at the 5' end of the IL-10 DNA sequence can then be produced.
  • the 5' DNA extensions are linker sequences used to attach the IL-IO DNA to that encoding the AHl.23 TCR ⁇ chain.
  • cccggg which encodes a Pro-Gly linker including a Xmal restriction enzyme site ggatccggcggtccg - (SEQ ID NO: 17) which encodes a Gly-Ser-Gly-Gly-Pro (SEQ ID NO: 18) linker including a BamHl restriction enzyme site.
  • One of the above synthetic genes is then sub-cloned into the pGMT7 plasmid containing the AHl .23 TCR ⁇ chain, produced as described in Example 5 to form a DNA sequence encoding the TCR ⁇ chain-linker-IL-10 fusion protein.
  • the DNA and amino acid sequence of the AHl .23 TCR ⁇ chain - Pro-Gly - IL- 10 fusion is detailed in Figures 8a and 8b respectively.
  • AHl.23 TCR ⁇ chain - Linker- IL-IO fusion proteins are then refolded with the AHl.23 TCR ⁇ chain using the methods detailed in Example 2 to produce the complete soluble AHl.23 TCR-IL-10 fusion protein.
  • IL-10 is often found in the form of a homodimer. Therefore, it may be advantageous to dimerise the IL-10 polypeptide attached to the soluble AHl.23 TCR. This can be achieved in a number of ways. For example, a single-chain version of the mature form human IL-10 homodimer can be fused to the TCR ⁇ prior to refolding with the TCR ⁇ chain.
  • mature form human IL-10 can be added in solution to either the TCR ⁇ Chain-IL-10 fusion proteins formed as described above prior to refolding with the soluble TCR ⁇ chain, or to the refolded ⁇ TCR-IL-10 fusion proteins.
  • an additional IL-10 molecule can be added to the TCR ⁇ chain as a fusion protein using the methods described in this example for the production of the TCR ⁇ chain - IL-10 fusion protein.
  • the two TCR chain-EL-10 fusion proteins can then be re-folded together using the methods described in Example 2.
  • complexes comprising two TCR, each containing a single IL-10 polypeptide linked to the TCR ⁇ chain, may be formed by homo-dimerisation of the IL-10 polypeptides. This would result in the formation of a complex of the following type:
  • Example 6 The methods detailed in Example 6 can also be used to produce fusion proteins containing the soluble AH-1.23 TCR linked to other polypeptides.
  • Synthetic genes including the mature human IL-4 DNA sequence detailed in Figure 11a and one of the 5' DNA extension sequences listed in Example 6 can be constructed and sub-cloned into the pGMT7 plasmid containing the AHl.23 TCR ⁇ chain, produced as described in Example 5 to form a DNA sequence encoding the TCR ⁇ chain-linker- IL-4 fusion proteins.
  • Synthetic genes including the mature human IL- 13 DNA sequence detailed in Figure 15a and one of the 5' DNA extension sequences listed in Example 6 can be constructed and sub-cloned into the pGMT7 plasmid containing the AH 1.23 TCR ⁇ chain, produced as described in Example 5 to form a DNA sequence encoding the TCR ⁇ chain-linker- IL-4 fusion proteins.
  • AH 1.23 TCR ⁇ chain - Linker- interleukin fusion proteins are then refolded with the AHl .23 TCR ⁇ chain using the methods detailed in Example 2 to produce the complete soluble AH 1.23 TCR-interleukin fusion protein.
  • Example 10 Thymidine incorporation assay for assessing the ability of AHl.23 TCR-IL-10 fusion proteins to cause Mast cell proliferation.
  • AH 1.23 TCR-IL-10 fusion protein compared to that seen in the absence of the fusion protein indicates that the IL-IO part of the fusion protein is active and causing D36 mast cell proliferation.
  • Example 11 Preparation of high affinity NY-ESO MTCR — therapeutic agent fusion proteins.
  • Synthetic genes comprising the DNA sequence encoding the soluble high affinity c61 NY-ESO TCR ⁇ chain detailed in Figure 23 a linked via a DNA sequence encoding a peptide linker to DNA encoding a number of imunomodulaotory agents were synthesised:
  • Figure 24a details the DNA sequence encoding the high affinity c61 NY-ESO MTCR beta chain linked at the C-terminus thereof via a peptide linker to IL-18.
  • Figure 24b details the AA sequence of this fusion protein, the peptide linker is underlined.
  • Figure 25 a details the DNA sequence encoding IL- 18 pro-protein linked at the C- terminus thereof via a peptide linker to the high affinity c61 NY-ESO MTCR beta chain.
  • the pro-IL-18 DNA sequence has been altered to encode a Factor X cleavage site which facilitates post translation removal of the amino acids within the pro- sequence.
  • Figure 25b details the AA sequence of this fusion protein, the peptide linker is underlined.
  • Figure 26a details the DNA sequence encoding the high affinity c61 NY-ESO MTCR beta chain linked at the C-terminus thereof via a peptide linker to IL-IO.
  • Figure 26b details the AA sequence of this fusion protein, the peptide linker is underlined.
  • Figure 27a details the DNA sequence encoding the high affinity c61 NY-ESO MTCR beta chain linked at the C-terminus thereof via a peptide linker to IL-13.
  • Figure 27b details the AA sequence of this fusion protein, the peptide linker is underlined.
  • Figure 28a details the DNA sequence encoding the high affinity c61 NY-ESO MTCR beta chain linked at the C-terminus thereof via a peptide linker to the "KDEL" variant of the PE38 exotoxin.
  • Figure 28b details the AA sequence of this fusion protein the peptide linker is underlined.
  • the DNA sequences above c61 NY-ESO TCR beta chain can be ligated into the pEX821 vector. (See Figures 19 and 20 for the DNA sequence and plasmid map of this vector respectively)
  • Disulfide-linked ⁇ TCR-therapeutic agents are then produced following the methods substantially as described in Example 2. Briefly, DNA encoding the high affinity c61 NY-ESO alpha chain detailed in Figure 29a is synthesised and ligated into the pEX954 vector. (See Figures 21 and 22 for the DNA sequence and plasmid map of this vector respectively) The TCR beta chain fusion proteins described above are then refolded in the presence of the c61 NY-ESO TCR alpha chain.
  • Figure 29a details the DNA sequence encoding the high affinity c58 NY-ESO MTCR alpha chain and Figure 29b details the AA sequence encoded by the DNA sequence of Figure 29a.
  • Example 12 -MTCR-P E- 38 fusion protein cytotoxicity assay.
  • 1x10 "6 of trie required target cells e.g. SK-MEL tumour cells or J82 cells
  • target cells e.g. SK-MEL tumour cells or J82 cells
  • FCS fetal calf serum
  • the target cells were then pulsed with 10 ⁇ M of cognate peptide for 2 hours at 37°C.
  • the samples were then washed three times in RPMI + 10% FCS, centrifuging at 1200 rpm for 5 min in between each wash.
  • the washed cells were then re-counted and re- suspended in the appropriate volume of RPMI + 10% FCS media to provide a final cell density of 2 x 10 5 cells/ml.
  • the MTCR-PE38 fusion proteins prepared as described in Example 11 were diluted in RPMI media + 10% FCS to a final concentration of 2 x 10 "6 M to provide a working standard. This working standard was then used to prepare a set of serial dilutions.
  • Experimental sample wells were filled with 50 ⁇ l mTCR-PE38 in media and 50 ⁇ l cells in medium. To produce a total volume of 100 ⁇ l in 96 well flat bottom white opaque walled plates (Nunc 136101). The mTCR-PE38 serial dilutions prepared above were used to provide a range of mTCR-PE38 concentrations in these wells.
  • Control sample wells were prepared using either 100 ⁇ l of cells (cell-only controls) or 100 ⁇ l of mTCR-PE38 and media (effector-only controls).
  • the experimental and control samples were then incubated at 37 0 C, 5% CO 2 for 48 or 96 hours.
  • the number of viable cells remaining in each well was then assessed using a CellTiter-Glo ® Luminescent assay (Promega Cat No: G7572) following the manufacturers instructions.
  • Figures 30a and 30b demonstrate that the NY-ESO + SK-MEL 37 and Mel 624 tumour cell lines can be killed by the 1G4 MTCR-PE38 fusion protein.
  • Figures 30a and 30b both demonstrate that pulsing the J82 target cells with the cognate SLLMWITQC NY-ESO peptide leads to more efficient killing of these cells by the NY-ESO TCR-PE38 construct compared to that observed with unpulsed J82 target cells.

Abstract

The present invention provides a dimeric TCR (dTCR) or single-chain TCR (scTCR) associated with selected therapeutic agents, wherein said TCR comprises a first segment constituted by an amino acid sequence corresponding to a TCR α chain variable domain sequence fused to the N terminus of an amino acid sequence corresponding to a TCR α chain constant domain extracellular sequence, a second segment constituted by an amino acid sequence corresponding to a TCR ß chain variable domain fused to the N terminus of an amino acid sequence corresponding to TCR ß chain constant domain extracellular sequence, a disulfide bond between the first and second chains, said disulfide bond being one which has no equivalent in native αβ T cell receptors, and in the case of said scTCRs further comprising a linker sequence linking the C terminus of the first segment to the N terminus of the second segment, or vice versa, the length of the linker sequence and the position of the disulfide bond being such that the variable domain sequences of the first and second segments are mutually orientated substantially as in native αβ T cell receptors.

