WO2006011736A1 - The crystal structure of cmy-10, a beta-lactamase causing antibiotic resistance with extended-substrate spectrum - Google Patents

The crystal structure of cmy-10, a beta-lactamase causing antibiotic resistance with extended-substrate spectrum Download PDF

Info

Publication number
WO2006011736A1
WO2006011736A1 PCT/KR2005/002400 KR2005002400W WO2006011736A1 WO 2006011736 A1 WO2006011736 A1 WO 2006011736A1 KR 2005002400 W KR2005002400 W KR 2005002400W WO 2006011736 A1 WO2006011736 A1 WO 2006011736A1
Authority
WO
WIPO (PCT)
Prior art keywords
cmy
extended
lactamase
crystal
site
Prior art date
Application number
PCT/KR2005/002400
Other languages
French (fr)
Inventor
Sang-Hee Lee
Sun-Shin Cha
Jung-Hun Lee
Ha-Il Jung
Original Assignee
Myongji University Industry And Academia Cooperation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020040058283A external-priority patent/KR20060009624A/en
Application filed by Myongji University Industry And Academia Cooperation filed Critical Myongji University Industry And Academia Cooperation
Priority to US11/659,244 priority Critical patent/US7709237B2/en
Publication of WO2006011736A1 publication Critical patent/WO2006011736A1/en
Priority to US12/695,810 priority patent/US7919267B2/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/78—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5)
    • C12N9/86—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5) acting on amide bonds in cyclic amides, e.g. penicillinase (3.5.2)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2299/00—Coordinates from 3D structures of peptides, e.g. proteins or enzymes

