WO2006028595A2 - Muteins of fibroblast growth factor 21 - Google Patents
Muteins of fibroblast growth factor 21 Download PDFInfo
- Publication number
- WO2006028595A2 WO2006028595A2 PCT/US2005/026398 US2005026398W WO2006028595A2 WO 2006028595 A2 WO2006028595 A2 WO 2006028595A2 US 2005026398 W US2005026398 W US 2005026398W WO 2006028595 A2 WO2006028595 A2 WO 2006028595A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- mutein
- leucine
- ser
- fgf
- cys
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/71—Receptors; Cell surface antigens; Cell surface determinants for growth factors; for growth regulators
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/475—Growth factors; Growth regulators
- C07K14/50—Fibroblast growth factor [FGF]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/04—Anorexiants; Antiobesity agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
- A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P5/00—Drugs for disorders of the endocrine system
- A61P5/48—Drugs for disorders of the endocrine system of the pancreatic hormones
- A61P5/50—Drugs for disorders of the endocrine system of the pancreatic hormones for increasing or potentiating the activity of insulin
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- the present invention relates to the identification of new muteins of fibroblast growth factor 21 that have reduced O-linked glycosylation when expressed in yeast.
- Fibroblast growth factors are large polypeptides widely expressed in developing and adult tissues (Baird et al., Cancer Cells, 3:239-243, 1991) and play crucial roles in multiple physiological functions including angiogenesis, mitogenesis, pattern formation, cellular differentiation, metabolic regulation and repair of tissue injury (McKeehan et al.,
- the FGF family now consists of at least twenty-three members, FGF-I to FGF- 23 (Reuss et al, Cell Tissue Res. 313:139-157 (2003).
- Fibroblast growth factor-21 has been reported to be preferentially expressed in the liver (Nishimura et al., Biochimica et Biophysica Acta, 1492:203-206, 2000);
- FGF-21 has been shown to stimulate glucose-uptake in mouse 3T3-L1 adipocytes after prolonged treatment (72 h), in the presence and absence of insulin, and to decrease fed and fasting blood glucose, triglycerides, and glucagon levels in ob/ob and db/db mice and 8 week old ZDF rats in a dose-dependant manner, thus, providing the basis for the use of FGF-21 as a therapy for treating diabetes and obesity (WO03/011213).
- recombinant products are often different from their natural counterparts.
- recombinant products produced in heterologous eukaryotic hosts usually differ from their naturally- occurring counterpart in their glycosylation content. This may concern the presence versus absence of any carbohydrate structure, the localization of said carbohydrate structure on the product, as well as the nature of the carbohydrate.
- yeast-derived recombinant products often bear additional unnatural O-glycans compared to their natural counterpart (Van den Steen, et al. , Crit. Reviews in Biochem. and Mole. Biol. 33(3):151-208, 1998).
- the present invention solves the problem of abnormal O-glycosylation associated with yeast-derived recombinant proteins by providing FGF-21 muteins that have a reduced amount for O-glycosylation compared to wild type FGF-21 when expressed in yeast.
- Applicants have found that the FGF-21 muteins with reduced O-glycosylation can be produced in industrial fermentation conditions and maintain the biological activity necessary to be useful to treat subjects with disorders including, but not limited to, type II diabetes, obesity, and metabolic syndrome.
- the present invention provides muteins of human FGF-21, or a biologically active peptide thereof, comprising the substitution of any amino acid except Ser or Thr for Ser 167, wherein the numbering of the amino acids is based on SEQ
- a second embodiment of the present invention provides muteins of human FGF- 21, or a biologically active peptide thereof, comprising the substitution of any amino acid except Ser or Thr for Ser 167, in combination with the substitution of a cysteine for two or more of the following: arginine 19, tyrosine 20, leucine 21, tyrosine 22, threonine 23, aspartate 24, aspartate 25, alanine 26, glutamine 27, glutamine 28, alanine 31, leucine 33, isoleucine 35, leucine 37, valine 41, glycine 42, glycine 43, glutamate 50, glutamine 54, leucine 58, valine 62, leucine 66, glycine 67, lysine 69, arginine 72, phenylalanine 73, glutamine 76, arginine 77, aspartate 79, glycine 80, alanine 81, leucine 82, glycine 84, serine 85, pro
- a third embodiment of the present invention provides muteins of human FGF-21, or a biologically active peptide thereof, comprising the substitution of any amino acid except Ser or Thr for Ser 167 in combination with the substitution of a charged and/or polar but uncharged amino acid for one or more of the amino acids at positions: glycine 42, glutamine 54, arginine 77, alanine 81, leucine 86, phenylalanine 88, lysine 122, histidine 125, arginine 126, proline 130, arginine 131,leucine 139, alaninel45, leucine 146, isoleucine 152; alanine 154; glutamine 156, glycine 161, serine 163, glycine 170, or serine 172, wherein the numbering of amino acids is based on SEQ ID NO:1 and wherein said mutein has reduced capacity for O-glycosylation when expressed in yeast compared to wild-type
- inventions are drawn to polynucleotides encoding the muteins of the first, second, and third embodiments, a vector containing said polynucleotides and a host cell carrying said vector.
- Another embodiment is drawn to processes for producing a polypeptide, to produce cells capable of producing said polypeptide and to produce a vector containing DNA encoding said polypeptide.
- Yet another embodiment is drawn to methods of treating a patient exhibiting one or more of the following condition(s): obesity, type II diabetes, insulin resistance, hyperinsulinemia, glucose intolerance, hyperglycemia, or metabolic syndrome comprising administering to said patient in need of such treatment a therapeutically effective amount of a human FGF-21 mutein of the first, second, or third embodiment.
- Human FGF-21 is a 208 amino acid polypeptide containing a 27 amino acid leader sequence. Human FGF-21 has -79% amino acid identity to mouse FGF-21 and -80% amino acid identity to rat FGF-21. Human FGF-21 is the preferred polypeptide template for the muteins of the present invention but it is recognized that one with skill in the art could readily make muteins based on an alternative mammalian FGF-21 polypeptide sequence.
- amino acid positions of the muteins of the present invention are determined from the mature human 181 amino acid FGF-21 polypeptide as shown below (SEQ ID NO:1):
- the corresponding DNA sequence coding for the mature human 181 amino acid FGF-21 polypeptide is (SEQ ID NO:2): CACCCCATCCCTGACTCCAGTCCTCTCCTGCAATTCGGGGGCCAAGTCCGGCA GCGGTACCTCTACACAGATGATGCCCAGCAGACAGAAGCCCACCTGGAGATC AGGGAGGATGGGACGGTGGGGGGCGCTGCTGACCAGAGCCCCGAAAGTCTC CTGCAGCTGAAAGCCTTGAAGCCGGGAGTTATTCAAATCTTGGGAGTCAAGA CATCCAGGTTCCTGTGCCAGCGGCCAGATGGGGGGCCCTGTATGGATCGCTCCAC TTTGACCCTGAGGCCTGCAGCTTCCGGGAGCTGCTTCTTGAGGACGGATACAA TGTTTACCAGTCCGAAGCCCACGGCCTCCCGCTGCACCTGCCAGGGAACAAG TCCACACCGGGACCCTGCACCCCGAGGACCAGCTCGCTGCCACTACC AGGCCTGCCCCCCGCACTCCCGGAGCCACCCGGG
- Amino acids are identified using the three-letter code or alternatively are designated using the standard one letter code. Mutations are designated by the three-letter code for the original amino acid, followed by the amino acid number, followed by the three-letter code for the replacement amino acid. The numerical designations of each mutein is based on the 181 amino acid sequence of mature, wild-type, human FGF-21. For example, a substitution for serine at position 167 (i.e. Serl67) with the non- polar/hydrophobic amino acid, alanine (Ala), is designated as Serl67Ala or S167A. In a similar fashion, the double substitution for leucine at position 118 and alanine at position
- Leul 18, Alal34 with the sulfur containing amino acid, cysteine (Cys) is designated as Leul 18Cys/Alal34Cys or Ll 18C/A134C.
- amino acid is used herein in its broadest sense, and includes naturally occurring amino acids as well as non-naturally occurring amino acids, including amino acid analogs and derivatives. The latter includes molecules containing an amino acid moiety.
- amino acid includes, for example, naturally occurring proteogenic L-amino acids; D-amino acids; chemically modified amino acids such as amino acid analogs and derivatives; naturally occurring non-proteogenic amino acids such as norleucine, ⁇ -alanine, ornithine, etc.; and chemically synthesized compounds having properties known in the art to be characteristic of amino acids.
- a human FGF-21 mutein is defined as comprising human FGF-21 in which at least one amino acid of the wild-type mature protein has been substituted by another amino acid. Examples of FGF-21 muteins are described in U.S. patent application 60/528,582 herein incorporated by reference. Generally speaking, a mutein possesses some modified property, structural or functional, of the wild-type protein. For example, the mutein may have enhanced or improved physical stability in concentrated solutions (e.g., less hydrophobic mediated aggregation), while maintaining a favorable bioactivity profile.
- the mutein may possess increased compatibility with pharmaceutical preservatives (e.g., /n-cresol, phenol, benzyl alcohol), thus enabling the preparation of a preserved pharmaceutical formulation that maintains the physiochemical properties and biological activity of the protein during storage.
- the mutein may have reduced O- glycosylation when expressed in yeast.
- O-glycosylation may introduce new immunological determinants on a protein and may therefore be antigenic when administered to humans; may alter the pharmacokinetic properties of a protein; and/or may affect the biological activity of a protein.
- yeast produced muteins with reduced O-glycosylation when compared to wild-type FGF-21 are less immunogenic and have a favorable pharmacokinetic profile, while maintaining biological potency.