Description

T cell receptors containing a non-native disulfide interchain bond linked to therapeutic agents
The present invention relates to T cell receptors (TCRs) containing a non-native disulphide interchain, bond associated with therapeutic agents.
Background to the Invention
The novel TCR therapeutic combinations disclosed herein will be of use in the treatment of autoimmune disease, organ rejection, Graft Versus Host Disease (GVHD) and cancer. The TCR portion of the TCR therapeutic agent combinations disclosed herein are targeting moieties.
Brief Description of the Invention
This invention makes available for the first time a dimeric TCR (dTCR) or single- chain TCR (scTCR) associated with a therapeutic agent, wherein said agent is selected from IL-I, IL- lα, IL-3, IL-4, IL-5, IL-6, IL-7, IL-10, IL-I l, IL-12, IL-13, IL- 15, IL-21, IL-23, TGF-β, IFN-γ, Lymphotoxin, TNFα, Anti-CD2 antibody, Anti- CD3 antibody, Anti-CD4 antibody, Anti-CD8 antibody, Anti-CD44 antibody, Anti- CD45RA antibody, Anti-CD45RB antibody, Anti-CD45RO antibody, Anti-Thy 1.2 antibody, Antilympliocyte globulin, Anti-αβTCR antibody, Anti-γδTCR antibody, Anti-CD49a antibody, Anti-CD49b antibody, Anti-CD49c antibody, Anti-CD49d antibody, Anti-CD49e antibody, Anti-CD49f antibody, Anti-TCR Vβ8 antibody, Anti-CD 16 antibody, Anti-CD28 antibody, CTLA-4-Ig, Anti-B7.2 antibody, Anti- CD40L antibody, Anti-ICAM-1 antibody, ICAM-I, Anti-Mac antibody, Anti-LFA-1 antibody, Anti-IFN-Y antibody IFN-γ, IFN-γR/IgGI fusions, Anti-IL-2R antibodies, IL-2R antibody, IL-2 Diptheria-toxin protein, Anti-IL-12 antibody, IL-12 Antagonist (p40), Anti-IL-1 antibody, IL-I Antagonist, Glutamic acid decarboxylase (GAD), Anti-GAD antibody, Viral proteins and peptides, Bacterial proteins or peptides, A- Galactosyl-ceramide, Calcitonin, Nicotinamide, Anti-oxidants (Vitamin E, Probucol analog, Probucol + deflazacoert or Aminoguanidine), Anti-Inflammatory agents
(Pentoxifylline or Rolipram), Immunomodulators (Linomide, Ling-zhi-8, D-Glucan, Multi-functional protein 14, Ciamexon, Cholera toxin B, Vanadate or Vitamin D3 analogue, small molecule CD80 inhibitors, Androgens, IGF-I, Immunomanipulation (Natural antibodies), Lupus idiotype, Lipopolysaccaride), Sulfatide, Bee venom, Kampo formulation, Silica, Ganglioside, Antiasialo GM-I antibody, Hyaluronidase, Concanavalin A, Anti-Class I MHC antibody, or Anti-Class II MHC antibody, Cyclosporin, FK-506, Azathioprine, Rapamycin or Deoxyspergualin, PE38 Pseudomonas exotoxin or a functional variant or fragment of any of the foregoing, and wherein said TCR comprises a first segment constituted by an amino acid sequence corresponding to a TCR α chain variable domain sequence fused to the N" terminus of an amino acid sequence corresponding to a TCR α chain constant domain extracellular sequence, a second segment constituted by an amino acid sequence corresponding to a TCR β chain variable domain fused to the N terminus of an amino acid sequence corresponding to TCR β chain constant domain extracellular sequence, a disulfide bond between the first and second chains, said disulfide bond being one which has no equivalent in native αβT cell receptors, and in the case of said ScTCK-S further comprising a linker sequence linking the C terminus of the first segment to the N terminus of the second segment, or vice versa, the length of the linker sequence and the position of the disulfide bond being such that the variable domain sequences of the first and second segments are mutually orientated substantially as in native αβ T cell receptors.
Detailed Description of the Invention
The present invention provides a dimeric TCR (dTCR) or single-chain TCR (scTCIR) associated with a therapeutic agent, wherein said agent selected from one of IL-I, IL- lα, IL-3, IL-4, IL-5, IL-6, IL-7, IL-10, IL-Il, IL-12, IL-13, IL-15, IL-21, IL-23, TGF- β, IFN-γ, Lymphotoxin, TNFα, Anti-CD2 antibody, Anti-CD3 antibody, Anti-CD4 antibody, Anti-CD8 antibody, Anti-CD44 antibody, Anti-CD45RA antibody, Anti- CD45RB antibody, Anti-CD45RO antibody, Anti-Thy 1.2 antibody, Antilymphocyte globulin, Anti-αβTCR antibody, Anti-γδTCR antibody, Anti-CD49a antibody, Anti- CD49b antibody, Anti-CD49c antibody, Anti-CD49d antibody, Anti-CD49e antibody, Anti-CD49f antibody, Anti-TCR Vβ8 antibody, Anti-CD16 antibody, Anti-CD28 antibody, CTLA-4-Ig, Anti-B7.2 antibody, Anti-CD40L antibody, Anti-ICAM-1 antibody, ICAM-I, Anti-Mac antibody, Anti-LFA-1 antibody, Anti-IFN-γ antibody IFN-γ, IFN-γR/IgGl fusions, Anti-IL-2R antibodies, IL-2R antibody, IL-2 Diptheria- toxin protein, Anti-IL-12 antibody, IL- 12 Antagonist (p40), Anti-IL-1 antibody, IL-I Antagonist, Glutamic acid decarboxylase (GAD), Anti-GAD antibody, Viral proteins and peptides, Bacterial proteins or peptides, A-Galactosyl-ceramide, Calcitonin, Nicotinamide, Anti-oxidants (Vitamin E, Probucol analog, Probucol + deflazacoert or Aminoguanidine), Anti-Inflammatory agents (Pentoxifylline or Rolipram),
Immunomodulators (Linomide, Ling-zhi-8, D-Glucan, Multi-functional protein 14, Ciamexon, Cholera toxin B, Vanadate or Vitamin D3 analogue, small molecule CD80 inhibitors, Androgens, IGF-I, Immunomanipulation (Natural antibodies), Lupus idiotype, Lipopolysaccaride), Sulfatide, Bee venom, Kampo formulation, Silica, Ganglioside, Antiasialo GM-I antibody, Hyaluronidase, Concanavalin A, Anti-Class I MHC antibody, or Anti-Class II MHC antibody, Cyclosporin, FK-506, Azathioprine, Rapamycin or Deoxyspergualin, PE38 Pseudomonas exotoxin, or a functional variant or fragment of any of the foregoing, and wherein said TCR comprises a first segment constituted by an amino acid sequence corresponding to a TCR α chain variable domain sequence fused to the N terminus of an amino acid sequence corresponding to a TCR α chain constant domain extracellular sequence, a second segment constituted by an amino acid sequence corresponding to a TCR β chain variable domain fused to the N terminus of an amino acid sequence corresponding to TCR β chain constant domain extracellular sequence, a disulfide bond between the first and second chains, said disulfide bond being one which has no equivalent in native αβ T cell receptors, and in the case of said scTCRs further comprising a linker sequence linking the C terminus of the first segment to the N terminus of the second segment, or vice versa, the length of the linker sequence and the position of the disulfide bond being such that the variable domain sequences of the first and second segments are mutually orientated substantially as in native αβ T cell receptors.
As used herein the term "a dimeric TCR (dTCR) or single-chain TCR (scTCR) associated with an therapeutic agent" is understood to refer to a TCR covalently or otherwise linked to an therapeutic agent. The therapeutic agent may either be directly linked to the TCR, or indirectly via a linker moiety. - A -
As used herein the term "functional variant" is understood to refer to analogues of the disclosed therapeutic agents which have the same therapeutic effect. For example, as is known to those skilled in the art, it may be possible to produce therapeutics that incorporate minor changes in the chemical structure or amino acid sequence thereof compared to those disclosed without altering the therapeutic effect of the agents. Such trivial variants are included in the scope of this invention.
Functional antibody fragments and variants
Antibody fragments and variants/analogues which are suitable for use in the compositions and methods described herein include, but are not limited to, the following.
Antibody Fragments
As is known to those skilled in the art, it is possible to produce fragments of a given antibody which retain substantially the same binding characteristics as those of the parent antibody. The following provides details of such fragments:
Minibodies - These constructs consist of antibodies with a truncated Fc portion. As such they retain the complete binding domains of the antibody from which are derived.
Fab fragments — These comprise a single immunoglobulin light chain covalently- linked to part of an immunoglobulin heavy chain. As such, Fab fragments comprise a single antigen combining site. Fab fragments are defined by the portion of an IgG that can be liberated by treatment with papain. Such fragments are commonly produced via recombinant DNA techniques. (Reeves et ah, (2000) Lecture Notes on Immunology (4th Edition) Published by Blackwell Science)
F(ab')2 fragments - These comprise both antigen combining sites and the hinge region from a single antibody. F(ab')2 fragments are defined by the portion of an IgG that can be liberated by treatment with pepsin. Such fragments are commonly produced via recombinant DNA techniques. (Reeves et al, (2000) Lecture Notes on Immunology (4tth Edition) Published by Blackwell Science)
Fv fragments - These comprise an immunoglobulin variable heavy domain linked to an immunoglobulin variable light domain. A number of Fv designs have been produced. These include dsFvs, in which the association between the two domains is enhanced by an introduced disulfide bond. Alternatively, scFVs can be formed using a peptide linker to bind the two domains together as a single polypeptide. Fvs constructs containing a variable domain of a heavy or light immunoglobulin chain associated to the variable and constant domain of the corresponding immunoglobulin heavy or light chain have also been produced. FV have also been multimerised to form diabodies and triabodies (Maynard et al., (2000) Annu Rev Biomed Eng 2 339-376)
Nanobodies™ - These constructs, marketed by Ablynx (Belgium), comprise synthetic single immunoglobulin variable heavy domain derived from a camelid (e.g. camel or llama) antibody.
Domain Antibodies - These constructs, marketed by Domantis (Belgium), comprise an affinity matured single immunoglobulin variable heavy domain or immunoglobulin variable light domain.
Antibody variants and analogues
The defining functional characteristic of antibodies in the context of the present invention is their ability to bind specifically to a target ligand. As is known to those skilled in the art it is possible to engineer such binding characteristics into a range of other proteins. Examples of antibody variants and analogues suitable for use in the compositions and methods of the present invention include, but are not limited to, the following.
Protein scaffold-based binding polypeptides - This family of binding constructs comprise mutated analogues of proteins which contain native binding loops. Examples include Affibodies, marketed by Affibody (Sweden), which are based on a three-helix motif derived from one of the IgG binding domains of Staphylococcus aureus Protein A. Another example is provided by Evibodies, marketed by EvoGenix (Australia) which are based on the extracellular domains of CTLA-4into which domains similar to antibody binding loops are grafted. A final example, Cytokine Traps marketed by Regeneron Pharmaceuticals (US), graft cytokine receptor domains into antibody scaffolds. (Nygren et al, (2000) Current Opinion in Structural biology 7 463-469) provides a review of the uses of scaffolds for engineering novel binding sites in proteins. This review mentions the following proteins as sources of scaffolds: CPl zinc finger, Tendamistat, Z domain (a protein A analogue), PSTl, Coiled coils, LACI-Dl and cytochrome b562. Other protein scaffold studies have reported the use of Fibronectin, Green fluorescent protein (GFP) and ankyrin repeats.
As is known to those skilled in the art antibodies or fragments, variants or analogues thereof can be produced which bind to various parts of a given protein ligand. For example, anti-CD3 antibodies can be raised to any of the polypeptide chains from which this complex is formed (i.e.γ, δ, ε, ζ, and η CD3 chains) Antibodies which bind to the ε CD3 chain are the preferred anti-CD3 antibodies for use in the compositions and methods of the present invention.
Another aspect of the invention provides a dTCR or scTCR associated with a therapeutic agent, wherein the therapeutic agent is selected from IL-I, IL- lα, IL-3, IL-5, IL-6, IL-7, IL-Il, IL-12, TGF-β, Lymphotoxin, TNFα, Anti-CD2 antibody, Anti-CD4 antibody, Anti-CD8 antibody, Anti-CD44 antibody, Anti-CD45RA antibody, Anti-CD45RB antibody, Anti-CD45RO antibody, Anti-Thy 1.2 antibody, Antilymphocyte globulin, Anti-αβTCR antibody, Anti-γδTCR antibody, Anti-CD49a antibody, Anti-CD49b antibody, Anti-CD49c antibody, Anti-CD49d antibody, Anti- CD49e antibody, Anti-CD49f antibody, Anti-TCR Vβ8 antibody, Anti-CD 16 antibody, Anti-CD28 antibody, CTLA-4-Ig, Anti-B7.2 antibody, Anti-CD40L antibody, Anti-ICAM-1 antibody, ICAM-I, Anti-Mac antibody, Anti-LFA-1 antibody, Anti-IFN-γ antibody IFN-γ, IFN-γR/IgGl fusions, Anti-IL-2R antibodies, IL-2R antibody, IL-2 Diptheria-toxin protein, Anti-IL-12 antibody, IL-12 Antagonist (ρ40), Anti-IL-1 antibody, IL-I Antagonist, Glutamic acid decarboxylase (GAD), Anti-GAD antibody, Viral proteins and peptides, Bacterial proteins or peptides, A- Galactosyl-ceramide, Calcitonin, Nicotinamide, Anti-oxidants (Vitamin E, Probucol analog, Probucol + deflazacoert or Aminoguanidine), Anti-Inflammatory agents (Pentoxifylline or Rolipram), Immunomodulators (Linomide, Ling-zhi-8, D-Glucan, Multi-functional protein 14, Ciamexon, Cholera toxin B, Vanadate or Vitamin D3 analogue, small molecule CD80 inhibitors, Androgens, IGF-I, Immunomanipulation (Natural antibodies), Lupus idiotype, Lipopolysaccaride), Sulfatide, Bee venom, Kampo formulation, Silica, Ganglioside, Antiasialo GM-I antibody, Hyaluronidase, Concanavalin A, Anti-Class I MHC antibody, or Anti-Class II MHC antibody, Cyclosporin, FK-506, Azathioprine, Rapamycin or Deoxyspergualin, or a functional variant or fragment of any of the foregoing.
"Anti-T cell" antibodies One preferred group of the immunomodulatory agents of the invention are antibodies or functional fragments or variants/analogues thereof which bind epitopes presented only by T cells or Natural Killer (NK) cells. The following are the antibodies which will specifically target these cells:
Anti-CD3 antibody, Auti-CD4 antibody, Anti-CD 8 antibody, Anti-αβTCR antibody, Anti-CD49a antibody, Anti-CD49b antibody, Anti-CD49c antibody, Anti-CD49d antibody, Anti-CD49e antibody, Anti-CD49f antibody, Anti-γδTCR antibody, Anti- TCR Vβ8 antibody and Anti-CD28 antibody.
As will be known to those skilled in the art particular subsets of T cells and/or NK cells are targeted by the majority of the above antibodies. Only anti-CD3 antibodies will target all NK cells and T cells.
Such antibodies, linked to a soluble TCR to form a bifunctional composition of the invention, will cause T cells and/or NK cells to be localised to the cells expressing the cognate peptide-MHC ligand for the soluble TCR. Without wishing to be limited by theory, the binding of these antibodies to the T cells or NK cells may cause these cells to be activated. Another aspect of the invention provides a dTCR or scTCR associated with a therapeutic agent selected from IL-IO, IL-4 or IL-13 or a functional variant or fragment of any of the foregoing.