Definitions

  • the present invention relates to a crystal structure of CMY-10 from Enterobacter aerogenes, a ⁇ -lactamase of plasmid class C causing resistance for ⁇ -lactam antibiotics, more precisely to a method for crystallizing a CMY-10 being a ⁇ -lactamase with extended-substrate spectrum, a crystal of CMY-10, and a crystal structure of CMY-10.
  • BACKGROUND ART ⁇ -Lactam antibiotic including penicillins, cephalosporins, monobactams, and carbapenems induces a death of live cell by inhibition of cell-wall synthesis
  • ⁇ - lactamase is a general resistance mechanism of bacteria for ⁇ -lactam antibiotics, which these enzymes hydrolyze a lactam-ring of the above antibiotics.
  • ⁇ -Lactamase is classified into four classes of A, B, C, and D according to homology of amino acid sequence (Ambler, 1980) .
  • the ⁇ -lactamase-mediated resistance of pathogenic bacteria to antibiotics is a continuing threat to public health. Therefore, a third generation of cephalosporins was developed that could escape inactivation by ⁇ -lactamases .
  • the new antibiotics such as cefotaxime and ceftazidime contain bulky oxyimino group at the C7 position of cephalosporin nucleus.
  • novel ⁇ -lactamases that could inactivate even the oxyimino ⁇ - lactams appeared.
  • the chromosomal class C ⁇ - lactamase that hydrolyzes the above oxyimino ⁇ -lactams has been isolated from the Gram-negative bacteria, Enterobacter cloacae strain GCl (Nukaga et al. , 1995) .
  • class A and C ⁇ -lactamase are the most commonly encountered of the four classes.
  • class C ⁇ -lactamases are more problematic than class A enzymes.
  • Class C ⁇ -lactamases can confer resistance to cephamycins (cefoxitin and cefotetan) , penicillins, cephalosporins and ⁇ -lactam/ ⁇ -lactamase inhibitor combinations and are not significantly inhibited by clinically used ⁇ -lactamase inhibitor such as clavulanic acid.
  • Class A ⁇ - lactamases are not able to confer resistance to cephamycins and the enzymes are generally susceptible to inhibition by clavulanic acid. ' .
  • Class C ⁇ -lactamases are typically synthesized by the Gram-negative bacteria and are mainly chromosomal. Recently, plasmid-encoded class C ⁇ -lactamases have been reported in several bacteria species (Lee et al., 2002) . Plasmid- ericoded class ,C ⁇ -lactamases pose more problems since they are transmissible to other bacterial species and are often expressed in a large amount (Marchese et al., 1998) .
  • CMY-I is the first plasmidic class C ⁇ -lactamase to be identified.
  • CMY-IO is a variant of the above CMY-I with a point mutation at position 346 from Asn to lie.
  • CMY-I and CMY-10 display the characteristics of extended-spectrum ⁇ - lactamase (ESBLs) (Lee et al., 2003; Horii et al. , 1993) .
  • the above CMY-10 enzyme is able to hydrolyze cefoxitin and cefotetan as well ⁇ as penicillins, the third-generation cephalosporins, - and monobactams (Lee et al., 2003; Bauernfeind et al., 1989) .
  • the high sequence identity between plasmidic ⁇ -lactamase and chromosomal lactamase clearly defines the origin of the above plasmidic enzymes.
  • MIR-I plasmidic ⁇ -lactamase
  • AmpC from Enterobacter cloacae-.- P99 is not ESBL, but is wild type of GCl.
  • CMY-I and CMY-10 the root is obscure since there is no closely related chromosomal class C enzyme.
  • CMY-IO gene present in the plasmid isolated from Enterobacter aerogenes has been over-expressed in E. coli, followed purification and crystallization of CMY-IO according to the present invention. It is also obtained X- ray diffraction data for CMY-10 crystal and determined a three-dimensional structure of the CMY-10 molecule using the above data.
  • the present invention is to allow using CMY-10, plasmidic class C ⁇ -lactamase, to develop new antibiotics that can prevent resistant bacteria from emerging by escaping hydrolysis by the above ⁇ -lactamase with determination of a three-dimensional structure of CMY-10 molecule from Enterobacter aerogenes.
  • the present invention provides a method for crystallizing a CMY-IO being a class C ⁇ -lactamase with extended-substrate spectrum, a crystal of CMY-IO, and a crystal structure of CMY-10.
  • a method for crystallizing a CMY-10 is provided. This method is characterized in that it consists of (1) a step providing a purified CMY-10 protein; (2) a step crystallizing . a purified CMY-10 protein with Microbatch crystallization method at 298K setting using precipitating agent containing 18% (w/v) polyethylene glycol 8000, 0.1 M sodium cacodylate (pH6.5) and 0.2 M zinc acetate dehydrate (condition No.45 of Crystal ScreenTM from Hampton Research); and (3) an analyzing step using a X-ray crystallography to obtain a three-dimensional structure of the above crystallized CMY-10 protein.
  • step (1) in the above step (1) , it is used as PCR template a plasmid pYMG-1 containing jbla C MY-io gene encoding ⁇ -lactamase produced by Enterobacter aerogenes which shows resistance to penicillins, three-generation cephalosporins, and monobactams as well as cefoxitin and cefotetan and is isolated at Kosin university gospel hospital, Korea . in 1998.
  • the used primer is N-iVdelF and C- XhoIB.
  • the above two primers contain recognition sequences for Ndel (N-NdeIF) and Xhol (C-XhoIB) at each end.
  • a method of Lee et al. is used for PCR amplification using DNA thermal cycler (mod 2400; Perkin-Elmer Cetus, Norwalk, CT,
  • PCR product of desired size 1179 bp is confirmed through an agarose gel electrophoresis.
  • PCR product digested by Ndel/Xhol is ligated at pET-26b(+) vector
  • pYMGlOOl The hybrid plasmid is designated as pYMGlOOl.
  • SP signal peptide
  • pYMG-1 is used as PCR template and, EK-CMY and the above C-XhoIB as primer, thereby PCR ' product ⁇ of .EK-CMY being obtained.
  • Ligation product digested with Bglll/Xhol is ligated at pET-2 ⁇ b(+) vector (Novagen, Wisconsin, WI, USA) ' digested with Bglll/Xhol.
  • the above recombinant plasmid DNA(pET-26b/Hisn-jbla C MY-io) is transformed to Escherichia coli strain BL21(DE3), and IPTG (isopropyl-1- thio- ⁇ -galactopyranoside) is added to induce an expression with a large amount of CMY-IO in culture broth of the above transformed cell; followed centrifugation of the above cell and re-suspension using 20 mM sodium phosphate buffer (pH 7.0, ice-cold phase) .
  • DNase I 100 ug/mL
  • PMSF phenylmethyl sulfonyl fluoride
