WO2006032504A2 - Method for introducing genetic mutations into plant cells - Google Patents

Method for introducing genetic mutations into plant cells Download PDF

Info

Publication number
WO2006032504A2
WO2006032504A2 PCT/EP2005/010270 EP2005010270W WO2006032504A2 WO 2006032504 A2 WO2006032504 A2 WO 2006032504A2 EP 2005010270 W EP2005010270 W EP 2005010270W WO 2006032504 A2 WO2006032504 A2 WO 2006032504A2
Authority
WO
WIPO (PCT)
Prior art keywords
plant
msh2
dna
gene
mismatch repair
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2005/010270
Other languages
French (fr)
Other versions
WO2006032504A3 (en
Inventor
Gabriela Ispas
Ivan Famelaer
Geert Angenon
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Vrije Universiteit Brussel VUB
Universite Libre de Bruxelles ULB
Original Assignee
Vrije Universiteit Brussel VUB
Universite Libre de Bruxelles ULB
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Vrije Universiteit Brussel VUB, Universite Libre de Bruxelles ULB filed Critical Vrije Universiteit Brussel VUB
Publication of WO2006032504A2 publication Critical patent/WO2006032504A2/en
Publication of WO2006032504A3 publication Critical patent/WO2006032504A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01HNEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H1/00Processes for modifying genotypes ; Plants characterised by associated natural traits
    • A01H1/06Processes for producing mutations, e.g. treatment with chemicals or with radiation
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/01Preparation of mutants without inserting foreign genetic material therein; Screening processes therefor
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology

Definitions

  • the present invention relates to mutagenesis in plants.
  • the present invention relates to methods for efficiently introducing genetic mutations into the genomes of plant cells. More specifically, the present invention discloses a method that can be especially useful for generating collections of plant mutants with mutation-saturated genomes.
  • the present invention aims at providing an efficient method to introduce genetic mutations into the genomes of plant cells. In doing so, the present invention aspires to enable the generation of libraries of mutants of various plant species, wherein a greater proportion of the genes will be containing a mutation, and wherein a greater number of different phenotypes will be obtained than achieved using current methods. This effect of the present invention will help close the 'phenotypic gap' present in the existing libraries of plant mutants.
  • repetitive sequences are mostly found outside of gene regions that code for proteins and hence, the increased mutation frequency of said repetitive sequences in MSH2- deficient plants will most likely result in a limited number of discernible phenotypes. Therefore, said increased mutation frequency of repetitive sequences is not useful for production of libraries of mutant plants.
  • WO0188192 described a way to generate hypermutable mammalian cells by introducing into said cells a dominant negative variant of a gene involved in MMR. Such cells show increased efficiency of mutagenesis in response to mutagenic agents and can be screened for mutations in genes of interest or for novel phenotypes. Following mutagenesis, genetic stability of the cells was re-established by turning off the expression of the dominant negative MMR gene. WO0188192 did not extend its findings to plant cells. However, there exist important differences in DNA repair systems between plants and mammalian species. For example, and also relevant to alkylating mutagens, plants do not possess methylguanyl methyl transferases, whereas mammals do.
  • WO0188192 used an inducibly expressed dominant negative MMR gene, such that following mutagenesis the expression of the said dominant negative gene could be turned off. Presumably, this was found crucial for re-establishing the genetic stability of the mutagenised cells.
  • reliable inducible systems that would work at the whole plant level and/or in seeds, and/or in a wide range of plants, are not available. While some systems have been developed for the model plants Arabidopsis thaliana or Nicotiana tabacum, these only work with particular well-characterized lines expressing a critical level of a repressor or activator and it remains very difficult to work with other lines, or to develop such lines for other (crop) plant species.
  • the uptake and transport of an inducer of expression in plant tissues and/or seeds may be problematic, especially if MMR should be suppressed only in particular cells of a plant, such as, e.g., in a few meristematic cells that would give rise to progeny.
  • a skilled person would not have considered applying the teachings of WO0188192 to plants cells.
  • a skilled person would also consider other ways of MMR suppression, in particular ways which are in general not readily reversible, as unsuitable for preparation of plant mutagenesis libraries.
  • WO0224890 described a method for increasing the efficiency of targeted gene mutation and/or of homologous recombination in a plant cell, wherein the activity of the MLH1 gene involved in MMR has been suppressed by one of multiple approaches in said plant cell.
  • this document did not investigate the possibility to increase the efficiency of random mutagenesis with mutagenic agents in plant cells by suppressing the activity of MMR.
  • EP 1 333 095 described that recombination between partially homologous DNA sequences can be facilitated through inactivation of the mismatch repair system in cells.
  • EP 1 333 095 utilised this finding to achieve targeted replacement of an endogenous sequence by a foreign DNA sequence.
  • targeted recombination is mechanistically entirely distinct from random mutagenesis, such as, e.g., using alkylating agents. Therefore, EP 1 333 095 does not disclose nor suggest using MMR deficient cells in random mutagenesis.
  • WO 02/054856 described the possibility to suppress mismatch repair system in plant cells using chemical inhibitors, thereby generating spontaneously hypermutable plant cells, and optionally subject the said plant cells to further chemical mutagenesis. Genetic stability of the cells following mutagenesis was re-established through removal of the chemical inhibitor of MMR.
  • chemical MMR inhibitors entails several disadvantages. Many such inhibitors (e.g., anthracenes) lack specificity and may show a wide variety of other effects, such as alterations in mitotic recombination, cell cycle regulation, single stranded DNA cleavage, double stranded DNA cleavage, general cytotoxicity, etc.
  • inhibitors including ATPase, nuclease and polymerase inhibitors, influence numerous metabolic reactions apart from MMR.
  • chemical MMR inhibitors e.g., cell cycle arrest, chromosome breakage, cell death, etc.
  • chemical inhibitors may suffer from inadequate uptake and/or transport in plant tissues and/or seeds, which may be particularly troublesome if one desires to suppress MMR only in particular tissues or cells of a plant, such as, e.g., in a few meristematic cells that give rise to progeny.
  • the present invention provides a method for efficiently introducing genetic mutations into the genome of a plant cell.
  • the method utilizes the fact that suppressing the function of an endogenous system of DNA repair will cause increased resistance of plant cells to high doses of mutagenic agents, as well as increased mutagenic effect of these agents in said plant cells.
  • the method provided in the present invention comprises the steps of: (i.) suppressing the activity of at least one endogenous system of DNA repair in said at least one plant cell; and (ii.) exposing said at least one plant cell to at least one mutagenic agent.
  • the present invention demonstrates that suppressing the mismatch repair system dramatically increases the ability of plant cells to sustain DNA damage induced by mutagenic agents and to accumulate mutations.
  • the method of the present invention comprises suppressing the activity of the mismatch repair system.
  • the present invention also realises that advantageous ways of suppressing the mismatch repair system in plant cells may comprise the following: partial or complete inactivation of at least one copy of at least one gene involved in said mismatch repair system, down-regulation of the expression of at least one gene involved in said mismatch repair system, introducing a dominant negative variant of at least one gene involved in said mismatch repair system, introducing an antibody or an expression cassette encoding such antibody capable of binding to at least one protein involved in said mismatch repair system, introducing agents capable of saturating the activity of said mismatch repair system, and over-expression of at least one gene involved in said mismatch repair system or a biologically active variant thereof.
  • advantageous ways of suppressing the mismatch repair system in plant cells may comprise the following: partial or complete inactivation of at least one copy of at least one gene involved in said mismatch repair system, down-regulation of the expression of at least one gene involved in said mismatch repair system, introducing a dominant negative variant of at least one gene involved in said mismatch repair system, introducing an antibody or an expression cassette encoding
  • an advantageous way of suppressing the mismatch repair system in plant cells may comprise introducing a dominant negative variant of at least one gene involved in said mismatch repair system.
  • dominant negative MMR variant could not be efficiently turned off in plant cells after mutagenesis.
  • MMR deficient plants can be propagated through several generations without the need to re-establish MMR proficiency.
  • MMR deficient plants obtained by introducing a dominant negative variant of an MMR gene can be propagated through several generations without the need to reduce the expression of the said dominant negative MMR variant.
  • some mutant phenotypes may appear, this does not substantially interfere with growth, reproduction and phenotypic characterisation, which is surprising.
  • the present application discloses that plant cells with suppressed mismatch repair system (such as, e.g., by dominant negative MMR variants) can be efficiently mutagenised.
  • plant cells with suppressed mismatch repair system such as, e.g., by dominant negative MMR variants
  • mutagenised plant cells are suitable for preparation of plant libraries, since the inventors found that MMR deficient plants may be propagated without the need to re-establish MMR proficiency (such as, e.g., without the need to reduce the expression of the said dominant negative MMR variant). Together, this may help to close the 'phenotypic gap' in such libraries.
  • the above detailed ways of suppressing the MMR in plant cells are advantageous over chemical MMR inhibitors which, as detailed above, often show non-specific effects and suffer from inadequate uptake and/or transport in plant tissues and/or seeds.
  • the above methods allow for specifically targeting the MMR process, and MMR in any desired cell type of a plant.
  • the present invention preferably employs mutagenic agents capable of introducing a random mutation into the genome of plant cells.
  • the present invention also realizes the advantages of using DNA-alkylating agents to mutagenise plant cells. Because of the fact that DNA-alkylating agents induce basepair substitutions rather than deletions or insertions, they can yield a qualitatively richer spectrum of mutations than other methods, such as X-ray irradiation or insertion of transposable elements. Basepair substitutions induced by DNA-alkylating agents will often result in single amino acid changes in the affected proteins, which might lead to for example a complete loss of function of the protein, a partial loss of its function, or to gaining a novel function. In this way a large variety of alleles can be created. Accordingly, in several embodiments of the present invention said method uses DNA-alkylating agents for mutagenesis.
  • the present invention provides mutagenised plant cells, as well as plants and plant parts and derivatives derived from these plant cells.
  • the present invention also envisages collections comprising such plants.
  • the present invention relates in particular to efficiently introducing random genetic mutations into the genome of a plant cell.
  • nucleic acid DNA, RNA, or other related compositions of matter that may include substitution of similar moieties.
  • nucleic acids may include bases that are not found in DNA or RNA, including, but not limited to, xanthine, inosine, uracil in DNA, thymine in RNA, hypoxanthine, and so on.
  • Nucleic acids may also include chemical modifications of phosphate or sugar moieties, which can be introduced to improve stability, resistance to enzymatic degradation, or some other useful property.
  • the present invention provides a method for introducing at least one genetic mutation into at least one plant cell, comprising the steps of: (i.) suppressing the activity of at least one endogenous system of DNA repair in said at least one plant cell; and (ii.) exposing said at least one plant cell to at least one mutagenic agent.
  • the DNA damage caused by applying a mutagenic agent would be to a large extent removed by the DNA repair systems before the cell would undergo the next cell division. This would in turn by large prevent the occurrence of mutations in the progeny of said cell.
  • the present invention performs mutagenesis in a plant cell with suppressed action of one or more DNA repair systems.
  • Such cells will be unable to efficiently remove the DNA damage caused by the mutagenic agent and this DNA damage will be turned into mutations - i.e., deviations from the DNA sequence of the mother cell before the mutagenesis - in daughter cells originating from the mutagenised mother cell.
  • the present method should therefore amplify the effect of said mutagenic agent and help obtain plant cells with much wider spectrum of mutations than can be achieved with currently available methods.
  • DNA damage is defined as any deviation from the usual base pairing between A-T and G-C, such as by way of example and not limitation: apurinic/apyrimidinic sites, base adducts, alkylated bases, dimers, mismatches, and loopouts resulting from DNA polymerase slippage. Also under DNA damage belong any deviation from the usual structure of the phosphodeoxyribose backbone of DNA, such as double strand breaks and single-strand nicks. Depending on the nature of the DNA damage, a cell will utilize various endogenous systems of DNA repair to re-establish the normal DNA structure.
  • the present invention anticipates that said endogenous system of DNA repair will be chosen from the group comprising mismatch repair system, nucleotide excision repair system, base excision repair system, direct reversal system, double strand break repair system, and enzymatic photoreactivation system. Also, because the proofreading activity of DNA polymerases considerably reduces the occurrence of mismatches during DNA replication, said proofreading activity will too be considered to constitute a DNA repair system in the context of the present invention.
  • MMR mismatch repair system
  • mutS orthologues identified in plants are of particular importance. While these currently comprise mutS orthologs isolated from Arabidopsis (MSH1 , MSH2, MSH3, MSH4, MSH5, MSH6, MSH7, and MutS2), maize (Musi , Mus2, Mus3), wheat (MSH2, MSH3, MSH6, MSH7), canola (MSH2), rice (MSH6), tobacco (MSH2), and sugarcane (MSH2, MSH3, MSH5, MSH6, MSH7, MutS2), the present invention also anticipates that future identified plant mutS homologues can be used in the context of the present invention.
  • the mutL orthologues comprise for example MLH1 , MLH2, MLH3, PMS1 , and PMS2.
  • MLH1 , MLH3, PMS1 the mutL orthologues isolated from plants, such as from Arabidopsis (MLH1 , MLH3, PMS1), rice (MLH1), and from sugarcane (MLH1 , MLH3, PMS1 ).
  • NER nucleotide excision repair system
  • the NER system is used by the cell to repair various types of damage, and is often involved in repairing DNA injuries induced by UV radiation, comprising cyclobutane pyrimidine dimers and 6-4 photoproducts, and by chemical agents, such as bulky DNA adducts.
  • the NER system includes the "global genome NER", which repairs the lesions over the entire genome, as well as the “transcription coupled NER", that repairs transcription blocked lesions present in transcribed DNA strand.
  • direct reversal system is meant a mechanism that involves a single enzyme- catalysed reaction to remove certain types of DNA damage.
  • DNA damage may comprise base alkylation, especially methylation of guanine at position 06, yielding O6-methylguanine.
  • MGMT methylguanine methyltransferases
  • base excision repair (BER) is understood the system in which the damaged DNA base is recognized and eliminated from the DNA strand by the action of DNA glycosylases, followed by repair of the apurinic/apyhmidinic site in several steps, comprising incision, gap filling and sealing.
  • the BER system repairs mainly DNA damage that arises spontaneously in a cell from hydrolytic events, such as deamination, base loss, base fragmentation by ionizing radiation, and oxidative damage.
  • zymatic photoreactivation system is understood the removal of UV-induced damage, such as cyclobutane pyrimidine dimers and 6-4 photoproducts, from DNA by the action of photolyases.
  • the "double strand break repair system” (DSBR) is involved in repairing DNA lesions, wherein both DNA strands of a DNA double helix are broken. Such lesions are usually caused by ionizing radiation, chemical agents, or arise during recombination.
  • the two mechanisms of DSBR comprise (i) homologous recombination and (ii) non-homologous end- joining. In homologous recombination the double strand break is repaired using genetic information from a sister chromatid. Non-homologous end-joining involves the joining of two broken ends.
  • said endogenous system of DNA repair is the mismatch repair system (MMR).
  • MMR is also responsible for signaling the extent of DNA damage to cellular mechanisms that control cell division and programmed cell death. Accordingly, if the amount of DNA damage exceeds a certain threshold, MMR will play a role in instructing the cell to interrupt the progression of the cell cycle until the damage is repaired. Alternatively, with even higher load of DNA damage the cell will be instructed to initiate apoptosis. This may likely constitute the cytotoxic effect of the mutagenesis treatment, which effectively limits the frequency of mutations that can be introduced with classical mutagenesis.
  • the invention anticipates that suppressing the activity of said endogenous system of DNA repair will be accomplished by means chosen from the group comprising: (i) exposure to a chemical agent; (ii) partial or complete inactivation of at least one copy of at least one gene involved in said endogenous system of DNA repair, said inactivation being attributable to for example base substitutions, methylation, insertions and/or deletions within the sequence of said gene; (iii) down-regulation of expression of at least one gene involved in said endogenous system of DNA repair, said down-regulation may for example result from base substitutions, insertions, or deletions in the regulatory sequences of said gene, or alternatively, said down-regulation may be accomplished using anti-sense nucleic acids or RNA silencing, or RNA interference; (iv) introducing a dominant negative variant of at least one gene involved in said endogenous system of DNA repair; (v) introducing an antibody or an expression cassette encoding such antibody, capable of binding to at least one protein involved in said endogen
  • the invention anticipates that suppressing the activity of said endogenous system of DNA repair will be accomplished by means chosen from the group comprising: (i) partial or complete inactivation of at least one copy of at least one gene involved in said endogenous system of DNA repair, (ii) down-regulation of the expression of at least one gene involved in said endogenous system of DNA repair, (iii) introducing a dominant negative variant of at least one gene involved in said endogenous system of DNA repair, (iv) introducing an antibody or an expression cassette encoding such antibody, capable of binding to at least one protein involved in said endogenous system of DNA repair, (v) introducing agents capable of saturating the activity of said endogenous system of DNA repair, and (vi) over-expression of at least one gene involved in said endogenous system of DNA repair or a biologically active variant thereof.
  • the approach (vi) may lead to titrating out of other components of the endogenous system of DNA repair by the over-expressed member, whereby the DNA repair system will be compromised.
  • the above means may in general not be readily reversible and may result in substantially permanent (e.g., substantially maintained upon further propagation of the mutagenised cells) suppression of the endogenous DNA repair system.
  • reversible use of the above means is also envisioned, whereby proficiency of endogenous DNA repair system following mutagenesis would be re- established.
  • biologically active variant is preferably defined to mean a peptide which has at least about 80%, preferably at least about 90%, and more preferably at least about 95%, sequence identity (e.g., by BLAST sequence comparison algorithm) to a naturally occurring gene.
  • Biologically active variants of the gene may encode peptides that have at least about 10%, preferably at least about 50%, and more preferably at least about 90%, of the activity of the peptides encoded by naturally occurring gene.
  • Such variants also encompass fragments of the naturally occurring gene encoding biologically active polypeptide fragments. The activity may be measured by any method known in the art and may involve testing of the ability of the variant to suppress an endogenous system of DNA repair upon over-expression in cells.
  • the present invention can use one of the above methods to permanently or transiently suppress the activity of the mismatch repair system.
  • the invention anticipates that suppressing the activity of said mismatch repair system will be accomplished by means chosen from the group comprising: (i) partial or complete inactivation of at least one copy of at least one gene involved in said mismatch repair system, (ii) down-regulation of the expression of at least one gene involved in said mismatch repair system, (iii) introducing a dominant negative variant of at least one gene involved in said mismatch repair system, and (iv) introducing an antibody or an expression cassette encoding such antibody, capable of binding to at least one protein involved in said mismatch repair system, (v) introducing agents capable of saturating the activity of said mismatch repair system, and (vi) over-expression of at least one gene involved in said mismatch repair system or a biologically active variant thereof.
  • the approach (vi) may lead to titrating out of other components of the mismatch repair system by the over-expressed member, whereby the of the mismatch repair system will be compromised.
  • the above means may in general not be readily reversible and may result in substantially permanent (e.g., substantially maintained upon further propagation of the mutagenised cells) suppression of the mismatch repair system.
  • reversible use of the above means is also envisioned, whereby proficiency of the mismatch repair system following mutagenesis may be re ⁇ established.
  • said mismatch repair system is suppressed by introducing into said at least one plant cell a dominant negative variant of at least one gene involved in said mismatch repair system.
  • Dominant negative variants cause a mismatch repair defective phenotype even in the presence of a wild-type gene in the same cell.
  • This approach offers the advantage that often the knowledge of the nucleic acid and/or protein sequence of the particular protein to be inhibited by a dominant negative variant is not required, because the high conservation of many proteins involved in mismatch repair system allows the use of a dominant negative variant from another plant species.
  • the present invention demonstrates in one of the examples that a dominant negative G 671 D mutant of the Arabidopsis thaliana MSH2 protein can exert a dominant inhibitory effect on the MSH2 function in Nicotiana plumbaginifolia.
  • this embodiment combines the advantageous effect that the suppression of the mismatch repair system has on the ability of said plant cell to sustain high load of DNA damage with the easiness of suppression achieved by using a dominant negative variant of at least one gene involved in said mismatch repair system.
  • the use of a dominant negative MMR variant allows for specifically targeting the MMR process, and the dominant negative MMR variant can easily be expressed in any desired cell type of a plant.
  • the expression of the dominant negative MMR variant in said plant cells does not depend on provision of an external inducer or may even be constitutive, typically by using endogenous or exogenous constitutive promoters.
  • the use of non-inducible expression systems can be advantageous, because systems of inducible expression which would reliably work at whole plant level and/or in a wide range of plants are not available.
  • constitutive expression of the dominant negative MMR variant in mutagenised plant cells does not interfere with the use of such cells to obtain mutant plants and that plants comprising and/or consisting of MMR deficient cells can be propagated and characterised on phenotypic level.
  • the expression of the dominant negative MMR in said plant cells may be inducible.
  • said at least one gene involved in MMR is a eukaryotic orthologue of the MutS gene of the bacterium Escherichia coli.
  • said eukaryotic orthologue of the MutS gene of E. coli is chosen from the group comprising MSH1 , MSH2, MSH3, MSH4, MSH5, MSH6, MSH7, MutS2, Musi , Mus2, and Mus3 isolated from various plant species.
  • the present invention uses a dominant negative variant of the MSH2 gene isolated from various plant species to suppress the activity of the MMR system.
  • Said MSH2 gene can be for example the MSH2 gene isolated from Arabidopsis thaliana.
  • the normal MSH2 protein forms heterodimers with the MutS homologue MSH6, said heterodimer recognising mainly mismatches, or with the MutS homologue MSH3, said latter heterodimer recognising mainly insertions and deletions of 2-14 bases.
  • said heterodimers associate with other proteins involved in the MMR system and begin to thread along the DNA strand searching for a signal that helps to differentiate the original DNA strand from the newly synthesized one. Afterwards, the system repairs said defect in the newly synthesized DNA strand. Dominant negative variants of said MSH2 gene will interfere with this mismatch repair mechanism and cause a mismatch repair defective phenotype even in the presence of a wild-type MSH2 gene in the same cell.
  • said dominant negative variant of the MSH2 gene carries a mutation affecting the amino acid sequence of the ATP-binding domain of the corresponding MSH2 protein, and more specifically the conserved box within said ATP- binding domain, comprising the amino acid sequence TGPNMGGKSTFI.
  • the corresponding MSH2 protein carrying a mutation in said ATP-binding domain tends to recognise and associate with defects in DNA structure, but cannot perform the subsequent steps of the MMR response. In staying associated with said defects in DNA structure, it also prevents heterodimers comprising wild-type MSH2 to recognise and associate with the defects in DNA, thus exerting a dominant negative effect.
  • said mutation in the ATP-binding domain of MSH2 is chosen from a group comprising all possible mutations that change the G (GIy) residue at a position corresponding to position G 671 in the Msh2 protein sequence of Arabidopsis thaliana.
  • such mutation can represent a G to D (Asp) change.