One aspect of the invention is provided wherein the dTCR or scTCR is tissue-specific. In a one embodiment of the present aspect the dTCR or scTCR is specific for a tissue which is a target for auto-reactive T cells in autoimmune disease, organ rejection or Graft Versus Host Disease (GVHD). In a specific embodiment of the present aspect the dTCR or scTCR is islet cell-specific. The T cell clones NY8.3 (Santamaria et al, J. Immunology (1995) 154 2494-2503) and (Nagata et al, (1995) J Immunology 152 2042-2050) and G9C8 (Wong et al, J Exp Med 1996) 183 67-76) are examples of murine T cell clones that are islet cell-specific. The NY8.3 T cell clone is specific for a glucose-6-phosphatase catalytic subunit-related protein (IGRP)-derived peptide presented by the murine H2-Kd MHC and the G9C8 T cell clone is specific for an insulin-derived peptide presented by the murine H2-Kd MHC.
A fuxther aspect of the invention provides a dTCR or scTCR associated with a therapeutic agent, wherein the therapeutic agent is selected from IL-15, IL-21, IL-23, PE38 Pseudomonas exotoxin, IFN-γ or Anti-CD3 antibody or a functional variant or fragment of any of the foregoing.
In one aspect of the invention the TCR associated with a therapeutic agent is a dTCR. In an alternative aspect of the invention the TCR associated with a therapeutic agent is a scTCR.
There are two classes of linker that are preferred for the association of TCRs and therapeutic agents of the present invention. A TCR of the invention in which the TCR is linked by a polyalkylene glycol chain to the therapeutic agent provides one embodiment of the present aspect. Peptidic linkers are the other class of TCR linkers. These two classes of linker are discussed in detail below in relation to their use in the formation of TCR multimers. Example 6 herein provides two examples of peptidic linkers which may be used to form the association between the TCR and therapeutic agent. As is known to those skilled in the art a variety of peptide linkers may be suitable to link the TCR β chains to the required therapeutic agents. The following are additional examples linker sequences which may be used for this purpose
ggcggtccg - which encodes a Gly-Gly-Pro linker. cccggg - which encodes a Pro-Gly linker including a Xmal restriction enzyme site
As mentioned above, the TCR portions of the TCR therapeutic agent combinations disclosed herein are targeting moieties. The TCRs of the invention target TCR ligands such as peptide-MHC or CDl -antigen complexes. As such, it would be desirable if these TCR had a higher affinity and/or a slower off-rate for the TCR ligands than native TCRs specific for that ligand. The inventors co-ending application WO 2004/044004 details methods of producing TCR having a higher affinity and/or a slower off-rate for the TCR ligand than native TCRs specific for that ligand. Preferably, the affinity (KD) of the TCR for the TCR ligand is higher than 1 μM, and/or the off-rate (koFF) is slower than 1 x 10"3 S"1. More preferably, the affinity (KD) of the TCR for the TCR ligand is higher than 1OnM, and/or the off-rate (koff) is slower than 1 x 10"4 S"1. Most preferably, the affinity (KD) of the TCR for the TCR ligand is higher than InM, and/or the off-rate (koff) is slower than 1 x 10"5 S" .
The affinity (KD) and/or off-rate (kOff) measurement can be made by any of the known methods. A preferred method is the Surface Plasmon Resonance (Biacore) method of Example 3.
In one broad aspect, the TCRs of the invention are in the form of either single chain TCRs (scTCRs) or dimeric TCRs (dTCRs) as described in WO 04/033685 and WO 03/020763.
A suitable scTCR form comprises a first segment constituted by an amino acid sequence corresponding to a TCR α chain variable domain, a second segment constituted by an amino acid sequence corresponding to a TCR β chain variable domain sequence fused to the N terminus of an amino acid sequence corresponding to a TCR β chain constant domain extracellular sequence, and a linker sequence linking the C terminus of the first segment to the N terminus of the second segment.
Alternatively the first segment may be constituted by an amino acid sequence corresponding to a TCR β chain variable domain, the second segment may be constituted by an amino acid sequence corresponding to a TCR α chain variable domain sequence fused to the N terminus of an amino acid sequence corresponding to a TCR α chain constant domain extracellular sequence
More specifically the first segment may be constituted by an amino acid sequence corresponding to a TCR α chain variable domain sequence fused to the N terminus of an amino acid sequence corresponding to a TCR α chain constant domain extracellular sequence, the second segment may be constituted by an amino acid sequence corresponding to a TCR β chain variable domain fused to the N terminus of an amino acid sequence corresponding to TCR β chain constant domain extracellular sequence, and a disulfide bond may be provided between the first and second chains, said disulfide bond being one which has no equivalent in native αβ T cell receptors.
In the above scTCR forms, the linker sequence may link the C terminus of the first segment to the N terminus of the second segment, and may have the formula -PGGG- (SGGGG)5-P- (SEQ ID NO: 1) or -PGGG-(SGGGG)6-P- (SEQ ID NO: 2) wherein P is proline, G is glycine and S is serine.
A suitable dTCR form of the TCRs of the present invention comprises a first polypeptide wherein a sequence corresponding to a TCR α chain variable domain sequence is fused to the N terminus of a sequence corresponding to a TCR α chain constant domain extracellular sequence, and a second polypeptide wherein a sequence corresponding to a TCR β chain variable domain sequence fused to the N terminus a sequence corresponding to a TCR β chain constant domain extracellular sequence, the first and second polypeptides being linked by a disulfide bond which has no equivalent in native αβ T cell receptors. The first polypeptide may comprise a TCR α chain variable domain sequence is fused to the N terminus of a sequence corresponding to a TCR α chain constant domain extracellular sequence, and a second polypeptide wherein a sequence corresponding to a TCR β chain variable domain sequence is fused to the N terminus a sequence corresponding to a TCR β chain constant domain extracellular sequence, the first and second polypeptides being linked by a disulfide bond between cysteine residues substituted for Thr 48 of exon 1 of TRAC*01 and Ser 57 of exon 1 of TRBC1*O1 or TRBC2*01 or the non-human equivalent thereof. ("TR-AC" etc. nomenclature herein as per T cell receptor Factsbook, (2001) LeFranc and LeFranc, Academic Press, ISBN 0-12-441352-8)
The dTCR or scTCR form of the TCRs of the invention may have amino acid sequences corresponding to human αβ TCR extracellular constant and variable domain sequences, and a disulfide bond may link amino acid residues of the said constant domain sequences, which disulfide bond has no equivalent in native TCRs. The disulfide bond is between cysteine residues corresponding to amino acid residues whose β carbon atoms are less than 0.6 nm apart in native TCRs, for example between cysteine residues substituted for Thr 48 of exon 1 of THAC*01 and Ser 57 of exon 1 of TRBCl*01 or TRBC2*01 or the non-human equivalent thereof. Other sites where cysteines can be introduced to form the disulfide bond are the following residues in exon 1 of TRAC*01 for the TCR α chain and TRBCl*01 or TRBC2*01 for the TCR β chain:
Figure imgf000012_0001
In addition to the non-native disulfide bond referred to above, the dTCR_ or scTCR form of the TCRs of the invention may include a disulfide bond between residues corresponding to those linked by a disulfide bond in native TCRs.
The dTCR or scTCR form of the TCRs of the invention preferably does not contain a sequence corresponding to transmembrane or cytoplasmic sequences of native TCRs.
One embodiment of the invention provides a TCR associated with a therapeutic agent, wherein said therapeutic agent is a PE38 exotoxin.
PE38 exotoxin is a truncated form of a Pseudomonas exotoxin. The native polypeptide is a 66kDa protein consisting of domains IA, II, IB and III. The PE38 derivative consists of domain II, amino acids 380-399 of domain IB and domain III. As will be obvious to those skilled in the art other truncated forms of Pseudomonas exotoxin may be of use in the present invention. (For example PE40).The preferred variant of PE38 for use in the present invention contains mutations in trie domain III thereof such that the C-terminus amino acids are KDEL. These C -terminal mutations have previously been shown to increase the toxicity of the Pseudomonas exotoxin. (Kreitman et al (1995) JBiochem 307 29-37)
In a preferred embodiment said TCR associated with a PE38 exotoxin comprises the amino acid sequences of (SEQ ED NO: 73) and (SEQ ID NO: 71). (Figures 29b and 28b respectively).
PEGylated TCR Monomers
In one particular embodiment a TCR associated with a therapeutic agent of the invention is associated with at least one polyalkylene glycol chain(s). This association may be cause in a number of ways known to those skilled in the art. Bi a preferred embodiment the polyalkylene chain(s) is/are covalently linked to the TCR. In a further embodiment the polyethylene glycol chains of the present aspect of the invention comprise at least two polyethylene repeating units. Multivalent TCR Complexes
One aspect of the invention provides a multivalent TCR complex comprising at least two TCRs associated with a therapeutic agent. In one embodiment of this aspect, at least two TCR molecules are linked via linker moieties to form multivalent complexes. Such multivalent TCR complexes may be linked by either a non-peptidic polymer chain or a peptidic linker sequence. Preferably the complexes are water soluble, so the linker moiety should be selected accordingly. Furthermore, it is preferable that the linker moiety should be capable of attachment to defined positions on the TCR molecules, so that the structural diversity of the complexes formed is minimised. One embodiment of the present aspect is provided by a TCR complex of the invention wherein the polymer chain or peptidic linker sequence extends between amino acid residues of each TCR which are not located in a variable region sequence of the TCR.
Since the complexes of the invention may be for use in medicine, the linker moieties should be chosen with due regard to their pharmaceutical suitability, for example their immunogenicity.
Examples of linker moieties which fulfil the above desirable criteria are known in the art, for example the art of linking antibody fragments.
There are two classes of linker that are preferred for use in the production of multivalent TCR molecules of the present invention. A TCR complex of the invention in which the TCRs are linked by a polyalkylene glycol chain provides one embodiment of the present aspect.
The first are hydrophilic polymers such as polyalkylene glycols. The most commonly used of this class are based on polyethylene glycol or PEG, the structure of which is shown below.
HOCH2CH2O (CH2CH2O)n-CH2CH2OH Wherein n is greater than two. However, others are based on other suitable, optionally substituted, polyalkylene glycols include polypropylene glycol, and copolymers of ethylene glycol and propylene glycol.
Such polymers may be used to treat or conjugate therapeutic agents, particularly polypeptide or protein therapeutics, to achieve beneficial changes to the PK profile of the therapeutic. Such improvements in the PK profile of the PEG-therapeutic conjugate are believe to result from the PEG molecule or molecules forming a 'shell' around the therapeutic which sterically hinders the reaction with the immune system and reduces proteolytic degradation. (Casey et al, (2000) Tumor Targetting 4 235- 244) The size of the hydrophilic polymer used my in particular be selected on the basis of the intended therapeutic use of the TCR complex. Thus for example, where the product is intended to leave the circulation and penetrate tissue, for example for use in the treatment of a tumour, it may be advantageous to use low molecular weight polymers in the order of 5 KDa. There are numerous review papers and books that detail the use of PEG and similar molecules in pharmaceutical formulations. For example, see Harris & Zalipsky (1997) Chemistry and Biological Applications of Polyethylene Glycol ACS Books, Washington, D.C.
The polymer used can have a linear or branched conformation. Branched PEG molecules, or derivatives thereof, can be induced by the addition of branching moieties including glycerol and glycerol oligomers, pentaerythritol, sorbitol and lysine.
Usually, the polymer will have a chemically reactive group or groups in its structure, for example at one or both termini, and/or on branches from the backbone, to enable the polymer to link to target sites in the TCR. This chemically reactive group or groups may be attached directly to the hydrophilic polymer, or there may be a spacer group/moiety between the hydrophilic polymer and the reactive chemistry as shown below:
Reactive chemistry-Hydrophilic polymer-Reactive chemistry Reactive chemistry-Spacer-Hydrophilic polymer-Spacer-Reactive chemistry
The spacer used in the formation of constructs of the type outlined above may be any organic moiety that is a non-reactive, chemically stable, chain, Such spacers include, by are not limited to the following:
-(CH2)n- wherein n = 2 to 5 -(CH2)3NHCO(CH2)2
A multivalent TCR complex of the invention in which a divalent alkylene spacer radical is located between the polyalkylene glycol chain and its point of attachment to a TCR associated with a therapeutic agent provides a further embodiment of the present aspect.
A multivalent TCR complex of the invention in which the polyalkylene glycol chain comprises at least two polyethylene glycol repeating units provides a further embodiment of the present aspect.
A wide variety of coupling chemistries can be used to couple polymer molecules to protein and peptide therapeutics. The choice of the most appropriate coupling chemistry is largely dependant on the desired coupling site. For example N- maleimide, Vinyl sulfone, Benzotriazole carbonate, Succinimidyl proprionate, Succinimidyl butanoate, Thio-ester, Acetaldehyde, Acrylate, Biotin and Primary amine coupling chemistries have been used attached to one or more of the termini of PEG molecules (Source: Nektar Molecular Engineering Catalogue 2003):
As stated above non-PEG based polymers also provide suitable linkers for multimerising the TCRs of the present invention. For example, moieties containing maleimide termini linked by aliphatic chains such as BMH and BMOE (Pierce, products Nos. 22330 and 22323) can be used.
Peptidic linkers are the other class of TCR linkers. These linkers are comprised of chains of amino acids, and function to produce simple linkers or multimerisation domains onto which TCR molecules can be attached. The biotin / streptavidin system has previously been used to produce TCR tetramers (see WO/99/60119) for in-vitro binding studies. However, strepavidin is a microbially-derived polypeptide and as such not ideally suited to use in a therapeutic.