  • a crude lysate is centrifuged again, a clarified supernatant is loaded His-Bind coiumn (Novagen, Wisconsin, WI, USA) equilibrated with a binding buffer (20 mM sodium phosphate, 10 mM imidazole,, and 500 mM NaCl pH 7.9) . And then, His u tag is removed from Hisu-CMY-10 by enterokinase.
  • a crystallization of CMY-10 protein in the above step (2) can be carried out by the Microbatch crystallization method at 298K set up or the hanging-drop vapor-diffusing method at a plate for culturing 24-well tissue (Supercon, South Korea) , and it is obtained with a crystal of 0.3' mm size using a precipitating agent containing 18% (w/v) polyethylene glycol 8000, 0.1 M sodium cacodylate (pH 6.5), and 0.2 M zinc acetate dehydrate (condition No.45- of Crystal ScreenTM from Hampton Research) .
  • a step analyzing a three-dimensional structure of CMY-IO protein crystal using an X-ray crystallography in the above step (3) can be carried out as following.
  • the present invention provides a crystal of CMY-10 protein crystallized• according to the above method.
  • CMY-10 crystal according to the present invention is presented as sequence list No.
  • the present- invention also provides three-dimensional structure of CMY-IO-- protein crystallized according to the above method.
  • a ribbon diagram of three-dimensional structure of CMY-10 protein is consisted of ⁇ -domain and ⁇ / ⁇ -domain.
  • the ⁇ -domain has three ⁇ -helices and loops.
  • the ⁇ / ⁇ domain folds as an eight stranded antiparallel ⁇ -sheet with eight ⁇ -helices and three ⁇ -strands ( ⁇ 3, ⁇ 4, and ⁇ 7) packed on both faces of the sheet, and with two ⁇ -strands ( ⁇ 5 and ⁇ ) on one edge ( ⁇ -helix: 11; ⁇ -strand: 13) .
  • An active site is located at a center, the upper active site is Rl site and the lower active site is R2 site.
  • the Rl site is a space formed by flexible part of ⁇ loop positioned at the upper left side, Glnl21 loop positioned at the most left side among ⁇ -domain and defining the edges of the active site, and ⁇ ll strand positioned at the most right side among ⁇ / ⁇ - domain and defining the edges of the active site.
  • the R2 site is a space formed by ⁇ lO, all helix, and Tyrl51 loop positioned at the lower site.
  • P99 has not extended-substrate spectrum due to its characteristic which is unable to hydrolyze third-generation cephalosporins.
  • CMY-10 shows extended-substrate spectrum by binding with third- generation cephalosporins (ceftazidime) due to the above two extended sites able to receive oxyimino group of ceftazidime, and this phenomenon is new characteristic that only CMY-10 has.
  • PDB Protein Data Bank
  • Figure 1 is a photograph of CMY-10 crystal from Enterobacter aeroge ⁇ es, which is crystallized according to the present invention. ⁇
  • Figure 2 shows three-dimensional molecular structure of CMY-10 from Enterobacter aerogenes by X-ray crystallography according to the present invention with ribbon diagram, the right of the above diagram is ⁇ -domain of CMY-IO, the left is ⁇ / ⁇ -domain, and the central pouch shape is an active site, respectively.
  • ⁇ -Helix is represented with blue color
  • ⁇ -sheet is represented with yellow color.
  • Figure 3 is C ⁇ backbone diagram showing a position of ⁇ -domain (the right) , ⁇ / ⁇ -domain (the left) , and an active site (the central pouch shape) of CMY-IO from Enterobacter aerogenes according to the present invention.
  • Figure 4 is C ⁇ backbone diagram showing a position of ⁇ -domain (the right) , ⁇ / ⁇ -domain (the left) , and an active site (the central pouch shape) of CMY-IO (yellow) from Enterobacter aerogenes ' and P99 (Red; PDB file IBLS; representing a 40.16% sequence identity to CMY-10) from Enterobacter cloacae according to the present invention.
  • Figure 5 is C ⁇ backbone diagram of CMY-10 (yellow) and P99 (Red; PDB ' file IBLS; representing a 40.16% sequence identity to CMY-10) , showing the first widening position
  • R2 active site being extended to 2A
  • R2 active site the central pouch shape of CMY-10 ' from Enterobacter aerogenes by deletion of amino acid sequence (PPA) being presented at position 303 to position 305 in P99 according to the present invention.
  • Figure 6 is C 01 ' backbone diagram of CMY-10 (yellow) and P99 (Red; PDB file IBLS; representing a 40.16% sequence identity to CMY-10), showing the second widening position (being indicated with .upper white circle, Rl active site being extended to lA) of Rl active site (the central pouch shape) of CMY-IO from Enterobacter aerogenes ' by difference of amino acid residues from 83 to 106 between CMY-IO and P99 according to the present invention.
  • Figure 7 is surface diagram showing a position of ⁇ - domain, ⁇ / ⁇ -domain, and an active site (the central pouch shape) of CMY-10 from Enterobacter aerogenes according to the present invention-.
  • Figure 8- is surface diagram of CMY-10 from Enterobacter aerogenes according to the present invention, showing extended-substrate spectrum by binding with third- generation cephalosporins (ceftazidime; central compound) due to two extended sites able to receive oxyimino group of ceftazidime and- shown at Figure 6 and Figure 7.
  • cephalosporins ceftazidime
  • the plasmid pYMG-1 (Lee et al., 2003) is used as PCR template and the plasmid contains jbla C MY-io gene encoding ⁇ - lactamase produced by Enterobacter aerogenes which shows resistance to penicillins, three-generation cephalosporins, and monobactams as well as cefoxitin and cefotetan and is isolated at Kosin university gospel hospital, Korea in 1998.
  • the used primer is N- ⁇ /delF (5'- GTAGACCATATGCAACAACGACAATCCATCCTGTGG-S' , containing Ndel recognition site shown in a bold-type) and C-XhoIB (5'- GAATGTCTCGAGCTCTTTCTTTGAACCGGCCAAC-S', containing Xhol recognition site shown in a bold-type) .
  • Two primers contain recognition sequences (bold-type) for Ndel (N- ⁇ JdelF) and Xhol ⁇ C-XhoIB) "at each end.
  • a method of Lee et al. is used for PCR amplification using DNA thermal cycler (mod 2400; Perkin-Elmer Cetus,. ' Norwalk, CT, USA) .
  • PCR product of desired size 1179 bp is confirmed through an agarose gel electrophoresis.
  • ⁇ PCR product digested by Ndel/Xhol is ligated at pET-26b(+) vector (Novagen, Wisconsin, WI, USA) digested with Ndel/Xhol.
  • the formed plasmid is named as pYMGlOOl.
  • pYMGlOOl is used as PCR template, and UP-26b-.Bg.ZII (5'- CTATCATGCCATACCCGCAAAG-3' , containing BgIII recognition site derived from pET26b(+) in PCR product) and Sp-HIS (5'- GCTATGATGATGATGATGATGATGATGATGATGATGATCCGGTGAAGCCTCACCTGCAT G-3', containing Hisn site shown in a bold-type) as primer, thereby PCR product of HIS-CMY-SP being obtained.
  • pYMG-1 is used as PCR template and, EK-CMY (5'- AGCGGCCATATCGACGACGACGACAAGGGTGAGGCTTCACCGGTCGATC-S ' , containing enterokinase recognition site shown in a bold- type) and the above .C-XhoIB . as primer, thereby PCR product of EK-CMY being • obtained. Ligation between blunt ends of the above PCR products, HIS-CMY-SP and EK-CMY, is carried out.
  • Ligation product digested with BgIIl/Xhol is ligated at pET-2 ⁇ b(+) vector (Novagen, Wisconsin, WI, USA) digested with BgIII/Xhol ..
  • the formed plasmid is named as pET- 26b/Hisn-jbla C MY-io• After verifying the above DNA sequence, in order to over-express the above Hisu-jblacMY-io/- the above recombinant plasmid- DNA . is transformed into Escherichia coli strain BL21 (DE3) .
  • the transformed cells are grown in Luria-Bertani medium (Difco) containing 50 ug/mL of kanamycin to an OD 6 oo O'f 0.6 at 303K and expression of CMY- 10 is induced . with 0.5 mM IPTG (iso ⁇ ropyl-1-thio- ⁇ - galactopyranoside) for 16h at 301K. Cells are harvested by centrifugation ' at 500Og for lOmin at 227K and re-suspended in ice-cold 20 mM. sodium phosphate buffer pH 7.0.
  • DNase I 100 ug/mL
  • PMSF phenylmethyl sulfonyl fluoride
  • the crude lysate is centrifuged at 20,00Og for 30min at 277K and the clarified supernatant is loaded onto a His-Bind column (Novagen, Wisconsin, WI, USA) equilibrated with binding buffer (20 mM sodium phosphate, 10 mM imidazole, and 500 mM NaCl pH 7.9) .
  • binding buffer 20 mM sodium phosphate, 10 mM imidazole, and 500 mM NaCl pH 7.9 .
  • Hi . Sn . tag is removed from enterokinase according to the instruction of manufacturer, Novagen.
  • the reaction mixture is desalted and concentrated with Fast Desalting column (Amersham Biosciences, UK) and then loaded onto Mono S column (Amersham Biosciences, UK) pre- equilibrated with 10 mM sodium phosphate buffer (pH 7.0) .
  • the soluble form of- CMY-IO without Hisn tag is obtained with a yield of .9.2 mg of homogeneous protein per liter of culture.
  • the purified CMY-IO is dialyzed against 10 mM phosphate buffer ' and subsequently concentrated to 17 mg/mL for crystallization.
  • the apparent molecular weight of the purified CMY-10 is estimated to be 38 kDa by SDS-PAGE.
  • Crystals of CMY-10 is obtained by the batch- crystallization method at 298K set up by using an automatic crystallization machine, IMPAX 1-5 system (Douglas
  • V M is calculated to be 2.25A 3 Da '1 with a solvent content of 44.84% (v/v) when the unit cell is assumed to contain two molecules. This corresponds to one molecule per asymmetric unit.
  • the statistics of data collection is shown in table 1. TABLE 1 ⁇
  • Example 3 Three-dimensional structure determination and refinement of CMY-10 protein
  • the crystal .is soaked in a cryoprotectant solution consisted of a ⁇ precipitant solution containing 15% (v/v) glycerol for a while and then flash-cooled with a nitrogen gas of 100 K by using a cooler (Oxford Cryosystems, UK) .
  • Diffraction data is collected from the above cooled CMY-10 crystal by using a MacScience 2030b area detector at beamline 6B of P ⁇ harig light Source (6B, PLS), South Korea.
  • the wavelength of synchrotron radiation is 1.12714A.
  • a total • of 90 frames of 2° oscillation are measured with the' crystal-to-detector distance set to 300 mm.
  • CMY-IO protein 359 amino acid residues
  • Figure 9 shows a space coordinates of three-dimensional structure of CMY- 10 protein.
  • the ⁇ -domain has three ⁇ -helices and loops.
  • the ⁇ / ⁇ domain folds as an eight stranded antiparallel ⁇ -sheet with eight ⁇ -helices and three ⁇ -strands ( ⁇ 3, ⁇ 4, and ⁇ 7) packed on both faces of the sheet, and with two ⁇ -strands
  • the Rl site is a space formed by flexible part (residues 212-226) of ⁇ loop positioned at the upper left side, Glnl21 loop (residues 118-128) positioned at the very left side among ⁇ -domain and defining the edges of the active site, and ⁇ ll strand positioned at the very right side among ⁇ / ⁇ -domain and defining the edges of the active site.
  • the R2 site is a space formed by ⁇ lO,. .
  • CMY-IO shows extended-substrate spectrum by binding with third-generation cephalosporins (ceftazidime; central compound in Figure 8) due to the above two extended sites able to receive oxy ⁇ mino group of ceftazidime, and this phenomenon is new characteristic .that only CMY-IO has.
  • Extended-substrate specificity of CMY-10 is produced by a new mechanism different from that of a chromosomal ⁇ - lactamase from E.
  • cloacae GCl (representing a 39.79% sequence identity to CMY-10) whose three-dimensional structure is only known among a class C ESBL having extended-substrate ⁇ .specificity for third-generation cephalosporins.
  • the insertion mutation consisting of an unusual tandem repeat of three residues (Ala208-Val209- Arg210) in Q-loop-is responsible for the extended activity of the GCl ⁇ -lact.amase, which widens the active site enough to accommodate • the- oxyimino group of third-generation cephalosporins (Crichlow et al. r 1999) .
  • CMY-10 does not have such an insertion mutation, and shows the extension of Rl- ' and R2 active site and a new three- dimensional structural specificity describing a mechanism of extended-substrate spectrum for third-generation cephalosporins.
  • the three-dimensional structural space coordinates of the above CMY-10 is deposited to PDB (Protein Data Bank, w-eb site: http://www.rcsb.org/pdb/) with deposition No. IZKJ on May 3, 2005.
  • the present invention relates to a method for crystallizing a CMY-IO being a ⁇ -lactamase with extended-substrate spectrum, a crystal of CMY-10, and a crystal structure of CMY-10.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The present invention related to a method for crystallizing a CMY-10 being a β-lactamase with extended- substrate spectrum, a crystal of CMY-10, and a crystal structure of CMY-10. With utilization of three-dimensional structure of CMY-10 . protein provided by the present invention, it is possible to develop novel antibiotics or inhibitors that can prevent an emergence of resistance bacteria appeared by^plasmidic class C β-lactamases having extended-substrate specificity.