  • said at least one gene involved in the mismatch repair is a eukaryotic orthologue of the MutL gene of the bacterium Escherichia coli. More specifically, in another embodiment, the present invention uses dominant negative variants of MLM , MLH2, MLH3, PMS1 and PMS2.
  • the method of the present invention suppresses the activity of the MMR system in at least one plant cell by introducing into said at least one plant cell a dominant negative variant of at least one gene chosen from the group comprising MSM ,
  • MLH3, PMS1 and PMS2 isolated from various plant species. If a dominant negative variant of a MutS or MutL orthologue from other species than plants would exert a dominant negative effect in a plant cell, this can also be used within the scope of the present invention.
  • Such orthologues may be isolated from for example bacteria, yeast, fungi, or animals.
  • the present invention uses as a mutagenic agent one capable of introducing random mutations into the genome of at least one plant cell.
  • the present invention uses as a mutagenic agent to introduce random mutations into the genome of at least one plant cell a step chosen from the group comprising: chemical mutagen, irradiation with ultraviolet light, irradiation with X-rays, irradiation with gamma rays, and a transposable genetic element.
  • said mutagenic agent will be a chemical agent and in particular a DNA-alkylating agent.
  • DNA-alkylating agents a more specific embodiment of the invention makes use of ethylmethane sulphonate (EMS) and N-Methyl-N'-nitro-N-nitrosoguanidine (MNNG). Said agents are able to introduce a methyl group on the 06 position of guanine. O6-methylguanine lesions can give rise to G-C to A-T transitions in subsequent DNA synthesis steps in propagation of the cell. Hence, this type of mutagenesis in general introduces basepair substitutions.
  • EMS ethylmethane sulphonate
  • MNNG N-Methyl-N'-nitro-N-nitrosoguanidine
  • deletions resulting from X- ray irradiation or insertions resulting from transposable elements which tend to result in frameshift mutations and partial or complete loss-of-function of a gene
  • basepair substitutions introduced by DNA-alkylating agents will mainly lead to amino acid substitutions. Therefore, such mutations can reveal a much larger spectrum of phenotypes, among others partial loss- of function phenotypes and gain-of-function phenotypes, than other forms of random mutagenesis.
  • said chemical agent will induce frameshift mutations.
  • the method described in the present invention can be used to introduce genetic mutations into at least one somatic or germ plant cell, which is capable of propagation.
  • plant cell may be a meristematic cell that gives rise to progeny.
  • the present method can also be used to mutagenise seed of a plant.
  • said plant cell can be derived from various plant species, such as by way of example and not limitation: maize, wheat, rice, barley, sorghum, tobacco, tomato, potato, Brassica spp., soybean, pea, sunflower, cotton, peanut, Arabidopsis thaliana, Nicotiana, and Medicago.
  • the present invention provides a plant cell that is obtainable by the method of the invention.
  • an additional embodiment of the invention provides a plant that is derived by propagation from said mutagenised cell.
  • progeny of said plant obtained in generative or vegetative manner is provided by the invention.
  • the present invention also provides parts or derivatives of said plant, which are suitable for propagation, such as organ tissue, leaves, stems, roots, shoots, protoplasts, somatic embryos, anthers, petioles, pollen, cells in culture, and seeds.
  • parts or derivatives of said plant which are suitable for consumption, such as seeds, fruits, stems and leaves, are provided by the present invention.
  • parts or derivatives of a plant obtainable from said mutagenised plant cell are also provided by the invention, comprising organ tissue, leaves, stems, roots, shoots, protoplasts, somatic embryos, anthers, petioles, pollen, cells in culture, and seeds.
  • the present invention also provides the plant obtainable from said mutagenised plant cell and the progeny of said plant obtained in generative or vegetative manner, said plant and the progeny thereof having at least one mutant phenotype.
  • Such plants will be a valuable resource in identification of novel advantageous phenotypes in plants, in mutation breeding and in forward and reverse genetics approaches.
  • the present invention also provides the nucleic acid isolated from the plant obtainable from said mutagenised plant cell and the progeny of said plant obtained in generative or vegetative manner, said plant and the progeny thereof having at least one mutant phenotype, wherein said nucleic acid comprises at least one mutation responsible for said at least one mutant phenotype.
  • nucleic acids comprising at least one nucleic acid carrying at least one mutation responsible for said at least one mutant phenotype according to the previous embodiment is anticipated. Such collection will be a valuable resource for forward and reverse genetics approaches in plants.
  • the present invention also provides an assay of the presence of mutagenic agents in an environmental sample, comprising the steps of: (i) exposing at least one plant cell to an environmental sample; (ii) assessing the occurrence of mutations in plants or plant parts and derivatives obtainable by propagation of said at least one plant cells. Further description of additional aspects of the described method can be found in the accompanying examples.
  • Figure 1 illustrates RT-PCR (A) and radioactive probing of the RT-PCR membrane (B) for different lines of transgenic N. plumbaginifolia overexpressing the Msh2 G671D mutant and the two controls: wild type N. plumbaginifolia (P2) and A. thaliana.
  • A RT-PCR
  • B radioactive probing of the RT-PCR membrane
  • P2 wild type N. plumbaginifolia
  • P2 wild type N. plumbaginifolia
  • A. thaliana A. thaliana
  • Figure 2 illustrates A. Location of point mutation in the dominant negative Msh2 G671D mutant and position of T-DNA insertion in Msh2 protein for 002708 line. Abbreviations:
  • MutS_N and MutS_C MutS domains found in proteins of the MutS family; MutSd: DNA binding domain of MutS family; MutSac: ATPase domain of MutS family.
  • the mutation G671 D in the dominant negative mutant is located in ATPase domain of Msh2 protein.
  • the T-DNA insertion caused a deletion in MUTSac domain, from 645 to 924 aac (Leonard et al. (2003). Plant Physiology 133: 328-338).
  • DNA insertion lines (002707 and 002708).
  • CoIO and 002707 line the PCR amplification with the combination of primers a and c indicate the absence of T-DNA insertion in the region
  • C-D primers indicates the deletion of this region in T-DNA insertion mutant while the amplification with the combination b of primers (A-LBbI) indicates the localisation of T-DNA insertion downstream to A primer.
  • FIG. 3 Spontaneous albino phenotype in Nicotiana plumbaginifolia overexpressing Msh2 G671 D mutants (A) and Arabidopsis thaliana Msh2-T-DNA insertion mutant: 002708 (B). Spontaneous callusogenesis from plantlets derived from seeds.
  • C Nicotiana plumbaginifolia overexpressing Msh2 G671 D mutant
  • D Arabidopsis thaliana Msh2 T-DNA insertion mutant 002708.
  • FIG. 1 Dynamic of cell division in protoplast population isolated from wild type P2 and plants overexpressing Msh2 G671D mutant. After 14 days of culture (dark, at room temperature) were scored in successive microscopic fields the number of single cells, two cells and microcolonies formed. The mean of these values are represented in the graph.
  • Figure 5 A. Gradual reduction of total leaf surface for wild type N. plumbaginifolia germinated on medium containing increasing concentrations of MNNG (0-100 ⁇ M). The higher the mutagen concentration, the stronger the delay exerted on plant development.
  • B Graphic representation of reduction in total leaf surface in N. plumbaginifolia plantlets derived from seeds germinated on medium containing different concentrations of MNNG. The amplitude of leaf reduction in mutated N. plumbaginifolia was quantified with the ASSESS program and expressed in relative values, reported to the maximum recorded value.
  • Figure 7 A. The difference in total leaf surface observed for plantlets in Petri dishes are retrieved to a lesser extent in untreated adult plants grown in greenhouse conditions, regardless of their position on the plant (A1 - P2 and A2 - Msh2 G671 D/S16). Wild type and transgenic plants derived from EMS 0.3% - 9Oh treated seeds, have a normal development in greenhouse conditions (A3 - P2 and A4 - Msh2 G671D/S16).). Leaf position on longitudinal axe: A: basal; B: 1/3 inferior; C: 1/3 superior; D: apical leaf. B. The yield of seeds harvested per individual capsule from mutated plants was considerable reduced compared to the yield of seeds harvested per individual capsule from untreated plants (B1 - P2 and B2 - Msh2 G671D/S16).
  • Figure 8 Phenotype of Msh2 G671 D/S16 - M2 plantlets generated from seeds collected from EMS treated parental plants. None of these abnormal phenotypes were observed for M2 wild type plantlets obtained from mutated M1 parental wild type plants.
  • Figure 9. Figure 9 Induced variegated phenotype after EMS mutagenic treatments in Arabidopsis thaliana Msh2-T-DNA insertion mutant 002708 A. multiple spotted, B. half white
  • FIG. 10 A. Germination of CoIO and 002708-T4 mutated seeds treated with 0.3% EMS for 18h. Difference in germination efficiency is observed between CoIO and 002708 for long EMS treatment (18h), but not for short EMS treatment (3h). B. Percentage of seed germination after EMS treatment. According to the germination test the resistance to EMS treatment (0.3%, 18h) is higher in successive generations of Msh2 deficient A. thaliana (002708-T4 and 002708-T5) than in controls CoIO and 002820 line.
  • Table 1 Segregation of albino (white and light green) phenotype in successive generations of Msh2 T-DNA insertion mutant: 002708.
  • the observed ratio of 1 :15 for albino in T5-4 generation indicates the mendelian inheritance of a double recessive mutation, and may explain the low frequency of albino in T4 and the absence of this phenotype in other 002708 offspring lines.
  • the seed stocks used in our experiment were obtained starting from a limited number of seeds SALK 002708 and seeds SALK 002707, supplied from SIGnAL: SaIk Institute Genomic Analysis Laboratory (http://signal.salk.edu/tdna_protocols.html). DNA was extracted from plantlets of CoIO, 002708 and 002707 lines using Plant DNA Mini Kit (Qiagen).
  • T-DNA fragment in msh2 gene was confirmed by PCR, using the left border T- DNA anchored primer LBbI (gcgtggaccgcttgctgcaact) and Msh2 specific primers A (atggagaatacatgatatcttcaagc), D (ctttcagtgtcaatgtgagcgctgac) and C (gcggatgaaagtggacttatctccca).
  • the primers A, D and C span the ATP binding domain of the Msh2 protein and the exact location of A, D and C primers is illustrated in Figure 2A.
  • the PCR amplification of 1 kb A-D fragment and 0.4 kb C-D fragment indicate the absence of T- DNA insertion in this region, while the amplification obtained with LBbI- A primers combination indicates the disruption of msh2 gene in the ATP binding site, downstream to the primer A.
  • the Msh2 point mutant was generated starting from A.thaliana cDNA Msh2 -gi 3914056 (generous gift of dr. Culligan), introducing the G 671 D point mutation in the TGPNM conserved domain, by SOEing PCR technique (Splicing by Overlap Extension).
  • the bordering primers used are: primer A (atggagaatacatgatatcttcaagc) containing the internal EcoRV restriction site and primer D (ctttcagtgtcaatgtgagcgctgac) containing the msh2 internal Eco47lll site. These restriction sites were used for cloning of the mutated fragment into the wild type msh2 gene.
  • the internal point mutation was introduced using C-B primers: primer C (gcggatgaaagtggacttatctccca) in sense and primer B (tgggagataagtccactttcatccgc), complementary to primer C, in antisense orientation.
  • primer C gcggatgaaagtggacttatctccca
  • primer B tgggagataagtccactttcatccgc
  • Apal site used for direct screening of the introduced point mutation.
  • the principle of SOEing PCR is presented in the Annexes and the exact location of A-D primers is illustrated in Figure 2A.
  • the presence of desired mutations was confirmed by sequencing.
  • the Ncol-Sphl fragment containing the full mutated Msh2 cDNA was isolated using a triple digestion: Ncol, Sphl and Pvul.
  • the 2.9kb fragment corresponding to Msh2 G 671 D mutant, flanked by Ncol site at 5' end and Sphl site at 3' end was isolated from the gel, and the ends polished by treatment with T4 DNA polymerase. Consequently to the fill-in and polishing of ends the fragment was ready for blunt-end cloning in the backbone of the modified binary vector FRG8 (Timmermans et al. (1990) J. Biotech. 14: 333-344).
  • the sense orientation of mutated Msh2 G 671 D was confirmed by restriction mapping.
  • the binary vector was introduced into Agrobacterium tumefaciens LBA 4404 by heat shock. Agrobacterium leaf-disc transformation of N.
  • plumbaginifolia P2 was performed as described by Horsch and collaborators (Horsch et al. (1985) Science 227: 1229-1231 ). Transformed plants were generated and selected on MS medium supplemented with 50mg/l kanamycine. The number of T-DNA insertion loci was determined from the kanamycine resistance segregation ratio.
  • the Arabidopsis msh2-specific primers will allow amplification of transcribed Msh2 in transgenic plants overexpressing Msh2 mutant and in Arabidopsis, but not necessarily in WT N. plumbaginifolia.
  • msh2 - mRNA for amplification of endogenous msh2 - mRNA in Nicotiana, couples of degenerate primers were used and different RT-PCR amplification profiles, starting from two weeks young leaves, without success.
  • Protoplasts were isolated from WT and plants overexpressing Msh2 G671 D protein, following the protocol of Negrutiu (Negrutiu (1981) Z.Planen physiologie 104: 431-442).
  • Negrutiu Negrutiu (1981) Z.Planen physiologie 104: 431-442.
  • MNNG mutagenesis we followed basically the protocol of King (King (1983). Cell Culture and somatic cell genetics of plants , voll: Laboratory procedures and their applications. Editor: lndra K. Vasil, Accademic Press.lnc, ISBN: 0-12-7150011983) adapted to microwell plates. Particular attention was given to the adjustment of protoplast density during MNNG treatment since the higher the cell density, the smaller the effect of any one MNNG concentration.
  • the protoplast density was counted with a Thoma chamber and adjusted to 500000 protoplasts/ml.
  • the mutagen MNNG was obtained from Sigma and diluted in DMSO to a stock concentration of 1OmM. Protoplasts were treated with MNNG to a final concentration of 10 ⁇ M mutagen, for a period of 10 minutes. Because of the loss of activity, MNNG was not washed from the protoplasts in the further steps but diluted 10 times in protoplasts culture medium. After the mutagenic treatment protoplasts were cultured at 10 times dilution, in a final volume of 500 ⁇ (50 ⁇ l treated protoplasts plus 450 ⁇ K3M medium) in multiwell plates, in culture room at 25°C and absence of light.
  • the plating efficiency was counted after 2 weeks according to the protocol of Harris and Oparka (Harris and Oparka (1994) Plant Cell Biology-A practical approach; Fluorescent probes for studies of living plant cells. Oxford University Press: pp 45-461994).
  • To 40 ⁇ protoplast suspension 4 ⁇ of 1mg/ml FDA (fluorescein diacetate) was added. The single cells; two sister cells formed after the first division and microcolonies were scored under a UV-light Axiophot microscope (Zeiss).
  • a second negative control beside CoIO was used for the germination test.
  • the line is called 002820, is originated from the same SIGnAL collection and the T-DNA insertion was identified at the level of methionine synthase gene, based on in silico analysis. Since the germination efficiency may be affected by the conditions in the greenhouse, the moment of harvesting and the storage conditions, the seeds used in this experiment were obtained from 002708 line, CoIO and 002820 line grown, harvested and stored in the same conditions. The scoring of occurrence of white sectoring in leaves was assayed ( a similar method was used by Preuss and Britt (Preusee and Britt(2003) Genetics.
  • RTLS total leaf surface
  • a number of 100 seeds were sowed per Petri dish and two to four Petri dishes scored for each variant.
  • the ASSESS program American Society of Plant Pathology
  • the RTLS represents the % of green leaf area reported to the total surface of the Petri dish (constant). After 2-3 weeks , in the stage of 4-6 leaves the Petri dishes were pictured with a digital camera and the RTLS measured using the ASSESS program.
  • Nicotiana plumbaginifolia transgenic lines overexpress the Msh2 G 671 D dominant negative mutant
  • N. plumbaginifolia T 0 competitive inhibition (Cl) transformants were screened by RT-PCR and a total number of 12 transgenic lines overexpressing the Msh2 G 671 D dominant negative mutant were identified ( Figure 1 ). No Msh2 expression was observed whatsoever neither for A. thaliana 2 weeks old plantlets nor for the wild type N. plumbaginifolia young leaves.
  • Ade et al. (Ade et al. (1999) MoI. Gen. Genet. 262: 239- 249) mentioned that msh2 gene is very poorly expressed in plant tissues. They have observed expression of A. thaliana Msh2 mainly in cell suspension with Msh2 most strongly expressed in cells in exponential growing phase, 2 days after inoculation. The msh genes expression pattern with very poor level of expression in somatic tissues and increased level of expression in highly dividing mitotic tissues and anthers in meiotic division was confirmed in wheat by Dong et al. (Dong et al. (2002) Genome 45: 116-124), and in Arabidopsis by Ade et al. (Ade et al. (2001) Genome 44: 651-657).
  • CaMV 35S and Msh2 promoters Consequently between the activity pattern of CaMV 35S and Msh2 promoters seems to be a strong difference. While both promoters are active in mitotically dividing cells, in mature vegetative tissues (mature leaves) just CaMV-35S promoter is highly active. Differential activity is observed as well for meiotically dividing cells, with Msh2 promoter up regulated during meiosis (Dong et al. (2002) Genome 45: 116-124) and background level of activity for CaMV 35S promoter in pollen mother cells in meiosis I with a slight increased activity in meiosis II.
  • This differential pattern of activity between the CaMV 35S and Msh2 promoters makes the CaMV 35S promoter suitable to assess MMR deficiency in mitotic dividing cells, meristematic apex and vegetative tissues but less appropriate to analyze meiotic specific processes in the context of MMR deficiency.
  • MMR deficiency is associated with a spontaneous mutator phenotype in Arabidopsis thaliana and Nicotiana plumbaginifolia, phenotype absent in MMR proficient plants
  • the T-DNA insertion in SALK 002708 line was located in At3g18525 locus based on in silico analysis, locus corresponding to msh2 gene. More precisely, based on the information published by Leonard et al., 2003 and our results, the T-DNA insertion is situated in one of the exons located in 3' terminal part, in the ATP binding site (Fig. 2A). The absence of PCR amplification of C-D fragment confirms that the T-DNA insertion caused the deletion of this region in 002708 line, C-D fragment being a part of msh2 deletion: exons 7 to 13, caused by the single T-DNA insertion (Leonard et al. (2003) Plant Physiol. 133: 328-338).
  • T4 generation we identified an "albino" phenotype, encompassing the whole plant and this phenotype was retrieved in generation T5 in one single line called T5-4 (Fig.3B).
  • Fig.3 A One single event of variegated (sectorial albino development) was recovered for one of the 20 primary competitive inhibition N. plumbaginifolia transformants (Fig.3 A). From this variegated plant, albino auxotrophic plants as well as normal green autotrophic Nicotiana were obtained in a further step by dissection of the apical meristem and leaves, indicating the location of mutation in one of the cells located in central zone of the meristem. It may be that during organogenesis, in MMR deficient background a mutation occurred in one of the albino loci and further on through somatic recombination the homozygotation of this mutation took place, leading to the observed variegated phenotype. A slight reduction in germination frequency of 002708 line (78-85%) compared with colO control (approximate 98%) was observed constantly in different experiments.
  • the second spontaneous mutator phenotype observed in MMR deficient plants is the generation of callus from seeds sowed on MS medium, without hormone supplement and without selection. Just one single event was observed in 4.000 sowed seeds for msh2 deficient Arabidopsis and respectively one single event in approximate 2.000 sowed Nicotiana MMR deficient plants (Fig. 3, C and D). No spontaneous or EMS induced callusogenesis was observed whatsoever in a similar number of wild type Nicotiana and CoIO Arabidopsis.
  • Nicotiana overexpressing Msh2 dominant negative mutant presents increased resistance to high dose of MNNG, based on protoplast plating efficiency
  • protoplasts were isolated from wild type and transgenic Nicotiana overexpressing Msh2 G 671 D protein. The results were scored after 14 days of culture in optimum conditions and represented as number of single cells (no division), two cells (one single division) and microcolonies (more than one division) per microscopic field.
  • the MNNG treatment blocked cells to enter first division, with the blockage being stronger for the second division, with a ration of protoplasts dividing more than once compared to the untreated protoplasts of 15 microcolonies vs 76,5 microcolonies per microscopic field for treated vs untreated protoplasts, giving a comparative value of 19,6 % - 15 x 100/76,5- ( Figure 4).
  • the MNNG blockage of the cell division is more relaxed in the plants overexpressing the dominant negative Msh2 mutant.
  • An increase in number of cells undergoing first and more than one division is observed for all 7 MMR deficient lines, with notable results for S16, where no significant difference is observed between the number of microcolonies formed in absence: 79 microcolonies and/or presence of mutagenic treatment: 82,5 microcolonies per microscopic field (Figure 4), giving a comparativetric value of 95,75%.
  • the comparison with untreated controls shows that the blockage of division is not completely removed, but constantly for the protoplasts with MMR deficiency the frequency of the cells being able to pass over the first block of division, is higher than the frequency of wild type cells able to divide in the same conditions.
  • the profile of cell division in MNNG treated protoplasts is similar to one for untreated cells ( Figure 4). This line was chosen for further studies on tolerance to alkylating agents at plantlet level.
  • reaction to the treatment with alkylating agents in plants will depend on the moment of the treatment, dose of mutagenic agent, targeted organ and plant species.
  • RTLS indicates no significant difference between P2 and G 671 D Msh2/ S16 plantlets germinated from seeds treated with 0.3% EMS for prolonged period of time: 9Oh (Figure 6C).
  • MMR deficient Arabidopsis thaliana shows increased resistance to high dose of EMS and increased frequencies of mutations at reduced dozes of EMS
  • Nicotiana overexpressing Msh2 dominant-negative mutant is a plant system where
  • A. thaliana SALK 002708 is a clear situation where the MMR system is dysfunctional due to the disruption of Msh2 gene through T-DNA insertion.
  • EMS treatment we have used the germination test for seeds treated with mutagenic agent. When low EMS concentrations and reduced treatment durations were used: 0.6% EMS for 3h and respectively 0.3% EMS for 6h, no significant differences in percentage of germination have been observed for CoIO and Msh2 deficient Arabidopsis. Nevertheless the MMR deficient plants presented mutated phenotypes with an increased frequency, scored based on albino marker.
  • a stronger mutagenic treatment with 0.3%EMS for 18h will cause embryo lethality and consequently the germination test will be the most adequate to illustrate the resistance of plants to these type of mutagenic treatment. Since the germination efficiency may vary in function of the greenhouse conditions, the moment of harvesting and storage conditions, the 002708 line, CoIO as well as the second negative control: the SALK line 002820, were grown, harvested and treated with mutagen for the germination test, simultaneously, within one experiment.
  • T4 and T5 of MMR deficient Arabidopsis show an increased resistance to EMS treatment compared to MMR proficient plants ( Figure 10B).
  • a germination frequency of 40% was observed for T4 generation of 002708 line compared with 10% germination efficiency for CoIO mutated seeds ( Figure 10 A and B).
  • Similar results were obtained for MMR deficient plants in T5 generation, with 70% germination for MMR deficient plants compared to 30% germination for 002820 line used as a first control and 38% germination for CoIO plants used as second control (Figure 10B).
  • Example 3 Genotypic analysis of EMS-mutagenised wild-type and mismatch repair deficient N. plumbaginifolia
  • N. plumbaginifolia sequences were selected from Genbank. The total length of the amplicons is 9812 base pairs (bp). 32 M2 plants from a WT line and 32 M2 plants from the MMR deficient line S-16 were screened for SNPs. Therefore a total of 628000 bp was screened for each genotype.
  • Candidate mutant alleles identified by TILLING were reamplified by PCR and sequenced. One confirmed mutation was found in the 628 kb screened DNA of M2 WT plants, and four confirmed mutations were found in 628 kb DNA of M2 mismatch repair deficient plants (see Table 3).
  • the invention has demonstrated that increase in mutation frequency in response to chemical mutagens (here in particular alkylating agents) can be achieved in plant cells deficient in the mismatch repair system.
  • the mutation frequency in WT EMS treated N. plumbaginifoiia is in the same range as that detected by TILLING in EMS treated A. thaliana, i.e. 1 mutation per 300 kb screened (Greene et al. Spectrum of chemically induced mutations from a large-scale reverse-genetic screen in Arabidopsis. Genetics 164: 731-740, 2003).
  • mismatch repair deficient N. plumbaginifoiia a four-fold increase in mutation frequency was found at the DNA level. This confirms the increase in induced mutations in mismatch repair deficient plants observed at the phenotypic level.