A TCR complex of the invention in which the TCRs are linked by a peptidic linker derived from a human multimerisation domain provides a further embodiment of the present aspect. There are a number of human proteins that contain a multimerisation domain that could be used in the production of multivalent TCR complexes. For example the tetramerisation domain of p53 which has been utilised to produce tetramers of scFv antibody fragments which exhibited increased serum persistence and significantly reduced off-rate compared to the monomelic scFV fragment. (Willuda et al. (2001) J. Biol. Chem. 276 (17) 14385-14392) Haemoglobin also has a tetramerisation domain that could potentially be used for this kind of application.
Soluble TCRs or multivalent TCR complexes of the invention may be linked to an enzyme capable of converting a prodrug to a drug. This allows the prodrug to be converted to the drug only at the site where it is required (i.e. targeted by the sTCR).
Therapeutic Use
The invention also provides a method for delivering a therapeutic agent to a target cell, which method comprises contacting potential target cells with a TCR or multivalent TCR complex in accordance with the invention under conditions to allow attachment of the TCR or multivalent TCR complex to the target cell, said TCR or multivalent TCR complex being specific for a given peptide-MHC complex.
In particular, the soluble TCR or multivalent TCR complex of the present invention can be used to deliver therapeutic agents to the location of cells presenting a particular antigen. This would be useful in many situations, for example, against tumours or sites of autoimmune disease. A therapeutic agent could be delivered such that it would exercise its effect locally but not only on the cell to which it binds. Thus, one particular strategy envisages immunostimulatory molecules linked to TCRs or multivalent TCR complexes according to the invention specific for tumour antigens. For cancer treatment, the localisation in the vicinity of tumours or metastasis would enhance the effect of toxins or immunostimulants. Alternatively, the soluble TCR or multivalent TCR complex of the present invention can be used to deliver immunoinhibitory agents to the location of cells presenting a particular antigen related to an autoimmune disease. For example, an Islet cell-specific TCR could be used to deliver an immunoinhibitory agent, such as IL-IO, IL-4 or IL- 13 or a functional variant or fragment of any of the foregoing to the Islet cells of a patient suffering from diabetes.
For vaccine delivery, the vaccine antigen could be localised in the vicinity of antigen presenting cells, thus enhancing the efficacy of the antigen.
It is envisaged that the administration of an interferon (IFN), such as IFN-γ, to a patient prior to, and/or simultaneously with, the administration of the TCR associated with a therapeutic agent may increase levels of peptide-MHC expression on the target cells. This may be of particular benefit in the treatment of cancer.
Further embodiments of the invention are provided by a pharmaceutical composition comprising a TCR associated with a therapeutic agent or a multivalent TCR complex thereof together with a pharmaceutically acceptable carrier.
The invention also provides a method of treatment of cancer comprising administering to a subject suffering such cancer disease an effective amount of a TCR associated with a therapeutic agent or a multivalent TCR complex thereof. In a related embodiment the invention provides for the use of a TCR associated with a therapeutic agent or a multivalent TCR complex thereof, in the preparation of a composition for the treatment of cancer. IL-15, IL-21 or Anti-CD3 antibody or a functional variant or fragment of the foregoing, are particularly preferred therapeutic agents for use in the treatment of cancer. The invention also provides a method of treatment of autoimmune disease, organ rejection or GVHD comprising administering to a subject suffering such an autoimmune disease, organ rejection or GVHD an effective amount of a TCR associated with a therapeutic agent or a multivalent TCR complex thereof. In a related embodiment the invention provides for the use of a TCR associated with a therapeutic agent or a multivalent TCR complex thereof, in the preparation of a composition for the treatment of autoimmune disease, organ rejection or GVHD. Preferred therapeutic agents for use in the treatment of autoimmune disease, organ rejection or GVHD are IL-IO, IL-4 and IL- 13 or a functional variant or fragment of any of the foregoing. In another related embodiment the dTCR or scTCR of the invention is tissue-specific, hi further related embodiment the dTCR or scTCR is specific for a tissue which is a target for auto-reactive T cells in autoimmune disease, organ rejection or Graft Versus Host Disease (GVHD). In a specific embodiment the invention provides a method of treating diabetes, wherein the dTCR or scTCR is islet cell-specific.
Cancers which may benefit the methods of the present invention include: leukaemia, head, neck, lung, breast, colon, cervical, liver, pancreatic, ovarian and testicular)
Auto-immune diseases which may benefit the methods of the following invention include:
Acute disseminated encephalomyelitis
Adrenal insufficiency
Allergic angiitis and granulomatosis Amylodosis
Ankylosing spondylitis
Asthma
Autoimmune Addison's disease
Autoimmune alopecia Autoimmune chronic active hepatitis
Autoimmune haemolytic anaemia
Autoimmune Neutrogena
Autoimmune thrombocytopenic purpura Behcet's disease
Cerebellar degeneration
Chronic active hepatitis
Chronic inflammatory demyelinating polyradiculoneuropathy Chronic neuropathy with monoclonal gammopathy
Classic polyarteritis nodosa
Congenital adrenal hyperplasia
Cryopathies
Dermatitis herpetiformis Diabetes
Eaton-Lambert myasthenic syndrome
Encephalomyelitis
Epidermolysis bullosa acquisita
Erythema nodosa Gluten- sensitive enteropathy
Goodpasture's syndrome
Guillain-Barre syndrome
Hashimoto's thyroiditis
Hyperthyroidism Idiopathic hemachromatosis
Idiopathic membranous glomerulonephritis
Isolated vasculitis of the central nervous system
Kawasaki's disease
Minimal change renal disease Miscellaneous vasculitides
Mixed connective tissue disease
Multifocal motor neuropathy with conduction block
Multiple sclerosis
Myasthenia gravis Opsoclonus-myoclonus syndrome
Pemphigoid
Pemphigus pernicious anaemia Polymyositis/dermatonryositis
Post-infective arthritides
Primary biliary sclerosis
Psoriasis Reactive arthritides
Reiter's disease
Retinopathy
Rheumatoid arthritis
Sclerosing cholangitis Sjogren's syndrome
Stiff-man syndrome
Subacute thyroiditis
Systemic lupus erythematosis
Systemic necrotizing vasculitides Systemic sclerosis (scleroderma)
Takayasu's arteritis
Temporal arteritis
Thromboangiitis obliterans
Type I and type II autoimmune polyglandular syndrome Ulcerative colitis
Uveitis
Wegener's granulomatosis
Therapeutic compositions in accordance with the invention will usually be supplied as part of a sterile, pharmaceutical composition which will normally include a pharmaceutically acceptable carrier. This pharmaceutical composition may be in any suitable form, (depending upon the desired method of administering it to a patient). It may be provided in unit dosage form, will generally be provided in a sealed container and may be provided as part of a kit. Such a kit would normally (although not necessarily) include instructions for use. It may include a plurality of said unit dosage forms. The pharmaceutical composition may be adapted for administration by any appropriate route, for example parenteral, transdermal or via inhalation, preferably a parenteral (including subcutaneous, intramuscular, or, most preferably intravenous) route. Such compositions may be prepared by any method known in the art of pharmacy, for example by mixing the active ingredient with the carrier(s) or excipient(s) under sterile conditions.
Dosages of the substances of the present invention can vary between wide limits, depending upon the disease or disorder to be treated, the age and condition of the individual to be treated, etc. and a physician will ultimately determine appropriate dosages to be used.
Additional Aspects
A scTCR or dTCR associated with a therapeutic agent (which TCR preferably is constituted by constant and variable sequences corresponding to human sequences) may be provided in substantially pure form, or as a purified or isolated preparation. For example, it may be provided in a form which is substantially free of other proteins.
Preferred features of each aspect of the invention are as for each of the other aspects mutatis mutandis. The prior art documents mentioned herein are incorporated to the fullest extent permitted by law.
Examples
The invention is further described in the following examples, which do not limit the scope of the invention in any way.
Reference is made in the following to the accompanying drawings in which:
Figures Ia and Ib show respectively the nucleic acid sequences of the α and β chains of a soluble A6 TCR, mutated so as to introduce a cysteine codon. The shading indicates the introduced cysteine codon; Figure 2a shows the A6 TCR α chain extracellular amino acid sequence, including the T48 — » C mutation (underlined) used to produce the novel disulphide inter-chain bond, and Figure 2b shows the A6 TCR β chain extracellular amino acid sequence, including the S57 — » C mutation (underlined.) used to produce the novel disulphide inter-chain bond;
Figure 3 a shows the A6 TCR α chain sequence including novel cysteine residue mutated to incorporate a BamHl restriction site. Shading indicates the mutations introduced to form the BamHl restriction site.
Figures 3b and 3 c show the DNA sequence of α and β chain of the JM22 TCR mutated to include additional cysteine residues to form a non-native disulphide bond;
Figures 4a and 4b show respectively the J1VI22 TCR α and β chain extracellular amino acid sequences produced from the DNA sequences of Figures 3b and 3c;
Figures 5 a and 5b show respectively the DNA sequences of the α and β chains of a soluble AH- 1.23 TCR5 mutated so as to introduce a novel cysteine codon (indicated by shading).
Figures 6a and 6b show respectively the AH-1.23 TCR α and β chain extracellular amino acid sequences produced from the DNA sequences of Figures 5a and 5b;
Figure 7a - DNA sequence of mature human IL- 10.
Figure 7b - Amino acid sequence of mature human IL-10.
Figure 8a - DNA sequence of AHl .23 TCR β chain containing a non-native cysteine involved in the formation of a novel interchain bond linked to mature human IL-10 via a Pro-Gly linker. The introduced cysteine is indicated by shading. The DNA sequence encoding the Pro-Gly linker is underlined. Figure 8b - Amino acid sequence of AH 1.23 TCR β chain corxtaining a non-native cysteine codon involved in the formation of a novel interchain bond linked to mature human IL-10 via a Pro-Gly linker. The introduced cysteine is indicated by shading. The Pro-Gly linker is underlined.
Figure 9a - DNA sequence of AHl.23 TCR β chain containing a non-native cysteine involved in the formation of a novel interchain bond linked to mature human IL-10 via a Gly-Ser-Gly-Gly-Pro linker. The introduced cysteine is indicated by shading. The DNA sequence encoding the Gly-Ser-Gly-Gly-Pro linker is underlined.
Figure 9b - Amino acid sequence of AH 1.23 TCR β chain containing a non-native cysteine codon involved in the formation of a novel interchain bond linked to mature human IL-10 via a Gly-Ser-Gly-Gly-Pro linker. The introduced cysteine is indicated by shading. The Gly-Ser-Gly-Gly-Pro linker is underlined.
Figure 10a- DNA sequence of AH 1.23 TCR β chain containing a non-native cysteine involved in the formation of a novel interchain bond linked to mature human IL-10 via a Gly-Ser-Gly-Gly-Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly-Pro linker. The introduced cysteine is indicated by shading. The DNA sequence encoding the Gly-Ser-Gly-Gly-Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly-Pro linker is underlined.
Figure 10b - Amino acid sequence of AHl.23 TCR β chain containing a non-native cysteine codon involved in the formation of a novel interchain bond linked to mature human IL-10 via a Gly-Ser-Gly-Gly-Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly- Pro linker. The introduced cysteine is indicated by shading. The Gly-Ser-Gly-Gly- Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly-Pro linker is xmderlined.
Figure 11 a - DNA sequence of mature human IL-4.
Figure 1 Ib — Amino acid sequence of mature human IL-4. Figure 12a - DNA sequence of AHl.23 TCR β chain containing a non-native cysteine involved in the formation of a novel interchain bond linked to mature human IL-4 via a Pro-Gly linker. The introduced cysteine is indicated by shading. The DNA sequence encoding the Pro-Gly linker is underlined.
Figure 12b - Amino acid sequence of AH 1.23 TCR β chain containing a non-native cysteine codon involved in the formation of a novel interchain bond linked to mature human IL-4 via a Pro-Gly linker. The introduced cysteine is indicated by shading. The Pro-Gly linker is underlined.
Figure 13a- DNA sequence of AH 1.23 TCR β chain containing a non-native cysteine involved in the formation of a novel interchain bond linked to mature human IL-4 via a GIy-S er-Gly-Gly-Pro linker. The introduced cysteine is indicated by shading. The DNA sequence encoding the GIy-S er-Gly-Gly-Pro linker is underlined.
Figure 13b - Amino acid sequence of AHl .23 TCR β chain containing a non-native cysteine codon involved in the formation of a novel interchain bond linked to mature human IL-4 via a Gly-Ser-Gly-Gly-Pro linker. The introduced cysteine is indicated by shading. The Gly-Ser-Gly-Gly-Pro linker is underlined.
Figure 14a - DNA sequence of AH 1.23 TCR β chain containing a non-native cysteine involved in the formation of a novel interchain bond linked to mature human IL-4 via a Gly-Ser-Gly-Gly-Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly-Pro linker. The introduced cysteine is indicated by shading. The DNA sequence encoding the GIy- Ser-Gly-Gly-Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly-Pro linker is underlined.
Figure 14b — Amino acid sequence of AHl.23 TCR β chain containing a non-native cysteine codon involved in the formation of a novel interchain bond linked to mature human IL-4 via a Gly-Ser-Gly-Gly-Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly- Pro linker. The introduced cysteine is indicated by shading. The Gly-Ser-Gly-Gly- Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly-Pro linker is underlined. Figure 15a - DNA sequence of mature human IL-13.
Figure 15b - Amino acid sequence of mature human IL-13.
Figure 16a - DNA sequence of AH1.23 TCR β chain containing a non-native cysteine involved in the formation of a novel interchain bond linked to mature human IL-13 via a Pro-Gly linker. The introduced cysteine is indicated by shading. The DNA sequence encoding the Pro-Gly linker is underlined.
Figure 16b - Amino acid sequence of AHl .23 TCR β chain containing a non-native cysteine codon involved in the formation of a novel interchain bond linked to mature human IL-13 via a Pro-Gly linker. The introduced cysteine is indicated by shading. The Pro-Gly linker is underlined.