Description

DESCRIPTION
THE CRYSTAL STRUCTURE OF CMY-10, A BETA-LACTAMASE CAUSING ANTIBIOTIC RESISTANCE WITH EXTENDED-SUBSTRATE SPECTRUM
TECHNICAL FIELD
The present invention relates to a crystal structure of CMY-10 from Enterobacter aerogenes, a β-lactamase of plasmid class C causing resistance for β-lactam antibiotics, more precisely to a method for crystallizing a CMY-10 being a β-lactamase with extended-substrate spectrum, a crystal of CMY-10, and a crystal structure of CMY-10.
BACKGROUND ART β-Lactam antibiotic, including penicillins, cephalosporins, monobactams, and carbapenems induces a death of live cell by inhibition of cell-wall synthesis
(Tomasz, 1979) . But it is induced an emergence of bacteria having a resistance for ■the above β-lactam antibiotics due to a broad use of these antibiotics. Expression of β- lactamase is a general resistance mechanism of bacteria for β-lactam antibiotics, which these enzymes hydrolyze a lactam-ring of the above antibiotics. β-Lactamase is classified into four classes of A, B, C, and D according to homology of amino acid sequence (Ambler, 1980) . The β-lactamase-mediated resistance of pathogenic bacteria to antibiotics is a continuing threat to public health. Therefore, a third generation of cephalosporins was developed that could escape inactivation by β-lactamases . The new antibiotics such as cefotaxime and ceftazidime contain bulky oxyimino group at the C7 position of cephalosporin nucleus. After clinical use, however, novel β-lactamases that could inactivate even the oxyimino β- lactams appeared. For example, the chromosomal class C β- lactamase that hydrolyzes the above oxyimino β-lactams has been isolated from the Gram-negative bacteria, Enterobacter cloacae strain GCl (Nukaga et al. , 1995) .
Clinically, class A and C β-lactamase are the most commonly encountered of the four classes. However, class C β-lactamases are more problematic than class A enzymes. Class C β-lactamases can confer resistance to cephamycins (cefoxitin and cefotetan) , penicillins, cephalosporins and β-lactam/β-lactamase inhibitor combinations and are not significantly inhibited by clinically used β-lactamase inhibitor such as clavulanic acid. In contrast, Class A β- lactamases are not able to confer resistance to cephamycins and the enzymes are generally susceptible to inhibition by clavulanic acid.' .
Class C β-lactamases are typically synthesized by the Gram-negative bacteria and are mainly chromosomal. Recently, plasmid-encoded class C β-lactamases have been reported in several bacteria species (Lee et al., 2002) . Plasmid- ericoded class ,C β-lactamases pose more problems since they are transmissible to other bacterial species and are often expressed in a large amount (Marchese et al., 1998) . CMY-I is the first plasmidic class C β-lactamase to be identified. CMY-IO is a variant of the above CMY-I with a point mutation at position 346 from Asn to lie. CMY-I and CMY-10 display the characteristics of extended-spectrum β- lactamase (ESBLs) (Lee et al., 2003; Horii et al. , 1993) . The above CMY-10 enzyme is able to hydrolyze cefoxitin and cefotetan as well ■ as penicillins, the third-generation cephalosporins, - and monobactams (Lee et al., 2003; Bauernfeind et al., 1989) . The high sequence identity between plasmidic β-lactamase and chromosomal lactamase clearly defines the origin of the above plasmidic enzymes. Namely, MIR-I, plasmidic β-lactamase, shows over 90% sequence identity to a chromosomal enzyme AmpC from Enterobacter cloacae-.- P99 is not ESBL, but is wild type of GCl. In the case of CMY-I and CMY-10, however, the root is obscure since there is no closely related chromosomal class C enzyme.
Structural information on class C β-lactamase is very restricted. All available structures have been determined using chromosomal β-lactamase (Crichlow et al. , 1999; Lobkovsky et al.,' 1993; Oefner et al., 1990; Usher et al., 1998) . Thus, the, structure of CMY-I and CMY-IO will open new opportunities for structural comparison between chromosomal and plasmidic class C β-lactamases and for the design of new antibiotics that can escape hydrolysis by plasmidic class C ESBLs.
With considering the above described state, therefore, it is found the CMY-IO gene present in the plasmid isolated from Enterobacter aerogenes has been over-expressed in E. coli, followed purification and crystallization of CMY-IO according to the present invention. It is also obtained X- ray diffraction data for CMY-10 crystal and determined a three-dimensional structure of the CMY-10 molecule using the above data.
DISCLOSURE OF INVENTION
TECHNICAL PROBLEM
The present invention is to allow using CMY-10, plasmidic class C β-lactamase, to develop new antibiotics that can prevent resistant bacteria from emerging by escaping hydrolysis by the above β-lactamase with determination of a three-dimensional structure of CMY-10 molecule from Enterobacter aerogenes.
TECHNICAL SOLUTION To achieve the above objection, the present invention provides a method for crystallizing a CMY-IO being a class C β-lactamase with extended-substrate spectrum, a crystal of CMY-IO, and a crystal structure of CMY-10.
The present invention will be explained in details hereinafter.
First, a method for crystallizing a CMY-10 is provided. This method is characterized in that it consists of (1) a step providing a purified CMY-10 protein; (2) a step crystallizing . a purified CMY-10 protein with Microbatch crystallization method at 298K setting using precipitating agent containing 18% (w/v) polyethylene glycol 8000, 0.1 M sodium cacodylate (pH6.5) and 0.2 M zinc acetate dehydrate (condition No.45 of Crystal Screen™ from Hampton Research); and (3) an analyzing step using a X-ray crystallography to obtain a three-dimensional structure of the above crystallized CMY-10 protein.
At this time, ;in the above step (1) , it is used as PCR template a plasmid pYMG-1 containing jblaCMY-io gene encoding β-lactamase produced by Enterobacter aerogenes which shows resistance to penicillins, three-generation cephalosporins, and monobactams as well as cefoxitin and cefotetan and is isolated at Kosin university gospel hospital, Korea . in 1998. The used primer is N-iVdelF and C- XhoIB. The above two primers contain recognition sequences for Ndel (N-NdeIF) and Xhol (C-XhoIB) at each end. A method of Lee et al. is used for PCR amplification using DNA thermal cycler (mod 2400; Perkin-Elmer Cetus, Norwalk, CT,
USA) . PCR product of desired size 1179 bp is confirmed through an agarose gel electrophoresis. PCR product digested by Ndel/Xhol is ligated at pET-26b(+) vector
(Novagen, Wisconsin, WI, USA) digested with Ndel/Xhol. The hybrid plasmid is designated as pYMGlOOl. To amplify signal peptide (SP) portion fused with promoter site of pYMGlOOl and Hisn (11-histidine) , pYMGlOOl is used as PCR template, and UP~26b-BglII and Sp-HIS as primer, thereby PCR product of HIS-CMY-SP being obtained. To amplify CMY-IO gene fused with enterokinase recognition site, pYMG-1 is used as PCR template and, EK-CMY and the above C-XhoIB as primer, thereby PCR 'product ■ of .EK-CMY being obtained. Ligation between blunt ends of the above PCR products, HIS-CMY-SP and EK-CMY, is carried out. Ligation product digested with Bglll/Xhol is ligated at pET-2βb(+) vector (Novagen, Wisconsin, WI, USA)' digested with Bglll/Xhol. In order to over-express the above Hisu-jblacMY-io/ the above recombinant plasmid DNA(pET-26b/Hisn-jblaCMY-io) is transformed to Escherichia coli strain BL21(DE3), and IPTG (isopropyl-1- thio-β-galactopyranoside) is added to induce an expression with a large amount of CMY-IO in culture broth of the above transformed cell; followed centrifugation of the above cell and re-suspension using 20 mM sodium phosphate buffer (pH 7.0, ice-cold phase) . DNase I (100 ug/mL) and 1 mM PMSF (phenylmethyl sulfonyl fluoride) is added to the above suspension solution. After lysis of the above cell, a crude lysate is centrifuged again, a clarified supernatant is loaded His-Bind coiumn (Novagen, Wisconsin, WI, USA) equilibrated with a binding buffer (20 mM sodium phosphate, 10 mM imidazole,, and 500 mM NaCl pH 7.9) . And then, Hisu tag is removed from Hisu-CMY-10 by enterokinase. The resulting product is desalted and concentrated with Fast Desalting column' (Amersham Biosciences, UK) and then loaded to Mono S column (Amersham Biosciences, UK) equilibrated previously with 10 mM sodium phosphate buffer (pH 7.0) . The nucleotide sequence of the CMY-10 isolated and purified by the above procedure is presented as sequence list No. 1, and registered at Gene Bank with registration No. AF357598.
Next, a crystallization of CMY-10 protein in the above step (2) can be carried out by the Microbatch crystallization method at 298K set up or the hanging-drop vapor-diffusing method at a plate for culturing 24-well tissue (Supercon, South Korea) , and it is obtained with a crystal of 0.3' mm size using a precipitating agent containing 18% (w/v) polyethylene glycol 8000, 0.1 M sodium cacodylate (pH 6.5), and 0.2 M zinc acetate dehydrate (condition No.45- of Crystal Screen™ from Hampton Research) . Lastly, a step analyzing a three-dimensional structure of CMY-IO protein crystal using an X-ray crystallography in the above step (3) can be carried out as following. Namely, it can be determined by obtaining an X-ray diffraction data from a cold- .substance of CMY-10 protein crystal, calculating an ■ electric density from the above data and using a well-known computer program for modeling the protein. In the present invention, it is processed with a CNS program base on an X-ray diffraction data collected at
1.55Aresolution... The present invention provides a crystal of CMY-10 protein crystallized• according to the above method.
The amino acid sequence of CMY-10 crystal according to the present invention is presented as sequence list No.
2, and its space group is P2±. The crystal of CMY-10 protein has a unit cell parameter, a=49.70, jb=59.51, c=63.75Aand /3=10.2.57°, and one CMY-10 molecule is included in asymmetric unit of the crystal.
The present- invention also provides three-dimensional structure of CMY-IO-- protein crystallized according to the above method.
A ribbon diagram of three-dimensional structure of CMY-10 protein is consisted of α-domain and α/β-domain. The α-domain has three α-helices and loops. The α/β domain folds as an eight stranded antiparallel β-sheet with eight α-helices and three β-strands (β3, β4, and β7) packed on both faces of the sheet, and with two β-strands (β5 and βδ) on one edge (α-helix: 11; β-strand: 13) . An active site is located at a center, the upper active site is Rl site and the lower active site is R2 site. The Rl site is a space formed by flexible part of Ω loop positioned at the upper left side, Glnl21 loop positioned at the most left side among α-domain and defining the edges of the active site, and βll strand positioned at the most right side among α/β- domain and defining the edges of the active site. The R2 site is a space formed by αlO, all helix, and Tyrl51 loop positioned at the lower site. Unlike CMY-IO, P99 has not extended-substrate spectrum due to its characteristic which is unable to hydrolyze third-generation cephalosporins. With comparing Cα ' backbone diagram of P99 (representing a 40.16% sequence identity to CMY-IO) with Cα backbone diagram of CMY-10, the' distance between αlO and adjacent all of R2 is extended to 2A due to deletion of amino acid sequence (PPA) ■ presenting at from 303 position to 305 position in P99, and the distance between Glnl21 loop and βll strand of' Rl- is extended to lA because residues 83-106 in the helical ' domain form solvent exposed loops that display the large structural deviation. The sequence difference between CMY-10 and P99 β-lactamase in this loop region is 68%. The extension of the above active site , Rl and R2 site, allows to bind a bulky oxyimino group presented at C7 position of nucleus of ceftazidime (a third-generation cephalosporin) at an active site of CMY-IO, thereby CMY-IO hydrolyzing ceftazidime-. With viewing a surface diagram which is a real feature of CMY-IO, CMY-10 shows extended-substrate spectrum by binding with third- generation cephalosporins (ceftazidime) due to the above two extended sites able to receive oxyimino group of ceftazidime, and this phenomenon is new characteristic that only CMY-10 has. The three-dimensional structural space coordinates of the 'above CMY-10 is deposited to PDB (Protein Data Bank, web site: http://www.rcsb.org/pdb/) with deposition No. IZKJ on May 3, 2005.
DESCRIPTION OF DRAWINGS Other objects . and aspects of the present invention will become apparent from the following description of embodiments with reference to the accompanying drawing in which:
Figure 1 is a photograph of CMY-10 crystal from Enterobacter aerogeπes, which is crystallized according to the present invention. ■
Figure 2 shows three-dimensional molecular structure of CMY-10 from Enterobacter aerogenes by X-ray crystallography according to the present invention with ribbon diagram, the right of the above diagram is α-domain of CMY-IO, the left is α/β-domain, and the central pouch shape is an active site, respectively. α-Helix is represented with blue color, and β-sheet is represented with yellow color. Figure 3 is Cα backbone diagram showing a position of α-domain (the right) , α/β-domain (the left) , and an active site (the central pouch shape) of CMY-IO from Enterobacter aerogenes according to the present invention.
Figure 4 is Cα backbone diagram showing a position of α-domain (the right) , α/β-domain (the left) , and an active site (the central pouch shape) of CMY-IO (yellow) from Enterobacter aerogenes ' and P99 (Red; PDB file IBLS; representing a 40.16% sequence identity to CMY-10) from Enterobacter cloacae according to the present invention. Figure 5 is Cα backbone diagram of CMY-10 (yellow) and P99 (Red; PDB' file IBLS; representing a 40.16% sequence identity to CMY-10) , showing the first widening position
(being indicated with lower white circle, R2 active site being extended to 2A) of R2 active site (the central pouch shape) of CMY-10 'from Enterobacter aerogenes by deletion of amino acid sequence (PPA) being presented at position 303 to position 305 in P99 according to the present invention.
Figure 6 is C01' backbone diagram of CMY-10 (yellow) and P99 (Red; PDB file IBLS; representing a 40.16% sequence identity to CMY-10), showing the second widening position (being indicated with .upper white circle, Rl active site being extended to lA) of Rl active site (the central pouch shape) of CMY-IO from Enterobacter aerogenes' by difference of amino acid residues from 83 to 106 between CMY-IO and P99 according to the present invention.
Figure 7 is surface diagram showing a position of α- domain, α/β-domain, and an active site (the central pouch shape) of CMY-10 from Enterobacter aerogenes according to the present invention-. Figure 8- . is surface diagram of CMY-10 from Enterobacter aerogenes according to the present invention, showing extended-substrate spectrum by binding with third- generation cephalosporins (ceftazidime; central compound) due to two extended sites able to receive oxyimino group of ceftazidime and- shown at Figure 6 and Figure 7.
BEST MODE
A greater understanding of the present invention and its concomitant advantages will be obtained by referring to the following Example and Comparative example provided, but it is not to limit the scope of the present invention.
Example 1: Overexpression and purification of CMY-10
To express CMY-10 as a histidine-tagged fusion form, the plasmid pYMG-1 (Lee et al., 2003) is used as PCR template and the plasmid contains jblaCMY-io gene encoding β- lactamase produced by Enterobacter aerogenes which shows resistance to penicillins, three-generation cephalosporins, and monobactams as well as cefoxitin and cefotetan and is isolated at Kosin university gospel hospital, Korea in 1998. The used primer is N-Λ/delF (5'- GTAGACCATATGCAACAACGACAATCCATCCTGTGG-S' , containing Ndel recognition site shown in a bold-type) and C-XhoIB (5'- GAATGTCTCGAGCTCTTTCTTTGAACCGGCCAAC-S', containing Xhol recognition site shown in a bold-type) . Two primers contain recognition sequences (bold-type) for Ndel (N-ΛJdelF) and Xhol {C-XhoIB) "at each end. A method of Lee et al. is used for PCR amplification using DNA thermal cycler (mod 2400; Perkin-Elmer Cetus,. ' Norwalk, CT, USA) . PCR product of desired size 1179 bp is confirmed through an agarose gel electrophoresis. ■ PCR product digested by Ndel/Xhol is ligated at pET-26b(+) vector (Novagen, Wisconsin, WI, USA) digested with Ndel/Xhol. The formed plasmid is named as pYMGlOOl. To amplify signal peptide (SP) portion fused with promoter site of pYMGlOOl and Hisn (11-histidine) , pYMGlOOl is used as PCR template, and UP-26b-.Bg.ZII (5'- CTATCATGCCATACCCGCAAAG-3' , containing BgIII recognition site derived from pET26b(+) in PCR product) and Sp-HIS (5'- GCTATGATGATGATGATGATGATGATGATGATGATGATCCGGTGAAGCCTCACCTGCAT G-3', containing Hisn site shown in a bold-type) as primer, thereby PCR product of HIS-CMY-SP being obtained. To amplify CMY-IO gene fused with enterokinase recognition site, pYMG-1 is used as PCR template and, EK-CMY (5'- AGCGGCCATATCGACGACGACGACAAGGGTGAGGCTTCACCGGTCGATC-S ' , containing enterokinase recognition site shown in a bold- type) and the above .C-XhoIB . as primer, thereby PCR product of EK-CMY being • obtained. Ligation between blunt ends of the above PCR products, HIS-CMY-SP and EK-CMY, is carried out. Ligation product digested with BgIIl/Xhol is ligated at pET-2βb(+) vector (Novagen, Wisconsin, WI, USA) digested with BgIII/Xhol .. The formed plasmid is named as pET- 26b/Hisn-jblaCMY-io• After verifying the above DNA sequence, in order to over-express the above Hisu-jblacMY-io/- the above recombinant plasmid- DNA . is transformed into Escherichia coli strain BL21 (DE3) . The transformed cells are grown in Luria-Bertani medium (Difco) containing 50 ug/mL of kanamycin to an OD6oo O'f 0.6 at 303K and expression of CMY- 10 is induced . with 0.5 mM IPTG (isoρropyl-1-thio-β- galactopyranoside) for 16h at 301K. Cells are harvested by centrifugation ' at 500Og for lOmin at 227K and re-suspended in ice-cold 20 mM. sodium phosphate buffer pH 7.0. DNase I (100 ug/mL) and 1 mM PMSF (phenylmethyl sulfonyl fluoride) are added to the: above suspension and cells are disrupted by sonication. The crude lysate is centrifuged at 20,00Og for 30min at 277K and the clarified supernatant is loaded onto a His-Bind column (Novagen, Wisconsin, WI, USA) equilibrated with binding buffer (20 mM sodium phosphate, 10 mM imidazole, and 500 mM NaCl pH 7.9) . For further purification, Hi.Sn . tag is removed from enterokinase according to the instruction of manufacturer, Novagen. The reaction mixture is desalted and concentrated with Fast Desalting column (Amersham Biosciences, UK) and then loaded onto Mono S column (Amersham Biosciences, UK) pre- equilibrated with 10 mM sodium phosphate buffer (pH 7.0) . The soluble form of- CMY-IO without Hisn tag is obtained with a yield of .9.2 mg of homogeneous protein per liter of culture. The purified CMY-IO is dialyzed against 10 mM phosphate buffer' and subsequently concentrated to 17 mg/mL for crystallization. Like other class C β-lactamase, the apparent molecular weight of the purified CMY-10 is estimated to be 38 kDa by SDS-PAGE.
Example 2 : Microbatch crystallization of CMY-IO
Crystals of CMY-10 is obtained by the batch- crystallization method at 298K set up by using an automatic crystallization machine, IMPAX 1-5 system (Douglas
Instruments Ltd; UK) . 1 uL of protein solution and an equal volume of crystallization regent are pipetted under a layer of a 1:1 mixture of silicon oil and paraffin oil in 72-well plate (Nunc) . Initial crystallization conditions are tested by using all :the available screening kits from Hampton Research and Emerald BioStructures Inc. As a result, the crystal of 0.3 mm size is produced by using a precipitating agent containing 18% (w/v) polyethylene glycol 8000, 0.1 M sodium cacodylate (pH 6.5), and 0.2 M zinc acetate dehydrate (condition No.45 of Crystal Screen™ from Hampton Research) . The crystal of CMY-10 is shown in Figure 1.
As a result, the crystal of CMY-10 protein is revealed to be belonged to the monoclinic space group P2i with unit-cell parameters a=49.70, £»=59.51, c=63.75A and
/3=102.57°, and the crystal volume per unit molecular weight
(VM) is calculated to be 2.25A3 Da'1 with a solvent content of 44.84% (v/v) when the unit cell is assumed to contain two molecules. This corresponds to one molecule per asymmetric unit. The statistics of data collection is shown in table 1. TABLE 1 ■
Characteristics of CMY-10 crystal and analysis of data- collection statisticsi •
Figure imgf000018_0001
Figure imgf000019_0001
Example 3: Three-dimensional structure determination and refinement of CMY-10 protein
To obtain an X-ray data from the crystal of the above CMY-10, the crystal .is soaked in a cryoprotectant solution consisted of a ■ precipitant solution containing 15% (v/v) glycerol for a while and then flash-cooled with a nitrogen gas of 100 K by using a cooler (Oxford Cryosystems, UK) . Diffraction data is collected from the above cooled CMY-10 crystal by using a MacScience 2030b area detector at beamline 6B of Pøharig light Source (6B, PLS), South Korea. At this time, the wavelength of synchrotron radiation is 1.12714A. A total • of 90 frames of 2° oscillation are measured with the' crystal-to-detector distance set to 300 mm.
An X-ray diffraction data is collected at 1.55A resolution and processed with the program CNS (Otwinowski & Minor, 1997) . 'After the X-ray data being obtained, an electric density map is calculated from the above data and model building of CMY-10 is carried out. In a quality analysis of a model, PROCHECK (Laskowski et al. , 1993) program is used, and the results show that 83.1% among 840 ordered residues are in the most favored regions, 15.2% are in additionally allowed regions, 1.1% are in generously allowed regions, and only 0.7% are in disallowed regions. Figure 2 to Figure 8 are drawn up by using Raster 3D
(Merrit and Murphy, 1994) and Molscript (Kraulis, 1991) program.
As a result, a ribbon diagram (see Figure 2) of three-dimensional structure of CMY-IO protein (359 amino acid residues) is consisted of α-domain (residues 83-170) and α/β-domain (residues 1-82 and 171-359) . Figure 9 shows a space coordinates of three-dimensional structure of CMY- 10 protein. The α-domain has three α-helices and loops. The α/β domain folds as an eight stranded antiparallel β-sheet with eight α-helices and three β-strands (β3, β4, and β7) packed on both faces of the sheet, and with two β-strands
(β5 and ββ) on one edge (α-helix : 11; β-strand : 13) . An active site is located at a center, the upper active site is Rl site and the lower active site is R2 site. The Rl site is a space formed by flexible part (residues 212-226) of Ω loop positioned at the upper left side, Glnl21 loop (residues 118-128) positioned at the very left side among α-domain and defining the edges of the active site, and βll strand positioned at the very right side among α/β-domain and defining the edges of the active site. The R2 site is a space formed by αlO,.. all helix and Tyrl51 loop (residues 149-152) positioned at the lower site. Unlike CMY-IO, P99 has not extended-substrate spectrum due to its characteristic which is unable to hydrolyze third- generation cephalosporins. With comparing Cα backbone diagram (see Figure 4) of P99 (representing a 40.16% sequence identity to' CMY-10) with Cα backbone diagram (see Figure 3 and Figure 4) of CMY-10, the location and geometry of catalytic residues such as Ser65, Tyrl51, the nucleophile and 'the-,main chain nitrogen atoms of Serβ5 and Ser315 that form, the oxyanion hole, are well conserved in P99 and CMY-10. But, the distance between αlO and adjacent all of R2 is extended to 2A because of the deletion of amino acid sequence (PPA) presenting from 303 position to 305 position in P99 (see white circle at Figure 5), and the distance between Glnl21 loop and βll strand of Rl is extended to lA. because residues 83-106 in the helical domain form solvent exposed loops that display the large structural deviation (see white circle at Figure 6) . The sequence difference between CMY-10 and P99 β-lactamase in this loop region 'is 68%. The extension of the above active site, Rl and' R2 site, allows to bind a bulky oxyimino group presented at C7 position of nucleus of ceftazidime (a third-generation cephalosporin) at an active site of CMY-10, thereby CMY-10 hydrolyzing ceftazidime. With viewing a surface diagram (see Figure 7) which is a real feature of CMY-IO, CMY-IO shows extended-substrate spectrum by binding with third-generation cephalosporins (ceftazidime; central compound in Figure 8) due to the above two extended sites able to receive oxyάmino group of ceftazidime, and this phenomenon is new characteristic .that only CMY-IO has. Extended-substrate specificity of CMY-10 is produced by a new mechanism different from that of a chromosomal β- lactamase from E. cloacae GCl (representing a 39.79% sequence identity to CMY-10) whose three-dimensional structure is only known among a class C ESBL having extended-substrate ■ .specificity for third-generation cephalosporins. The insertion mutation consisting of an unusual tandem repeat of three residues (Ala208-Val209- Arg210) in Q-loop-is responsible for the extended activity of the GCl β-lact.amase, which widens the active site enough to accommodate • the- oxyimino group of third-generation cephalosporins (Crichlow et al.r 1999) . However, CMY-10 does not have such an insertion mutation, and shows the extension of Rl-' and R2 active site and a new three- dimensional structural specificity describing a mechanism of extended-substrate spectrum for third-generation cephalosporins. The three-dimensional structural space coordinates of the above CMY-10 is deposited to PDB (Protein Data Bank, w-eb site: http://www.rcsb.org/pdb/) with deposition No. IZKJ on May 3, 2005.
INDUSTRIAL AVAILABILITY
As described in. detail through the above example, the present invention relates to a method for crystallizing a CMY-IO being a β-lactamase with extended-substrate spectrum, a crystal of CMY-10, and a crystal structure of CMY-10. With utilization of three-dimensional structure of CMY-10 protein as the above description, it is possible to develop novel antibiotics or- inhibitors being capable of preventing an emergence of resistance bacteria appeared by plasmidic class C β-lactamases-having extended-substrate specificity, therefore the present invention is very useful in medical industry.