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Cell Biology (AREA)
  • Botany (AREA)
  • Developmental Biology & Embryology (AREA)
  • Environmental Sciences (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The present invention provides a method for introducing genetic mutations into the genome of plant cells, comprising the steps of: (i.) suppressing the activity of at least one endogenous system of DNA repair in said at least one plant cell; (ii.) exposing said at least one plant cell to at least one mutagenic agent. In particular embodiments of the present invention the mismatch repair system is suppressed in said plant cell, and a DNA-alkylating agent is used for mutagenesis. The present invention aspires to enable the generation of libraries of mutants of various plant species, wherein a greater proportion of the genes will be containing a mutation, and wherein a greater number of different phenotypes will be obtained than achieved using current methods. This effect of the present invention will help close the 'phenotypic gap' present in the existing libraries of plant mutants.

Description

METHOD FOR INTRODUCING GENETIC MUTATIONS INTO PLANT CELLS
Field of the Invention
The present invention relates to mutagenesis in plants. In particular, the present invention relates to methods for efficiently introducing genetic mutations into the genomes of plant cells. More specifically, the present invention discloses a method that can be especially useful for generating collections of plant mutants with mutation-saturated genomes.
Background to the Invention
Collections of plants with very high numbers of mutations are needed for reverse genetics and forward genetics approaches and for mutation breeding. Traditional approaches to plant mutagenesis typically involve mutagenising wild-type cells as exemplified in, e.g., Lightner and Caspar (Methods in Molecular Biology, Vol. 82 Arabidopsis protocols. Seed mutagenesis of Arabidopsis. Martinez-Zapater and Salinas, Eds., Humana Press Inc., Totowa NJ, 1998).
However there are many problems associated with generating these mutant resources. Many crop plants have very large genomes, which makes it difficult to saturate their genomes with mutations. Moreover, it is often difficult to find an acceptable balance between a high frequency of mutations and the lethality of the treatment with mutagenic agents. Thus, there seems to exist a problem of 'phenotypic gap', meaning that many phenotypes have not yet been recovered in the existing libraries of mutant plants (see, e.g., Brown and Peters. Combining mutagenesis and genomics in the mouse - closing the phenotype gap. Trends in Genetics 12: 433-435, 1996; Maluszinsky. Crop germplasm enhancement through mutation techniques. Proceedings of the International Symposium on rice germplasm evaluation and enhancement, Rutger, Robinson, and Dilday, Eds. pp. 74-82, 1998; Miflin B. Crop improvement in the 21st century. Journal of Experimental Botany 51 : 1-8, 2000).
'Phenotypic gap' appears both in forward genetics approaches, i.e., when searching for particular phenotypes, and in reverse genetics approaches, i.e., when looking for individuals with a mutations in a particular gene - in both situations, very large populations need to screened to obtain the desired mutant. For example in Arabidopsis, which has a very small genome, it is estimated that more than 6000 mutagenised plants are necessary to obtain 20 mutant alleles, which may be considered as a sufficiently large allelic series for a mutational analysis, for a given gene (Greene et al. Spectrum of chemically induced mutations from a large-scale reverse-genetic screen in Arabidopsis. Genetics 164: 731-740, 2003).
The present invention aims at providing an efficient method to introduce genetic mutations into the genomes of plant cells. In doing so, the present invention aspires to enable the generation of libraries of mutants of various plant species, wherein a greater proportion of the genes will be containing a mutation, and wherein a greater number of different phenotypes will be obtained than achieved using current methods. This effect of the present invention will help close the 'phenotypic gap' present in the existing libraries of plant mutants.
The inventors are unaware of prior art that would solve the problem of closing the 'phenotypic gap' in plant mutagenesis. Nevertheless, an account of related prior art is included here below. Leonard et al. (Plant Physiology 133 (2003): 328-338) showed that inactivation or down-regulation in Arabidopsis thaliana of the AtMSH2 gene that encodes one of the proteins involved in the mismatch repair system (MMR) leads to increased instability of select repetitive sequences in these plants. Hence, MMR in plants is likely important for maintaining the length of repetitive sequences and a higher number of spontaneous insertion and deletion mutations in these repetitive sequences will arise in plants with deficient MMR. Importantly, however, such repetitive sequences are mostly found outside of gene regions that code for proteins and hence, the increased mutation frequency of said repetitive sequences in MSH2- deficient plants will most likely result in a limited number of discernible phenotypes. Therefore, said increased mutation frequency of repetitive sequences is not useful for production of libraries of mutant plants.
WO0188192 described a way to generate hypermutable mammalian cells by introducing into said cells a dominant negative variant of a gene involved in MMR. Such cells show increased efficiency of mutagenesis in response to mutagenic agents and can be screened for mutations in genes of interest or for novel phenotypes. Following mutagenesis, genetic stability of the cells was re-established by turning off the expression of the dominant negative MMR gene. WO0188192 did not extend its findings to plant cells. However, there exist important differences in DNA repair systems between plants and mammalian species. For example, and also relevant to alkylating mutagens, plants do not possess methylguanyl methyl transferases, whereas mammals do. On the other hand, plants do possess photolyases which are absent in mammals. Also the repertoire of glycosylases which remove various types of base damage differs substantially between plants and other organisms (see, e.g., Hays. Arabidopsis thaliana, a versatile model system for study of eukaryotic genome- maintenance functions. DNA Repair 1 : 579-600, 2002; Arabidopsis Genome Initiative. Analysis of the genome sequence of the flowering plant Arabidopsis thaliana. Nature 408: 796-815, 2000). Therefore, the effects of manipulating a DNA repair system in mammalian cells cannot be readily extrapolated to plants, and it was not at all obvious from this document whether suppression of MMR in plant cells would lead to increased efficiency of mutagenesis in these cells. Another major difference between plants and animals is that in somatic plant cells mutation frequencies may be orders of magnitude higher than in mammalian cells (Kovalchuk et al. Genome-wide variation of the somatic mutation frequency in transgenic plants. EMBO J. 19: 4431-4438, 2000). Hence, it could not be inferred from experiments with mammalian cells, whether inactivation of MMR would also increase the mutability of plant cells in response to mutagens.
In addition, WO0188192 used an inducibly expressed dominant negative MMR gene, such that following mutagenesis the expression of the said dominant negative gene could be turned off. Presumably, this was found crucial for re-establishing the genetic stability of the mutagenised cells. However, reliable inducible systems that would work at the whole plant level and/or in seeds, and/or in a wide range of plants, are not available. While some systems have been developed for the model plants Arabidopsis thaliana or Nicotiana tabacum, these only work with particular well-characterized lines expressing a critical level of a repressor or activator and it remains very difficult to work with other lines, or to develop such lines for other (crop) plant species. Moreover, the uptake and transport of an inducer of expression in plant tissues and/or seeds may be problematic, especially if MMR should be suppressed only in particular cells of a plant, such as, e.g., in a few meristematic cells that would give rise to progeny. Also for the above reasons, a skilled person would not have considered applying the teachings of WO0188192 to plants cells. In particular, he would presume that because the expression of the dominant negative MMR gene could not be effectively turned off in the mutagenised plant cells, the cells would remain genetically unstable (hypermutable) and thus unsuitable for further propagation and phenotypic analysis. For analogous reasons, a skilled person would also consider other ways of MMR suppression, in particular ways which are in general not readily reversible, as unsuitable for preparation of plant mutagenesis libraries.
WO0224890 described a method for increasing the efficiency of targeted gene mutation and/or of homologous recombination in a plant cell, wherein the activity of the MLH1 gene involved in MMR has been suppressed by one of multiple approaches in said plant cell. However, this document did not investigate the possibility to increase the efficiency of random mutagenesis with mutagenic agents in plant cells by suppressing the activity of MMR.
EP 1 333 095 described that recombination between partially homologous DNA sequences can be facilitated through inactivation of the mismatch repair system in cells. EP 1 333 095 utilised this finding to achieve targeted replacement of an endogenous sequence by a foreign DNA sequence. However, targeted recombination is mechanistically entirely distinct from random mutagenesis, such as, e.g., using alkylating agents. Therefore, EP 1 333 095 does not disclose nor suggest using MMR deficient cells in random mutagenesis.
WO 02/054856 described the possibility to suppress mismatch repair system in plant cells using chemical inhibitors, thereby generating spontaneously hypermutable plant cells, and optionally subject the said plant cells to further chemical mutagenesis. Genetic stability of the cells following mutagenesis was re-established through removal of the chemical inhibitor of MMR. However, the use of chemical MMR inhibitors entails several disadvantages. Many such inhibitors (e.g., anthracenes) lack specificity and may show a wide variety of other effects, such as alterations in mitotic recombination, cell cycle regulation, single stranded DNA cleavage, double stranded DNA cleavage, general cytotoxicity, etc. Similarly, inhibitors including ATPase, nuclease and polymerase inhibitors, influence numerous metabolic reactions apart from MMR. These and other non-specific effects of chemical MMR inhibitors (e.g., cell cycle arrest, chromosome breakage, cell death, etc.) can greatly reduce their utility in plant mutagenesis. Moreover, chemical inhibitors may suffer from inadequate uptake and/or transport in plant tissues and/or seeds, which may be particularly troublesome if one desires to suppress MMR only in particular tissues or cells of a plant, such as, e.g., in a few meristematic cells that give rise to progeny. Summary of the Invention
The present invention provides a method for efficiently introducing genetic mutations into the genome of a plant cell. The method utilizes the fact that suppressing the function of an endogenous system of DNA repair will cause increased resistance of plant cells to high doses of mutagenic agents, as well as increased mutagenic effect of these agents in said plant cells.
Accordingly, the method provided in the present invention comprises the steps of: (i.) suppressing the activity of at least one endogenous system of DNA repair in said at least one plant cell; and (ii.) exposing said at least one plant cell to at least one mutagenic agent.
Furthermore, the present invention demonstrates that suppressing the mismatch repair system dramatically increases the ability of plant cells to sustain DNA damage induced by mutagenic agents and to accumulate mutations. In accordance with this new fact, in several embodiments the method of the present invention comprises suppressing the activity of the mismatch repair system.
The present invention also realises that advantageous ways of suppressing the mismatch repair system in plant cells may comprise the following: partial or complete inactivation of at least one copy of at least one gene involved in said mismatch repair system, down-regulation of the expression of at least one gene involved in said mismatch repair system, introducing a dominant negative variant of at least one gene involved in said mismatch repair system, introducing an antibody or an expression cassette encoding such antibody capable of binding to at least one protein involved in said mismatch repair system, introducing agents capable of saturating the activity of said mismatch repair system, and over-expression of at least one gene involved in said mismatch repair system or a biologically active variant thereof. As explained above, such ways would not appear suitable to an average skilled person. More in particular, a skilled person would presume that because such ways may be in general not readily reversible, they would result in plant cells that would remain hypermutable and would accrue additional mutations after the actual mutagenesis step. The skilled person would consider such genetically unstable cells as unsuitable for further propagation and phenotypic analysis. As a matter of example an not limitation, the present invention realises that an advantageous way of suppressing the mismatch repair system in plant cells may comprise introducing a dominant negative variant of at least one gene involved in said mismatch repair system. A skilled person would presume that dominant negative MMR variant could not be efficiently turned off in plant cells after mutagenesis. Therefore, the skilled artisan would expect that the use of dominant negative MMR variants would result in plant cells which would remain hypermutable and would accrue additional mutations after the actual mutagenesis step. The skilled person would consider such genetically unstable cells as unsuitable for further propagation and phenotypic analysis.
In contrary to the above considerations, the present inventors surprisingly realised that MMR deficient plants (such as those obtained in the above mentioned ways) can be propagated through several generations without the need to re-establish MMR proficiency. As a matter of example, but not limitation, MMR deficient plants obtained by introducing a dominant negative variant of an MMR gene can be propagated through several generations without the need to reduce the expression of the said dominant negative MMR variant. Although some mutant phenotypes may appear, this does not substantially interfere with growth, reproduction and phenotypic characterisation, which is surprising.
Hence, the present application discloses that plant cells with suppressed mismatch repair system (such as, e.g., by dominant negative MMR variants) can be efficiently mutagenised. Surprisingly, such mutagenised plant cells are suitable for preparation of plant libraries, since the inventors found that MMR deficient plants may be propagated without the need to re-establish MMR proficiency (such as, e.g., without the need to reduce the expression of the said dominant negative MMR variant). Together, this may help to close the 'phenotypic gap' in such libraries.
In addition, the above detailed ways of suppressing the MMR in plant cells are advantageous over chemical MMR inhibitors which, as detailed above, often show non-specific effects and suffer from inadequate uptake and/or transport in plant tissues and/or seeds. In contrast, the above methods allow for specifically targeting the MMR process, and MMR in any desired cell type of a plant. Furthermore, the present invention preferably employs mutagenic agents capable of introducing a random mutation into the genome of plant cells.
Moreover, the present invention also realizes the advantages of using DNA-alkylating agents to mutagenise plant cells. Because of the fact that DNA-alkylating agents induce basepair substitutions rather than deletions or insertions, they can yield a qualitatively richer spectrum of mutations than other methods, such as X-ray irradiation or insertion of transposable elements. Basepair substitutions induced by DNA-alkylating agents will often result in single amino acid changes in the affected proteins, which might lead to for example a complete loss of function of the protein, a partial loss of its function, or to gaining a novel function. In this way a large variety of alleles can be created. Accordingly, in several embodiments of the present invention said method uses DNA-alkylating agents for mutagenesis.
The present invention provides mutagenised plant cells, as well as plants and plant parts and derivatives derived from these plant cells. The present invention also envisages collections comprising such plants.
Preferred embodiments of the present invention are described here below and in claims 2 to 29.
Detailed Description of the Invention
Before the present method and compositions used in the method are described, it is to be understood that this invention is not limited to particular methods, components, or compositions described, as such methods and compositions may, of course, vary. In the present specification and the appended claims, the singular forms "a", "an", and "the" include plural references unless the context clearly dictates otherwise. It should also be understood that the terminology used herein is not intended to be limiting, since the scope of the present invention will be limited only by the appended claims. Accordingly, definitions should not be understood to limit the scope of the invention. Rather, they should be used to interpret the language of the description and, where appropriate, the language of the claims. These terms may also be understood more fully in the context of the description of the invention. If a term is included in the description or the claims that is not further defined within the present description, or that cannot be interpreted based on its context, then it should be construed to have the same meaning as it is understood by those skilled in the art. The present invention relates in particular to efficiently introducing random genetic mutations into the genome of a plant cell.
By "nucleic acid" is meant DNA, RNA, or other related compositions of matter that may include substitution of similar moieties. For example, nucleic acids may include bases that are not found in DNA or RNA, including, but not limited to, xanthine, inosine, uracil in DNA, thymine in RNA, hypoxanthine, and so on. Nucleic acids may also include chemical modifications of phosphate or sugar moieties, which can be introduced to improve stability, resistance to enzymatic degradation, or some other useful property.
In one aspect, the present invention provides a method for introducing at least one genetic mutation into at least one plant cell, comprising the steps of: (i.) suppressing the activity of at least one endogenous system of DNA repair in said at least one plant cell; and (ii.) exposing said at least one plant cell to at least one mutagenic agent. In a plant cell with functioning DNA repair systems, the DNA damage caused by applying a mutagenic agent would be to a large extent removed by the DNA repair systems before the cell would undergo the next cell division. This would in turn by large prevent the occurrence of mutations in the progeny of said cell. On the contrary, the present invention performs mutagenesis in a plant cell with suppressed action of one or more DNA repair systems. Such cells will be unable to efficiently remove the DNA damage caused by the mutagenic agent and this DNA damage will be turned into mutations - i.e., deviations from the DNA sequence of the mother cell before the mutagenesis - in daughter cells originating from the mutagenised mother cell. The present method should therefore amplify the effect of said mutagenic agent and help obtain plant cells with much wider spectrum of mutations than can be achieved with currently available methods.