Figure 17a - DNA sequence of AHl .23 TCR β chain containing a non-native cysteine involved in the formation of a novel interchain bond linked to mature human IL-13 via a Gly-Ser-Gly-Gly-Pro linker. The introduced cysteine is indicated by shading. The DNA sequence encoding the Gly-Ser-Gly-Gly-Pro linker is underlined.
Figure 17b — Amino acid sequence of AH 1.23 TCR β chain containing a non-native cysteine codon involved in the formation of a novel interchain bond linked to mature human IL-13 via a Gly-Ser-Gly-Gly-Pro linker. The introduced cysteine is indicated by shading. The Gly-Ser-Gly-Gly-Pro linker is underlined.
Figure 18a- DNA sequence of AH1.23 TCR β chain containing a non-native cysteine involved in the formation of a novel interchain bond linked to mature human IL-13 via a Gly-Ser-Gly-Gly-Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly-Pro linker. The introduced cysteine is indicated by shading. The DNA sequence encoding the Gly-Ser-Gly-Gly-Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly-Pro linker is underlined.
Figure 18b - Amino acid sequence of AHl.23 TCR β chain containing a non-native cysteine codon involved in the formation of a novel interchain bond linked to mature human IL-13 via a Gly-Ser-Gly-Gly-Gly-Gly-Ser-Gry-Gly-Ser-Gly-Gly-Ser-Gly-Gly- Pro linker. The introduced cysteine is indicated by shading. The Gly-Ser-Gly-Gly- Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly-Pro linker is underlined.
Figure 19 details the DNA sequence of the pEX821 plasmid.
Figure 20 provides a plasmid map of the pEX821 vector, the DNA sequence of which is provided by Figure 19.
Figure 21 details the DNA sequence of the pEX954 plasmid.
Figure 22 provides a plasmid map of the pEX954 plasmid, the DNA sequence of which is provided by Figure 21.
Figure 23 a details the DNA sequence encoding the high affinity c61 NY-ESO MTCR beta chain and Figure 23b details the AA sequence encoded by the DNA sequence of Figure 23 a.
Figure 24a details the DNA sequence encoding the high affinity c61 NY-ESO MTCR beta chain linked at the C-terminus thereof via a peptide linker to IL-18. Figure 24b details the AA sequence of this fusion protein, the peptide linker is underlined.
Figure 25 a details the DNA sequence encoding IL- 18 pro-protein linked at the C- terminus thereof via a peptide linker to the high affinity c61 NY-ESO MTCR beta chain. The pro-IL-18 DNA has been altered to encode a Factor X cleavage site. Figure 25b details the AA sequence of this fusion protein, the peptide linker is underlined.
Figure 26a details the DNA sequence encoding the high affinity c61 NY-ESO MTCR beta chain linked at the C-terminus thereof via a peptide linker to IL-IO. Figure 26b details the AA sequence of this fusion protein, the peptide linker is underlined. Figure 27a details the DNA sequence encoding the high affinity c61 NY-ESO MTCR beta chain linked at the C-terminus thereof via a peptide linker to IL-13. Figure 27b details the AA sequence of this fusion protein, the peptide linker is underlined.
Figure 28a details the DNA sequence encoding the high affinity c61 NY-ESO MTCR beta chain linked at the C-terminus thereof via a peptide linker to the "KDEL" variant of the PE38 exotoxin. Figure 28b details the AA sequence of this fusion protein, the peptide linker is underlined.
Figure 29a details the DNA sequence encoding the high affinity c58 NY-ESO MTCR alpha chain and Figure 29b details the AA sequence encoded by the DNA sequence of Figure 29a.
Example 1 —Design of primers and mutagenesis ofA6 Tax TCR a and β chains
For mutating A6 Tax threonine 48 of exon 1 in TRAC*01to cysteine, the following primers were designed (mutation shown in lower case):
5'-C ACA GAC AAA tgT GTG CTA GAC AT (SEQ ID NO: 3) 5'-AT GTC TAG CAC Aca TTT GTC TGT G (SEQ ID NO: 4)
For mutating A6 Tax serine 57 of exon 1 in both TRBC 1*01 and TRBC2*01 to cysteine, the following primers were designed (mutation shown in lower case):
5 '-C AGT GGG GTC tGC ACA GAC CC (SEQ ID NO: 5) 5'-GG GTC TGT GCa GAC CCC ACT G (SEQ ID NO: 6)
PCR mutagenesis:
Expression plasmids containing the genes for the A6 Tax TCR α or β chain were mutated using the α-chain primers or the β-chain primers respectively, as follows. 100 ng of plasmid was mixed with 5 μl 10 mM dNTP, 25 μl lOxPfu-buffer (Stratagene), 10 units Pfu polymerase (Stratagene) and the final volume was adjusted to 240 μl with H2O. 48 μl of this mix was supplemented with primers diluted to give a final concentration of 0.2 μM in 50 μl final reaction volume. After an initial denaturation step of 30 seconds at 95°C, the reaction mixture was subjected to 15 rounds of denaturation (950C, 30 sec), annealing (55°C, 60 sec), and elongation (73°C, 8 min.) in a Hybaid PCR express PCR machine. The product was then digested for 5 hours at 37°C with 10 units of Dpnl restriction enzyme (New England Biolabs). 10 μl of the digested reaction was transformed into competent XLl -Blue bacteria and grown for 18 hours at 370C. A single colony was picked and grown over night in 5 ml TYP + ampicillin (16 g/1 Bacto-Tryptone, 16 g/1 Yeast Extract, 5 g/1 NaCl, 2.5 g/1 K2HPO4, 100 mg/1 Ampicillin). Plasmid DNA was purified on a Qiagen mini-prep column according to the manufacturer's instructions and the sequence was verified by automated sequencing. The respective mutated nucleic acid and amino acid sequences are shown in Figures Ia and 2a for the α chain and Figures Ib and 2b for the β chain.
Example 2 — Expression, refolding and purification of soluble TCR
The expression plasmids containing the mutated α-chain and β-chain respectively were transformed separately into E.coli strain BL21pLysS, and single ampicillin- resistant colonies were grown at 37°C in TYP (ampicillin lOOμg/ml) medium to OD600 of 0.4 before inducing protein expression with 0.5mM IPTG. Cells were harvested three hours post-induction by centrifugation for 30 minutes at 4000rpm in a Beckman J-6B. Cell pellets were re-suspended in a buffer containing 5OmM Tris- HCI, 25% (w/v) sucrose, ImMNaEDTA, 0.1% (w/v) NaAzide, 1OmM DTT, pH 8.0. After an overnight freeze-thaw step, re-suspended cells were sonicated in 1 minute bursts for a total of around 10 minutes in a Milsonix XL2020 sonicator using a standard 12mm diameter probe. Inclusion body pellets were recovered by centrifugation for 30 minutes at 13000rpm in a Beckman J2-21 centrifuge. Three detergent washes were then carried out to remove cell debris and membrane components. Each time the inclusion body pellet was homogenised in a Triton buffer (5OmM Tris-HCL 0.5% Triton-XIOO, 20OmM NaCI, 1OmM NaEDTA, 0.1% (w/v) NaAzide, 2mM DTT, pH 8.0) before being pelleted by centrifugation for 15 minutes at 13000rpm in a Beckman J2-21. Detergent and salt was then removed by a similar wash in the following buffer: 5OmM Tris-HCl, ImM NaEDTA, 0.1% (w/v) NaAzide, 2mM DTT, pH 8.0. Finally, the inclusion bodies were divided into 30 mg aliquots and frozen at -70°C. Inclusion body protein yield was quantitated by solubilising with 6M guanidine-HCl and measurement with a Bradford dye-binding assay (PerBio).
Denaturation of soluble TCRs; 30mg of the solubilised TCR β-chain inclusion body and 60mg of the solubilised TCR α-chain inclusion body was thawed from frozen stocks. The inclusion bodies were diluted to a final concentration of 5mg/ml in 6M guanidine solution, and DTT (2M stock) was added to a final concentration of 1OmM. The mixture was incubated at 37°C for 30 min.
Refolding of soluble TCRs: 1 L refolding buffer was stirred vigorously at 50C ± 30C. The redox couple (2-mercaptoethylamine and cystamine (to final concentrations of 6.6mM and 3.7mM, respectively) were added approximately 5 minutes before addition of the denatured TCR chains. The protein was then allowed to refold for approximately 5 hours ± 15 minutes with stirring at 50C ± 30C. Dialysis of refolded soluble TCRs: The refolded TCR was dialysed in Spectrapor 1 membrane (Spectrum; Product No. 132670) against 10 L 10 mM Tris pH 8.1 at 5°C ± 30C for 18-20 hours. After this time, the dialysis buffer was changed to fresh 10 mM Tris pH 8.1 (10 L) and dialysis was continued at 50C ± 3°C for another 20-22 hours.
Example 3 - BIAcore surface plasmon resonance characterisation ofsTCR binding to specific pMHC
A surface plasmon resonance biosensor (BIAcore 3000™ ) was used to analyse the binding of a sTCR to its peptide-MHC ligand. This was facilitated by producing single pMHC complexes (described below) which were immobilised to a streptavidin- coated binding surface in a semi-oriented fashion, allowing efficient testing of the binding of a soluble T-cell receptor to up to four different pMHC (immobilised on separate flow cells) simultaneously. Manual injection of HLA complex allows the precise level of immobilised class I molecules to be manipulated easily. Such immobilised complexes are capable of binding both T-cell receptors and the coreceptor CD8αα, both of which may be injected in the soluble phase. Specific binding of TCR is obtained even at low concentrations (at least 40μg/ml), implying the TCR is relatively stable. The pMHC binding properties of sTCR are observed to be qualitatively and quantitatively similar if sTCR is used either in the soluble or immobilised phase. This is an important control for partial activity of soluble species and also suggests that biotinylated pMHC complexes are biologically as active as non-biotinylated complexes.
Biotinylated class I HLA- A2 - peptide complexes were refolded in vitro from bacterially-expressed inclusion bodies containing the constituent subunit proteins and synthetic peptide, followed by purification and in vitro enzymatic biotinylation (O'Callaghan et al. (1999) Anal. Biochem. 266: 9-15). HLA-heavy chain was expressed with a C-terminal biotinylation tag which replaces the transmembrane and cytoplasmic domains of the protein in an appropriate construct. Inclusion body expression levels of ~75 mg/litre bacterial culture were obtained. The HLA light- chain or β2-microglobulin was also expressed as inclusion bodies in E.coli from an appropriate construct, at a level of ~500 mg/litre bacterial culture.
E. coli cells were lysed and inclusion bodies are purified to approximately 80% purity. Protein from inclusion bodies was denatured in 6 M guanidine-HCl, 50 niM Tris pH 8.1, 100 rnM NaCl, 10 mM DTT, 10 mM EDTA, and was refolded at a concentration of 30 mg/litre heavy chain, 30 mg/litre β2m into 0.4 M L-Arginine-HCl, 100 mM Tris pH 8.1, 3.7 mM cystamine, mM cysteamine, 4 mg/ml peptide (e.g. tax 11-19), by addition of a single pulse of denatured protein into refold buffer at < 5°C. Refolding was allowed to reach completion at 40C for at least 1 hour.
Buffer was exchanged by dialysis in 10 volumes of 10 mM Tris pH 8.1. Two changes of buffer were necessary to reduce the ionic strength of the solution sufficiently. The protein solution was then filtered through a 1.5μm cellulose acetate filter and loaded onto a POROS 50HQ anion exchange column (8 ml bed volume). Protein was eluted with a linear 0-500 mM NaCl gradient. HLA- A2 -peptide complex eluted at approximately 250 rtiM NaCl, and peak fractions were collected, a cocktail of protease inhibitors (Calbiochem) was added and the fractions were chilled on ice.
Biotinylation tagged HLA complexes were buffer exchanged into 10 niM Tris pH 8.1, 5 mM NaCl using a Pharmacia fast desalting column equilibrated in the same buffer. Immediately upon elution, the protein-containing fractions were chilled on ice and protease inhibitor cocktail (Calbiochem) was added. Biotinylation reagents were then added: 1 mM biotin, 5 mM ATP (buffered to pH 8), 7.5 mM MgC12, and 5 μg/ml BirA enzyme (purified according to O'Callaghan et al. (1999) Anal. Biochem. 266: 9- 15). The mixture was then allowed to incubate at room temperature overnight.
Biotinylated HLA complexes were purified using gel filtration chromatography. A Pharmacia Superdex 75 HR 10/30 column was pre-equilibrated with filtered PBS and 1 ml of the biotinylation reaction mixture was loaded and the column was developed with PBS at 0.5 ml/min. Biotinylated HLA complexes eluted as a single peak at approximately 15 ml. Fractions containing protein were pooled, chilled on ice, and protease inhibitor cocktail was added. Protein concentration was determined using a Coomassie-binding assay (PerBio) and aliquots of biotinylated HLA complexes were stored frozen at -2O0C. Streptavidin was immobilised by standard amine coupling methods.
The interactions between A6 Tax sTCR containing a novel inter-chain bond and its ligand/ MHC complex or an irrelevant HLA-peptide combination, the production of which is described above, were analysed on a BIAcore 3000™ surface plasmon resonance (SPR) biosensor. SPR measures changes in refractive index expressed in response units (RU) near a sensor surface within a small flow cell, a principle that can be used to detect receptor ligand interactions and to analyse their affinity and kinetic parameters. The probe flow cells were prepared by immobilising the individual HLA- peptide complexes in separate flow cells via binding between the biotin cross linked onto β2m and streptavidin which have been chemically cross linked to the activated surface of the flow cells. The assay was then performed by passing sTCR over the surfaces of the different flow cells at a constant flow rate, measuring the SPR response in doing so. Initially, the specificity of the interaction was verified by passing sTCR at a constant flow rate of 5 μl min-1 over two different surfaces; one coated with -5000 RU of specific peptide-HLA complex, the second coated with -5000 RU of non-specific peptide-HLA complex . Injections of soluble sTCR at constant flow rate and different concentrations o^ver the peptide-HLA complex were used to define the background resonance. The values of these control measurements were subtracted from the values obtained with specific peptide-HLA complex and used to calculate binding affinities expressed as the dissociation constant, Kd (Price & Dwek, Principles and Problems in Physical Chemistry for Biochemists (2nd Edition) 1979, Clarendon Press, Oxford).
The Kd value obtained (1.8μM) is close to that reported for the interaction between A6 Tax sTCR without the novel di-sulphide bond and pMHC (0.91 μM - Ding et al, 1999, Immunity 11:45-56).
Example 4 — Production of soluble JM22 TCR containing a novel disulphide bond.
The β chain of the soluble A6 TCR prepared in Example 1 contains in the native sequence a BgIII restriction site (AAGCTT) suitable for use as a ligation site.
PCR mutagenesis was carried as detailed below to introduce a BamHl restriction site (GGATCC) into the α chain of soluble A6 TCR5, 5' of the novel cysteine codon. The sequence described in Figure Ia was used as a template for this mutagenesis. The following primers were used:
IBamHI I
5'-ATATCCAGAACCCgGAtCCTGCCGTGTA-3'(SEQIDNO: 7) 5'-TACACGGCAGGAaTCcGGGTTCTGGATAT-3' (SEQIDNO: 8)