- these terms are not limiting, it being entirely possible that a given mutein has one or more modified properties of the wild-type protein.
- a “therapeutically-effective amount” is the minimal amount of an active agent necessary to impart therapeutic benefit to a patient.
- a “therapeutically- effective amount” to a patient suffering or prone to suffer or to prevent it from suffering from type II diabetes, obesity, or metabolic syndrome is such an amount which induces, ameliorates or otherwise causes an improvement in the pathological symptoms, disease progression, physiological conditions associated with or resistance to succumbing to the afore mentioned disorders.
- patient is preferably a human.
- Type II diabetes is characterized by excess glucose production in spite of the availability of insulin, and circulating glucose levels remain excessively high as a result of inadequate glucose clearance.
- Glucose intolerance can be defined as an exceptional sensitivity to glucose.
- Hyperglycemia is defined as an excess of sugar (glucose) in the blood. Hypoglycemia, also called low blood sugar, occurs when your blood glucose level drops too low to provide enough energy for your body's activities.
- Hyperinsulinemia is defined as a higher-than-normal level of insulin in the blood.
- Insulin resistance is defined as a state in which a normal amount of insulin produces a subnormal biologic response.
- Obesity in terms of the human subject, can be defined as that body weight over 20 percent above the ideal body weight for a given population (R.H. Williams, Textbook of Endocrinology, 1974, p.904-916).
- Metabolic syndrome can be defined as a cluster of at least three of the following signs: abdominal fat — in most men, a 40-inch waist or greater; high blood sugar — at least 110 milligrams per deciliter (mg/dl) after fasting; high triglycerides — at least 150 mg/dL in the bloodstream; low HDL — less than 40 mg/dl; and, blood pressure of 130/85 or higher.
- the present invention provides glycosylation muteins wherein the number and/or type of glycosylation sites is altered compared to native FGF-21.
- One such embodiment includes FGF-21 muteins comprising a lesser number for O-linked glycosylation sites.
- FGF-21 muteins comprising a lesser number for O-linked glycosylation sites.
- O-linked glycosylation occurs on the side chain of a serine or threonine residue. Once an O-linked glycosylation site is identified, amino acid substitutions to eliminate this sequence may remove an existing O- linked carbohydrate chain.
- O-linked glycosylation sites identified in the present invention include Serl63, Ser 164, Ser 167, Ser 172 and Ser 176.
- the primary site for O- glycosylation is Ser 167. Applicants have discovered that eliminating the Ser 167 site results in a significant reduction for O-glycosylation of the yeast expressed mutein. Although Ser 167 is the preferred site of mutation to remove O-glycosylation, mutations to the other sites for O-glycosylation in human FGF-21 (Serl63, Serl64, Serl72 and Serl 76) are within the scope of the present invention.
- the present invention provides muteins of human FGF-21, or a biologically active peptide thereof, comprising the substitution of any amino acid except Ser or Thr for Ser 167, wherein the numbering of the amino acids is based on SEQ ID NO:1 and wherein said mutein has reduced capacity for O- glycosylation when expressed in yeast compared to wild-type human FGF-21.
- Preferred muteins of the first embodiment are Serl67Ala, Serl67Glu, Serl67Asp, Serl67Asn, Serl67Gln, Serl67Gly, Serl67Val, Serl67His, Serl67Lys, and Serl67Tyr.
- a second embodiment of the present invention provides muteins of human FGF- 21, or a biologically active peptide thereof, comprising the substitution of any amino acid except Ser or Thr for Ser 167, in combination with the substitution of a cysteine for two or more of the following: arginine 19, tyrosine 20, leucine 21, tyrosine 22, threonine 23, aspartate 24, aspartate 25, alanine 26, glutamine 27, glutamine 28, alanine 31, leucine 33, isoleucine 35, leucine 37, valine 41, glycine 42, glycine 43, glutamate 50, glutamine 54, leucine 58, valine 62, leucine 66, glycine 67, lysine 69, arginine 72, phenylalanine 73, glutamine 76, arginine 77, aspartate 79, glycine 80, alanine 81, leucine 82, glycine 84, serine 85, pro
- the phrase 'two or more' means the substitution of a cysteine for 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 of the amino acid residues at the positions indicated above. More preferably it means the substitution of a cysteine for 2 or 4 of the amino acid residues at the positions indicated above.
- cysteines cysteine 75 and cysteine 93
- cysteine 75 and cysteine 93 could also be utilized as loci to introduce a novel disulfide bond that may impart improved properties.
- cysteine substitution at serine 85 or phenylalanine 73, coupled with a concomitant change at either cysteine 93 or cysteine 75, respectively, wherein the latter sites are replaced with any other amino acid.
- a third embodiment of the present invention provides muteins of human FGF-21 , or a biologically active peptide thereof, comprising the substitution of any amino acid except Ser or Thr for Ser 167 in combination with the substitution of a charged and/or polar but uncharged amino acid for one or more of the amino acids at positions: glycine 42, glutamine 54, arginine 77, alanine 81, leucine 86, phenylalanine 88, lysine 122, histidine 125, arginine 126, proline 130, arginine 131, leucine 139, alaninel45, leucine 146, isoleucine 152, alanine 154, glutamine 156, glycine 161 serine 163, glycine 170, or serine 172, wherein the numbering of the amino acids is based on SEQ ID NO:1 and wherein said mutein has reduced capacity for O-glycosylation when expressed in yeast compared to wild
- a charged amino acid is defined as a positively- or negatively-charged amino acid.
- a positively charged amino acid is defined to include histidine, lysine, arginine, and non-naturally occurring analogs thereof (e.g., gamma aminobutyric acid, ornithine, etc.).
- a negatively charged amino acid is defined to included aspartate, glutamate, and non- naturally occurring analogs thereof (e.g., aminoadipic acid).
- a polar but uncharged amino acid is defined to include serine, threonine, asparagine, glutamine, and non- naturally occurring analogs thereof.
- Preferred muteins of the third embodiment are Gln54Glu-Serl67Ala, Leul39Glu-Serl67Ala, Alal45Glu-Serl67Ala, Leul46Glu- Serl67Ala, Ilel52Glu-Serl67Ala, Glnl56Glu-Serl67Ala, Serl63Glu-Serl67Ala, and Ilel52Glu-Serl63Glu-Serl67Ala.
- FIG. 1 is a diagrammatic representation of an exemplary embodiment of the present invention.
- FIG. 1 is a diagrammatic representation of an exemplary embodiment of the present invention.
- FIG. 1 is a diagrammatic representation of an exemplary embodiment of the present invention.
- FIG. 1 is a diagrammatic representation of an exemplary embodiment of the present invention.
- the biological potency of the muteins of the present invention is defined by the ability of the muteins to affect glucose uptake as measured in the in vitro 3T3-L1 cell assay (Example 2) and/or the lowering of plasma glucose levels, as well as, plasma triglycerides, as measured in vivo in the ob/ob mouse assay (Example 3).
- the muteins of FGF-21 administered according to this invention may be generated and/or isolated by any means known in the art.
- the most preferred method for producing the mutein is through recombinant DNA methodologies and is well known to those skilled in the art. Such methods are described in Current Protocols in Molecular Biology (John Wiley & Sons, Inc.), which is incorporated herein by reference.
- the preferred embodiments include a biologically active peptide derived from the mutein described herein and that such a peptide will contain at least one of the substitutions described, will exhibit reduced capacity for O-glycosylation compared to the corresponding non-mutated peptide, and will possess biological activity, .
- This biological activity is defined by the ability of the peptide to affect glucose uptake as measured in the in vitro 3T3-L1 cell assay (Example 2) and/or the lowering of plasma glucose levels, as well as, plasma triglycerides, as measured in vivo in the ob/ob mouse assay (Example 3).
- the peptide may be produced by any means known to those skilled in the art, examples of which included but are not limited to enzymatic digestion, chemical synthesis or recombinant DNA methodologies.
- DPP-IV dipeptidyl peptidase IV
- the N-terminus of FGF-21 contains two dipeptides that could potentially be substrates to DPP-IV, resulting in a fragment of FGF-21 truncated at the N- terminus by up to 4 amino acids.
- this fragment of wild-type FGF-21 has been demonstrated to retain biological activity (Table 1), thus, muteins of the present invention truncated at the N-terminus by up to 4 amino acids in combination with the amino acid substitutions of any of the embodiments of the present invention.
- truncation of 5 amino acids or greater from the N-terminus negatively impacts biological activity.
- the present invention also encompasses polynucleotides encoding the above- described muteins that may be in the form of RNA or in the form of DNA, which DNA includes cDNA, genomic DNA, and synthetic DNA.
- the DNA may be double-stranded or single-stranded.
- the coding sequences that encode the muteins of the present invention may vary as a result of the redundancy or degeneracy of the genetic code.
- the polynucleotides that encode for the muteins of the present invention may include the following: only the coding sequence for the mutein, the coding sequence for the mutein and additional coding sequence such as a functional polypeptide, or a leader or secretory sequence or a pro-protein sequence; the coding sequence for the mutein and non-coding sequence, such as introns or non-coding sequence 5' and/or 3' of the coding sequence for the mutein.
- polynucleotide encoding a mutein encompasses a polynucleotide that may include not only coding sequence for the mutein but also a polynucleotide, which includes additional coding and/or non-coding sequence.
- the present invention further relates to variants of the described polynucleotides that encode for fragments, analogs and derivatives of the polypeptide that contain the indicated substitutions.
- the variant of the polynucleotide may be a naturally occurring allelic variant of the human FGF-21 sequence, a non-naturally occurring variant, or a truncated variant as described above.
- the present invention also includes polynucleotides encoding the muteins described above, as well as variants of such polynucleotides, which variants encode for a fragment, derivative or analog of the disclosed mutein that exhibit reduced capacity for O-glycosylation compared to the corresponding non-mutated fragment, deriviative, or analog.
- Such nucleotide variants include deletion variants, substitution variants, truncated variants, and addition or insertion variants as long as at least one of the indicated amino acid substitutions of the first, second, or third embodiments is present.
- the polynucleotides of the present invention will be expressed in a host cell after the sequences have been operably linked to an expression control sequence.
- These expression vectors are typically replicable in the host organisms either as episomes or as an integral part of the host chromosomal DNA.
- expression vectors will contain selection markers, e.g., tetracycline, neomycin, and dihydrofolate reductase, to permit detection of those cells transformed with the desired DNA sequences.
- the host cell is a fungal or yeast cell.
- Yeast cells used for expressing the muteins of the present invention include Pichia pastoris, Saccharomyces cerevisiae, Schizosaccharomyces pombe, and Pichia angust.
- the yeast host cells contain suitable vectors with expression control sequences, such as promoters, including 3-phosphoglycerate kinase or other glycolytic enzymes, and an origin of replication, termination sequences and the like as desired.
- the preferred yeast host of the present invention is Pichia pastoris wherein the expression vector is integrated into the host chromosomal DNA. Aspergillus niger, Trichoderma reesei; and Schizophyllum commune, are examples of fungi hosts, although others may also be employed as a matter of choice.
- the vectors containing the polynucleotide sequences of interest can be transferred into the host cell by well-known methods, which vary depending on the type of cellular host. For example, calcium chloride transfection is commonly utilized for prokaryotic cells, whereas calcium phosphate treatment or electroporation may be used for other cellular hosts.
- the FGF-21 mutein-containing compositions should be formulated and dosed in a fashion consistent with good medical practice, taking into account the clinical condition of the patient, the site of delivery of the FGF-21 mutein composition, the method of administration, the scheduling of administration, and other factors known to practitioners.
- the "therapeutically effective amount" of the FGF-21 mutein for purposes herein is thus determined by such considerations.
- compositions of the FGF-21 muteins of the present invention may be administered by any means known in the art that achieve the generally intended purpose to treat type II diabetes, obesity, or metabolic syndrome.
- the preferred route of administration is parenteral, defined herein as referring to modes of administration that include intravenous, intramuscular, intraperitoneal, intrastemal, subcutaneous, and intraarticular injection and infusion.
- the dosage administered will be dependent upon the age, health, and weight of the recipient, kind of concurrent treatment, if any, frequency of treatment, and the nature of the effect desired.
- Compositions within the scope of the invention include all compositions wherein an FGF-21 mutein is present in an amount that is effective to achieve the desired medical effect for treatment type II diabetes, obesity, or metabolic syndrome. While individual needs may vary from one patient to another, the determination of the optimal ranges of effective amounts of all of the components is within the ability of the clinician of ordinary skill.
- the muteins of FGF-21 of the present invention can be formulated according to known methods to prepare pharmaceutically useful compositions.
- a desired formulation would be one that is a stable lyophilized product that is reconstituted with an appropriate diluent or an aqueous solution of high purity with optional pharmaceutically acceptable carriers, preservatives, excipients or stabilizers [Remington 's Pharmaceutical Sciences 16th edition (1980)].
- the muteins of the present invention may be combined with a pharmaceutically acceptable buffer, and the pH adjusted to provide acceptable stability, - and a pH acceptable for administration.
- the muteins of the present invention may be placed into a container selected from the group consisting of a vial, a cartridge, a pen delivery device, a syringe, intravenous administration tubing and an intravenous administration bag, wherein the container is a unit dose container.
- the FGF-21 muteins are formulated generally by mixing one or more of them at the desired degree of purity, in a unit dosage injectable form (solution, suspension, or emulsion), with a pharmaceutically acceptable carrier, i.e., one that is non-toxic to recipients at the dosages and concentrations employed and is compatible with other ingredients of the formulation.
- a pharmaceutically acceptable carrier i.e., one that is non-toxic to recipients at the dosages and concentrations employed and is compatible with other ingredients of the formulation.
- one or more pharmaceutically acceptable anti-microbial agents may be added. Phenol, m-cresol, and benzyl alcohol are preferred pharmaceutically acceptable anti-microbial agents.
- one or more pharmaceutically acceptable salts may be added to adjust the ionic strength or tonicity.
- One or more excipients may be added to further adjust the isotonicity of the formulation. Glycerin, sodium chloride, and mannitol are examples of an isotonicity adjusting excipient.
- an FGF-21 mutein Those skilled in the art can readily optimize pharmaceutically effective dosages and administration regimens for therapeutic compositions comprising an FGF-21 mutein, as determined by good medical practice and the clinical condition of the individual patient.
- the appropriate dose of an FGF-21 mutein administered will result in lowering blood glucose levels and increasing energy expenditure by faster and more efficient glucose utilization, and thus is useful for treating type 2 diabetes, obesity and metabolic syndrome.
- FGF-21 did not induce hypoglycemia in lean ZDF rats when compared to rats dosed with insulin (WO03/011213). This data indicates that FGF-21 affects plasma glucose levels in an insulin independent manner, suggesting that FGF-21 muteins of the present invention may also be useful in the treatment of Type I diabetes.
- muteins of human FGF-21 herein described, or a biologically active peptide thereof are used as a medicament.
- an effective amount of the muteins of FGF-21 herein described, or a biologically active peptide thereof are used in the manufacture of a medicament for the treatment or prevention of one or more conditions selected from type II diabetes, obesity, or metabolic syndrome.
- FGF-21 muteins are expressed in yeast, such as Pichiapastoris, Pichia methanolica or Saccharomyces cerevisiae.
- yeast such as Pichiapastoris, Pichia methanolica or Saccharomyces cerevisiae.
- AOXl alcohol oxidase
- vectors that use the promoter from the GAP gene are available for high level constitutive expression.
- the multi-copy Pichia expression vectors allows one to obtain strains with multiple copies of the gene of interest integrated into the genome. Increasing the number of copies of the gene of interest in a recombinant Pichia strain can increase protein expression levels.
- Yet another yeast expression system is Saccharomyces cerevisiae. Expression vectors contain the promoter and enhancer sequences from the GALl gene.
- the GALl promoter is one of the most widely used yeast promoters because of its strong transcriptional activity upon induction with galactose.
- Analytical characterization indicates that the FGF-21 expressed in Pichia pastoris is truncated (four amino acid removal at the wild-type N- terminus).
- this truncated variant of FGF-21 stimulates glucose uptake at the same level as wild-type FGF-21 (Table 1).
- 3T3-L1 cells are obtained from the American Type Culture Collection (ATCC, Rockville, MD). Cells are cultured in growth medium (GM) containing 10% iron- enriched fetal bovine serum in Dulbecco's modified Eagle's medium. For standard adipocyte differentiation, two days after cells reached confluency (referred as day 0), cells are exposed to differentiation medium (DM) containing 10% fetal bovine serum, 10 ⁇ g/ml of insulin, 1 ⁇ M dexamethasone, and 0.5 ⁇ M isobutylmethylxanthine, for 48 h. Cells then are maintained in post differentiation medium containing 10% fetal bovine serum, and 10 ⁇ g/ml of insulin.
- GM growth medium
- DM differentiation medium
- Glucose Transport Assay Hexose uptake, as assayed by the accumulation of 0.1 mM 2-deoxy-D-[ 14 C]glucose, is measured as follows: 3T3-L1 adipocytes in 12-well plates are washed twice with KRP buffer (136 mM NaCl, 4.7 mM KCl, 10 mM NaPO 4 , 0.9 mM CaCl 2 , 0.9 mM MgSO 4 , pH 7.4) warmed to 37 °C and containing 0.2% BSA, incubated in Leibovitz's L- 15 medium containing 0.2% BSA for 2 h at 37°C in room air, washed twice again with KRP containing, 0.2% BSA buffer, and incubated in KRP, 0.2%
- In vitro potency is normalized to the in vitro activity of wild-type FGF-21, which is given a designation of 1.0 and used as a positive control.
- the in vitro potency of muteins of FGF-21 of the present invention is compared to wild-type FGF-21 in Table 1. As indicated in Table 1, the muteins of the present invention maintained biological potency to various degrees compare to wild-type FGF-21.
- a study in an obesity model using male ob/ob mice is done to monitor plasma glucose levels and triglyceride levels after treatment with FGF-21, compared to vehicle and insulin control groups.
- the test groups of male ob/ob mice (7 weeks old) are injected with vehicle alone (0.9% NaCl), or FGF-21 mutein (0.125 mg/kg) subcutaneously (0.1 mL, once daily) for seven days. Blood is collected by tail clip bleeding on day 7, one hour after the last compound injection and plasma glucose levels are measured using a standard protocol.
- the ability of the FGF-21 muteins to lower plasma glucose levels as compared to the vehicle control is shown in Table 2.
- the data in Table 2 indicates that muteins of the present invention lowered plasma glucose levels as compared to vehicle control.
- the ability of the FGF-21 muteins to lower triglyceride levels as compared to the vehicle control is shown in Table 3.
- the stability of the FGF-21 muteins of the present invention is analyzed under simulated physiological and pharmaceutical formulation conditions.
- the mutein is analyzed for stability in PBS at room temperature (RT) at a target protein concentration of 10 mg/ml, pH 7.4. Solubility/physical stability of the muteins in PBS is considered satisfactory if recovery of protein following preparation resulted in >90% recovery at RT as determined by size-exclusion and/or reversed-phase chromatography. As indicated in Tables 4 and 5, the muteins of the present invention meet this criteria.
- a preservative 3 mg/mL final concentration, a concentration usually sufficient to meet European Pharmacopia B criteria for preservative effectiveness under neutral pH conditions
- m-cresol 3 mg/mL final concentration, a concentration usually sufficient to meet European Pharmacopia B criteria for preservative effectiveness under neutral pH conditions
- the extent of aggregation as measured by DLS (dynamic light scattering) at 37 0 C is shown as the average diameter of particles in the presence of /w-cresol after two hours, compared to wild-type FGF-21.
- a larger average diameter corresponds to an increased degree protein association and/or aggregation.
- the preservative compatibility (as a function average diameter of particulates) of the muteins of the first and second embodiments of the present invention compared to wild-type FGF-21 is shown in Table 4. Wild-type protein is expressed in E. coli., while the muteins are expressed in yeast (P ichia pastor is).
- Muteins of the present invention that are stable in PBS and compatible with preservative are designated to have enhanced or improved pharmaceutical properties as compared to wild-type FGF-21.
- the preferred muteins of the present invention that have enhanced pharmaceutical properties as compared to wild-type FGF-21 are L118C-A134C and Ll 18C-A134C-S167A.
- Average Particulate diameter represents a protein solution at a target cone, of 10 mg/ml, w-cresol at 3 mg/ml, after 2 hours incubation at 37 C.
- Example 5 Analysis of O-Glycosylation FGF-21 muteins are expressed in Pichia pastoris and are purified from the culture broth by HPLC (Waters 2695) using a Zorbax, 330-SB C8, 4.6x50 mm, 3.5 ⁇ m particle Column at 40°C (Move Phase C: 0.1% TFA in 10% ACN and 90%H2O, D: 0.1% TFA in ACN).
- O-glycosylation levels of the purified muteins of FGF-21 are measured by standard LC/MS analysis. The percentage for O-glycosylation for representative muteins is shown in Table 5 compared to human wild type FGF-21.
- the O-glycosylation levels of the preferred mutein Ll 18C-A134C-S167A is only 3% compared to > 60% for wild type FGF-21 or the mutien L118C-A134C, clearly demonstrating that the S 167 A mutien significantly reduces the level of O-glycosylation.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Diabetes (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Animal Behavior & Ethology (AREA)
- Gastroenterology & Hepatology (AREA)
- General Chemical & Material Sciences (AREA)
- Pharmacology & Pharmacy (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Obesity (AREA)
- Toxicology (AREA)
- Hematology (AREA)
- Biomedical Technology (AREA)
- Endocrinology (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Child & Adolescent Psychology (AREA)
- Physics & Mathematics (AREA)
- Immunology (AREA)
- Cell Biology (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Emergency Medicine (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Peptides Or Proteins (AREA)
Abstract
Description
Claims
Priority Applications (16)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| BRPI0514790-5A BRPI0514790A (en) | 2004-09-02 | 2005-07-26 | fgf-21 mutein of human, or a biologically active peptide thereof, method for producing mutein, pharmaceutical composition, and, use of fgf-21 mutein of human |
| JP2007529870A JP4809352B2 (en) | 2004-09-02 | 2005-07-26 | Fibroblast growth factor 21 mutein |
| MX2007002616A MX2007002616A (en) | 2004-09-02 | 2005-07-26 | Muteins of fibroblast growth factor 21. |
| CA002575753A CA2575753A1 (en) | 2004-09-02 | 2005-07-26 | Muteins of fibroblast growth factor 21 |
| AU2005283025A AU2005283025B2 (en) | 2004-09-02 | 2005-07-26 | Muteins of fibroblast growth factor 21 |
| US11/574,332 US7582607B2 (en) | 2004-09-02 | 2005-07-26 | Muteins of fibroblast growth factor 21 |
| DK05775749T DK1789442T3 (en) | 2004-09-02 | 2005-07-26 | Muteins of fibroblast growth factor 21 |
| PL05775749T PL1789442T3 (en) | 2004-09-02 | 2005-07-26 | Muteins of fibroblast growth factor 21 |
| CN2005800294803A CN101010338B (en) | 2004-09-02 | 2005-07-26 | Muteins of fibroblast growth factor 21 |
| EA200700533A EA011390B1 (en) | 2004-09-02 | 2005-07-26 | Muteins of fibroblast growth factor 21 |
| DE602005016946T DE602005016946D1 (en) | 2004-09-02 | 2005-07-26 | MUTINES OF FIBROBLAST GROWTH FACTOR 21 |
| AT05775749T ATE444307T1 (en) | 2004-09-02 | 2005-07-26 | MUTEINE OF FIBROBLAST GROWTH FACTOR 21 |
| HR20090597T HRP20090597T1 (en) | 2004-09-02 | 2005-07-26 | Muteins of fibroblast growth factor 21 |
| EP05775749A EP1789442B1 (en) | 2004-09-02 | 2005-07-26 | Muteins of fibroblast growth factor 21 |
| IL181573A IL181573A0 (en) | 2004-09-02 | 2007-02-26 | Muteins of fibroblast growth factor 21 |
| NO20071327A NO20071327L (en) | 2004-09-02 | 2007-03-12 | Fibroblast growth factor-21 muteins |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US60680504P | 2004-09-02 | 2004-09-02 | |
| US60/606,805 | 2004-09-02 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2006028595A2 true WO2006028595A2 (en) | 2006-03-16 |
| WO2006028595A3 WO2006028595A3 (en) | 2007-01-18 |
Family
ID=36036790
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2005/026398 Ceased WO2006028595A2 (en) | 2004-09-02 | 2005-07-26 | Muteins of fibroblast growth factor 21 |
Country Status (21)
| Country | Link |
|---|---|
| US (1) | US7582607B2 (en) |
| EP (2) | EP2161281A1 (en) |
| JP (1) | JP4809352B2 (en) |
| KR (1) | KR100854198B1 (en) |
| CN (1) | CN101010338B (en) |
| AT (1) | ATE444307T1 (en) |
| AU (1) | AU2005283025B2 (en) |
| BR (1) | BRPI0514790A (en) |
| CA (1) | CA2575753A1 (en) |
| DE (1) | DE602005016946D1 (en) |
| DK (1) | DK1789442T3 (en) |
| EA (1) | EA011390B1 (en) |
| ES (1) | ES2332057T3 (en) |
| HR (1) | HRP20090597T1 (en) |
| IL (1) | IL181573A0 (en) |
| MX (1) | MX2007002616A (en) |
| NO (1) | NO20071327L (en) |
| PL (1) | PL1789442T3 (en) |
| PT (1) | PT1789442E (en) |
| SI (1) | SI1789442T1 (en) |
| WO (1) | WO2006028595A2 (en) |
Cited By (43)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010084169A2 (en) | 2009-01-23 | 2010-07-29 | Novo Nordisk A/S | Fgf21 derivatives with albumin binder a-b-c-d-e- and their use |
| WO2010129503A1 (en) * | 2009-05-05 | 2010-11-11 | Amgen Inc. | Fgf21 mutants and uses thereof |
| WO2011020319A1 (en) | 2009-08-20 | 2011-02-24 | 重庆富进生物医药有限公司 | Fusion protein regulating plasma glucose and lipid, its preparation method and use |
| WO2010129600A3 (en) * | 2009-05-05 | 2011-04-21 | Amgen Inc. | Fgf21 mutants and uses thereof |
| WO2011089203A1 (en) | 2010-01-21 | 2011-07-28 | Sanofi-Aventis | Pharmaceutical composition for treating a metabolic syndrome |
| WO2011089170A2 (en) | 2010-01-22 | 2011-07-28 | Novo Nordisk A/S | Process for preparing fgf-21 with low degree of o-glycosylation |
| US8012931B2 (en) | 2007-03-30 | 2011-09-06 | Ambrx, Inc. | Modified FGF-21 polypeptides and their uses |
| US8030275B2 (en) | 1999-09-07 | 2011-10-04 | Amgen Inc. | Methods for treating obesity using fibroblast growth factor-like polypeptides |
| US8034770B2 (en) | 2008-06-04 | 2011-10-11 | Amgen Inc. | FGF21 polypeptides comprising two or more mutations |
| WO2011154349A2 (en) | 2010-06-08 | 2011-12-15 | Novo Nordisk A/S | Fgf21 analogues and derivatives |
| WO2012010553A1 (en) | 2010-07-20 | 2012-01-26 | Novo Nordisk A/S | N-terminal modified fgf21 compounds |
| US8324160B2 (en) | 2009-06-17 | 2012-12-04 | Amgen Inc. | Chimeric polypeptides and uses thereof |
| EP2548570A1 (en) | 2011-07-19 | 2013-01-23 | Sanofi | Pharmaceutical composition for treating a metabolic syndrome |
| WO2013052311A1 (en) | 2011-10-04 | 2013-04-11 | Eli Lilly And Company | Fibroblast growth factor 21 variants |
| WO2013093720A2 (en) | 2011-12-22 | 2013-06-27 | Pfizer Inc. | Anti-diabetic compounds |
| US8557769B2 (en) | 2007-08-03 | 2013-10-15 | Eli Lilly And Company | Co-administration of FGF-21 and GLP-1 to treat diabetes and lower blood glucose |
| WO2013188182A1 (en) | 2012-06-11 | 2013-12-19 | Eli Lilly And Company | Fibroblast growth factor 21 variants |
| US8981061B2 (en) | 2001-03-20 | 2015-03-17 | Novo Nordisk A/S | Receptor TREM (triggering receptor expressed on myeloid cells) and uses thereof |
| US9000127B2 (en) | 2012-02-15 | 2015-04-07 | Novo Nordisk A/S | Antibodies that bind and block triggering receptor expressed on myeloid cells-1 (TREM-1) |
| US9120871B2 (en) | 2009-01-23 | 2015-09-01 | Novo Nordisk A/S | Process for preparing FGF21 with low degree of O-glycosylation |
| US9273111B2 (en) | 2004-11-29 | 2016-03-01 | Universite De Lorraine | Therapeutic TREM-1 peptides |
| US9279013B2 (en) | 2008-10-10 | 2016-03-08 | Amgen Inc. | FGF-21 mutants comprising polyethylene glycol and uses thereof |
| WO2016065326A2 (en) | 2014-10-24 | 2016-04-28 | Bristol-Myers Squibb Company | Modified fgf-21 polypeptides and uses thereof |
| US9517264B2 (en) | 2010-04-15 | 2016-12-13 | Amgen Inc. | Human FGF receptor and β-Klotho binding proteins |
| US9550830B2 (en) | 2012-02-15 | 2017-01-24 | Novo Nordisk A/S | Antibodies that bind and block triggering receptor expressed on myeloid cells-1 (TREM-1) |
| US9663568B2 (en) | 2012-02-15 | 2017-05-30 | Novo Nordisk A/S | Antibodies that bind peptidoglycan recognition protein 1 |
| WO2017093465A1 (en) | 2015-12-02 | 2017-06-08 | Sanofi | Fgf21 variants |
| US9744213B2 (en) | 2014-12-23 | 2017-08-29 | Novo Nordisk A/S | FGF21 derivatives and uses thereof |
| WO2018032785A1 (en) | 2016-08-19 | 2018-02-22 | 安源医药科技(上海)有限公司 | Human fibroblast growth factor 21 (hfgf21) fusion protein, preparation method therefor, and use thereof |
| US10179814B2 (en) | 2014-07-17 | 2019-01-15 | Novo Nordisk A/S | Site directed mutagenesis of TREM-1 antibodies for decreasing viscosity |
| WO2019051073A1 (en) | 2017-09-08 | 2019-03-14 | Bristol-Myers Squibb Company | Modified fibroblast growth factor 21 (fgf-21) for use in methods for treating nonalcoholic steatohepatitis (nash) |
| WO2020010117A2 (en) | 2018-07-03 | 2020-01-09 | Bristol-Myers Squibb Company | Fgf21 formulations |
| US10570205B2 (en) | 2009-12-07 | 2020-02-25 | Amgen, Inc. | Human antigen binding proteins that bind β-Klotho, FGF receptors and complexes thereof |
| WO2021142143A1 (en) | 2020-01-08 | 2021-07-15 | Bristol-Myers Squibb Company | Fgf-21 conjugate formulations |
| WO2021094435A3 (en) * | 2019-11-12 | 2021-08-05 | Technische Universität München | Homogeneous muteins of the human il-27 alpha-subunit |
| US11123438B2 (en) | 2016-08-19 | 2021-09-21 | Ampsource Biopharma Shanghai Inc. | Linker peptide for constructing fusion protein |
| US11155618B2 (en) | 2018-04-02 | 2021-10-26 | Bristol-Myers Squibb Company | Anti-TREM-1 antibodies and uses thereof |
| WO2022032187A1 (en) | 2020-08-07 | 2022-02-10 | Bristol-Myers Squibb Company | Fgf21 combined with ccr2/5 antagonists for the treatment of fibrosis |
| EP3749683A4 (en) * | 2018-02-08 | 2022-03-16 | Sunshine Lake Pharma Co., Ltd. | VARIANT OF FGF21, FUSION PROTEIN AND ITS APPLICATION |
| WO2022115597A1 (en) | 2020-11-25 | 2022-06-02 | Bristol-Myers Squibb Company | Methods of treating liver diseases |
| US11471513B2 (en) | 2016-08-19 | 2022-10-18 | Ampsource Biopharma Shanghai Inc. | Highly glycosylated human blood-clotting factor VIII fusion protein, and manufacturing method and application of same |
| US11752173B2 (en) | 2017-12-19 | 2023-09-12 | Beijing Jiyuan Biological Technology Co., Ltd. | FGF21 and GLP1 double gene-modified mesenchymal stem cell and use in treating a metabolic disease |
| US11981718B2 (en) | 2020-05-27 | 2024-05-14 | Ampsource Biopharma Shanghai Inc. | Dual-function protein for lipid and blood glucose regulation |
Families Citing this family (38)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9453251B2 (en) | 2002-10-08 | 2016-09-27 | Pfenex Inc. | Expression of mammalian proteins in Pseudomonas fluorescens |
| EP1774017B1 (en) | 2004-07-26 | 2013-05-15 | Pfenex Inc. | Process for improved protein expression by strain engineering |
| US9580719B2 (en) | 2007-04-27 | 2017-02-28 | Pfenex, Inc. | Method for rapidly screening microbial hosts to identify certain strains with improved yield and/or quality in the expression of heterologous proteins |
| US9394571B2 (en) | 2007-04-27 | 2016-07-19 | Pfenex Inc. | Method for rapidly screening microbial hosts to identify certain strains with improved yield and/or quality in the expression of heterologous proteins |
| JP2013512672A (en) * | 2009-12-02 | 2013-04-18 | アムジエン・インコーポレーテツド | Human FGFR1c, human β-croto-, and binding proteins that bind to both human FGFR1c and human β-croto- |
| CA2796459C (en) | 2010-04-16 | 2016-05-24 | Salk Institute For Biological Studies | Methods for treating metabolic disorders using fgf-1 |
| WO2012059873A2 (en) | 2010-11-05 | 2012-05-10 | Covx Technologies Ireland, Ltd. | Anti-diabetic compounds |
| US9023791B2 (en) * | 2010-11-19 | 2015-05-05 | Novartis Ag | Fibroblast growth factor 21 mutations |
| WO2013006486A2 (en) | 2011-07-01 | 2013-01-10 | Ngm Biopharmaceuticals, Inc. | Compositions, uses and methods for treatment of metabolic disorders and diseases |
| UY34346A (en) * | 2011-09-26 | 2013-04-30 | Novartis Ag | FUSION PROTEINS TO TREAT METABOLIC DISORDERS |
| WO2013131091A1 (en) | 2012-03-02 | 2013-09-06 | New York University | Chimeric fgf21 proteins with enhanced binding affinity for beta-klotho for the treatment of type ii diabetes, obesity and related metabolic disorders |
| US9474785B2 (en) | 2012-06-07 | 2016-10-25 | New York University | Chimeric fibroblast growth factor 19 proteins and methods of use |
| US9464126B2 (en) | 2012-06-07 | 2016-10-11 | New York University | Chimeric fibroblast growth factor 21 proteins and methods of use |
| US9657075B2 (en) | 2012-06-07 | 2017-05-23 | New York University | Chimeric fibroblast growth factor 23 proteins and methods of use |
| US9290557B2 (en) | 2012-11-28 | 2016-03-22 | Ngm Biopharmaceuticals, Inc. | Compositions comprising variants and fusions of FGF19 polypeptides |
| WO2014085365A2 (en) | 2012-11-28 | 2014-06-05 | Ngm Biopharmaceuticals, Inc. | Compositions and methods for treatment of metabolic disorders and diseases |
| IL292303A (en) | 2012-12-27 | 2022-06-01 | Ngm Biopharmaceuticals Inc | Methods of regulating bile acid homeostasis and treatment of bile acid disorders and diseases |
| US9273107B2 (en) | 2012-12-27 | 2016-03-01 | Ngm Biopharmaceuticals, Inc. | Uses and methods for modulating bile acid homeostasis and treatment of bile acid disorders and diseases |
| WO2014130659A1 (en) | 2013-02-22 | 2014-08-28 | New York University | Chimeric fibroblast growth factor 23 proteins and methods of use |
| WO2015061331A1 (en) | 2013-10-21 | 2015-04-30 | Salk Institute For Biological Studies | Chimeric fibroblast growth factor (fgf) 2/fgf1 peptides and methods of use |
| JP6621752B2 (en) | 2013-10-21 | 2019-12-18 | ソーク インスティテュート フォー バイオロジカル スタディーズ | Mutated fibroblast growth factor (FGF) 1 and methods of use |
| SG11201602870YA (en) | 2013-10-28 | 2016-05-30 | Ngm Biopharmaceuticals Inc | Cancer models and associated methods |
| PL3097122T3 (en) | 2014-01-24 | 2020-10-19 | Ngm Biopharmaceuticals, Inc. | Antibodies binding beta klotho domain 2 and methods of use thereof |
| WO2015183890A2 (en) | 2014-05-28 | 2015-12-03 | Ngm Biopharmaceuticals, Inc. | Methods and compositions for the treatment of metabolic disorders and diseases |
| WO2015195509A2 (en) | 2014-06-16 | 2015-12-23 | Ngm Biopharmaceuticals, Inc. | Methods and uses for modulating bile acid homeostasis and treatment of bile acid disorders and diseases |
| WO2016065106A1 (en) | 2014-10-23 | 2016-04-28 | Ngm Biopharmaceuticals, Inc. | Pharmaceutical compositions comprising peptide variants and methods of use thereof |
| WO2016073855A1 (en) | 2014-11-07 | 2016-05-12 | Ngm Biopharmaceuticals, Inc. | Methods for treatment of bile acid-related disorders and prediction of clinical sensitivity to treatment of bile acid-related disorders |
| WO2016187558A2 (en) | 2015-05-20 | 2016-11-24 | University Of Pittsburgh-Of The Commonwealth System Of Higher Education | Method to improve neurologic outcomes in temperature managed patients |
| US10800843B2 (en) | 2015-07-29 | 2020-10-13 | Ngm Biopharmaceuticals, Inc. | Beta klotho-binding proteins |
| WO2017075260A1 (en) | 2015-10-30 | 2017-05-04 | Salk Institute For Biological Studies | Treatment of steroid-induced hyperglycemia with fibroblast growth factor (fgf) 1 analogs |
| AU2016353988B2 (en) | 2015-11-09 | 2019-09-26 | Ngm Biopharmaceuticals, Inc. | Methods for treatment of bile acid-related disorders |
| WO2018039557A1 (en) | 2016-08-26 | 2018-03-01 | Ngm Biopharmaceuticals, Inc. | Methods of treating fibroblast growth factor 19-mediated cancers and tumors |
| ES3014984T3 (en) | 2017-03-14 | 2025-04-28 | Sunshine Lake Pharma Co Ltd | Dual-target fusion proteins comprising the fc portion of an immunoglobulin |
| EP3935075A4 (en) | 2019-03-05 | 2023-01-18 | Sunshine Lake Pharma Co., Ltd. | POLYPEPTIDIC MOLECULE AND ITS APPLICATION |
| US11542309B2 (en) | 2019-07-31 | 2023-01-03 | Salk Institute For Biological Studies | Fibroblast growth factor 1 (FGF1) mutant proteins that selectively activate FGFR1B to reduce blood glucose |
| WO2021139744A1 (en) | 2020-01-11 | 2021-07-15 | Beijing Ql Biopharmaceutical Co., Ltd. | Conjugates of fusion proteins of glp-1 and fgf21 |
| CN113633756A (en) * | 2021-06-17 | 2021-11-12 | 温州医科大学 | FGF21 temperature-sensitive slow-release carrier, gene modification method and preparation method thereof |
| KR20240034235A (en) | 2021-07-14 | 2024-03-13 | 베이징 큐엘 바이오파마슈티컬 컴퍼니 리미티드 | Fusion polypeptides for metabolic disorders |
Family Cites Families (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| SE9301583D0 (en) * | 1993-05-07 | 1993-05-07 | Kabi Pharmacia Ab | YEAST STRAIN AND METHODS FOR EXPRESSING HETEROLOGOUS PROTEINS IN YEAST |
| JP4334615B2 (en) * | 1994-08-12 | 2009-09-30 | ワシントン・ユニバーシティ | Single-chain form of the glycoprotein hormone quartet |
| ATE257843T1 (en) | 1994-08-12 | 2004-01-15 | Univ Washington | SINGLE CHAIN FORMS OF THE CLYCOPROTEIN HORMONE QUARTET |
| US7459540B1 (en) | 1999-09-07 | 2008-12-02 | Amgen Inc. | Fibroblast growth factor-like polypeptides |
| AU7368100A (en) | 1999-09-10 | 2001-04-10 | Curagen Corporation | Fibroblast growth factor polypeptide and nucleic acids encoding same |
| US6716626B1 (en) | 1999-11-18 | 2004-04-06 | Chiron Corporation | Human FGF-21 nucleic acids |
| JP2003516731A (en) * | 1999-11-18 | 2003-05-20 | カイロン コーポレイション | Human FGF-21 gene and gene expression product |
| AU1628101A (en) | 1999-11-22 | 2001-06-04 | Millennium Pharmaceuticals, Inc. | Jaffa, a novel fibroblast growth factor family member and uses therefor |
| US20040259780A1 (en) * | 2001-07-30 | 2004-12-23 | Glasebrook Andrew Lawrence | Method for treating diabetes and obesity |
| JP2005519891A (en) | 2002-01-15 | 2005-07-07 | イーライ・リリー・アンド・カンパニー | Methods to reduce morbidity and mortality in critically ill patients |
| AU2004303783A1 (en) * | 2003-12-10 | 2005-07-07 | Eli Lilly And Company | Muteins of fibroblast growth factor 21 |
| PL1751184T3 (en) * | 2004-05-13 | 2010-02-26 | Lilly Co Eli | Fgf-21 fusion proteins |
-
2005
- 2005-07-26 DK DK05775749T patent/DK1789442T3/en active
- 2005-07-26 EP EP08162741A patent/EP2161281A1/en not_active Withdrawn
- 2005-07-26 MX MX2007002616A patent/MX2007002616A/en active IP Right Grant
- 2005-07-26 PT PT05775749T patent/PT1789442E/en unknown
- 2005-07-26 DE DE602005016946T patent/DE602005016946D1/en not_active Expired - Lifetime
- 2005-07-26 PL PL05775749T patent/PL1789442T3/en unknown
- 2005-07-26 JP JP2007529870A patent/JP4809352B2/en not_active Expired - Fee Related
- 2005-07-26 WO PCT/US2005/026398 patent/WO2006028595A2/en not_active Ceased
- 2005-07-26 EP EP05775749A patent/EP1789442B1/en not_active Expired - Lifetime
- 2005-07-26 AU AU2005283025A patent/AU2005283025B2/en not_active Ceased
- 2005-07-26 AT AT05775749T patent/ATE444307T1/en active
- 2005-07-26 CN CN2005800294803A patent/CN101010338B/en not_active Expired - Fee Related
- 2005-07-26 SI SI200530852T patent/SI1789442T1/en unknown
- 2005-07-26 US US11/574,332 patent/US7582607B2/en not_active Expired - Fee Related
- 2005-07-26 EA EA200700533A patent/EA011390B1/en not_active IP Right Cessation
- 2005-07-26 BR BRPI0514790-5A patent/BRPI0514790A/en not_active IP Right Cessation
- 2005-07-26 KR KR1020077004881A patent/KR100854198B1/en not_active Expired - Fee Related
- 2005-07-26 ES ES05775749T patent/ES2332057T3/en not_active Expired - Lifetime
- 2005-07-26 HR HR20090597T patent/HRP20090597T1/en unknown
- 2005-07-26 CA CA002575753A patent/CA2575753A1/en not_active Abandoned
-
2007
- 2007-02-26 IL IL181573A patent/IL181573A0/en unknown
- 2007-03-12 NO NO20071327A patent/NO20071327L/en not_active Application Discontinuation
Non-Patent Citations (1)
| Title |
|---|
| VAN DEN STEEN ET AL., CRIT. REVIEWS IN BIOCHEM. AND MOLE. BIOL., vol. 33, no. 3, 1998, pages 151 - 208 |
Cited By (112)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8030275B2 (en) | 1999-09-07 | 2011-10-04 | Amgen Inc. | Methods for treating obesity using fibroblast growth factor-like polypeptides |
| US8053408B2 (en) | 1999-09-07 | 2011-11-08 | Amgen Inc. | Methods for treating obesity using fibroblast growth factor-like polypeptides |
| US8981061B2 (en) | 2001-03-20 | 2015-03-17 | Novo Nordisk A/S | Receptor TREM (triggering receptor expressed on myeloid cells) and uses thereof |
| US10603357B2 (en) | 2004-11-29 | 2020-03-31 | Bristol-Myers Squibb Company | Therapeutic TREM-1 peptides |
| US9273111B2 (en) | 2004-11-29 | 2016-03-01 | Universite De Lorraine | Therapeutic TREM-1 peptides |
| US9517273B2 (en) | 2007-03-30 | 2016-12-13 | Ambrx, Inc. | Methods of treatment using modified FGF-21 polypeptides comprising non-naturally occurring amino acids |
| US10961291B2 (en) | 2007-03-30 | 2021-03-30 | Ambrx, Inc. | Modified FGF-21 polypeptides and their uses |
| US8012931B2 (en) | 2007-03-30 | 2011-09-06 | Ambrx, Inc. | Modified FGF-21 polypeptides and their uses |
| US9975936B2 (en) | 2007-03-30 | 2018-05-22 | Ambrx, Inc. | Nucleic acids encoding modified FGF-21 polypeptides comprising non-naturally occurring amino acids |
| US10377805B2 (en) | 2007-03-30 | 2019-08-13 | Ambrx, Inc. | Modified FGF-21 polypeptides comprising non-naturally encoding amino acids and their uses |
| US8383365B2 (en) | 2007-03-30 | 2013-02-26 | Ambrx, Inc. | Methods of making FGF-21 mutants comprising non-naturally encoded phenylalanine derivatives |
| JP2015057404A (en) * | 2007-03-30 | 2015-03-26 | アンブルックス, インコーポレイテッドAmbrx, Inc. | Modified fgf-21 polypeptides |
| US9079971B2 (en) | 2007-03-30 | 2015-07-14 | Ambrx, Inc. | Modified FGF-21 polypeptides comprising non-naturally occurring amino acids |
| US11993637B2 (en) | 2007-03-30 | 2024-05-28 | Ambrx, Inc. | Modified FGF-21 polypeptides with non-naturally encoded amino acids |
| US8557769B2 (en) | 2007-08-03 | 2013-10-15 | Eli Lilly And Company | Co-administration of FGF-21 and GLP-1 to treat diabetes and lower blood glucose |
| US11072640B2 (en) | 2008-06-04 | 2021-07-27 | Amgen Inc. | Methods of treating non-alcoholic steatohepatitis using FGF21 mutants |
| US9273106B2 (en) | 2008-06-04 | 2016-03-01 | Amgen Inc. | FGF mutants with reduced proteolysis and aggregation |
| US11840558B2 (en) | 2008-06-04 | 2023-12-12 | Amgen Inc. | Methods of treating non-alcoholic steatohepatitis using FGF21 mutants |
| US8361963B2 (en) | 2008-06-04 | 2013-01-29 | Amgen Inc. | Uses of FGF21 polypeptides comprising two or more mutations |
| US10011642B2 (en) | 2008-06-04 | 2018-07-03 | Amgen Inc. | Methods of treating of diabetes and obesity using FGF21 mutants |
| EA017690B1 (en) * | 2008-06-04 | 2013-02-28 | Амген Инк. | Fgf21 mutants and uses thereof |
| US8410051B2 (en) | 2008-06-04 | 2013-04-02 | Amgen Inc. | FGF21 mutants and uses thereof |
| US8034770B2 (en) | 2008-06-04 | 2011-10-11 | Amgen Inc. | FGF21 polypeptides comprising two or more mutations |
| US8642546B2 (en) | 2008-06-04 | 2014-02-04 | Amgen Inc. | FGF21 mutant fusion polypeptides and uses thereof |
| US9279013B2 (en) | 2008-10-10 | 2016-03-08 | Amgen Inc. | FGF-21 mutants comprising polyethylene glycol and uses thereof |
| US9480753B2 (en) | 2009-01-23 | 2016-11-01 | Novo Nordisk A/S | FGF21 derivatives with albumin binder A-B-C-D-E- and their use |
| US9120871B2 (en) | 2009-01-23 | 2015-09-01 | Novo Nordisk A/S | Process for preparing FGF21 with low degree of O-glycosylation |
| WO2010084169A2 (en) | 2009-01-23 | 2010-07-29 | Novo Nordisk A/S | Fgf21 derivatives with albumin binder a-b-c-d-e- and their use |
| EP4353247A3 (en) * | 2009-05-05 | 2024-07-17 | Amgen Inc. | Fgf21 mutants and uses thereof |
| EA021425B1 (en) * | 2009-05-05 | 2015-06-30 | Амген Инк. | Fgf21 mutants and uses thereof |
| WO2010129503A1 (en) * | 2009-05-05 | 2010-11-11 | Amgen Inc. | Fgf21 mutants and uses thereof |
| US8618053B2 (en) | 2009-05-05 | 2013-12-31 | Amgen Inc. | FGF21 mutants multimers and uses thereof |
| JP2012525844A (en) * | 2009-05-05 | 2012-10-25 | アムジエン・インコーポレーテツド | FGF21 variants and uses thereof |
| WO2010129600A3 (en) * | 2009-05-05 | 2011-04-21 | Amgen Inc. | Fgf21 mutants and uses thereof |
| US8795985B2 (en) | 2009-05-05 | 2014-08-05 | Amgen Inc. | FGF 21 polypeptides comprising two or more mutations and uses thereof |
| CN102655877A (en) * | 2009-05-05 | 2012-09-05 | 安姆根有限公司 | FGF21 mutants and uses thereof |
| AU2010246108B2 (en) * | 2009-05-05 | 2014-10-23 | Amgen Inc. | FGF21 mutants and uses thereof |
| EP3248610A1 (en) * | 2009-05-05 | 2017-11-29 | Amgen, Inc | Fgf21 mutants and uses thereof |
| US8188040B2 (en) | 2009-05-05 | 2012-05-29 | Amgen Inc. | FGF21 mutants and uses thereof |
| US9493530B2 (en) | 2009-05-05 | 2016-11-15 | Amgen Inc. | FGF21 mutants comprising a mutation at position 98, 171 and/or 180 |
| US8324160B2 (en) | 2009-06-17 | 2012-12-04 | Amgen Inc. | Chimeric polypeptides and uses thereof |
| WO2011020319A1 (en) | 2009-08-20 | 2011-02-24 | 重庆富进生物医药有限公司 | Fusion protein regulating plasma glucose and lipid, its preparation method and use |
| US8809499B2 (en) | 2009-08-20 | 2014-08-19 | Chongqing Fagen Biomedical Inc. | Fusion protein of human fibroblast growth factor-21 and exendin-4 |
| US12116413B2 (en) | 2009-12-07 | 2024-10-15 | Amgen Inc. | Human antigen binding proteins that bind β-klotho, FGF receptors and complexes thereof |
| US10570205B2 (en) | 2009-12-07 | 2020-02-25 | Amgen, Inc. | Human antigen binding proteins that bind β-Klotho, FGF receptors and complexes thereof |
| EP2359843A1 (en) | 2010-01-21 | 2011-08-24 | Sanofi | Pharmaceutical composition for treating a metabolic syndrome |
| EP3607964A1 (en) | 2010-01-21 | 2020-02-12 | Sanofi | Pharmaceutical composition for treating a metabolic syndrome |
| EP3216459A1 (en) | 2010-01-21 | 2017-09-13 | Sanofi | Pharmaceutical composition for treating a metabolic syndrome |
| US20130203651A1 (en) * | 2010-01-21 | 2013-08-08 | Sanofi | Pharmaceutical composition for treating a metabolic syndrome |
| EP2754449A1 (en) | 2010-01-21 | 2014-07-16 | Sanofi | Pharmaceutical composition for treating a metabolic syndrome |
| EP2460527A1 (en) | 2010-01-21 | 2012-06-06 | Sanofi | Pharmaceutical composition for treating a metabolic syndrome |
| WO2011089203A1 (en) | 2010-01-21 | 2011-07-28 | Sanofi-Aventis | Pharmaceutical composition for treating a metabolic syndrome |
| EP3357503A1 (en) | 2010-01-21 | 2018-08-08 | Sanofi | Pharmaceutical composition for treating a metabolic syndrome |
| WO2011089170A3 (en) * | 2010-01-22 | 2011-11-17 | Novo Nordisk A/S | Process for preparing fgf-21 with low degree of o-glycosylation |
| WO2011089170A2 (en) | 2010-01-22 | 2011-07-28 | Novo Nordisk A/S | Process for preparing fgf-21 with low degree of o-glycosylation |
| CN102791730A (en) * | 2010-01-22 | 2012-11-21 | 诺沃—诺迪斯克有限公司 | Preparation method of low-degree O-glycosylated FGF21 |
| US9517264B2 (en) | 2010-04-15 | 2016-12-13 | Amgen Inc. | Human FGF receptor and β-Klotho binding proteins |
| WO2011154349A2 (en) | 2010-06-08 | 2011-12-15 | Novo Nordisk A/S | Fgf21 analogues and derivatives |
| WO2012010553A1 (en) | 2010-07-20 | 2012-01-26 | Novo Nordisk A/S | N-terminal modified fgf21 compounds |
| WO2013010780A1 (en) | 2011-07-19 | 2013-01-24 | Sanofi | Pharmaceutical composition for treating a metabolic syndrome |
| EP2548570A1 (en) | 2011-07-19 | 2013-01-23 | Sanofi | Pharmaceutical composition for treating a metabolic syndrome |
| US8883726B2 (en) | 2011-10-04 | 2014-11-11 | Eli Lilly And Company | Fibroblast growth factor 21 variants |
| US8541369B2 (en) | 2011-10-04 | 2013-09-24 | Eli Lilly And Company | Fibroblast growth factor 21 variants having improved pharmacological potency and/or improved pharmaceutical stability |
| WO2013052311A1 (en) | 2011-10-04 | 2013-04-11 | Eli Lilly And Company | Fibroblast growth factor 21 variants |
| WO2013093720A2 (en) | 2011-12-22 | 2013-06-27 | Pfizer Inc. | Anti-diabetic compounds |
| US9663568B2 (en) | 2012-02-15 | 2017-05-30 | Novo Nordisk A/S | Antibodies that bind peptidoglycan recognition protein 1 |
| US9550830B2 (en) | 2012-02-15 | 2017-01-24 | Novo Nordisk A/S | Antibodies that bind and block triggering receptor expressed on myeloid cells-1 (TREM-1) |
| US10150809B2 (en) | 2012-02-15 | 2018-12-11 | Bristol-Myers Squibb Company | Antibodies that bind peptidoglycan recognition protein 1 |
| US10906965B2 (en) | 2012-02-15 | 2021-02-02 | Novo Nordisk A/S | Methods of treating autoimmune disease or chronic inflammation wtih antibodies that bind peptidoglycan recognition protein 1 |
| US10906975B2 (en) | 2012-02-15 | 2021-02-02 | Novo Nordisk A/S | Methods of treating autoimmune disease or chronic inflammation with antibodies that bind and block triggering receptor expressed on myeloid cells-1 (TREM-1) |
| US10189904B2 (en) | 2012-02-15 | 2019-01-29 | Novo Nordisk A/S | Antibodies that bind and block triggering receptor expressed on myeloid cells-1 (TREM-1) |
| US9000127B2 (en) | 2012-02-15 | 2015-04-07 | Novo Nordisk A/S | Antibodies that bind and block triggering receptor expressed on myeloid cells-1 (TREM-1) |
| US9422353B2 (en) | 2012-06-11 | 2016-08-23 | Eli Lilly And Company | Fibroblast growth factor 21 variant, composition , and uses thereof |
| WO2013188182A1 (en) | 2012-06-11 | 2013-12-19 | Eli Lilly And Company | Fibroblast growth factor 21 variants |
| US11072654B2 (en) | 2014-07-17 | 2021-07-27 | Novo Nordisk A/S | Site directed mutagenesis of TREM-1 antibodies for decreasing viscosity |
| US10179814B2 (en) | 2014-07-17 | 2019-01-15 | Novo Nordisk A/S | Site directed mutagenesis of TREM-1 antibodies for decreasing viscosity |
| US12116408B2 (en) | 2014-07-17 | 2024-10-15 | Novo Nordisk A/S | Site directed mutagenesis of TREM-1 antibodies for decreasing viscosity |
| EP3412302A1 (en) | 2014-10-24 | 2018-12-12 | Bristol-Myers Squibb Company | Modified fgf-21 polypeptides and uses thereof |
| US12247058B2 (en) | 2014-10-24 | 2025-03-11 | Bristol-Myers Squibb Company | Nucleic acids encoding modified FGF-21 polypeptides, vectors and cells containing, and use thereof |
| US10377806B2 (en) | 2014-10-24 | 2019-08-13 | Bristol-Myers Squibb Company | Methods of treating diseases associated with fibrosis using modified FGF-21 polypeptides and uses thereof |
| US9631004B2 (en) | 2014-10-24 | 2017-04-25 | Bristol-Myers Squibb Company | Modified FGF-21 polypeptides comprising an internal deletion and uses thereof |
| US11248031B2 (en) | 2014-10-24 | 2022-02-15 | Bristol-Myers Squibb Company | Methods of treating diseases associated with fibrosis using modified FGF-21 polypeptides |
| EP3909596A1 (en) | 2014-10-24 | 2021-11-17 | Bristol-Myers Squibb Company | Modified fgf-21 polypeptides and uses thereof |
| WO2016065326A2 (en) | 2014-10-24 | 2016-04-28 | Bristol-Myers Squibb Company | Modified fgf-21 polypeptides and uses thereof |
| US10189883B2 (en) | 2014-10-24 | 2019-01-29 | Bristol-Myers Squibb Company | Therapeutic uses of modified FGF-21 polypeptides |
| US10124039B2 (en) | 2014-12-23 | 2018-11-13 | Novo Nordisk A/S | FGF21 derivatives and uses thereof |
| US9895417B2 (en) | 2014-12-23 | 2018-02-20 | Novo Nordisk A/S | FGF21 derivatives and uses thereof |
| US9744213B2 (en) | 2014-12-23 | 2017-08-29 | Novo Nordisk A/S | FGF21 derivatives and uses thereof |
| WO2017093465A1 (en) | 2015-12-02 | 2017-06-08 | Sanofi | Fgf21 variants |
| EP3693382A1 (en) | 2015-12-02 | 2020-08-12 | Sanofi | Fgf21 variants |
| US11833212B2 (en) | 2016-08-19 | 2023-12-05 | Ampsource Biopharma Shanghai Inc. | Linker peptide for constructing fusion protein |
| US11123438B2 (en) | 2016-08-19 | 2021-09-21 | Ampsource Biopharma Shanghai Inc. | Linker peptide for constructing fusion protein |
| WO2018032785A1 (en) | 2016-08-19 | 2018-02-22 | 安源医药科技(上海)有限公司 | Human fibroblast growth factor 21 (hfgf21) fusion protein, preparation method therefor, and use thereof |
| US11471513B2 (en) | 2016-08-19 | 2022-10-18 | Ampsource Biopharma Shanghai Inc. | Highly glycosylated human blood-clotting factor VIII fusion protein, and manufacturing method and application of same |
| US11472863B2 (en) | 2016-08-19 | 2022-10-18 | Ampsource Biopharma Shanghai Inc. | Human coagulation factor IX (FIX) fusion protein, preparation method therefor, and use thereof |
| US11642395B2 (en) | 2017-09-08 | 2023-05-09 | Bristol-Myers Squibb Company | Modified fibroblast growth factor 21 (FGF-21) for use in methods for treating nonalcoholic steatohepatitis (NASH) |
| WO2019051073A1 (en) | 2017-09-08 | 2019-03-14 | Bristol-Myers Squibb Company | Modified fibroblast growth factor 21 (fgf-21) for use in methods for treating nonalcoholic steatohepatitis (nash) |
| US11752173B2 (en) | 2017-12-19 | 2023-09-12 | Beijing Jiyuan Biological Technology Co., Ltd. | FGF21 and GLP1 double gene-modified mesenchymal stem cell and use in treating a metabolic disease |
| US12414966B2 (en) | 2017-12-19 | 2025-09-16 | Beijing Jiyuan Biological Technology Co., Ltd. | Method of treating diabetes with FGF21 and GLP1 double gene-modified cell |
| EP3749683A4 (en) * | 2018-02-08 | 2022-03-16 | Sunshine Lake Pharma Co., Ltd. | VARIANT OF FGF21, FUSION PROTEIN AND ITS APPLICATION |
| CN116098989A (en) * | 2018-02-08 | 2023-05-12 | 广东东阳光药业有限公司 | FGF21 variant, fusion protein and application thereof |
| CN116098989B (en) * | 2018-02-08 | 2026-03-20 | 广东东阳光药业股份有限公司 | FGF21 variants, fusion proteins and their applications |
| US11952420B2 (en) | 2018-04-02 | 2024-04-09 | Bristol-Myers Squibb Company | Nucleic acids encoding anti-TREM-1 antibodies |
| US11919954B2 (en) | 2018-04-02 | 2024-03-05 | Bristol-Myers Squibb Company | Anti-TREM-1 antibodies and uses thereof |
| US11155618B2 (en) | 2018-04-02 | 2021-10-26 | Bristol-Myers Squibb Company | Anti-TREM-1 antibodies and uses thereof |
| WO2020010117A2 (en) | 2018-07-03 | 2020-01-09 | Bristol-Myers Squibb Company | Fgf21 formulations |
| US12226451B2 (en) | 2018-07-03 | 2025-02-18 | Bristol-Myers Squibb Company | FGF-21 formulations |
| WO2021094435A3 (en) * | 2019-11-12 | 2021-08-05 | Technische Universität München | Homogeneous muteins of the human il-27 alpha-subunit |
| WO2021142143A1 (en) | 2020-01-08 | 2021-07-15 | Bristol-Myers Squibb Company | Fgf-21 conjugate formulations |
| US11981718B2 (en) | 2020-05-27 | 2024-05-14 | Ampsource Biopharma Shanghai Inc. | Dual-function protein for lipid and blood glucose regulation |
| WO2022032187A1 (en) | 2020-08-07 | 2022-02-10 | Bristol-Myers Squibb Company | Fgf21 combined with ccr2/5 antagonists for the treatment of fibrosis |
| WO2022115597A1 (en) | 2020-11-25 | 2022-06-02 | Bristol-Myers Squibb Company | Methods of treating liver diseases |
Also Published As
| Publication number | Publication date |
|---|---|
| MX2007002616A (en) | 2007-05-16 |
| JP4809352B2 (en) | 2011-11-09 |
| AU2005283025A1 (en) | 2006-03-16 |
| SI1789442T1 (en) | 2010-01-29 |
| JP2008511323A (en) | 2008-04-17 |
| EA200700533A1 (en) | 2007-08-31 |
| HRP20090597T1 (en) | 2009-12-31 |
| US7582607B2 (en) | 2009-09-01 |
| IL181573A0 (en) | 2007-07-04 |
| ES2332057T3 (en) | 2010-01-25 |
| BRPI0514790A (en) | 2008-06-24 |
| EA011390B1 (en) | 2009-02-27 |
| KR100854198B1 (en) | 2008-08-26 |
| CA2575753A1 (en) | 2006-03-16 |
| CN101010338A (en) | 2007-08-01 |
| NO20071327L (en) | 2007-05-29 |
| PL1789442T3 (en) | 2010-02-26 |
| AU2005283025B2 (en) | 2011-06-30 |
| KR20070050454A (en) | 2007-05-15 |
| ATE444307T1 (en) | 2009-10-15 |
| DK1789442T3 (en) | 2009-11-16 |
| DE602005016946D1 (en) | 2009-11-12 |
| CN101010338B (en) | 2011-06-15 |
| WO2006028595A3 (en) | 2007-01-18 |
| US20080103096A1 (en) | 2008-05-01 |
| EP1789442A2 (en) | 2007-05-30 |
| EP2161281A1 (en) | 2010-03-10 |
| PT1789442E (en) | 2009-11-11 |
| EP1789442B1 (en) | 2009-09-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US7582607B2 (en) | Muteins of fibroblast growth factor 21 | |
| US7622445B2 (en) | Muteins of fibroblast growth factor 21 | |
| US7655627B2 (en) | Muteins of fibroblast growth factor 21 | |
| US7491697B2 (en) | Muteins of fibroblast growth factor 21 | |
| US7576190B2 (en) | FGF-21 fusion proteins | |
| WO2013188182A1 (en) | Fibroblast growth factor 21 variants | |
| US20080200378A1 (en) | KGF polypeptide compositions | |
| HK1109408A (en) | Muteins of fibroblast growth factor 21 | |
| AU2002326742A1 (en) | KGF polypeptide compositions | |
| MXPA06006616A (en) | Muteins of fibroblast growth factor 21 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KM KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NG NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SM SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU LV MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2575753 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2005775749 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 623/KOLNP/2007 Country of ref document: IN |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2005283025 Country of ref document: AU Ref document number: 181573 Country of ref document: IL |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 11574332 Country of ref document: US |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2007529870 Country of ref document: JP Ref document number: 1020077004881 Country of ref document: KR |
|
| WWE | Wipo information: entry into national phase |
Ref document number: MX/a/2007/002616 Country of ref document: MX Ref document number: 200580029480.3 Country of ref document: CN |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| ENP | Entry into the national phase |
Ref document number: 2005283025 Country of ref document: AU Date of ref document: 20050726 Kind code of ref document: A |
|
| WWP | Wipo information: published in national office |
Ref document number: 2005283025 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 200700533 Country of ref document: EA |
|
| WWP | Wipo information: published in national office |
Ref document number: 2005775749 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: PI0514790 Country of ref document: BR |