Under "endogenous system of DNA repair" is meant any of the multiple enzymatic pathways utilized by a cell to repair DNA damage and restore the integrity of DNA. "DNA damage" is defined as any deviation from the usual base pairing between A-T and G-C, such as by way of example and not limitation: apurinic/apyrimidinic sites, base adducts, alkylated bases, dimers, mismatches, and loopouts resulting from DNA polymerase slippage. Also under DNA damage belong any deviation from the usual structure of the phosphodeoxyribose backbone of DNA, such as double strand breaks and single-strand nicks. Depending on the nature of the DNA damage, a cell will utilize various endogenous systems of DNA repair to re-establish the normal DNA structure.
Accordingly, in one embodiment, the present invention anticipates that said endogenous system of DNA repair will be chosen from the group comprising mismatch repair system, nucleotide excision repair system, base excision repair system, direct reversal system, double strand break repair system, and enzymatic photoreactivation system. Also, because the proofreading activity of DNA polymerases considerably reduces the occurrence of mismatches during DNA replication, said proofreading activity will too be considered to constitute a DNA repair system in the context of the present invention.
In accordance with the terminology used in the art, under "mismatch repair system" (MMR) is understood a system that recognizes and repairs incorrect base pairing ("mismatch"). Such incorrect base pairing in DNA duplexes may result from errors introduced during DNA replication, during heteroduplex formation in homologous recombination, or from enzymatic modification of DNA such as deamination of 5-methylcytosine to thymine. MMR is found in most organisms and involves the activity of proteins homologous to the mutS and mutL proteins of the bacterium Escherichia coli. In eukaryotic organisms the proteins orthologous to the mutS protein will comprise for example MSH1 , MSH2, MSH3, MSH4, MSH5, MSH6, and MSH7. In the context of the present invention, mutS orthologues identified in plants are of particular importance. While these currently comprise mutS orthologs isolated from Arabidopsis (MSH1 , MSH2, MSH3, MSH4, MSH5, MSH6, MSH7, and MutS2), maize (Musi , Mus2, Mus3), wheat (MSH2, MSH3, MSH6, MSH7), canola (MSH2), rice (MSH6), tobacco (MSH2), and sugarcane (MSH2, MSH3, MSH5, MSH6, MSH7, MutS2), the present invention also anticipates that future identified plant mutS homologues can be used in the context of the present invention. Also in eukaryotic organisms, the mutL orthologues comprise for example MLH1 , MLH2, MLH3, PMS1 , and PMS2. Of particular importance are the mutL orthologues isolated from plants, such as from Arabidopsis (MLH1 , MLH3, PMS1), rice (MLH1), and from sugarcane (MLH1 , MLH3, PMS1 ).
Under "nucleotide excision repair system" (NER) is understood a system, wherein during the repair process an oligonucleotide fragment including the site of DNA damage, and typically containing between 20 and 40 nucleotides, is cut out from the damaged DNA-strand, and this strand is then re-synthesized by action of appropriate enzymes. The NER system is used by the cell to repair various types of damage, and is often involved in repairing DNA injuries induced by UV radiation, comprising cyclobutane pyrimidine dimers and 6-4 photoproducts, and by chemical agents, such as bulky DNA adducts. The NER system includes the "global genome NER", which repairs the lesions over the entire genome, as well as the "transcription coupled NER", that repairs transcription blocked lesions present in transcribed DNA strand.
With "direct reversal system" (DR) is meant a mechanism that involves a single enzyme- catalysed reaction to remove certain types of DNA damage. By way of example and not limitation such DNA damage may comprise base alkylation, especially methylation of guanine at position 06, yielding O6-methylguanine. In the "direct reversal system" the methyl group from the guanine residue will be removed by the action of methylguanine methyltransferases (MGMT).
With "base excision repair" (BER) is understood the system in which the damaged DNA base is recognized and eliminated from the DNA strand by the action of DNA glycosylases, followed by repair of the apurinic/apyhmidinic site in several steps, comprising incision, gap filling and sealing. The BER system repairs mainly DNA damage that arises spontaneously in a cell from hydrolytic events, such as deamination, base loss, base fragmentation by ionizing radiation, and oxidative damage.
With "enzymatic photoreactivation system" is understood the removal of UV-induced damage, such as cyclobutane pyrimidine dimers and 6-4 photoproducts, from DNA by the action of photolyases.
The "double strand break repair system" (DSBR) is involved in repairing DNA lesions, wherein both DNA strands of a DNA double helix are broken. Such lesions are usually caused by ionizing radiation, chemical agents, or arise during recombination. The two mechanisms of DSBR comprise (i) homologous recombination and (ii) non-homologous end- joining. In homologous recombination the double strand break is repaired using genetic information from a sister chromatid. Non-homologous end-joining involves the joining of two broken ends. In a preferred embodiment of the present invention said endogenous system of DNA repair is the mismatch repair system (MMR). Importantly, besides repairing DNA mismatches and single strand loopouts, MMR is also responsible for signaling the extent of DNA damage to cellular mechanisms that control cell division and programmed cell death. Accordingly, if the amount of DNA damage exceeds a certain threshold, MMR will play a role in instructing the cell to interrupt the progression of the cell cycle until the damage is repaired. Alternatively, with even higher load of DNA damage the cell will be instructed to initiate apoptosis. This may likely constitute the cytotoxic effect of the mutagenesis treatment, which effectively limits the frequency of mutations that can be introduced with classical mutagenesis. However, it is shown in the examples of the present invention that protoplasts of Nicotiana plumbaginifolia with suppressed activity of the MMR system show increased resistance to a lethal dose of the DNA-alkylating agent N-Methyl-N'-nitro-N-nitrosoguanidine (MNNG). Similarly, seeds of Arabidopsis thaliana with compromised MMR activity show higher resistance to a lethal dose of the DNA-alkylating agent ethylmethane sulphonate (EMS). Together, this suggests that plant cells with suppressed MMR will be able to overcome the cytotoxic effect of the mutagenesis, i.e. cell division block and/or apoptosis signal associated with high extent of DNA damage. Such cells will propagate despite containing large amount of DNA damage, which upon consecutive cell cycles will be converted into mutations. In this way, the treatment of plant cells with suppressed activity of the MMR system with mutagenic agents will yield plant cells carrying a high number of mutations.
In the various embodiments, the invention anticipates that suppressing the activity of said endogenous system of DNA repair will be accomplished by means chosen from the group comprising: (i) exposure to a chemical agent; (ii) partial or complete inactivation of at least one copy of at least one gene involved in said endogenous system of DNA repair, said inactivation being attributable to for example base substitutions, methylation, insertions and/or deletions within the sequence of said gene; (iii) down-regulation of expression of at least one gene involved in said endogenous system of DNA repair, said down-regulation may for example result from base substitutions, insertions, or deletions in the regulatory sequences of said gene, or alternatively, said down-regulation may be accomplished using anti-sense nucleic acids or RNA silencing, or RNA interference; (iv) introducing a dominant negative variant of at least one gene involved in said endogenous system of DNA repair; (v) introducing an antibody or an expression cassette encoding such antibody, capable of binding to at least one protein involved in said endogenous system of DNA repair, and (vi) introducing agents capable of saturating the activity of said endogenous system of DNA repair. The above approaches (i) to (v) will affect either the expression levels, or the availability within the cell, or the activity of at least one protein involved in a given DNA repair system. On the contrary, the last approach (vi) will compromise the ability of a given DNA repair system to repair the damage in endogenous DNA by introducing into said at least one plant cell excess exogenous substrate carrying select type of DNA damage. In one example, said substrate could comprise a double-stranded oligonucleotide carrying a mismatch. Importantly, based on the specific methods used, such suppressing the activity of said at least one endogenous system of DNA repair can be either permanent or transient.
In embodiments, the invention anticipates that suppressing the activity of said endogenous system of DNA repair will be accomplished by means chosen from the group comprising: (i) partial or complete inactivation of at least one copy of at least one gene involved in said endogenous system of DNA repair, (ii) down-regulation of the expression of at least one gene involved in said endogenous system of DNA repair, (iii) introducing a dominant negative variant of at least one gene involved in said endogenous system of DNA repair, (iv) introducing an antibody or an expression cassette encoding such antibody, capable of binding to at least one protein involved in said endogenous system of DNA repair, (v) introducing agents capable of saturating the activity of said endogenous system of DNA repair, and (vi) over-expression of at least one gene involved in said endogenous system of DNA repair or a biologically active variant thereof. The approach (vi) may lead to titrating out of other components of the endogenous system of DNA repair by the over-expressed member, whereby the DNA repair system will be compromised. The above means may in general not be readily reversible and may result in substantially permanent (e.g., substantially maintained upon further propagation of the mutagenised cells) suppression of the endogenous DNA repair system. However, reversible use of the above means is also envisioned, whereby proficiency of endogenous DNA repair system following mutagenesis would be re- established.
As used herein, the term "biologically active variant" is preferably defined to mean a peptide which has at least about 80%, preferably at least about 90%, and more preferably at least about 95%, sequence identity (e.g., by BLAST sequence comparison algorithm) to a naturally occurring gene. Biologically active variants of the gene may encode peptides that have at least about 10%, preferably at least about 50%, and more preferably at least about 90%, of the activity of the peptides encoded by naturally occurring gene. Such variants also encompass fragments of the naturally occurring gene encoding biologically active polypeptide fragments. The activity may be measured by any method known in the art and may involve testing of the ability of the variant to suppress an endogenous system of DNA repair upon over-expression in cells.
In a preferred embodiment, the present invention can use one of the above methods to permanently or transiently suppress the activity of the mismatch repair system.
In embodiments, the invention anticipates that suppressing the activity of said mismatch repair system will be accomplished by means chosen from the group comprising: (i) partial or complete inactivation of at least one copy of at least one gene involved in said mismatch repair system, (ii) down-regulation of the expression of at least one gene involved in said mismatch repair system, (iii) introducing a dominant negative variant of at least one gene involved in said mismatch repair system, and (iv) introducing an antibody or an expression cassette encoding such antibody, capable of binding to at least one protein involved in said mismatch repair system, (v) introducing agents capable of saturating the activity of said mismatch repair system, and (vi) over-expression of at least one gene involved in said mismatch repair system or a biologically active variant thereof. The approach (vi) may lead to titrating out of other components of the mismatch repair system by the over-expressed member, whereby the of the mismatch repair system will be compromised. The above means may in general not be readily reversible and may result in substantially permanent (e.g., substantially maintained upon further propagation of the mutagenised cells) suppression of the mismatch repair system. However, reversible use of the above means is also envisioned, whereby proficiency of the mismatch repair system following mutagenesis may be re¬ established.
In another preferred embodiment, said mismatch repair system is suppressed by introducing into said at least one plant cell a dominant negative variant of at least one gene involved in said mismatch repair system. Dominant negative variants cause a mismatch repair defective phenotype even in the presence of a wild-type gene in the same cell. This approach offers the advantage that often the knowledge of the nucleic acid and/or protein sequence of the particular protein to be inhibited by a dominant negative variant is not required, because the high conservation of many proteins involved in mismatch repair system allows the use of a dominant negative variant from another plant species. For example, the present invention demonstrates in one of the examples that a dominant negative G671D mutant of the Arabidopsis thaliana MSH2 protein can exert a dominant inhibitory effect on the MSH2 function in Nicotiana plumbaginifolia. Hence, this embodiment combines the advantageous effect that the suppression of the mismatch repair system has on the ability of said plant cell to sustain high load of DNA damage with the easiness of suppression achieved by using a dominant negative variant of at least one gene involved in said mismatch repair system. In addition, the use of a dominant negative MMR variant allows for specifically targeting the MMR process, and the dominant negative MMR variant can easily be expressed in any desired cell type of a plant.
In a preferred embodiment, the expression of the dominant negative MMR variant in said plant cells does not depend on provision of an external inducer or may even be constitutive, typically by using endogenous or exogenous constitutive promoters. The use of non-inducible expression systems can be advantageous, because systems of inducible expression which would reliably work at whole plant level and/or in a wide range of plants are not available. The present inventors surprisingly realised that constitutive expression of the dominant negative MMR variant in mutagenised plant cells does not interfere with the use of such cells to obtain mutant plants and that plants comprising and/or consisting of MMR deficient cells can be propagated and characterised on phenotypic level. In another embodiment, the expression of the dominant negative MMR in said plant cells may be inducible.
In a further more specific embodiment, said at least one gene involved in MMR is a eukaryotic orthologue of the MutS gene of the bacterium Escherichia coli.
In another embodiment, said eukaryotic orthologue of the MutS gene of E. coli is chosen from the group comprising MSH1 , MSH2, MSH3, MSH4, MSH5, MSH6, MSH7, MutS2, Musi , Mus2, and Mus3 isolated from various plant species. In still a more preferred embodiment, the present invention uses a dominant negative variant of the MSH2 gene isolated from various plant species to suppress the activity of the MMR system. Said MSH2 gene can be for example the MSH2 gene isolated from Arabidopsis thaliana. In a cell, the normal MSH2 protein forms heterodimers with the MutS homologue MSH6, said heterodimer recognising mainly mismatches, or with the MutS homologue MSH3, said latter heterodimer recognising mainly insertions and deletions of 2-14 bases. After recognising such defects in DNA structure, said heterodimers associate with other proteins involved in the MMR system and begin to thread along the DNA strand searching for a signal that helps to differentiate the original DNA strand from the newly synthesized one. Afterwards, the system repairs said defect in the newly synthesized DNA strand. Dominant negative variants of said MSH2 gene will interfere with this mismatch repair mechanism and cause a mismatch repair defective phenotype even in the presence of a wild-type MSH2 gene in the same cell.
In still a more preferred embodiment of the invention, said dominant negative variant of the MSH2 gene carries a mutation affecting the amino acid sequence of the ATP-binding domain of the corresponding MSH2 protein, and more specifically the conserved box within said ATP- binding domain, comprising the amino acid sequence TGPNMGGKSTFI. The corresponding MSH2 protein carrying a mutation in said ATP-binding domain tends to recognise and associate with defects in DNA structure, but cannot perform the subsequent steps of the MMR response. In staying associated with said defects in DNA structure, it also prevents heterodimers comprising wild-type MSH2 to recognise and associate with the defects in DNA, thus exerting a dominant negative effect.
In a further more specific embodiment of the invention, said mutation in the ATP-binding domain of MSH2 is chosen from a group comprising all possible mutations that change the G (GIy) residue at a position corresponding to position G 671 in the Msh2 protein sequence of Arabidopsis thaliana. By way of example and not limitation, such mutation can represent a G to D (Asp) change.
In another embodiment of the present invention, said at least one gene involved in the mismatch repair is a eukaryotic orthologue of the MutL gene of the bacterium Escherichia coli. More specifically, in another embodiment, the present invention uses dominant negative variants of MLM , MLH2, MLH3, PMS1 and PMS2.
Hence, in one embodiment the method of the present invention suppresses the activity of the MMR system in at least one plant cell by introducing into said at least one plant cell a dominant negative variant of at least one gene chosen from the group comprising MSM ,
MSH2, MSH3, MSH4, MSH5, MSH6, MSH7, MutS2, Musi , Mus2, Mus3, MLH1 , MLH2,
MLH3, PMS1 and PMS2 isolated from various plant species. If a dominant negative variant of a MutS or MutL orthologue from other species than plants would exert a dominant negative effect in a plant cell, this can also be used within the scope of the present invention. Such orthologues may be isolated from for example bacteria, yeast, fungi, or animals.
As exemplified, in a preferred embodiment, the present invention uses as a mutagenic agent one capable of introducing random mutations into the genome of at least one plant cell.