100 ng of plasmid was mixed with 5 μl 10 niM dNTP, 25 μl lOxPfu-buffer (Stratagene), 10 units PfU polymerase (Stratagerie) and the final volume was adjusted to 240 μl with H2O. 48 μl of this mix was supplemented with primers diluted to give a final concentration of 0.2 μM in 50 μl final reaction volume. After an initial denaturation step of 30 seconds at 95°C, the reaction mixture was subjected to 15 rounds of denaturation (950C, 30 sec), annealing (55°C, 60 sec), and elongation (73 °C, 8 min.) in a Hybaid PCR express PCR machine. The product was then digested for 5 hours at 370C with 10 units of Dpnl restriction enzyme (New England Bio labs). 10 μl of the digested reaction was transformed into competent XLl -Blue bacteria and grown for 18 hours at 37°C. A single colony was picked and grown over night in 5 ml TYP + ampicillin (16 g/1 Bacto-Tryptone, 16 g/1 Yeast Extract, 5 g/1 NaCl, 2.5 g/1 K2HPO4, 100 mg/1 Ampicillin). Plasmid DNA was purified on a Qiagen mini-prep column according to the manufacturer's instructions and. the sequence was verified by automated sequencing. The mutations introduced into the α chain were "silent", therefore the amino acid sequence of this chain remained unchanged from that detailed in Figure 2a. The DNA sequence for the mutated α chain is shown in Figure 3 a.
In order to produce a soluble JM22 TCR incorporating a novel disulphide bond, A6 TCR plasmids containing the α chain BamHl and β chain BgIII restriction sites were used as templates. The following primers were used:
I Ndel I 5 ' -GGAGATATACATATGCAACTACTAGAACAA- 3 ' (SEQ ID NO: 9)
5 ' -TACACGGCAGGATCCGGGTTCTGGATATT-S ' (SEQ ID NO : 10)
I BamHI
I Ndel I
5 ' -GGAGATATACATATGGTGGATGGTGGAATC-3 ' (SEQIDNO: 11)
5' -CCCAAGCTTAGTCTGCTCTACCCCAGGCCTCGGC-S '(SEQ IDNO: 12)
|BglIl|
JM22 TCR α and β-chain constructs were obtained by PCR cloning as follows. PCR reactions were performed using the primers as shown above, and templates containing the JM22 TCR chains. The PCR products were restriction digested with the relevant restriction enzymes, and cloned into pGMT7 to obtain expression plasmids. The sequence of the plasmid inserts were confirmed by automated DNA sequencing. Figures 3b and 3c show the DNA sequence of the mutated α and β chains of the JM22 TCR respectively, and Figures 4a and 4b show the resulting amino acid sequences.
The respective TCR chains were expressed, co-refolded and purified as described in Examples 1 and 2.
A Biacore analysis of the binding of the JM22 TCR to pMHC was carried out as described in Example 3. The Kd of this disulphide-linked TCR for the HLA- flu complex was determined to be 7.9 ± 0.51 μM
Example 5 — Production of soluble AH-1.23 TCR containing a novel disulphide inter¬ chain bond
cDNA encoding AH- 1.23 TCR was isolated from T cells supplied by Hill Gaston (Medical School, Addenbrooke's Hospital, Cambridge) according to known techniques. cDNA encoding NY-ESO TCR was produced by treatment of the HiRNA with reverse transcriptase.
In order to produce a soluble AH- 1.23 TCR incorporating a novel disulphide bond, TCR plasmids containing the α chain BamHI and β chain BgIII restriction sites were used as a framework as described in Example 4. The following primers were used:
Ndel I 5'-GGGAAGCTTACATATGAAGGAGGTGGAGCAGAATTCTGG-3 '(SEQIDNO: 13)
5' -TACACGGCAGGATCCGGGTTCTGGATATT-3 '(SEQIDNO: 14)
I BamHII
I Ndel I 5 ' - TTGGAATTCACATATGGGCGTCATGCAGAACCCAAGACAC - 3
(SEQ ID NO: 15)
5 ' -CCCAAGCTTAGTCTGCTCTACCCCAGGCCTCGGC-S ' (SEQ ID NO: 16) l Bglll l AH- 1.23 TCR α and β-chain constructs were obtained by PCR cloning as follows. PCR reactions were performed using the primers as shown above, and templates containing the AH-1.23 TCR chains. The PCR products were restriction digested with the relevant restriction enzymes, and cloned into pGMT7 to obtain expression plasmids. The sequence of the plasmid inserts were confirmed by automated DNA sequencing. Figures 5a and 5b show the DNA sequence of the mutated α and β chains of the AH- 1.23 TCR respectively, and Figures 6a and 6b show the resulting amino acid sequences.
The respective TCR chains were expressed, co-refolded and purified as described in Example 2.
Example 6 — Production of a soluble AH- 1.23 TCR - IL-IO fusion protein.
Synthetic genes including the mature human IL-10 DNA sequence detailed in Figure 7a and one of a number of DNA extensions at the 5' end of the IL-10 DNA sequence can then be produced. The 5' DNA extensions are linker sequences used to attach the IL-IO DNA to that encoding the AHl.23 TCR β chain.
Linker sequences:
cccggg - which encodes a Pro-Gly linker including a Xmal restriction enzyme site ggatccggcggtccg - (SEQ ID NO: 17) which encodes a Gly-Ser-Gly-Gly-Pro (SEQ ID NO: 18) linker including a BamHl restriction enzyme site. ggatccggtgggggcggaagtggaggcagcggtggatocggcggtccg - (SEQ ID NO : 19) which encodes a Gly-Ser-Gly-Gly-Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly-Pro (SEQ ID NO: 20) linker including two BamHl restriction enzyme sites.
One of the above synthetic genes is then sub-cloned into the pGMT7 plasmid containing the AHl .23 TCR β chain, produced as described in Example 5 to form a DNA sequence encoding the TCR β chain-linker-IL-10 fusion protein. The DNA and amino acid sequence of the AHl .23 TCR β chain - Pro-Gly - IL- 10 fusion is detailed in Figures 8a and 8b respectively.
The DNA and amino acid sequence of the AHl.23 TCR β chain - Gly-Ser-Gly-Gly- Pro (SEQ ID NO: 18) - IL-IO fusion is detailed in Figures 9a and 9b respectively.
The DNA and amino acid sequence of the AHl .23 TCR β chain - Gly-Ser-Gly-Gly- Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly -Pro- (SEQ ID NO: 20) IL-IO fusion is detailed in Figures 10a and 10b respectively.
These AHl.23 TCR β chain - Linker- IL-IO fusion proteins are then refolded with the AHl.23 TCR α chain using the methods detailed in Example 2 to produce the complete soluble AHl.23 TCR-IL-10 fusion protein.
The methods detailed above describe the production of a soluble αβTCR onto which an IL-10 monomer is attached to the C-terminus of the TCR β chain. IL-10 is often found in the form of a homodimer. Therefore, it may be advantageous to dimerise the IL-10 polypeptide attached to the soluble AHl.23 TCR. This can be achieved in a number of ways. For example, a single-chain version of the mature form human IL-10 homodimer can be fused to the TCR β prior to refolding with the TCR α chain.
Alternatively, mature form human IL-10 can be added in solution to either the TCR β Chain-IL-10 fusion proteins formed as described above prior to refolding with the soluble TCR α chain, or to the refolded αβTCR-IL-10 fusion proteins. Alternatively, an additional IL-10 molecule can be added to the TCR α chain as a fusion protein using the methods described in this example for the production of the TCR β chain - IL-10 fusion protein. The two TCR chain-EL-10 fusion proteins can then be re-folded together using the methods described in Example 2. Finally, complexes comprising two TCR, each containing a single IL-10 polypeptide linked to the TCR β chain, may be formed by homo-dimerisation of the IL-10 polypeptides. This would result in the formation of a complex of the following type:
αβTCR-IL-10 homodimer-αβTCR Example 7 - Production of soluble AH-1.23 TCR - IL-4 and AH-1.23 TCR - IL-13 fusion proteins.
The methods detailed in Example 6 can also be used to produce fusion proteins containing the soluble AH-1.23 TCR linked to other polypeptides.
Synthetic genes including the mature human IL-4 DNA sequence detailed in Figure 11a and one of the 5' DNA extension sequences listed in Example 6 can be constructed and sub-cloned into the pGMT7 plasmid containing the AHl.23 TCR β chain, produced as described in Example 5 to form a DNA sequence encoding the TCR β chain-linker- IL-4 fusion proteins.
The DNA and amino acid sequence of the AHl .23 TCR β chain - Pro-Gly - IL-4 fusion is detailed in Figures 12a and 12b respectively.
The DNA and amino acid sequence of the AHl.23 TCR β chain - Gly-Ser-Gly-Gly- Pro- (SEQ ID NO: 18) - IL-4 fusion is detailed in Figures 13a and 13b respectively.
The DNA and amino acid sequence of the AHl.23 TCR β chain - Gly-Ser-Gly-Gly- Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly-Pro-(SEQ ID NO: 20)- IL-4 fusion is detailed in Figures 14a and 14b respectively.
Synthetic genes including the mature human IL- 13 DNA sequence detailed in Figure 15a and one of the 5' DNA extension sequences listed in Example 6 can be constructed and sub-cloned into the pGMT7 plasmid containing the AH 1.23 TCR β chain, produced as described in Example 5 to form a DNA sequence encoding the TCR β chain-linker- IL-4 fusion proteins.
The DNA and amino acid sequence of the AHl .23 TCR β chain - Pro-Gly - IL- 13 fusion is detailed in Figures 16a and 16b respectively.
The DNA and amino acid sequence of the AHl.23 TCR β chain - Gly-Ser-Gly-Gly- Pro (SEQ ID NO: 18)- IL- 13 fusion is detailed in Figures 17a and 17b respectively. The DNA and amino acid sequence of the AHl .23 TCR β chain - Gly-Ser-Gly-Gly- Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly-Pro- (SEQ ID NO: 20)- IL-13 fusion is detailed in Figures 18a and 18b respectively.
These AH 1.23 TCR β chain - Linker- interleukin fusion proteins are then refolded with the AHl .23 TCR α chain using the methods detailed in Example 2 to produce the complete soluble AH 1.23 TCR-interleukin fusion protein.
Example 10 — Thymidine incorporation assay for assessing the ability of AHl.23 TCR-IL-10 fusion proteins to cause Mast cell proliferation.
5 xlO6 cells of the D36 murine mast cell line which proliferates in response to human IL-10 in the presence of IL-4 are cultured in RPMI 1640 medium.
A range (0, 0.01, 0.1, 0.5 and lμM of the AHl .23 TCR-IL-10 fusion protein prepared as described in Example 9 and IL-4 are added to the above culture. (Schlaak et al. , (1994) J Immunological Methods 168 49-54)
1.85 MBq / ml of H3 Thymidine is then added to 1 x 105 cells of the above culture in a 96 well plate. These cultures are then incubated for a further 8 hours at 370C, 5% CO2. The cells are harvested using a cell-harvester, and the level of thymidine incorporation into the cells is measured using a Top Count β counter.
A reduction in thymidine incorporation into the D36 cells in the presence of the
AH 1.23 TCR-IL-10 fusion protein, compared to that seen in the absence of the fusion protein indicates that the IL-IO part of the fusion protein is active and causing D36 mast cell proliferation.
Example 11 -Preparation of high affinity NY-ESO MTCR — therapeutic agent fusion proteins. Synthetic genes comprising the DNA sequence encoding the soluble high affinity c61 NY-ESO TCR β chain detailed in Figure 23 a linked via a DNA sequence encoding a peptide linker to DNA encoding a number of imunomodulaotory agents were synthesised:
There are a number of companies that provide a suitable DNA service, such as Geneart (Germany)
Figure 24a details the DNA sequence encoding the high affinity c61 NY-ESO MTCR beta chain linked at the C-terminus thereof via a peptide linker to IL-18. Figure 24b details the AA sequence of this fusion protein, the peptide linker is underlined.
Figure 25 a details the DNA sequence encoding IL- 18 pro-protein linked at the C- terminus thereof via a peptide linker to the high affinity c61 NY-ESO MTCR beta chain. The pro-IL-18 DNA sequence has been altered to encode a Factor X cleavage site which facilitates post translation removal of the amino acids within the pro- sequence. Figure 25b details the AA sequence of this fusion protein, the peptide linker is underlined.
Figure 26a details the DNA sequence encoding the high affinity c61 NY-ESO MTCR beta chain linked at the C-terminus thereof via a peptide linker to IL-IO. Figure 26b details the AA sequence of this fusion protein, the peptide linker is underlined.
Figure 27a details the DNA sequence encoding the high affinity c61 NY-ESO MTCR beta chain linked at the C-terminus thereof via a peptide linker to IL-13. Figure 27b details the AA sequence of this fusion protein, the peptide linker is underlined.
Figure 28a details the DNA sequence encoding the high affinity c61 NY-ESO MTCR beta chain linked at the C-terminus thereof via a peptide linker to the "KDEL" variant of the PE38 exotoxin. Figure 28b details the AA sequence of this fusion protein the peptide linker is underlined. The DNA sequences above c61 NY-ESO TCR beta chain can be ligated into the pEX821 vector. (See Figures 19 and 20 for the DNA sequence and plasmid map of this vector respectively)
Disulfide-linked αβTCR-therapeutic agents are then produced following the methods substantially as described in Example 2. Briefly, DNA encoding the high affinity c61 NY-ESO alpha chain detailed in Figure 29a is synthesised and ligated into the pEX954 vector. (See Figures 21 and 22 for the DNA sequence and plasmid map of this vector respectively) The TCR beta chain fusion proteins described above are then refolded in the presence of the c61 NY-ESO TCR alpha chain.
Figure 29a details the DNA sequence encoding the high affinity c58 NY-ESO MTCR alpha chain and Figure 29b details the AA sequence encoded by the DNA sequence of Figure 29a.
Example 12 -MTCR-P E- 38 fusion protein cytotoxicity assay.
1x10"6 of trie required target cells (e.g. SK-MEL tumour cells or J82 cells) were suspended in 10 ml RPMI media + 10% fetal calf serum (FCS). If required the target cells were then pulsed with 10 μM of cognate peptide for 2 hours at 37°C. The samples were then washed three times in RPMI + 10% FCS, centrifuging at 1200 rpm for 5 min in between each wash. The washed cells were then re-counted and re- suspended in the appropriate volume of RPMI + 10% FCS media to provide a final cell density of 2 x 105 cells/ml.
The MTCR-PE38 fusion proteins prepared as described in Example 11 were diluted in RPMI media + 10% FCS to a final concentration of 2 x 10"6 M to provide a working standard. This working standard was then used to prepare a set of serial dilutions.
Preparation of experimental and control samples in microtitre plate wells: Experimental sample wells were filled with 50 μl mTCR-PE38 in media and 50 μl cells in medium. To produce a total volume of 100 μl in 96 well flat bottom white opaque walled plates (Nunc 136101). The mTCR-PE38 serial dilutions prepared above were used to provide a range of mTCR-PE38 concentrations in these wells.
Control sample wells were prepared using either 100 μl of cells (cell-only controls) or 100 μl of mTCR-PE38 and media (effector-only controls).
The experimental and control samples were then incubated at 370C, 5% CO2 for 48 or 96 hours. The number of viable cells remaining in each well was then assessed using a CellTiter-Glo® Luminescent assay (Promega Cat No: G7572) following the manufacturers instructions.
Results
Figures 30a and 30b demonstrate that the NY-ESO+ SK-MEL 37 and Mel 624 tumour cell lines can be killed by the 1G4 MTCR-PE38 fusion protein.
EC50 values for the effect of the 1G4 MTCR-PE38 fusion protein on the SK-MEL 37 and Mel 624 tumour cell lines after 48 hours incubation of 5.9 x 10"9 and 1 x 10"8 M respectively were calculated from the data presented in Figure 30a.
EC50 values for the effect of the 1G4 MTCR-PE38 fusion protein on the SK-MEL 37 and Mel 624 tumour cell lines after 96 hours incubation of 5.7 x 10"9 and 2.1 x 10"8 M respectively were calculated from the data presented in Figure 30b.
The results provided by Figures 30a and 30b both demonstrate that pulsing the J82 target cells with the cognate SLLMWITQC NY-ESO peptide leads to more efficient killing of these cells by the NY-ESO TCR-PE38 construct compared to that observed with unpulsed J82 target cells.