Claims

1. Three-dimensional structure of CMY-IO protein being characterized in that it is constructed with α-domain and α/β-domain, and has extended-substrate specificity for third-generation cephalosporins due to extension of the active site, Rl and R2 site, and is formed by space coordinates deposited to PDB (Protein Data Bank) with deposition No. IZKJ.
2. Use of CMY-IO protein structure according to claim 1 for developing novel antibiotics or inhibitors being capable of preventing an emergence of resistance bacteria appeared by plasmidic'class C β-lactamases having extended- substrate specificity.
PCT/KR2005/002400 2004-07-26 2005-07-25 The crystal structure of cmy-10, a beta-lactamase causing antibiotic resistance with extended-substrate spectrum WO2006011736A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US11/659,244 US7709237B2 (en) 2004-07-26 2005-07-25 Crystal structure of CMY-10, a β-lactamase causing antibiotic resistance with extended-substrate spectrum
US12/695,810 US7919267B2 (en) 2004-07-26 2010-01-28 Method for Identifying an inhibitor of plasmidic classic C beta-lactamase having extended-substrate specifity

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR10-2004-0058283 2004-07-26
KR1020040058283A KR20060009624A (en) 2004-07-26 2004-07-26 The crystal structure of cmy-10, a beta-lactamase with extended-substrate spectrum
KR1020050041342A KR100700743B1 (en) 2004-07-26 2005-05-17 - - 3 The crystal structure of CMY-10 a beta-lactamase causing antibiotic resistance with extended-substrate spectrum
KR10-2005-0041342 2005-05-17

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US11/659,244 A-371-Of-International US7709237B2 (en) 2004-07-26 2005-07-25 Crystal structure of CMY-10, a β-lactamase causing antibiotic resistance with extended-substrate spectrum
US12/695,810 Division US7919267B2 (en) 2004-07-26 2010-01-28 Method for Identifying an inhibitor of plasmidic classic C beta-lactamase having extended-substrate specifity

Publications (1)

Publication Number Publication Date
WO2006011736A1 true WO2006011736A1 (en) 2006-02-02

Family

ID=35786445

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2005/002400 WO2006011736A1 (en) 2004-07-26 2005-07-25 The crystal structure of cmy-10, a beta-lactamase causing antibiotic resistance with extended-substrate spectrum

Country Status (1)

Country Link
WO (1) WO2006011736A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2948549A4 (en) * 2013-05-21 2016-12-07 Ind And Acad Coop Found Myongji Univ Primers and kits for colony multiplex pcr for the detection of class a, b, c, and d b-lactamase genes and methods of using thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
LEE S.-J. ET AL: "Crystallization and preliminary X-ray crystallographic analyses of CMY-1 and CMY-10, plasmidic class C beta-lactamases with extended substrate spectrum", ACTA CRYSTALLOGRAPHICA, vol. D60, 2 February 2004 (2004-02-02), pages 382 - 384 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2948549A4 (en) * 2013-05-21 2016-12-07 Ind And Acad Coop Found Myongji Univ Primers and kits for colony multiplex pcr for the detection of class a, b, c, and d b-lactamase genes and methods of using thereof

Similar Documents

Publication Publication Date Title
Murphy et al. Crystal structure of Pseudomonas aeruginosa SPM-1 provides insights into variable zinc affinity of metallo-β-lactamases
Sun et al. Comparison of β‐lactamases of classes A and D: 1.5‐Å crystallographic structure of the class D OXA‐1 oxacillinase
Yun et al. Crystal structure and allosteric regulation of the cytoplasmic Escherichia coli L-asparaginase I
Wang et al. Crystal structure and activity studies of the Mycobacterium tuberculosis β-lactamase reveal its critical role in resistance to β-lactam antibiotics
Ullah et al. The crystal structure of the L1 metallo-β-lactamase from Stenotrophomonas maltophilia at 1.7 Å resolution
Garcıa-Sáez et al. Three-dimensional structure of FEZ-1, a monomeric subclass B3 metallo-β-lactamase from Fluoribacter gormanii, in native form and in complex with D-captopril
Maveyraud et al. Insights into class D β-lactamases are revealed by the crystal structure of the OXA10 enzyme from Pseudomonas aeruginosa
Davlieva et al. Biochemical characterization of cardiolipin synthase mutations associated with daptomycin resistance in enterococci
Paetzel et al. Crystal structure of the class D β-lactamase OXA-10
Bou et al. Design, synthesis, and crystal structures of 6-alkylidene-2′-substituted penicillanic acid sulfones as potent inhibitors of Acinetobacter baumannii OXA-24 carbapenemase
Yoshida et al. Crystal structures of penicillin-binding protein 3 (PBP3) from methicillin-resistant Staphylococcus aureus in the Apo and cefotaxime‐bound forms
Sandy et al. The structure of arylamine N-acetyltransferase from Mycobacterium smegmatis—an enzyme which inactivates the anti-tubercular drug, isoniazid
Heikinheimo et al. The structure of bovine lysosomal α-mannosidase suggests a novel mechanism for low-pH activation
Kishida et al. Crystal structure of penicillin binding protein 4 (dacB) from Escherichia coli, both in the native form and covalently linked to various antibiotics
Ibuka et al. Crystal structure of extended-spectrum β-lactamase Toho-1: insights into the molecular mechanism for catalytic reaction and substrate specificity expansion
Dementieva et al. Pentameric assembly of potassium channel tetramerization domain-containing protein 5
Vincent et al. Multifunctional xylooligosaccharide/cephalosporin C deacetylase revealed by the hexameric structure of the Bacillus subtilis enzyme at 1.9 Å resolution
Cozzi et al. Structure analysis and site-directed mutagenesis of defined key residues and motives for pilus-related sortase C1 in group B Streptococcus
Cha et al. Structural basis for the β‐lactamase activity of EstU1, a family VIII carboxylesterase
Tassoni et al. New conformations of acylation adducts of inhibitors of β-lactamase from Mycobacterium tuberculosis
Smith et al. Crystal structure of carbapenemase OXA-58 from Acinetobacter baumannii
Kerff et al. Crystal structure of the sensor domain of the BlaR penicillin receptor from Bacillus licheniformis
Delbrück et al. Kinetic and crystallographic studies of extended-spectrum GES-11, GES-12, and GES-14 β-lactamases
Oueslati et al. Role of arginine 214 in the substrate specificity of OXA-48
US7919267B2 (en) Method for Identifying an inhibitor of plasmidic classic C beta-lactamase having extended-substrate specifity

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KM KP KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NG NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SM SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU LV MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase
WWE Wipo information: entry into national phase

Ref document number: 11659244

Country of ref document: US