Further, in one embodiment the present invention uses as a mutagenic agent to introduce random mutations into the genome of at least one plant cell a step chosen from the group comprising: chemical mutagen, irradiation with ultraviolet light, irradiation with X-rays, irradiation with gamma rays, and a transposable genetic element.
In a more specific embodiment of the present invention, said mutagenic agent will be a chemical agent and in particular a DNA-alkylating agent. Among DNA-alkylating agents, a more specific embodiment of the invention makes use of ethylmethane sulphonate (EMS) and N-Methyl-N'-nitro-N-nitrosoguanidine (MNNG). Said agents are able to introduce a methyl group on the 06 position of guanine. O6-methylguanine lesions can give rise to G-C to A-T transitions in subsequent DNA synthesis steps in propagation of the cell. Hence, this type of mutagenesis in general introduces basepair substitutions. Unlike deletions resulting from X- ray irradiation or insertions resulting from transposable elements, which tend to result in frameshift mutations and partial or complete loss-of-function of a gene, basepair substitutions introduced by DNA-alkylating agents will mainly lead to amino acid substitutions. Therefore, such mutations can reveal a much larger spectrum of phenotypes, among others partial loss- of function phenotypes and gain-of-function phenotypes, than other forms of random mutagenesis. In another embodiment of the present invention, said chemical agent will induce frameshift mutations.
It should be appreciated that the method described in the present invention can be used to introduce genetic mutations into at least one somatic or germ plant cell, which is capable of propagation. In an exemplary embodiment, such plant cell may be a meristematic cell that gives rise to progeny. Importantly, the present method can also be used to mutagenise seed of a plant.
It also should be appreciated that said plant cell can be derived from various plant species, such as by way of example and not limitation: maize, wheat, rice, barley, sorghum, tobacco, tomato, potato, Brassica spp., soybean, pea, sunflower, cotton, peanut, Arabidopsis thaliana, Nicotiana, and Medicago.
In a further embodiment, the present invention provides a plant cell that is obtainable by the method of the invention.
Moreover, an additional embodiment of the invention provides a plant that is derived by propagation from said mutagenised cell.
Also, progeny of said plant obtained in generative or vegetative manner is provided by the invention.
Furthermore, the present invention also provides parts or derivatives of said plant, which are suitable for propagation, such as organ tissue, leaves, stems, roots, shoots, protoplasts, somatic embryos, anthers, petioles, pollen, cells in culture, and seeds.
Similarly, parts or derivatives of said plant, which are suitable for consumption, such as seeds, fruits, stems and leaves, are provided by the present invention. Parts or derivatives of a plant obtainable from said mutagenised plant cell are also provided by the invention, comprising organ tissue, leaves, stems, roots, shoots, protoplasts, somatic embryos, anthers, petioles, pollen, cells in culture, and seeds.
Furthermore, the present invention also provides the plant obtainable from said mutagenised plant cell and the progeny of said plant obtained in generative or vegetative manner, said plant and the progeny thereof having at least one mutant phenotype. Such plants will be a valuable resource in identification of novel advantageous phenotypes in plants, in mutation breeding and in forward and reverse genetics approaches.
Similarly, a collection comprising at least one plant or the progeny thereof having at least one mutant phenotype is anticipated by the present invention. Such collections of mutant plants will be a valuable resource in identification of novel advantageous phenotypes in plants, in mutation breeding and in forward and reverse genetics approaches.
Moreover, in another embodiment the present invention also provides the nucleic acid isolated from the plant obtainable from said mutagenised plant cell and the progeny of said plant obtained in generative or vegetative manner, said plant and the progeny thereof having at least one mutant phenotype, wherein said nucleic acid comprises at least one mutation responsible for said at least one mutant phenotype.
Similarly, a collection of nucleic acids comprising at least one nucleic acid carrying at least one mutation responsible for said at least one mutant phenotype according to the previous embodiment is anticipated. Such collection will be a valuable resource for forward and reverse genetics approaches in plants.
Additional uses
Apart from efficient random mutagenesis in plant cells, the present invention also provides an assay of the presence of mutagenic agents in an environmental sample, comprising the steps of: (i) exposing at least one plant cell to an environmental sample; (ii) assessing the occurrence of mutations in plants or plant parts and derivatives obtainable by propagation of said at least one plant cells. Further description of additional aspects of the described method can be found in the accompanying examples.
Short Description of the Figures
Figure 1 illustrates RT-PCR (A) and radioactive probing of the RT-PCR membrane (B) for different lines of transgenic N. plumbaginifolia overexpressing the Msh2 G671D mutant and the two controls: wild type N. plumbaginifolia (P2) and A. thaliana. High level of msh2 expression driven by CaMV 35S promoter was found in most of the transgenic lines, while in 2 weeks old Arabidopsis and Nicotiana plantlets the Msh2 expression was not observed.
Figure 2 illustrates A. Location of point mutation in the dominant negative Msh2 G671D mutant and position of T-DNA insertion in Msh2 protein for 002708 line. Abbreviations:
MutS_N and MutS_C: MutS domains found in proteins of the MutS family; MutSd: DNA binding domain of MutS family; MutSac: ATPase domain of MutS family. The mutation G671 D in the dominant negative mutant is located in ATPase domain of Msh2 protein. In the 002708 line the T-DNA insertion caused a deletion in MUTSac domain, from 645 to 924 aac (Leonard et al. (2003). Plant Physiology 133: 328-338). B. PCR screening of Arabidopsis Msh2 T-
DNA insertion lines (002707 and 002708). For CoIO and 002707 line the PCR amplification with the combination of primers a and c indicate the absence of T-DNA insertion in the region
A-D of Msh2 gene. For 002708 line the absence of PCR amplification with the combination a
(C-D primers) indicates the deletion of this region in T-DNA insertion mutant while the amplification with the combination b of primers (A-LBbI) indicates the localisation of T-DNA insertion downstream to A primer. a: primer combination C with D; b: primer combination LBbI with A; c: primer combination A with D.
Figure 3. Spontaneous albino phenotype in Nicotiana plumbaginifolia overexpressing Msh2 G671 D mutants (A) and Arabidopsis thaliana Msh2-T-DNA insertion mutant: 002708 (B). Spontaneous callusogenesis from plantlets derived from seeds. C: Nicotiana plumbaginifolia overexpressing Msh2 G671 D mutant, D: Arabidopsis thaliana Msh2 T-DNA insertion mutant 002708.
Figure 4. A. Dynamic of cell division in protoplast population isolated from wild type P2 and plants overexpressing Msh2 G671D mutant. After 14 days of culture (dark, at room temperature) were scored in successive microscopic fields the number of single cells, two cells and microcolonies formed. The mean of these values are represented in the graph.
Symbols: 0: untreated protoplasts; 10: protoplasts treated with 10μM MNNG for 10 min.
B. Plating efficiency (%) expressed as number of microcolonies per total number of units scored (= single cells + two cells + microcolonies).
Figure 5. A. Gradual reduction of total leaf surface for wild type N. plumbaginifolia germinated on medium containing increasing concentrations of MNNG (0-100 μM). The higher the mutagen concentration, the stronger the delay exerted on plant development. B. Graphic representation of reduction in total leaf surface in N. plumbaginifolia plantlets derived from seeds germinated on medium containing different concentrations of MNNG. The amplitude of leaf reduction in mutated N. plumbaginifolia was quantified with the ASSESS program and expressed in relative values, reported to the maximum recorded value.
Figure 6. The effect of EMS mutagenic treatment on leaf development.
A. Development of total leaf surface in EMS treated and untreated N. plumbaginifolia wild type. B. Development of total leaf surface in EMS treated and untreated N. plumbaginifolia S16 line, with MMR deficiency. C. Comparison between the results obtained for the total leaf development of wild type and S16 N. plumbaginifolia in EMS mutagenesis experiment
Figure 7. A. The difference in total leaf surface observed for plantlets in Petri dishes are retrieved to a lesser extent in untreated adult plants grown in greenhouse conditions, regardless of their position on the plant (A1 - P2 and A2 - Msh2 G671 D/S16). Wild type and transgenic plants derived from EMS 0.3% - 9Oh treated seeds, have a normal development in greenhouse conditions (A3 - P2 and A4 - Msh2 G671D/S16).). Leaf position on longitudinal axe: A: basal; B: 1/3 inferior; C: 1/3 superior; D: apical leaf. B. The yield of seeds harvested per individual capsule from mutated plants was considerable reduced compared to the yield of seeds harvested per individual capsule from untreated plants (B1 - P2 and B2 - Msh2 G671D/S16).
Figure 8. Phenotype of Msh2 G671 D/S16 - M2 plantlets generated from seeds collected from EMS treated parental plants. None of these abnormal phenotypes were observed for M2 wild type plantlets obtained from mutated M1 parental wild type plants. Figure 9. Figure 9 Induced variegated phenotype after EMS mutagenic treatments in Arabidopsis thaliana Msh2-T-DNA insertion mutant 002708 A. multiple spotted, B. half white
Figure 10. A. Germination of CoIO and 002708-T4 mutated seeds treated with 0.3% EMS for 18h. Difference in germination efficiency is observed between CoIO and 002708 for long EMS treatment (18h), but not for short EMS treatment (3h). B. Percentage of seed germination after EMS treatment. According to the germination test the resistance to EMS treatment (0.3%, 18h) is higher in successive generations of Msh2 deficient A. thaliana (002708-T4 and 002708-T5) than in controls CoIO and 002820 line.
Tables
Table 1. Segregation of albino (white and light green) phenotype in successive generations of Msh2 T-DNA insertion mutant: 002708. In T5-4 line we obtained a segregation of 30/463 = 6.47% = 1 : 15.45/ albino: normal phenotype. The observed ratio of 1 :15 for albino in T5-4 generation indicates the mendelian inheritance of a double recessive mutation, and may explain the low frequency of albino in T4 and the absence of this phenotype in other 002708 offspring lines.
Figure imgf000024_0001
Table 2. Frequency of albino variegated phenotype in plantlets germinated from seeds after EMS mutagenic treatment.
Figure imgf000025_0001
Table 3. N. plumbaginifolia sequences screened by TILLING and type and location of the mutations identified
Figure imgf000025_0002
Examples
Example 1
Selection of Arabidopsis thaliana Msh2 deficient line by PCR screening
The seed stocks used in our experiment were obtained starting from a limited number of seeds SALK 002708 and seeds SALK 002707, supplied from SIGnAL: SaIk Institute Genomic Analysis Laboratory (http://signal.salk.edu/tdna_protocols.html). DNA was extracted from plantlets of CoIO, 002708 and 002707 lines using Plant DNA Mini Kit (Qiagen). The exact insertion of T-DNA fragment in msh2 gene was confirmed by PCR, using the left border T- DNA anchored primer LBbI (gcgtggaccgcttgctgcaact) and Msh2 specific primers A (atggagaatacatgatatcttcaagc), D (ctttcagtgtcaatgtgagcgctgac) and C (gcggatgaaagtggacttatctccca). The primers A, D and C span the ATP binding domain of the Msh2 protein and the exact location of A, D and C primers is illustrated in Figure 2A. The PCR amplification of 1 kb A-D fragment and 0.4 kb C-D fragment indicate the absence of T- DNA insertion in this region, while the amplification obtained with LBbI- A primers combination indicates the disruption of msh2 gene in the ATP binding site, downstream to the primer A.
Construction of dominant negative Msh2 mutant and production of transgenic Nicotiana plumbaginifolia overexpressing Msh2 G671D protein
The Msh2 point mutant was generated starting from A.thaliana cDNA Msh2 -gi 3914056 (generous gift of dr. Culligan), introducing the G671D point mutation in the TGPNM conserved domain, by SOEing PCR technique (Splicing by Overlap Extension). The bordering primers used are: primer A (atggagaatacatgatatcttcaagc) containing the internal EcoRV restriction site and primer D (ctttcagtgtcaatgtgagcgctgac) containing the msh2 internal Eco47lll site. These restriction sites were used for cloning of the mutated fragment into the wild type msh2 gene. The internal point mutation was introduced using C-B primers: primer C (gcggatgaaagtggacttatctccca) in sense and primer B (tgggagataagtccactttcatccgc), complementary to primer C, in antisense orientation. These primers contain the G671D transition and a silent mutation introducing an Apal site, used for direct screening of the introduced point mutation. The principle of SOEing PCR is presented in the Annexes and the exact location of A-D primers is illustrated in Figure 2A. The presence of desired mutations was confirmed by sequencing. The Ncol-Sphl fragment containing the full mutated Msh2 cDNA was isolated using a triple digestion: Ncol, Sphl and Pvul. The 2.9kb fragment corresponding to Msh2 G671D mutant, flanked by Ncol site at 5' end and Sphl site at 3' end was isolated from the gel, and the ends polished by treatment with T4 DNA polymerase. Consequently to the fill-in and polishing of ends the fragment was ready for blunt-end cloning in the backbone of the modified binary vector FRG8 (Timmermans et al. (1990) J. Biotech. 14: 333-344). The sense orientation of mutated Msh2 G671D was confirmed by restriction mapping. The binary vector was introduced into Agrobacterium tumefaciens LBA 4404 by heat shock. Agrobacterium leaf-disc transformation of N. plumbaginifolia P2 was performed as described by Horsch and collaborators (Horsch et al. (1985) Science 227: 1229-1231 ). Transformed plants were generated and selected on MS medium supplemented with 50mg/l kanamycine. The number of T-DNA insertion loci was determined from the kanamycine resistance segregation ratio.
RT-PCR amplification of Msh2 transcript in Nicotiana plumbaginifolia protoplasts and in Arabidopsis thaliana young leaves
Total RNA was extracted using RNeasy kit (Qiagen) from protoplasts isolated from transgenic and wild type N. plumbaginifolia and from young rosette leaves of A.thaliana. This RNA was the template for RT-PCR (Omniscript RT-PCR kit - Invitrogen), using primer D for cDNA synthesis and A-D primers for the PCR reaction.
The Arabidopsis msh2-specific primers will allow amplification of transcribed Msh2 in transgenic plants overexpressing Msh2 mutant and in Arabidopsis, but not necessarily in WT N. plumbaginifolia. For amplification of endogenous msh2 - mRNA in Nicotiana, couples of degenerate primers were used and different RT-PCR amplification profiles, starting from two weeks young leaves, without success.
Protoplast isolation and MNNG mutagenesis
Protoplasts were isolated from WT and plants overexpressing Msh2 G671 D protein, following the protocol of Negrutiu (Negrutiu (1981) Z.Pflanzen physiologie 104: 431-442). For MNNG mutagenesis we followed basically the protocol of King (King (1983). Cell Culture and somatic cell genetics of plants , voll: Laboratory procedures and their applications. Editor: lndra K. Vasil, Accademic Press.lnc, ISBN: 0-12-7150011983) adapted to microwell plates. Particular attention was given to the adjustment of protoplast density during MNNG treatment since the higher the cell density, the smaller the effect of any one MNNG concentration. The protoplast density was counted with a Thoma chamber and adjusted to 500000 protoplasts/ml. The mutagen MNNG was obtained from Sigma and diluted in DMSO to a stock concentration of 1OmM. Protoplasts were treated with MNNG to a final concentration of 10μM mutagen, for a period of 10 minutes. Because of the loss of activity, MNNG was not washed from the protoplasts in the further steps but diluted 10 times in protoplasts culture medium. After the mutagenic treatment protoplasts were cultured at 10 times dilution, in a final volume of 500 μ\ (50 μl treated protoplasts plus 450 μ\ K3M medium) in multiwell plates, in culture room at 25°C and absence of light. The plating efficiency was counted after 2 weeks according to the protocol of Harris and Oparka (Harris and Oparka (1994) Plant Cell Biology-A practical approach; Fluorescent probes for studies of living plant cells. Oxford University Press: pp 45-461994). To 40 μ\ protoplast suspension 4μ\ of 1mg/ml FDA (fluorescein diacetate) was added. The single cells; two sister cells formed after the first division and microcolonies were scored under a UV-light Axiophot microscope (Zeiss).
EMS mutagenesis and evaluation of the mutagenic effect in MMR deficient Arabidopsis and Nicotiana
For seed mutagenesis we followed basically the protocol of Lightner and Caspar (Lightner and Caspar (1998) Methods in Molecular Biology, Vol.82: Arabidopsis Protocols, Seed Mutagenesis of Arabidopsis. Edited by: J.Martinez-Zapater and J.Salinas, Humana Press Inc., Totowa,NJ1998). The seeds were submerged in mutagen solution in Falcon tubes, tightly closed, and kept in a horizontal position under continuous agitation, for a maximum contact of the mutagen with the seeds. At the end of the treatment the seeds were rinsed with several changes of water for complete removal of mutagen (collected into the mutagenic waste, for decontamination with NaOH). EMS was obtained from Sigma and diluted in distillated water, at required concentration 0.3% and/or 0.6%. The duration of treatment varied from 3h to 9Oh treatment. For the germination assay, mutated seeds are planted on MS germination medium.
In the case of Arabidopsis the germination of seeds was scored positive when the radicle tip had fully penetrated the seed coat and the two cotyledons were fully expanded. The percentage of germination was determined by dividing the number of seeds that germinated at a given time by the total number of plated seeds x 100. An indication that the mutagenesis has been successful was the appearance of chlorophyll deficient sectors at low frequency among the M1 plants.
A second negative control beside CoIO was used for the germination test. The line is called 002820, is originated from the same SIGnAL collection and the T-DNA insertion was identified at the level of methionine synthase gene, based on in silico analysis. Since the germination efficiency may be affected by the conditions in the greenhouse, the moment of harvesting and the storage conditions, the seeds used in this experiment were obtained from 002708 line, CoIO and 002820 line grown, harvested and stored in the same conditions. The scoring of occurrence of white sectoring in leaves was assayed ( a similar method was used by Preuss and Britt (Preusee and Britt(2003) Genetics. 164: 323-334), to assess the effect of a mutation that suppress the radiation-induced arrest in plants on recombination frequency). In the case of Nicotiana, the seeds were treated for 1h with 1mg/l GA3 (giberelic acid) after mutagenic treatment but before sowing, in order to stimulate and synchronize the seed germination.