Claims

Claims
1. A dimeric TCR (dTCR) or single-chain TCR (scTCR) associated with a therapeutic agent, wherein said agent is selected from IL-I, IL-lα, IL-3, IL-4, IL-5, IL-6, IL-7, IL-IO, IL-11, IL-12, IL-13, IL-15, IL-21, IL-23, TGF-β, IFN-γ,
Lymphotoxin, TNFα, Anti-CD2 antibody, Anti-CD3 antibody, Anti-CD4 antibody, Anti-CD8 antibody, Anti-CD44 antibody, Anti-CD45RA antibody, Anti-CD45RB antibody, Anti-CD45RO antibody, Anti-Thy 1.2 antibody, Antilymphocyte globulin, Anti-αβTCR antibody, Anti-γδTCR antibody, Anti-CD49a antibody, Anti-CD49b antibody, Anti-CD49c antibody, Anti-CD49d antibody, Anti-CD49e antibody, Anti-
CD49f antibody, Anti-TCR Vβ8 antibody, Anti-CD 16 antibody, Anti-CD28 antibody, CTLA-4-Ig, Anti-B7.2 antibody, Anti-CD40L antibody, Anti-ICAM-1 antibody, ICAM-I, Anti-Mac antibody, Anti-LFA-1 antibody, Anti-IFN-γ antibody IFN-γ, IFN- γR/IgGl fusions, Anti-IL-2R antibodies, IL-2R antibody, IL-2 Diptheria-toxin protein, Anti-IL-12 antibody, IL-12 Antagonist (p40), Anti-IL-1 antibody, IL-I
Antagonist, Glutamic acid decarboxylase (GAX)), Anti-GAD antibody, Viral proteins and peptides, Bacterial proteins or peptides, A.-Galactosyl-ceramide, Calcitonin, Nicotinamide, Anti-oxidants (Vitamin E, Probucol analog, Probucol + deflazacoert or Aminoguanidine), Anti-Inflammatory agents (Pentoxifylline or Rolipram), Immunomodulators (Linomide, Ling-zhi-8, D-Glucan, Multi-functional protein 14, Ciamexon, Cholera toxin B, Vanadate or Vitamin D3 analogue, small molecule CD80 inhibitors, Androgens, IGF-I, Immunomanipulation (Natural antibodies), Lupus idiotype, Lipopolysaccaride), Sulfatide, Bee venom, Kampo formulation, Silica, Ganglioside, Antiasialo GM-I antibody, Hyaluronidase, Concanavalin A, Anti-Class I MHC antibody, or Anti-Class II MHC antibody, Cyclosporin, FK-506,
Azathioprine, Rapamycin or Deoxyspergualin, PE38 Pseudomonas exotoxin, and wherein said TCR comprises
a first segment constituted by an amino acid sequence corresponding to a TCR α chain variable domain sequence fused to the N terminus of an amino acid sequence corresponding to a TCR α chain constant domain extracellular sequence, a second segment constituted by an amino acid sequence corresponding to a TCR β chain variable domain fused to the N terminus of an amino acid sequence corresponding to TCR β chain constant domain extracellular sequence,
a disulfide bond between the first and second chains, said disulfide bond being one which has no equivalent in native αβT cell receptors,
and in the case of said scTCRs further comprising a linker sequence linking the C terminus of the first segment to the N terminus of the second segment, or vice versa, the length of the linker sequence and the position of the disulfide bond being such that the variable domain sequences of the first and second segments are mutually orientated substantially as in native αβ T cell receptors.
2. A dTCR or scTCR associated with a therapeutic agent, as claimed in claim 1, wherein the therapeutic agent is selected from IL-I, IL-lα, IL-3, IL-5, IL-6, IL-7, IL- 11, IL- 12, TGF-β, Lymphotoxin, TNFα, Anti-CD2 antibody, Anti-CD4 antibody, Anti-CD8 antibody, Anti-CD44 antibody, Anti-CD45RA antibody, Anti-CD45RB antibody, Anti-CD45RO antibody, Anti-Thy 1.2 antibody, Antilymphocyte globulin, Anti-αβTCR antibody, Anti-γδTCR antibody, Anti-CD49a antibody, Anti-CD49b antibody, Anti-CD49c antibody,Anti-CD49d antibody,Anti-CD49e antibody,Anti-
CD49f antibody, Anti-TCR Vβ8 antibody, Anti-CD 16 antibody, Anti-CD28 antibody, CTLA-4-Ig, Anti-B7.2 antibody, Anti-CD40L antibody, Anti:ICAM-l antibody, ICAM-I, Anti-Mac antibody, Anti-LFA-1 antibody, Anti-IFN-γ antibody IFN-γ, IFN- γR/IgGl fusions, Anti-IL-2R antibodies, IL-2R antibody, IL-2 Diptheria-toxin protein, Anti-IL-12 antibody, IL-12 Antagonist (p40), Anti-IL-1 antibody, IL-I
Antagonist, Glutamic acid decarboxylase (GAD), Anti-GAD antibody, Viral proteins and peptides, Bacterial proteins or peptides, A-Galactosyl-cerainide, Calcitonin, Nicotinamide, Anti-oxidants (Vitamin E, Probucol analog, Probucol + deflazacoert or Aminoguanidine), Anti-Inflammatory agents (Pentoxifylline or Rolipram), Irnmunomodulators (Linomide, Ling-zhi-8, D-Glucan, Multi-functional protein 14, Ciamexon, Cholera toxin B, Vanadate or Vitamin D3 analogue, small molecule CD80 inhibitors, Androgens, IGF-I, Immunomanipulation (Natural antibodies), Lupus idiotype, Lipopolysaccaride), Sulfatide, Bee venom, Kampo formulation, Silica, Ganglioside, Antiasialo GM-I antibody, Hyaluronidase, Concanavalin A, Anti-Class I MHC antibody, or Anti-Class II MHC antibody, Cyclosporin, FK-506, Azathioprine, Rapamycin or Deoxyspergualin.
3. A dTCR or scTCR associated with a therapeutic agent, as claimed in clainx 1, wherein the therapeutic agent is one of IL-IO, IL-4 or IL-13.
4. A dTCR or scTCR associated with a therapeutic agent as claimed in any preceding claim, wherein the dTCR or scTCR is tissue-specific.
5. A dTCR or scTCR associated with a therapeutic agent, as claimed in claim 4, wherein the dTCR or scTCR is specific for a tissue which is a target for auto-reactive T cells in autoimmune disease, organ rejection or Graft Versus Host Disease (GVHD).
6. A dTCR or scTCR associated with a therapeutic agent, as claimed in clairrxs 4 or 5, wherein the dTCR or scTCR is islet cell-specific.
7. A dTCR or scTCR associated with a therapeutic agent as claimed in claim 1, wherein the therapeutic agent consists of one of IL-15, IL-21, IL-23, PE38 Pseudomonas exotoxin, IFN-γ or Anti-CD3 antibody.
8. A dTCR associated with a therapeutic agent as claimed in any preceding claim.
9. An scTCR associated with a therapeutic agent as claimed in any preceding claim.
10. An scTCR associated with a therapeutic agent, as claimed in claim 9 wher<sin the linker sequence links the C terminus of the first segment to the N terminus of the second segment.
11. A scTCR associated with a therapeutic agent, as claimed in claim 9 wherein the linker sequence has the formula -PGGG-(SGGGG)n-P- wherein n is 5 or 6 and P is proline, G is glycine and S is serine.
12. A dTCR associated with a therapeutic agent, as claimed in claim 8 which is a dTCR comprising a first polypeptide wherein a sequence corresponding to a TCR α chain variable domain sequence is fused to the N terminus of a sequence corresponding to a TCR α chain constant domain extracellular sequence, and
a second polypeptide wherein a sequence corresponding to a TCR βchain variable domain sequence fused to the N terminus a sequence corresponding to a TCR β chain constant domain extracellular sequence,
the first and second polypeptides being linked by a disulfide bond which has no equivalent in native αβ T cell receptors.
13. A TCR associated with a therapeutic agent, as claimed in claim 8 which is a dTCR comprising a first polypeptide wherein a sequence corresponding to a TCR α chain variable domain sequence is fused to the N terminus of a sequence corresponding to a TCR α chain constant domain extracellular sequence, and
a second polypeptide wherein a sequence corresponding to a TCR β chain variable domain sequence is fused to the N terminus a sequence corresponding to a TCR β chain constant domain extracellular sequence,
the first and second polypeptides being linked by a disulfide bond between cysteine residues substituted for Thr 48 of exon 1 of TRAC*01 and Ser 57 of exon 1 of TRBCPOl or TRBC2*01 or the non-human equivalent thereof.
14. A TCR associated with a therapeutic agent, as claimed in any preceding claim which dTCR or scTCR has amino acid sequences corresponding to human αβ TCR extracellular constant and variable domain sequences.
15. A TCR associated with a therapeutic agent, as claimed in claim 14 wherein a disulfide bond links amino acid residues of the said constant domain sequences, which disulfide bond has no equivalent in native TCRs.
16. A TCR associated with a therapeutic agent, as claimed in claim 15 wherein the said disulfide bond is between cysteine residues corresponding to amino acid residues whose β carbon atoms are less than 0.6 ran apart in native TCRs.
17. A TCR associated with a therapeutic agent, as claimed in claim 15 wherein the said disulfide bond is between cysteine residues substituted for Thr 48 of exon 1 of TRAC*01 and Ser 57 of exon 1 of TRBCl*01 or TRBC2*01 or the non-human equivalent thereof.
18. A TCR associated with a therapeutic agent, as claimed in any preceding claim wherein the dTCR or scTCR includes a disulfide bond between residues corresponding to those linked by a disulfide bond in native TCRs.
19. A TCR associated with a therapeutic agent, as claimed in any preceding claim wherein the dTCR or scTCR does not contain a sequence corresponding to transmembrane or cytoplasmic sequences of native TCRs.
20. A TCR associated with a therapeutic agent, as claimed in any preceding claim wherein said therapeutic agent is a PE38 exotoxin.
21. A TCR associated with a PE38 exotoxin as claimed in claim 20 comprising the amino acid sequences of (SEQ ID NO: 73) and (SEQ ID NO: 71).
22. A TCR associated with a therapeutic agent, as claimed in any preceding claim wherein the TCR is associated with at least one polyalkylene glycol chain(s).
23. A TCR associated with a therapeutic agent, as claimed in claim 22, wherein the polyalkylene glycol chain(s) is/are covalently linked to the TCR.
24. A TCR associated with a therapeutic agent, as claimed in claim 22 or claim 23 wherein the polyalkylene glycol chain(s) comprise(s) at least two polyethylene glycol repeating units.
25. A multivalent TCR complex comprising at least two TCRs associated with a therapeutic agent, as claimed in any preceding claim.
26. A multivalent TCR complex comprising at least two TCRs associated with a therapeutic agent, as claimed in any of claims 1 to 24 linked by a non-peptidic polymer chain or a peptidic linker sequence.
27. A multivalent TCR complex as claimed in claim 26 wherein the polymer chain or peptidic linker sequence extends between amino acid residues of each TCR associated with a therapeutic agent or a functional variant or fragment thereof, which are not located in a variable region sequence of the TCR.
28. A multivalent TCR complex as claimed in either of claims 26 or 27 in which the TCRs associated with a therapeutic agent, are linked by a polyalkylene glycol chain or a peptidic linker derived from a human multimerisation domain.
29. A multivalent TCR complex as claimed in claim 28 wherein a divalent alkylene spacer radical is located between the polyalkylene glycol chain and its point of attachment to a TCR associated with a therapeutic agent, of the complex.
30. A multivalent TCR complex as claimed in claim 28 or claim 29 wherein the polyalkylene glycol chain comprises at least two polyethylene glycol repeating units.
31. A pharmaceutical composition comprising a TCR associated with a therapeutic agent, as claimed in any of claims 1 to 24 or a multivalent complex thereof as claimed in any of claims 25 to 30, together with a pharmaceutically acceptable carrier.
32. A method of treatment of cancer comprising administering to a subject suffering such cancer an effective amount of a TCR associated with a therapeutic agent, as claimed in any of claims 1 to 24 or a multivalent complex thereof as claimed in any of claims 25 to 30 wherein said therapeutic agent is selected from those defined in claim 2.
33. The use of a TCR associated with a therapeutic agent, as claimed in any of claims 1 to 24 or a multivalent complex thereof as claimed in any of claims 25 to 30, wherein said therapeutic agent is selected from those defined in claim 2 in the preparation of a composition for the treatment of cancer.
34. A method of treatment of cancer comprising administering to a subject suffering such cancer an effective amount of the fusion protein as claimed in claims 20 or 21.
35. The use of the fusion protein as claimed in claims 20 or 21 in the preparation of a composition for the treatment of cancer.
36. A method of treatment of autoimmune disease, organ rejection or GVHD comprising administering to a subject suffering such autoimmune disease, organ rejection or GVHD an effective amount of a TCR associated with a therapeutic agent, as claimed in any of claims 1 to 24 or a multivalent complex thereof as claimed in any of claims 25 to 30, wherein said therapeutic agent is selected from those defined in claim 3.
37. The use of a TCR associated with a therapeutic agent, as claimed in as claimed in any of claims 1 to 24, wherein said therapeutic agent is selected from those defined in claim 3 in the preparation of a composition for the treatment of autoimmune disease, organ rejection or GVHD.
PCT/GB2005/003752 2004-10-01 2005-09-29 T-cell receptors containing a non-native disulfide interchain bond linked to therapeutic agents WO2006037960A2 (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
CA002582963A CA2582963A1 (en) 2004-10-01 2005-09-29 T-cell receptors containing a non-native disulfide interchain bond linked to therapeutic agents
EP05787358A EP1809669A2 (en) 2004-10-01 2005-09-29 T-cell receptors containing a non-native disulfide interchain bond linked to therapeutic agents
AU2005291039A AU2005291039A1 (en) 2004-10-01 2005-09-29 T-cell receptors containing a non-native disulfide interchain bond linked to therapeutic agents
MX2007003910A MX2007003910A (en) 2004-10-01 2005-09-29 T-cell receptors containing a non-native disulfide interchain bond linked to therapeutic agents.
JP2007534081A JP2008514685A (en) 2004-10-01 2005-09-29 T cell receptor containing a non-natural disulfide interchain linkage linked to a therapeutic agent

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
GBGB0421836.8A GB0421836D0 (en) 2004-10-01 2004-10-01 T cell receptors containing a non-native disulfide interchain bond linked to immunomodulatory agents
GB0421836.8 2004-10-01
US62106304P 2004-10-25 2004-10-25
US60/621,063 2004-10-25
GB0427584.8 2004-12-16
GB0427584A GB0427584D0 (en) 2004-12-16 2004-12-16 T cell receptors containing a novel disulfide interchain bond linked to immunomodulatory agents

Publications (2)

Publication Number Publication Date
WO2006037960A2 true WO2006037960A2 (en) 2006-04-13
WO2006037960A3 WO2006037960A3 (en) 2006-08-03

Family

ID=36000822

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2005/003752 WO2006037960A2 (en) 2004-10-01 2005-09-29 T-cell receptors containing a non-native disulfide interchain bond linked to therapeutic agents

Country Status (6)

Country Link
EP (1) EP1809669A2 (en)
JP (1) JP2008514685A (en)
AU (1) AU2005291039A1 (en)
CA (1) CA2582963A1 (en)
MX (1) MX2007003910A (en)
WO (1) WO2006037960A2 (en)

Cited By (42)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010133828A1 (en) * 2009-05-20 2010-11-25 Immunocore Ltd. Bifunctional polypeptides
CN103130894A (en) * 2011-11-30 2013-06-05 中国医学科学院基础医学研究所 Recombinant single-chain antibody G5-4ScFv of anti-human gamma delta T cell receptor (TCR) monoclonal antibody and encoding gene and application thereof
EP2628802A1 (en) * 2011-01-14 2013-08-21 Affiliated Hospital of Academy of Military Medical Sciences, PLA Dna vaccine based on b7-1-pe40kdel exotoxin fusion gene and use thereof
US20140094417A1 (en) * 2011-06-09 2014-04-03 The United States of America,as represented by the Secretary, Department of Health and Human Servic Pseudomonas exotoxin a with less immunogenic t cell and/or b cell epitopes
EP2894164A1 (en) 2006-07-05 2015-07-15 F-Star Biotechnologische Forschungs- und Entwicklungsges.m.b.H Method for engineering T-cell receptors
US9651559B2 (en) 2007-06-26 2017-05-16 F-star Biotechnologische Forschungs— und Entwicklungsges.m.b.H Display of binding agents
US9657066B2 (en) 2011-09-16 2017-05-23 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Pseudomonas exotoxin A with less immunogenic B cell epitopes
WO2017193107A2 (en) 2016-05-06 2017-11-09 Juno Therapeutics, Inc. Genetically engineered cells and methods of making the same
US9856311B2 (en) 2005-01-05 2018-01-02 F-Star Biotechnologische Forschungs- Und Entwicklungsges.M.B.H Synthetic immunoglobulin domains with binding properties engineered in regions of the molecule different from the complementarity determining regions
WO2018005559A1 (en) 2016-06-27 2018-01-04 Juno Therapeutics, Inc. Method of identifying peptide epitopes, molecules that bind such epitopes and related uses
WO2018005556A1 (en) 2016-06-27 2018-01-04 Juno Therapeutics, Inc. Mhc-e restricted epitopes, binding molecules and related methods and uses
WO2018067618A1 (en) 2016-10-03 2018-04-12 Juno Therapeutics, Inc. Hpv-specific binding molecules
US10125197B2 (en) 2008-05-02 2018-11-13 F-Star Biotechnologische Forschungs-Und Entwicklungsges.M.B.H Cytotoxic immunoglobulin
WO2019070541A1 (en) 2017-10-03 2019-04-11 Juno Therapeutics, Inc. Hpv-specific binding molecules
WO2019089884A2 (en) 2017-11-01 2019-05-09 Editas Medicine, Inc. Methods, compositions and components for crispr-cas9 editing of tgfbr2 in t cells for immunotherapy
WO2019090202A1 (en) 2017-11-06 2019-05-09 Editas Medicine, Inc. Methods, compositions and components for crispr-cas9 editing of cblb in t cells for immunotherapy
US10316087B2 (en) * 2015-05-20 2019-06-11 Guangdong Xiangxue Life Sciences, Ltd. Soluble and stable heterodimeric TCR
WO2019195491A1 (en) 2018-04-05 2019-10-10 Juno Therapeutics, Inc. T cells expressing a recombinant receptor, related polynucleotides and methods
WO2019195486A1 (en) 2018-04-05 2019-10-10 Juno Therapeutics, Inc. T cell receptors and engineered cells expressing same
WO2019195492A1 (en) 2018-04-05 2019-10-10 Juno Therapeutics, Inc. Methods of producing cells expressing a recombinant receptor and related compositions
WO2019231920A1 (en) * 2018-05-28 2019-12-05 Dragonfly Therapeutics, Inc. Multi-specific binding proteins and improvements thereon
WO2020033927A2 (en) 2018-08-09 2020-02-13 Juno Therapeutics, Inc. Processes for generating engineered cells and compositions thereof
WO2020056047A1 (en) 2018-09-11 2020-03-19 Juno Therapeutics, Inc. Methods for mass spectrometry analysis of engineered cell compositions
US10654906B2 (en) 2013-06-26 2020-05-19 Guangdong Xiangxue Life Sciences, Ltd. High-stability T-cell receptor and preparation method and application thereof
WO2020223535A1 (en) 2019-05-01 2020-11-05 Juno Therapeutics, Inc. Cells expressing a recombinant receptor from a modified tgfbr2 locus, related polynucleotides and methods
US10946104B2 (en) 2012-01-13 2021-03-16 Apo-Tb.V. Aberrant cell-restricted immunoglobulins provided with a toxic moiety
US11098115B2 (en) * 2011-09-29 2021-08-24 Apo-T B.V. Multi-specific binding molecules targeting aberrant cells
WO2021191870A1 (en) 2020-03-27 2021-09-30 Dcprime B.V. Ex vivo use of modified cells of leukemic origin for enhancing the efficacy of adoptive cell therapy
WO2021191871A1 (en) 2020-03-27 2021-09-30 Dcprime B.V. In vivo use of modified cells of leukemic origin for enhancing the efficacy of adoptive cell therapy
WO2021260186A1 (en) 2020-06-26 2021-12-30 Juno Therapeutics Gmbh Engineered t cells conditionally expressing a recombinant receptor, related polynucleotides and methods
WO2022060904A1 (en) 2020-09-16 2022-03-24 Obsidian Therapeutics, Inc. Compositions and methods for expression of t-cell receptors with small molecule-regulated cd40l in t cells
WO2022097068A1 (en) 2020-11-05 2022-05-12 Dcprime B.V. Use of tumor-independent antigens in immunotherapies
US20220204582A1 (en) * 2016-12-02 2022-06-30 University Of Southern California Synthetic immune receptors and methods of use thereof
WO2023081900A1 (en) 2021-11-08 2023-05-11 Juno Therapeutics, Inc. Engineered t cells expressing a recombinant t cell receptor (tcr) and related systems and methods
WO2023138573A1 (en) * 2022-01-21 2023-07-27 广东菲鹏制药股份有限公司 Complex of interleukin 21 and receptor thereof
WO2023196884A1 (en) 2022-04-06 2023-10-12 Juno Therapeutics, Inc. Detection assay for human papillomavirus (hpv) type 16 (hpv-16)
WO2023223185A1 (en) 2022-05-16 2023-11-23 Mendus B.V. Use of leukemia-derived cells for enhancing natural killer (nk) cell therapy
US11827688B2 (en) 2016-06-02 2023-11-28 Immunocore Limited Dosing regimen for GP100-specific TCR—anti-CD3 SCFV fusion protein
US11827720B2 (en) 2006-07-05 2023-11-28 F-Star Therapeutics Limited Multivalent immunoglobulins
US11834506B2 (en) 2017-02-08 2023-12-05 Dragonfly Therapeutics, Inc. Multi-specific binding proteins that bind NKG2D, CD16, and a tumor-associated antigen for activation of natural killer cells and therapeutic uses thereof to treat cancer
US11884733B2 (en) 2018-02-08 2024-01-30 Dragonfly Therapeutics, Inc. Antibody variable domains targeting the NKG2D receptor
US11884732B2 (en) 2017-02-20 2024-01-30 Dragonfly Therapeutics, Inc. Proteins binding HER2, NKG2D and CD16

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107223133B (en) * 2014-11-07 2021-01-29 广东香雪精准医疗技术有限公司 Soluble heterogeneous dimeric T cell receptor and preparation method and application thereof

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003020763A2 (en) * 2001-08-31 2003-03-13 Avidex Limited Soluble t cell receptor
WO2004033685A1 (en) * 2002-10-09 2004-04-22 Avidex Ltd Single chain recombinant t cell receptors
WO2004044004A2 (en) * 2002-11-09 2004-05-27 Avidex Limited T cell receptor display
WO2004050705A2 (en) * 2002-12-03 2004-06-17 Avidex Ltd. Complexes of receptors
WO2004074322A1 (en) * 2003-02-22 2004-09-02 Avidex Ltd Modified soluble t cell receptor

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003020763A2 (en) * 2001-08-31 2003-03-13 Avidex Limited Soluble t cell receptor
WO2004033685A1 (en) * 2002-10-09 2004-04-22 Avidex Ltd Single chain recombinant t cell receptors
WO2004044004A2 (en) * 2002-11-09 2004-05-27 Avidex Limited T cell receptor display
WO2004050705A2 (en) * 2002-12-03 2004-06-17 Avidex Ltd. Complexes of receptors
WO2004074322A1 (en) * 2003-02-22 2004-09-02 Avidex Ltd Modified soluble t cell receptor

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
BOULTER JONATHAN M ET AL: "Stable, soluble T-cell receptor molecules for crystallization and therapeutics." PROTEIN ENGINEERING. SEP 2003, vol. 16, no. 9, September 2003 (2003-09), pages 707-711, XP002379684 ISSN: 0269-2139 *
REITER Y ET AL: "CONSTRUCTION OF A FUNCTIONAL DISULFIDE-STABILIZED TCR FV INDICATES THAT ANTIBODY AND TCR FV FRAMEWORKS ARE VERY SIMILAR IN STRUCTURE" IMMUNITY, CELL PRESS, US, vol. 2, no. 3, March 1995 (1995-03), pages 281-287, XP009004075 ISSN: 1074-7613 *

Cited By (67)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9856311B2 (en) 2005-01-05 2018-01-02 F-Star Biotechnologische Forschungs- Und Entwicklungsges.M.B.H Synthetic immunoglobulin domains with binding properties engineered in regions of the molecule different from the complementarity determining regions
US10385118B2 (en) 2005-01-05 2019-08-20 F-Star Biotechnologische Forschungs- Und Entwicklungsges.M.B.H Synthetic immunoglobulin domains with binding properties engineered in regions of the molecule different from the complementarity determining regions
EP2894164A1 (en) 2006-07-05 2015-07-15 F-Star Biotechnologische Forschungs- und Entwicklungsges.m.b.H Method for engineering T-cell receptors
US11827720B2 (en) 2006-07-05 2023-11-28 F-Star Therapeutics Limited Multivalent immunoglobulins
US9651559B2 (en) 2007-06-26 2017-05-16 F-star Biotechnologische Forschungs— und Entwicklungsges.m.b.H Display of binding agents
US10125197B2 (en) 2008-05-02 2018-11-13 F-Star Biotechnologische Forschungs-Und Entwicklungsges.M.B.H Cytotoxic immunoglobulin
US10420846B2 (en) 2009-05-20 2019-09-24 Immunocore Limited Bifunctional polypeptides
EA020841B1 (en) * 2009-05-20 2015-02-27 Иммунокор Лтд. Bifunctional polypeptides
AU2010250951B2 (en) * 2009-05-20 2015-04-30 Immunocore Ltd. Bifunctional polypeptides
US10517960B2 (en) 2009-05-20 2019-12-31 Immunocore Limited Bifunctional polypeptides
EP3112377B1 (en) 2009-05-20 2018-04-18 Immunocore Ltd. Bifunctional polypeptides
EP3112377A1 (en) * 2009-05-20 2017-01-04 Immunocore Ltd. Bifunctional polypeptides
EP3112376A3 (en) * 2009-05-20 2017-03-29 Immunocore Ltd. Bifunctional polypeptides
US10130721B2 (en) 2009-05-20 2018-11-20 Immunocore Limited Bifunctional polypeptides
US10576162B2 (en) 2009-05-20 2020-03-03 Immunocore Limited Bifunctional polypeptides
WO2010133828A1 (en) * 2009-05-20 2010-11-25 Immunocore Ltd. Bifunctional polypeptides
EP3112376B1 (en) 2009-05-20 2019-01-23 Immunocore Ltd. Bifunctional polypeptides
EP2628802A4 (en) * 2011-01-14 2014-05-07 Affiliated Hospital Of Academy Of Military Medical Sciences Pla Dna vaccine based on b7-1-pe40kdel exotoxin fusion gene and use thereof
US9029520B2 (en) 2011-01-14 2015-05-12 Affiliated Hospital Of Academy Of Military Medical Sciences, Pla B7-1-PE40KDEL exotoxin fusion gene-based DNA vaccine and the use thereof
EP2628802A1 (en) * 2011-01-14 2013-08-21 Affiliated Hospital of Academy of Military Medical Sciences, PLA Dna vaccine based on b7-1-pe40kdel exotoxin fusion gene and use thereof
US9765123B2 (en) 2011-06-09 2017-09-19 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Pseudomonas exotoxin a with less immunogenic T cell and/or B cell epitopes
US10428119B2 (en) 2011-06-09 2019-10-01 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Pseudomonas exotoxin A with less immunogenic T cell and/or B cell epitopes
AU2017200541B2 (en) * 2011-06-09 2018-11-08 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Pseudomonas exotoxin A with less immunogenic T cell and/or B cell epitopes
US20140094417A1 (en) * 2011-06-09 2014-04-03 The United States of America,as represented by the Secretary, Department of Health and Human Servic Pseudomonas exotoxin a with less immunogenic t cell and/or b cell epitopes
US9346859B2 (en) * 2011-06-09 2016-05-24 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Pseudomonas exotoxin A with less immunogenic T cell and/or B cell epitopes
AU2012268013B2 (en) * 2011-06-09 2016-11-17 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Pseudomonas exotoxin A with less immunogenic T cell and/or B cell epitopes
US10111927B2 (en) 2011-09-16 2018-10-30 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Pseudomonas exotoxin A with less immunogenic B cell epitopes
US9657066B2 (en) 2011-09-16 2017-05-23 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Pseudomonas exotoxin A with less immunogenic B cell epitopes
US11098115B2 (en) * 2011-09-29 2021-08-24 Apo-T B.V. Multi-specific binding molecules targeting aberrant cells
CN103130894A (en) * 2011-11-30 2013-06-05 中国医学科学院基础医学研究所 Recombinant single-chain antibody G5-4ScFv of anti-human gamma delta T cell receptor (TCR) monoclonal antibody and encoding gene and application thereof
US10946104B2 (en) 2012-01-13 2021-03-16 Apo-Tb.V. Aberrant cell-restricted immunoglobulins provided with a toxic moiety
US10654906B2 (en) 2013-06-26 2020-05-19 Guangdong Xiangxue Life Sciences, Ltd. High-stability T-cell receptor and preparation method and application thereof
US10316087B2 (en) * 2015-05-20 2019-06-11 Guangdong Xiangxue Life Sciences, Ltd. Soluble and stable heterodimeric TCR
WO2017193107A2 (en) 2016-05-06 2017-11-09 Juno Therapeutics, Inc. Genetically engineered cells and methods of making the same
US11827688B2 (en) 2016-06-02 2023-11-28 Immunocore Limited Dosing regimen for GP100-specific TCR—anti-CD3 SCFV fusion protein
EP3992632A1 (en) 2016-06-27 2022-05-04 Juno Therapeutics, Inc. Mhc-e restricted epitopes, binding molecules and related methods and uses
WO2018005559A1 (en) 2016-06-27 2018-01-04 Juno Therapeutics, Inc. Method of identifying peptide epitopes, molecules that bind such epitopes and related uses
WO2018005556A1 (en) 2016-06-27 2018-01-04 Juno Therapeutics, Inc. Mhc-e restricted epitopes, binding molecules and related methods and uses
WO2018067618A1 (en) 2016-10-03 2018-04-12 Juno Therapeutics, Inc. Hpv-specific binding molecules
US11072660B2 (en) 2016-10-03 2021-07-27 Juno Therapeutics, Inc. HPV-specific binding molecules
US20220204582A1 (en) * 2016-12-02 2022-06-30 University Of Southern California Synthetic immune receptors and methods of use thereof
US11834506B2 (en) 2017-02-08 2023-12-05 Dragonfly Therapeutics, Inc. Multi-specific binding proteins that bind NKG2D, CD16, and a tumor-associated antigen for activation of natural killer cells and therapeutic uses thereof to treat cancer
US11884732B2 (en) 2017-02-20 2024-01-30 Dragonfly Therapeutics, Inc. Proteins binding HER2, NKG2D and CD16
EP4215543A2 (en) 2017-10-03 2023-07-26 Juno Therapeutics, Inc. Hpv-specific binding molecules
US11952408B2 (en) 2017-10-03 2024-04-09 Juno Therapeutics, Inc. HPV-specific binding molecules
WO2019070541A1 (en) 2017-10-03 2019-04-11 Juno Therapeutics, Inc. Hpv-specific binding molecules
WO2019089884A2 (en) 2017-11-01 2019-05-09 Editas Medicine, Inc. Methods, compositions and components for crispr-cas9 editing of tgfbr2 in t cells for immunotherapy
WO2019090202A1 (en) 2017-11-06 2019-05-09 Editas Medicine, Inc. Methods, compositions and components for crispr-cas9 editing of cblb in t cells for immunotherapy
US11884733B2 (en) 2018-02-08 2024-01-30 Dragonfly Therapeutics, Inc. Antibody variable domains targeting the NKG2D receptor
US11939384B1 (en) 2018-02-08 2024-03-26 Dragonfly Therapeutics, Inc. Antibody variable domains targeting the NKG2D receptor
US11471489B2 (en) 2018-04-05 2022-10-18 Juno Therapeutics, Inc. T cell receptors and engineered cells expressing same
WO2019195491A1 (en) 2018-04-05 2019-10-10 Juno Therapeutics, Inc. T cells expressing a recombinant receptor, related polynucleotides and methods
WO2019195486A1 (en) 2018-04-05 2019-10-10 Juno Therapeutics, Inc. T cell receptors and engineered cells expressing same
WO2019195492A1 (en) 2018-04-05 2019-10-10 Juno Therapeutics, Inc. Methods of producing cells expressing a recombinant receptor and related compositions
WO2019231920A1 (en) * 2018-05-28 2019-12-05 Dragonfly Therapeutics, Inc. Multi-specific binding proteins and improvements thereon
WO2020033927A2 (en) 2018-08-09 2020-02-13 Juno Therapeutics, Inc. Processes for generating engineered cells and compositions thereof
WO2020056047A1 (en) 2018-09-11 2020-03-19 Juno Therapeutics, Inc. Methods for mass spectrometry analysis of engineered cell compositions
WO2020223535A1 (en) 2019-05-01 2020-11-05 Juno Therapeutics, Inc. Cells expressing a recombinant receptor from a modified tgfbr2 locus, related polynucleotides and methods
WO2021191871A1 (en) 2020-03-27 2021-09-30 Dcprime B.V. In vivo use of modified cells of leukemic origin for enhancing the efficacy of adoptive cell therapy
WO2021191870A1 (en) 2020-03-27 2021-09-30 Dcprime B.V. Ex vivo use of modified cells of leukemic origin for enhancing the efficacy of adoptive cell therapy
WO2021260186A1 (en) 2020-06-26 2021-12-30 Juno Therapeutics Gmbh Engineered t cells conditionally expressing a recombinant receptor, related polynucleotides and methods
WO2022060904A1 (en) 2020-09-16 2022-03-24 Obsidian Therapeutics, Inc. Compositions and methods for expression of t-cell receptors with small molecule-regulated cd40l in t cells
WO2022097068A1 (en) 2020-11-05 2022-05-12 Dcprime B.V. Use of tumor-independent antigens in immunotherapies
WO2023081900A1 (en) 2021-11-08 2023-05-11 Juno Therapeutics, Inc. Engineered t cells expressing a recombinant t cell receptor (tcr) and related systems and methods
WO2023138573A1 (en) * 2022-01-21 2023-07-27 广东菲鹏制药股份有限公司 Complex of interleukin 21 and receptor thereof
WO2023196884A1 (en) 2022-04-06 2023-10-12 Juno Therapeutics, Inc. Detection assay for human papillomavirus (hpv) type 16 (hpv-16)
WO2023223185A1 (en) 2022-05-16 2023-11-23 Mendus B.V. Use of leukemia-derived cells for enhancing natural killer (nk) cell therapy

Also Published As

Publication number Publication date
MX2007003910A (en) 2007-06-07
AU2005291039A1 (en) 2006-04-13
CA2582963A1 (en) 2006-04-13
EP1809669A2 (en) 2007-07-25
WO2006037960A3 (en) 2006-08-03
JP2008514685A (en) 2008-05-08

Similar Documents

Publication Publication Date Title
EP1809669A2 (en) T-cell receptors containing a non-native disulfide interchain bond linked to therapeutic agents
US20210061878A1 (en) High affinity ny-eso t cell receptors
EP1885754B1 (en) T cell receptors which specifically bind to vygfvracl-hla-a24
AU2006253941B2 (en) High affinity Melan-A T cell receptors
US8017730B2 (en) T cell receptors which specifically bind to VYGFVRACL-HLA-A24
WO2006054096A2 (en) Soluble bifunctional proteins
US20100068186A1 (en) High affinity telomerase t cell receptors

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KM KP KR KZ LC LK LR LS LT LU LV LY MA MD MG MK MN MW MX MZ NA NG NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SM SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU LV MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: MX/a/2007/003910

Country of ref document: MX

Ref document number: 2007534081

Country of ref document: JP

Ref document number: 2582963

Country of ref document: CA

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2005291039

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 554616

Country of ref document: NZ

WWE Wipo information: entry into national phase

Ref document number: 2005787358

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2005291039

Country of ref document: AU

Date of ref document: 20050929

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 200580039381.3

Country of ref document: CN

WWP Wipo information: published in national office

Ref document number: 2005787358

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 2005787358

Country of ref document: EP