For Nicotiana the total leaf surface and not the germination frequency was affected by the EMS mutagenic treatment and an index referring to the reduction of total leaf surface (RTLS) was defined. A number of 100 seeds were sowed per Petri dish and two to four Petri dishes scored for each variant. The ASSESS program (American Society of Plant Pathology) was used to quantify the total reduction in leaf surface caused by different mutagenic treatments. The RTLS represents the % of green leaf area reported to the total surface of the Petri dish (constant). After 2-3 weeks , in the stage of 4-6 leaves the Petri dishes were pictured with a digital camera and the RTLS measured using the ASSESS program.
Example 2
Nicotiana plumbaginifolia transgenic lines overexpress the Msh2 G671D dominant negative mutant
A number of 16 N. plumbaginifolia T0 competitive inhibition (Cl) transformants were screened by RT-PCR and a total number of 12 transgenic lines overexpressing the Msh2 G671D dominant negative mutant were identified (Figure 1 ). No Msh2 expression was observed whatsoever neither for A. thaliana 2 weeks old plantlets nor for the wild type N. plumbaginifolia young leaves.
Since no data were available regarding the Msh2 sequence for N. plumbaginifolia, we have used in previous experiments degenerate primers and 2 weeks old plantlets in order to amplify by RT-PCR and/or PCR the endogenous gene but without success (due to the lack of specific primers). When specific primers were used for A. thaliana, the gene was easily amplified by PCR but no amplification by RT-PCR was obtained for the two weeks old plantlets.
This result was not surprising since Ade et al. (Ade et al. (1999) MoI. Gen. Genet. 262: 239- 249) mentioned that msh2 gene is very poorly expressed in plant tissues. They have observed expression of A. thaliana Msh2 mainly in cell suspension with Msh2 most strongly expressed in cells in exponential growing phase, 2 days after inoculation. The msh genes expression pattern with very poor level of expression in somatic tissues and increased level of expression in highly dividing mitotic tissues and anthers in meiotic division was confirmed in wheat by Dong et al. (Dong et al. (2002) Genome 45: 116-124), and in Arabidopsis by Ade et al. (Ade et al. (2001) Genome 44: 651-657).
Consequently between the activity pattern of CaMV 35S and Msh2 promoters seems to be a strong difference. While both promoters are active in mitotically dividing cells, in mature vegetative tissues (mature leaves) just CaMV-35S promoter is highly active. Differential activity is observed as well for meiotically dividing cells, with Msh2 promoter up regulated during meiosis (Dong et al. (2002) Genome 45: 116-124) and background level of activity for CaMV 35S promoter in pollen mother cells in meiosis I with a slight increased activity in meiosis II. This differential pattern of activity between the CaMV 35S and Msh2 promoters, makes the CaMV 35S promoter suitable to assess MMR deficiency in mitotic dividing cells, meristematic apex and vegetative tissues but less appropriate to analyze meiotic specific processes in the context of MMR deficiency.
MMR deficiency is associated with a spontaneous mutator phenotype in Arabidopsis thaliana and Nicotiana plumbaginifolia, phenotype absent in MMR proficient plants
Albino mutants
The T-DNA insertion in SALK 002708 line was located in At3g18525 locus based on in silico analysis, locus corresponding to msh2 gene. More precisely, based on the information published by Leonard et al., 2003 and our results, the T-DNA insertion is situated in one of the exons located in 3' terminal part, in the ATP binding site (Fig. 2A). The absence of PCR amplification of C-D fragment confirms that the T-DNA insertion caused the deletion of this region in 002708 line, C-D fragment being a part of msh2 deletion: exons 7 to 13, caused by the single T-DNA insertion (Leonard et al. (2003) Plant Physiol. 133: 328-338). The location and orientation of the T-DNA insertion in msh2 was confirmed in T3 plants by PCR, as well as the homozygous nature of T-DNA insertion and respectively the absence of an intact msh2 gene in the initial mother plants (Fig. 2B). The original mother plants were called T3 and the seeds collected from these plants gave the T4 generation. In T4 generation we identified an "albino" phenotype, encompassing the whole plant and this phenotype was retrieved in generation T5 in one single line called T5-4 (Fig.3B). From a total of 463 plantlets analyzed for T5-4 line, 7 are white, 23 have light green color, representing by summation a ratio of 1 :15, corresponding to a mendelian inheritance of a character determined by a double recessive mutation (Table 1 ).
One single event of variegated (sectorial albino development) was recovered for one of the 20 primary competitive inhibition N. plumbaginifolia transformants (Fig.3 A). From this variegated plant, albino auxotrophic plants as well as normal green autotrophic Nicotiana were obtained in a further step by dissection of the apical meristem and leaves, indicating the location of mutation in one of the cells located in central zone of the meristem. It may be that during organogenesis, in MMR deficient background a mutation occurred in one of the albino loci and further on through somatic recombination the homozygotation of this mutation took place, leading to the observed variegated phenotype. A slight reduction in germination frequency of 002708 line (78-85%) compared with colO control (approximate 98%) was observed constantly in different experiments.
Spontaneous callusoqenesis
The second spontaneous mutator phenotype observed in MMR deficient plants is the generation of callus from seeds sowed on MS medium, without hormone supplement and without selection. Just one single event was observed in 4.000 sowed seeds for msh2 deficient Arabidopsis and respectively one single event in approximate 2.000 sowed Nicotiana MMR deficient plants (Fig. 3, C and D). No spontaneous or EMS induced callusogenesis was observed whatsoever in a similar number of wild type Nicotiana and CoIO Arabidopsis.
Nicotiana overexpressing Msh2 dominant negative mutant presents increased resistance to high dose of MNNG, based on protoplast plating efficiency
To assess the differential rate of division for MMR proficient and deficient cells after the treatment with alkylating agents, protoplasts were isolated from wild type and transgenic Nicotiana overexpressing Msh2 G671D protein. The results were scored after 14 days of culture in optimum conditions and represented as number of single cells (no division), two cells (one single division) and microcolonies (more than one division) per microscopic field. In the wild type protoplasts the MNNG treatment blocked cells to enter first division, with the blockage being stronger for the second division, with a ration of protoplasts dividing more than once compared to the untreated protoplasts of 15 microcolonies vs 76,5 microcolonies per microscopic field for treated vs untreated protoplasts, giving a comparative value of 19,6 % - 15 x 100/76,5- (Figure 4).
The MNNG blockage of the cell division is more relaxed in the plants overexpressing the dominant negative Msh2 mutant. An increase in number of cells undergoing first and more than one division is observed for all 7 MMR deficient lines, with notable results for S16, where no significant difference is observed between the number of microcolonies formed in absence: 79 microcolonies and/or presence of mutagenic treatment: 82,5 microcolonies per microscopic field (Figure 4), giving a comparative procentual value of 95,75%. The comparison with untreated controls shows that the blockage of division is not completely removed, but constantly for the protoplasts with MMR deficiency the frequency of the cells being able to pass over the first block of division, is higher than the frequency of wild type cells able to divide in the same conditions. For the transgenic line S16, the profile of cell division in MNNG treated protoplasts is similar to one for untreated cells (Figure 4). This line was chosen for further studies on tolerance to alkylating agents at plantlet level.
Mutagenic treatment with alkylating agents causes the reduction in total leaf surface in Nicotiana
The reaction to the treatment with alkylating agents in plants will depend on the moment of the treatment, dose of mutagenic agent, targeted organ and plant species.
In the case of Nicotiana in a first experiment, MNNG was added at increasing concentrations of 0-100 μM in the germination medium. A gradual reduction in total leaf surface (RTLS) was observed in wild type plantlets generated from seeds germinated on mutagenic medium, with approximate 20% reduction for 3.3 μM MNNG and 80% reduction for 100 μM MNNG (Fig.5 A and B).
When EMS was used for the mutagenic treatment, the same reduction in RTLS was observed for wild type Nicotiana (Figure 6). In this case the seeds were pretreated with the alkylating agent. The concentration of alkylating agent and the exposure time conditioned the amplitude of size reduction, from approximate 25-30% reduction for 3h treatment with 0.6 % EMS to 40-
45 % reduction in case of 0.6 % EMS for 24h (Figure 6 A). Using the RTLS quantification method we were able to analyze as well the differential resistance to the EMS mutagenic treatment for wild type and one of the transformant lines overexpressing Msh2 mutant (S16 line). The S16 line was chosen between different transformant lines based on the results of MNNG tolerance test applied at protoplast level.
Overexpression of Msh2 dominant negative mutant is associated with increased resistance to alkylating agents in Nicotiana plants
Based on the reduction of total leaf surface as a method to quantify the tolerance of Nicotiana to the treatment with alkylating agents we compared the S16 line overexpressing Msh2 G671D protein with wild type plants.
Surprisingly, S16 line in T1 and T2 generations presents constantly a slight reduction in total leaf surface in untreated plantlets compared to the wild type N. plumbaginifolia. This reduction was less evident in mature plants grown in the greenhouse (Figure 7). The S16 plantlets generated from EMS mutated seeds present a higher tolerance to EMS treatment based on RTLS quantification compared to wild type P2 (Figure 6 B1C). For MMR proficient plants 45-50% of RTLS was obtained, when treated with 0.6% EMS for 24h and a 30% of RTLS was observed for an EMS treatment of 3 and/or 9h (Figure 6A). For MMR deficient N. plumbaginifolia plants just a slight reduction in RTLS was obtained compared to the control, regardless of the type of mutagenic treatment, with the exception of prolonged mutagenic treatment (9Oh) which gives no differences between S16 and wild type P2 (Figure 6B). Through this experiment, we can extrapolate at plantlet level the previous observations obtained based on MNNG experiment at protoplasts level, regarding the MMR involvement in cell cycle control in plants. It seems that in MMR proficient conditions (wild type Nicotiana) when the amount of DNA damage accumulated reaches a critical level, the cell cycle progression will be blocked, assuring the delay necessary to repair the damage. In MMR deficient conditions (S16-line) the blockage of cell division in genotoxic conditions is released and the division will progress, probably at the expense of an increased frequency of mutations. In MMR deficient plants the mutagenic treatment will not cause considerable reduction of total leaf surface (Figure 6 B) while the development of wild type plants after mutagenic treatment is considerably delayed compared to the MMR deficient plants (Figure 6A and 6C). A difference of 6h in period of treatment (3h vs 9h) seems without relevance on mutagenic effect according to this assay (Figure 6 A,B,C).A prolonged EMS treatment (24h) will cause 40-45% reduction in total leaf surface for wild type plants, while MMR deficient plants present just a 5-10% reduction (Figure 6 A and B).
RTLS indicates no significant difference between P2 and G671D Msh2/ S16 plantlets germinated from seeds treated with 0.3% EMS for prolonged period of time: 9Oh (Figure 6C).
Major increase in frequency of spontaneous callusogenesis and abnormal development in plantlets originated from genotypes saturated with mutations, for Nicotiana overexpressing G671D Msh2 protein
When treated with EMS for 9Oh, no difference between wild type and transgenic Nicotiana could be observed, based on RTLS index, the percentage of germination was not affected and the plantlets developed normal in vitro.
Subsequent to the seed mutagenic treatment and to germination on basal medium, a few plantlets were selected from P2 and Msh2 G671 D/S16 transgenic Nicotiana and transferred to the greenhouse. The mutagenized wild type and transgenic plants present a normal development in greenhouse conditions, with a slight reduction in size for S16 plants (Figure 7 A). The first indication of a mutated phenotype was the major decrease in seed production in WT as well as in S16, without notable differences in between the two types of plants (Figure 7 B). Most of the flowers derived from 0.3%/ 9Oh EMS treated plants are sterile. A small number of seeds were harvested nevertheless from P2 and G671D Msh2 plants from flowers with partial fertility (Figure 7B) and plated on MS minimal medium. While the M2 plantlets derived from P2 mutated seeds have a normal development in vitro (data not shown), the M2 plantlets derived from Msh2G671D /S16 mutated seeds present spontaneous callusogenesis with a frequency of 17/200 and sometimes absence of symmetry (Figure 8). Subsequently, from the calli, teratoma like structures were formed, reminding of plant teratomas formed under the infection with Agrobacterium tumefaciens (Lewin (1994). Genes V. Oxford University Press and Cell Press).
When the normal plantlets were transferred ex vitro: P2 plants developed normally, while just 1 out of 5 MSH2 G671D plants were resistant to acclimatisation. The prolonged treatment with EMS will saturate the genome with O6 ethyl-guanine - T mismatches. The genotoxic effect became evident in the second generation, when the high frequency of abnormal phenotypes recovered for transgenic plants indicates an increased mutation frequency in plants overexpressing G671D Msh2 protein. This fact indicates that overexpression of G671D Msh2 protein hinders the activity of endogenous Msh2, involved in alkylation tolerance mechanism in plants.
MMR deficient Arabidopsis thaliana shows increased resistance to high dose of EMS and increased frequencies of mutations at reduced dozes of EMS
While the Nicotiana overexpressing Msh2 dominant-negative mutant is a plant system where
MMR activity is impeded but not completely absent, in A. thaliana SALK 002708 is a clear situation where the MMR system is dysfunctional due to the disruption of Msh2 gene through T-DNA insertion. In an attempt to quantify the tolerance of A. thaliana MMR deficient plants to EMS treatment, we have used the germination test for seeds treated with mutagenic agent. When low EMS concentrations and reduced treatment durations were used: 0.6% EMS for 3h and respectively 0.3% EMS for 6h, no significant differences in percentage of germination have been observed for CoIO and Msh2 deficient Arabidopsis. Nevertheless the MMR deficient plants presented mutated phenotypes with an increased frequency, scored based on albino marker. The multiple spotted phenotypes were recovered with a frequency of 1.43% for 002708 line, while no similar mutations were obtained for CoIO plants (Figure 9A, Table2). When seeds were treated with 0.3% EMS for 6h, 1.77% of Msh2 deficient A. thaliana presented the "half white" phenotype while just 0.5% of CoIO presented a similar phenotype (Figure 9B, Table 2).
A stronger mutagenic treatment with 0.3%EMS for 18h will cause embryo lethality and consequently the germination test will be the most adequate to illustrate the resistance of plants to these type of mutagenic treatment. Since the germination efficiency may vary in function of the greenhouse conditions, the moment of harvesting and storage conditions, the 002708 line, CoIO as well as the second negative control: the SALK line 002820, were grown, harvested and treated with mutagen for the germination test, simultaneously, within one experiment.
Successive generations T4 and T5 of MMR deficient Arabidopsis show an increased resistance to EMS treatment compared to MMR proficient plants (Figure 10B). A germination frequency of 40% was observed for T4 generation of 002708 line compared with 10% germination efficiency for CoIO mutated seeds (Figure 10 A and B). Similar results were obtained for MMR deficient plants in T5 generation, with 70% germination for MMR deficient plants compared to 30% germination for 002820 line used as a first control and 38% germination for CoIO plants used as second control (Figure 10B).
CoIO and Msh2 deficient Arabidopsis plants originating from seeds harvested from EMS mutated plants (0.3% EMS, 18h) were transferred to the greenhouse conditions. The adult plants present a reduced size and complete sterility compared to the untreated controls.
Example 3: Genotypic analysis of EMS-mutagenised wild-type and mismatch repair deficient N. plumbaginifolia
Rate of EMS mutagenesis in the mismatch repair deficient transgenic line S16 of Nicotiana plumbaginifolia which is overexpressing a dominant negative mutant of the MSH2 gene from A. thaliana under the control of CaMV 35S promoter and the wild-type Nicotiana plumbaginifolia, were compared at the level of genotype. Seeds from WT and S16 plants were treated with 0.3 % EMS for 9Oh and grown to maturity (M1 generation). Seeds of the M1 plants resulting from selfing, were harvested and germinated to obtain the M2 generation. To asses the mutation rates in EMS treated Wild type (WT) and EMS treated mismatch repair deficient plants, the TILLING technique was used (Colbert et al. High-throughput screening for induced point mutations. Plant Phys. 126: 480-484, 2001). A pooling rate of 1X was used. The PCR was done with IRD700 and IRD800 labelled primers. After hybridization with reference DNA and CELI treatment, samples were run on a Licor 4200 sequencer. Candidate mutations obtained through TILLING were verified by DNA sequence analysis.
For TILLING 12 N. plumbaginifolia sequences (see Table 3) were selected from Genbank. The total length of the amplicons is 9812 base pairs (bp). 32 M2 plants from a WT line and 32 M2 plants from the MMR deficient line S-16 were screened for SNPs. Therefore a total of 628000 bp was screened for each genotype. Candidate mutant alleles identified by TILLING were reamplified by PCR and sequenced. One confirmed mutation was found in the 628 kb screened DNA of M2 WT plants, and four confirmed mutations were found in 628 kb DNA of M2 mismatch repair deficient plants (see Table 3).
Hence, in this aspect the invention has demonstrated that increase in mutation frequency in response to chemical mutagens (here in particular alkylating agents) can be achieved in plant cells deficient in the mismatch repair system. More in particular, the mutation frequency in WT EMS treated N. plumbaginifoiia is in the same range as that detected by TILLING in EMS treated A. thaliana, i.e. 1 mutation per 300 kb screened (Greene et al. Spectrum of chemically induced mutations from a large-scale reverse-genetic screen in Arabidopsis. Genetics 164: 731-740, 2003). In mismatch repair deficient N. plumbaginifoiia a four-fold increase in mutation frequency was found at the DNA level. This confirms the increase in induced mutations in mismatch repair deficient plants observed at the phenotypic level.

Claims

Claims
1. A method for introducing at least one random genetic mutation into at least one plant cell, comprising the steps of: (i.) suppressing the activity of mismatch repair system in said at least one plant cell; and
(ii.) exposing said at least one plant cell to at least one mutagenic agent capable of introducing a random mutation into the genome of said at least one plant cell.
2. The method according to claim 1 , wherein said suppressing the activity of the mismatch repair system in said at least one plant cell is accomplished by means chosen from the group comprising: (i) partial or complete inactivation of at least one copy of at least one gene involved in said mismatch repair system, (ii) down-regulation of the expression of at least one gene involved in said mismatch repair system, (iii) introducing a dominant negative variant of at least one gene involved in said mismatch repair system, (iv) and over-expression of at least one gene involved in said mismatch repair system or a biologically active variant thereof.
3. The method according to claim 2, wherein said at least one gene involved in said mismatch repair system is a eukaryotic homolog of the MutS gene of Escherichia coli.
4. The method according to claim 3, wherein said eukaryotic homolog of the MutS gene of Escherichia coli is chosen from the group comprising MSH1 , MSH2, MSH3, MSH4, MSH5, MSH6, and MSH7.
5. The method according to claim 4, wherein said eukaryotic homolog of the MutS gene of Escherichia coli is MSH2.
6. The method according to claim 5, wherein said at least one gene involved in said mismatch repair system is a eukaryotic homolog of the MutL gene of Escherichia coli.
7. The method according to claim 6, wherein said eukaryotic homolog of the MutL gene of Escherichia coli is chosen from the group comprising MLH1 , MLH2, MLH3, PMS1 and PMS2.
8. The method according to any of claims 1 or 2, wherein said suppressing the activity of said mismatch repair system is accomplished by means of introducing a dominant negative variant of at least one gene involved in said mismatch repair system as defined in any of claims 3 to 7.
9. The method according to claim 8, wherein said suppressing the activity of said mismatch repair system is accomplished by means of introducing a dominant negative variant of the MSH2 gene.
10. The method according to claim 9, wherein said dominant negative variant of the MSH2 gene carries a mutation in its ATP-binding domain.
11. The method according to claim 10, wherein said dominant negative variant of the MSH2 gene carries a mutation in the TGPNMGGKSTFI conserved box of the ATP-binding domain.
12. The method according to claim 11 , wherein said mutation is selected from a group comprising all possible mutations that change the G residue at a position corresponding to amino acid 671 in the Msh2 protein sequence of Arabidopsis thaliana.
13. The method according to any of claims 1 to 12, wherein said at least one mutagenic agent is chosen from the group comprising a chemical mutagen, irradiation with ultraviolet light, irradiation with X-rays, irradiation with gamma rays, and a transposable genetic element.
14. The method according to claim 13, wherein said at least one mutagenic agent is a chemical mutagen.
15. The method according to claim 14, wherein said chemical mutagen is a DNA-alkylating agent.
16. The method according to claim 15, wherein said DNA-alkylating agent is chosen from the group comprising ethylmethane sulphonate and N-Methyl-N'-nitro-N-nitrosoguanidine.
17. The method according to claim 14, wherein said chemical mutagen induces frameshift mutations.
18. The method according to any of claims 1 to 17, wherein said at least one plant cell comprises a somatic cell or a germ cell capable of propagation.
19. The method according to any of claims 1 to 18, wherein said at least one plant cell is derived from a plant chosen from the group comprising maize, wheat, rice, barley, sorghum, tobacco, tomato, potato, Brassica spp., soybean, pea, sunflower, cotton, peanut, Arabidopsis thaliana, Nicotiana, and Medicago.
20. A plant cell obtainable using the method according to any of claims 1 to 19.
21. A plant obtainable from the plant cell according to claim 20.
22. Progeny of the plant according to claim 21 obtained in generative or vegetative manner.
23. Parts or derivatives of the plant according to claim 21 or of the progeny thereof according to claim 22, which are suitable for propagation, such as organ tissue, leaves, stems, roots, shoots, protoplasts, somatic embryos, anthers, petioles, pollen, cells in culture, and seeds.
24. Parts or derivatives of the plant according to claim 21 or of the progeny thereof according to claim 22, which are suitable for consumption, such as seeds, fruits, stems, and leaves.
25. Parts or derivatives of a plant obtainable from the plant cell according to claim 20, such as organ tissue, leaves, stems, roots, shoots, protoplasts, somatic embryos, anthers, petioles, cells in culture, and seeds.
26. The plant obtainable from the plant cell according to claim 21 and the progeny thereof obtained in generative or vegetative manner according to claim 22, said plant or the progeny thereof having at least one mutant phenotype.
27. A collection of plants comprising at least one plant or the progeny thereof according to claim 26.
28. A nucleic acid isolated from the plant or the progeny thereof according to claim 26, wherein said nucleic acid comprises at least one mutation responsible for said at least one mutant phenotype.
29. A collection of nucleic acids comprising at least one nucleic acid according to claim 28.
PCT/EP2005/010270 2004-09-22 2005-09-22 Method for introducing genetic mutations into plant cells Ceased WO2006032504A2 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EPPCT/EP2004/010617 2004-09-22
EP2004010617 2004-09-22

Publications (2)

Publication Number Publication Date
WO2006032504A2 true WO2006032504A2 (en) 2006-03-30
WO2006032504A3 WO2006032504A3 (en) 2006-07-13

Family

ID=36084413

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2005/010270 Ceased WO2006032504A2 (en) 2004-09-22 2005-09-22 Method for introducing genetic mutations into plant cells

Country Status (1)

Country Link
WO (1) WO2006032504A2 (en)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010074562A1 (en) * 2008-12-22 2010-07-01 Keygene N.V. Use of double stranded rna to increase the efficiency of targeted gene alteration in plant protoplasts
WO2011078665A1 (en) * 2009-12-21 2011-06-30 Keygene N.V. Improved techniques for transfecting protoplasts
CN101597328B (en) * 2008-06-06 2012-07-11 中国科学院遗传与发育生物学研究所 Transcription factor for enhancing embryogenesis of plant cell and synthesis of fatty acid as well as encoding gene and application thereof
CN102812803A (en) * 2012-07-02 2012-12-12 青岛市农业科学研究院 Method for constructing pea EMS mutant library
WO2015164805A1 (en) * 2014-04-24 2015-10-29 Purdue Research Foundation Induced mutagenesis

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
PT842289E (en) * 1995-07-26 2005-01-31 Mixis France Sa RECOMBINATION APPROVAL IN EUCARIOT CELLS WITH INACTIVATION OF THE REPAIR SYSTEM OF INCORRECT PAINTS
AUPO974597A0 (en) * 1997-10-10 1997-11-06 Rhone-Poulenc Agro Methods for obtaining plant varieties
ATE404665T1 (en) * 2000-02-11 2008-08-15 Univ Johns Hopkins METHOD FOR PRODUCING HYPERMUTATING BACTERIA
AU2001226023A1 (en) * 2000-02-18 2001-08-27 Luigi Grasso A method for generating hypermutable plants
WO2001088192A2 (en) * 2000-05-12 2001-11-22 The Johns Hopkins University A method for generating hypermutable organisms
WO2002054856A1 (en) * 2001-01-15 2002-07-18 Morphotek Inc. Chemical inhibitors of mismatch repair
US6906243B2 (en) * 2001-12-20 2005-06-14 Boyce Thompson Institute For Plant Research Plant MSH2 sequences and methods of use

Cited By (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101597328B (en) * 2008-06-06 2012-07-11 中国科学院遗传与发育生物学研究所 Transcription factor for enhancing embryogenesis of plant cell and synthesis of fatty acid as well as encoding gene and application thereof
WO2010074562A1 (en) * 2008-12-22 2010-07-01 Keygene N.V. Use of double stranded rna to increase the efficiency of targeted gene alteration in plant protoplasts
JP2012513199A (en) * 2008-12-22 2012-06-14 キージーン・エン・フェー Use of double-stranded RNA to increase the efficiency of targeted genetic modification in plant protoplasts
JP2013514764A (en) * 2009-12-21 2013-05-02 キージーン・エン・フェー Improved technique for transfection of protoplasts
CN102791865A (en) * 2009-12-21 2012-11-21 凯津公司 Improved techniques for transfecting protoplasts
WO2011078665A1 (en) * 2009-12-21 2011-06-30 Keygene N.V. Improved techniques for transfecting protoplasts
AU2010335107B2 (en) * 2009-12-21 2014-07-03 Keygene N.V. Improved techniques for transfecting protoplasts
EP2813572A3 (en) * 2009-12-21 2015-02-18 Keygene N.V. Improved techniques for transfecting protoplasts
CN104651394A (en) * 2009-12-21 2015-05-27 凯津公司 Technique for transfecting protoplasts
CN102791865B (en) * 2009-12-21 2015-07-01 凯津公司 Improved techniques for transfecting protoplasts
JP2015165812A (en) * 2009-12-21 2015-09-24 キージーン・エン・フェー Improved techniques for transfecting protoplasts
CN102812803A (en) * 2012-07-02 2012-12-12 青岛市农业科学研究院 Method for constructing pea EMS mutant library
WO2015164805A1 (en) * 2014-04-24 2015-10-29 Purdue Research Foundation Induced mutagenesis

Also Published As

Publication number Publication date
WO2006032504A3 (en) 2006-07-13

Similar Documents

Publication Publication Date Title
Hays Arabidopsis thaliana, a versatile model system for study of eukaryotic genome-maintenance functions
US12600976B2 (en) Maize gene KRN2 and uses thereof
JP5973533B2 (en) Characteristic marker production method
JP2009225803A (en) Reverse breeding
CN112204156A (en) Systems and methods for improving breeding by modulating recombination rates
JP5036119B2 (en) Chemical inhibitors of mismatch repair
AU2010214718B2 (en) Method for screening genomic DNA fragments
JP7847878B2 (en) Wheat having short anther characteristics, and method for producing the same
US20190153456A1 (en) Brassica plants with altered properties in seed production
WO2006032504A2 (en) Method for introducing genetic mutations into plant cells
KR20230098337A (en) Parthenocarpic Watermelon Plant
US20250163445A1 (en) Domestication of a legume plant
JP2023526035A (en) Methods for obtaining mutant plants by targeted mutagenesis
CN101037695B (en) Control gene of paddy pollen fertility and application
WO2023199304A1 (en) Controlling juvenile to reproductive phase transition in tree crops
CN113544277A (en) Compositions and methods for driving T1 event diversity
US20190241901A1 (en) Control of meiotic crossover in maize
US20230203513A1 (en) Cucumber plant habit
JP2024523647A (en) Methods for selecting watermelon plants and plant parts containing a modified DWARF14 gene
Wilcox Effects of DNA mismatch repair inhibition in Arabidopsis thaliana
CN121495940A (en) OsDOC1, a gene related to cytoplasmic segregation in male meiosis of rice, and its application
CN120866337A (en) Rice essential gene ELD1 and application thereof in adjusting heading stage
JP2023111899A (en) Rice with short anther trait and method for producing the same
CN118284331A (en) Delaying or preventing browning of banana fruit
CN120249546A (en) A ZmWOX9B gene mutation detection primer and its application in screening maize inbred lines with strong somatic cell regeneration ability

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KM KP KR KZ LC LK LR LS LT LU LV LY MA MD MG MK MN MW MX MZ NA NG NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SM SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU LV MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase