WO2006007857A1 - Bilf1, a constitutive active g-protein coupled receptor - Google Patents

Bilf1, a constitutive active g-protein coupled receptor Download PDF

Info

Publication number
WO2006007857A1
WO2006007857A1 PCT/DK2005/000509 DK2005000509W WO2006007857A1 WO 2006007857 A1 WO2006007857 A1 WO 2006007857A1 DK 2005000509 W DK2005000509 W DK 2005000509W WO 2006007857 A1 WO2006007857 A1 WO 2006007857A1
Authority
WO
WIPO (PCT)
Prior art keywords
amino acid
receptor
herpesvirus
identity
constitutively active
Prior art date
Application number
PCT/DK2005/000509
Other languages
French (fr)
Inventor
Thomas Nitschke Kledal
Jesper Eugen-Olsen
Sarah Paulsen
Mette Rosenkilde
Original Assignee
Hvidovre Hospital
Københavns Universitet
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Hvidovre Hospital, Københavns Universitet filed Critical Hvidovre Hospital
Publication of WO2006007857A1 publication Critical patent/WO2006007857A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/566—Immunoassay; Biospecific binding assay; Materials therefor using specific carrier or receptor proteins as ligand binding reagents where possible specific carrier or receptor proteins are classified with their target compounds
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
    • G01N33/56983—Viruses
    • G01N33/56994—Herpetoviridae, e.g. cytomegalovirus, Epstein-Barr virus
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/16011—Herpesviridae
    • C12N2710/16211—Lymphocryptovirus, e.g. human herpesvirus 4, Epstein-Barr Virus
    • C12N2710/16222—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/705—Assays involving receptors, cell surface antigens or cell surface determinants
    • G01N2333/72—Assays involving receptors, cell surface antigens or cell surface determinants for hormones
    • G01N2333/726—G protein coupled receptor, e.g. TSHR-thyrotropin-receptor, LH/hCG receptor, FSH
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00—Screening for compounds of potential therapeutic value

Definitions

  • the present invention relates to a novel constitutively active G protein coupled receptor of ⁇ l-herpesviruses.
  • the invention further relates to a method for identifying a compound capable of modifying a signal of the constitutively active G protein coupled receptor of a ⁇ l- herpesvirus, to a method for identifying a ⁇ l-herpesvirus in a mammal, to a method for modifying the signal of the constitutively active G protein coupled receptor in a ⁇ l- herpesvirus infected mammal, and to a method of treating a ⁇ l-herpesvirus related disease.
  • GPCRs guanine nucleotide-binding protein-coupled receptors
  • ⁇ - and ⁇ -herpesviruses have acquired GPCRs, some of which are functional chemokine receptors. While all members of the ⁇ -herpesvirus family, e.g. cytomegalovirus (CMV) encode GPCR homologs, it is the general notion that ⁇ l-herpesviruses, e.g. EBV, unlike ⁇ 2-herpesviruses, e.g. Kaposis sarcoma associated herpesvirus (KSHV), do not encode GPCR homologs (Rickinson, A. and E. Kieff).
  • CMV cytomegalovirus
  • KSHV Kaposis sarcoma associated herpesvirus
  • GPCRs require agonist binding for activation.
  • Constitutive (or agonist- independent) signalling activity in mutant receptors has been well documented, but only a few GPCRs have been shown to exhibit agonist-independent activity in the wild type (or native) form.
  • vGPCR virus encoded GPCRs
  • UL33, M33, R33, UL78, M78, R78, US27 and US28 are dispensable for viral growth in tissue culture.
  • vGPCRs are highly significant for viral replication and for virus induced pathogenesis in the natural hosts.
  • Murine ⁇ HV68 ORF74 knock out virus for example suffers from decreased efficiency of reactivation from latency both in vitro and in vivo compared to wild type virus. This is surprising since ORF74 is regarded as an early lytic gene and is not expressed in the vast majority of otherwise latently infected cells. This suggests that lytic replication can transform latently infected cells, presumably through paracrine mechanisms. The activities and biological effects of the KSHV encoded chemokine receptor ORF74 are well characterized.
  • ORF74 is highly constitutively active and mediates its signals through several different Ga proteins and by activating ⁇ -subunits. As a result, ORF74 triggers several of the major signalling transduction pathways, including the phospholipase C (PLC) and protein kinase C pathways (PKC), the phosphoinosital-3'-kinase (PI3K) - AKT/protein kinase B (PKB) pathway, and the mitogen activated protein kinase (MAPK) pathways; JNK, p38 and p44/p42 MAPK.
  • PLC phospholipase C
  • PLC protein kinase C pathways
  • PI3K phosphoinosital-3'-kinase
  • AKT/protein kinase B PKT/protein kinase B
  • MAPK mitogen activated protein kinase
  • ORF74 induces various growth factors and angiogenic and proinflammatory cytokines.
  • VEGF vascular endothelial growth factor
  • ORF74 stimulates the proliferation of transfected cells and induce angiogenesis of human umbilical vein endothelial cells (HUVECs).
  • HUVECs human umbilical vein endothelial cells
  • Injection of ORF74 expressing mouse fibroblasts into the flank of nude mice causes vascularized tumors, and most significantly, transgenic mice expressing ORF74 ubiquitously or within hematopoietic or endothelial cells develop Kaposi's sarcoma (KS) -like lesions in multiple organs.
  • KS Kaposi's sarcoma
  • ORF74 is considered the key viral oncogene in KS pathogenesis.
  • the EBV genome was sequenced and annotated twenty years ago (Baer, R., et al.).
  • the EBV annotation is based on a BamHI fragments, and the BILFl ORF is localized to the small I BamHI-fragment.
  • At least two lytic transcripts, a 1.1kb and a 1.4 kb transcript, are known to be expressed from this region (Hummel, M. and E. Kieff).
  • Epstein-Barr virus is a human gammaherpesvirus that causes severe and sometimes lethal lymphoproliferative diseases, such as Hodgkin's disease, which is the most common lymphoma in the Western world.
  • BILF-I encodes a GPCR which constitutively signals through G ⁇ (alpha) proteins of the i-class (G ⁇ i), and describes that the oncogenicy of the ⁇ l-herpesviruses like ⁇ 2-herpesviruses may be due to constitutively active GPCRs, thus BILF-I is a target for drug discovery of ⁇ l-herpesviruses related diseases.
  • the present application thus relates to a method for identifying a compound capable of modifying a signal of a constitutively active G protein coupled receptor of a ⁇ l-herpesvirus, said method comprising a) contacting the constitutively active G protein coupled receptor or a functional part thereof with a compound to be screened, and b) determining whether the signal of said constitutively active G protein coupled receptor or a functional part thereof is modified by said compound.
  • the invention further provides a method for identifying a ⁇ l-herpesvirus in a mammal, said method comprising determining the presence of a constitutively active G protein coupled receptor of a ⁇ l-herpesvirus in a sample obtained from said mammal.
  • the invention relates to a method for identifying a ⁇ l-herpesvirus in a mammal, said method comprising a) determining the level of a constitutively active G protein coupled receptor of a ⁇ l-herpesvirus in a sample obtained from said mammal, and b) evaluating the level of said constitutively active G protein coupled receptor measured in step (a) relative to a reference value for said receptor of said mammal.
  • Another aspect of the present invention relates to a method for modifying the signal of a constitutively active G protein coupled receptor in a ⁇ l-herpesvirus infected mammal, comprising administrating, to the mammal, a compound capable of specifically binding to said constitutively active G protein coupled receptor, the compound being administered in an amount effective to modify the signal.
  • the invention also provides a method of treating or preventing a ⁇ l-herpesvirus related disease comprising modifying a constitutively active G protein coupled receptor of the ⁇ l- herpesvirus.
  • operably linked refers to the covalent joining of two or more nucleotide sequences, by means of enzymatic ligation or otherwise, in a configuration relative to one another such that the normal function of the sequences can be performed.
  • the nucleotide sequence encoding a presequence or secretory leader is operably linked to a nucleotide sequence for a polypeptide if it is expressed as a preprotein that participates in the secretion of the polypeptide: a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence; a ribosome binding site is operably linked to a coding sequence if it is positioned so as to facilitate translation.
  • operably linked means that the nucleotide sequences being linked are contiguous and, in the case of a secretory leader, contiguous and in reading phase. Linking is accomplished by ligation at convenient restriction sites. If such sites do not exist, then synthetic oligonucleotide adaptors or linkers are used, in conjunction with standard recombinant DNA methods.
  • control sequences is defined herein to include all components, which are necessary or advantageous for the expression of a polypeptide of the present invention.
  • Each control sequence may be native or foreign to the nucleotide sequence encoding the polypeptide.
  • control sequences include, but are not limited to, a leader, polyadenylation sequence, propeptide sequence, promoter, signal peptide sequence, and transcription terminator.
  • the control sequences include a promoter, and transcriptional and translational stop signals.
  • the control sequences may be provided with linkers for the purpose of introducing specific restriction sites facilitating ligation of the control sequences with the coding region of the nucleotide sequence encoding a polypeptide.
  • expression vector covers a DNA molecule, linear or circular, that comprises a segment encoding a polypeptide, and which is operably linked to additional segments that provide for its transcription.
  • host cell includes any cell type which is susceptible to transformation with a nucleic acid construct.
  • Kd The Kd value is the equilibrium dissociation constant: K-! [L] x [R]
  • K -1 dissociation rate constant
  • K +1 association rate constant
  • IC50 The inhibition concentration 50%, the IC50 value is the concentration of an inhibitor ligand that reduces the binding of a radio- (labelled) ligand/substrate with 50%
  • the present application describes that the EBV encoded ORF, BILFl encodes a functional GPCR.
  • BILFl contained several hallmarks of GPCRs, including seven hydrophobic trans-membrane domains, conserved cysteines in the amino terminal and in the extra cellular loops, amino-terminal glycosylation sites and intracellular phosphorylation sites, and thus set out to test, whether BILFl was a functional GPCR.
  • BILFl is expressed as a heavily glycosylated membrane protein and that BILFl is a highly potent GPCR, constitutively signalling through Ga 1 .
  • BILF-I influence cellular transformation and oncogenesis, a process conventionally believed to be associated with latent genes only.
  • BILF-I is therefore a target for intervention against e.g. endemic Burkitt's lymphoma, nasopharyngeal carcinoma, Hodgkin's disease, gastric carcinoma, leiomyosarcoma and AIDS- and transplant- associated B cell lymphomas.
  • the present invention relates to a method for identifying a compound capable of modifying a signal of a constitutively active G protein coupled receptor of a ⁇ l-herpesvirus, said method comprising
  • the present invention relates to a method according to the present invention, wherein said ⁇ l-herpesvirus is an Epstein-Barr virus.
  • said ⁇ l-herpesvirus is a human Epstein-Barr virus.
  • Herpesviridae Membership in the family Herpesviridae is based on the architecture of the virion.
  • the members of the family Herpesviridae were initially classified into three subfamilies, the Alphaherpesvirinae, the Betaherpesvirinae, and the Gammaherpesvirinae on the basis of biologic properties.
  • Gamma herpesvirus The experimental host range of the members of the subfamily Gammaherpesvirinae is limited to the family or order to which the natural host belongs. In vitro, all members replicate in lymphoblastoid cells, and some also cause lytic infections in some types of epithelioid and fibroblastic cells. Viruses in this group are usually specific for either T or B lymphocytes. Latent virus is frequently demonstrated in lymphoid tissue. This subfamily contains two genera: ⁇ l-herpesvirus (Lymphocryptovirus) , and ⁇ 2-herpesvirus (Rhadinovirus). ⁇ l -herpesvirus
  • EBV is the only presently known human ⁇ l-herpesvirus
  • KSHV Kaposi's sarcoma-associated herpesvirus
  • the ⁇ l-herpesvirus genomes are very similar to each other in structure and gene organization. In general, their DNAs are composed of colinearly homologous sequences.
  • the ⁇ l-herpesvirus share structural features such as similar 0.5-kbp terminal (TR), 3-kbp internal (IRl), and short internal (IR2, IR4) tandem direct repeats.
  • TR 0.5-kbp terminal
  • IRl 3-kbp internal
  • IR2, IR4 short internal tandem direct repeats.
  • the ⁇ l-herpesvirus open reading frames (ORFs) also encode colinearly homologous, antigenically related, structural and nonstructural proteins.
  • ⁇ l-herpesvirus genomes include genes that are shared by most herpesviruses, genes that are shared among gamma herpesviruses but not with other herpesviruses, and a number of genes that are characteristic only of ⁇ l-herpesvirus, including homologs of EBV BALFl, BILFl, EBNA-I, BZLFl, BZLF2 and gp350.
  • ⁇ l-herpesvirus and ⁇ 2-herpesvirus are clearly distinct genera.
  • the sequence homology between e.g. EBV and KSHV is insufficient to detect significant cross-reactive antibody or T-cell responses.
  • Primates including humans can be persistently systemically infected by viruses of both genera.
  • ⁇ l-herpesvirus are able to efficiently immortalise B lymphocytes of their natural host, ⁇ 2-herpesvirus lack similar activity.
  • EBV variants EBV-I and EBV-2 differ markedly in several nuclear antigen (EBNA) gene sequences.
  • EBNA nuclear antigen
  • the differences lead to differences in some biologic properties, including transforming potential.
  • the variants do not occupy distinct ecological niches, (b) the differences map to a small number of genes, and (c) intermediates carrying one variant allele at one locus and the other variant allele at another locus have been detected.
  • the EBV variants must be recognized as allelic variants of the same species.
  • Taxonomists have renamed EBV as human herpesvirus 4 (HHV4).
  • a constitutively active signal in a G protein coupled receptor may be modified by a ligand, such ligand may reduce or induce the signal of said receptor.
  • the present invention also relates to receptors according to the present invention, which can be modified by such ligands.
  • ligands can e.g. be agonists, neutral ligands or invers agonists (negative antagonists).
  • modifying the signal of a GPCR relates to altering the signal of said receptor, such as, reducing, blocking, inhibiting, or even enhancing said signal.
  • said modification could e.g. be mediated by a ligand.
  • G protein coupled receptor is a 7 transmembrane receptor that is able to couple to at least one GTP binding protein/GTPase (G protein).
  • a constitutively active G protein coupled relates to a G protein coupled receptor that mediates a signal without activation by a receptor ligand (agonist).
  • An active GPCR bind to at least one active G protein.
  • a G protein is active when it is bound to GTP. Hydrolysis of GTP to GDP regenerates the resting state of the G protein.
  • a ⁇ l-herpesvirus G protein coupled receptor according to the present invention comprises a G protein coupled receptor, which contains seven hydrophobic transmembrane domains and at least 4 conserved cysteins placed as follows:
  • receptors of the present invention all disclose a new distinct family and a dendrogram of herpesvirus encoded G protein-coupled receptors based on their amino acid identities are shown in figure 3.
  • such receptor comprises at least one nucleotide sequence selected from the group consisting of a) SEQ ID NO.: 1; and b) a sequence having at least 80% sequence identity to a)
  • such receptor comprises at least one nucleotide sequence sequence selected from the group consisting of a) SEQ ID NO.: 2-8 and b) a sequence having at least 80% sequence identity to a)
  • such receptor comprises at least one amino acid sequence selected from the group consisting of a) SEQ ID NO. : 9; and b) a sequence having at least 80% sequence identity to a)
  • such receptor comprises at least one amino acid sequence selected from the group consisting of a) SEQ ID NO.: 10-16 and b) a sequence having at least 80% sequence identity to a)
  • nt nucleotide number according to the given genbank sequence accession number
  • the present invention relates to a method according to the present invention, wherein said constitutively active G protein coupled receptor has at least 80% identity to the amino acid sequence of human BILF-I (SEQ ID NO: 9).
  • the constitutively active G protein coupled receptor has at least 95 % identity to amino acid sequence of human BILF-I (SEQ ID NO: 9).
  • the constitutively active G protein coupled receptor is encoded by a nucleotide sequence having at least 80% identity to the nucleotide sequence of human BILFl (SEQ ID NO: 1).
  • the term "at least 80% identity” relates to sequence similarities such as at least 81% identity, such as at least 82% identity, such as at least 83% identity, such as at least 84% identity, such as at least 85% identity, such as at least 86% identity, such as at least 87% identity, such as at least 88% identity, such as at least 89% identity, such as at least 90% identity, such as at least 91% identity, such as at least 92% identity, such as at least 93% identity, such as at least 94% identity, such as at least 95% identity, such as at least 96% identity, such as at least 97% identity, such as at least 98% identity, such as at least 99% identity or even 100% identity.
  • nucleic acid or polypeptide sequences refers to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same, when compared and aligned for maximum correspondence, as measured using one of the following sequence comparison algorithms or by visual inspection.
  • Sequence identity is a measure of identity between polypeptides at the amino acid level and a measure of identity between nucleic acids at nucleotide level.
  • the protein sequence identity may be determined by comparing the amino acid sequence in a given position in each sequence when the sequences are aligned.
  • the nucleic acid sequence identity may be determined by comparing the nucleotide sequence in a given position in each sequence when the sequences are aligned To determine the percent identity of two amino acid sequences or of two nucleic acids, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in the sequence of a first amino acid or nucleic acid sequence for optimal alignment with a second amino or nucleic acid sequence).
  • the amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position.
  • the percent identity between the two sequences is a function of the number of identical positions shared by the sequences (i.e., % identity # of identical positions/total # of positions (e.g., overlapping positions) x 100). In one embodiment the two sequences are the same length.
  • only a part of the constitutively active G protein coupled receptor could be made accessible to the compound.
  • the N-terminal extracellular part of the receptor could be used as a target for screening of compounds for high affinity to that part of the receptor. High affinity hits could then subsequently be tested for binding to the whole receptor, e.g. expressed in cells.
  • the invention relates to a method, wherein the functional part of said receptor has at least 80 % identity such as e.g. at least 85%, or such as e.g. or such as e.g. 90%, or such as e.g. or such as e.g. 95 %, or such as e.g. at least 96%, or such as e.g. at least 97%, or such as e.g. at least 98%, or such as e.g. at least 99 % or such as e.g. 100% to an amino acid sequence selected from the group consisting of the amino acid sequence defined by amino acid No. 1 to amino acid No.
  • Candidate compound Various candidate compounds can be screened for their effectiveness as modulators of the constitutively active GPCRs of the present invention.
  • Candidate compounds can be, for example, traditional chemical compounds or peptides and any suitable test substance can be screened in the subject methods of the present invention.
  • Compounds of the present invention includes any such which is amenable to a screening technique.
  • Compounds of the present invention includes any such which is able to inhibit a possible natural ligand.
  • the "candidate compound” does not include compounds which were publicly known to be compounds selected from the group consisting of inverse agonist, agonist or antagonist to a receptor, as previously determined by an indirect identification process ("indirectly identified compound”); more preferably, not including an indirectly identified compound which has previously been determined to have therapeutic efficacy in at least one mammal; and, most preferably, not including an indirectly identified compound which has previously been determined to have therapeutic utility in humans.
  • Directly identifying or directly identified, in relationship to the phrase "candidate compound” shall mean the screening of a candidate compound against a constitutively activated receptor of the present invention, and assessing the compound efficacy of such compound. This phrase is, under no circumstances, to be interpreted or understood to be encompassed by or to encompass the phrase “indirectly identifying” or “indirectly identified”.
  • the compound modifies the signal of the constitutively active G protein coupled receptor or a functional part thereof by inhibiting said signal.
  • Inhibiting the constitutively active G protein coupled receptor of the ⁇ l-herpesvirus according to the present invention may also be obtained by blocking said receptor by a ligand as described above, or by destroying the overall receptor structure by e.g. enzymatic degradation, deglycosylation, or cleavage, or by inhibiting the expression of said receptor e.g. by using siRNA, synthetic antisense nucleotides or other strategies known to the skilled addressee, or by blocking the signal transduction e.g. specifically inhibiting the interaction between the receptor and the g-protein or the down stream pathways.
  • the present invention relates to a method according to the present invention, wherein the modification is a inhibition of the signal of at least 5%, such as at least 6% inhibition of the signal, such as at least 7% inhibition of the signal, such as at least 8% inhibition of the signal, such as at least 9% inhibition of the signal, such as at least 10% inhibition of the signal, such as at least 15% inhibition of the signal, such as at least 20% inhibition of the signal, such as at least 25% inhibition of the signal, such as at least 30% inhibition of the signal, such as at least 35% inhibition of the signal, such as at least 40% inhibition of the signal, such as at least 45% inhibition of the signal, such as at least 50% inhibition of the signal, such as at least 55% inhibition of the signal, such as at least 60% inhibition of the signal, such as at least 65% inhibition of the signal, such as at least 70% inhibition of the signal, such as at least 75% inhibition of the signal, such as at least 80% inhibition of the signal, such as at least 85% inhibition of the signal, such as at least
  • Inhibition of the signal can be measured by, but not limited to, one of the methods described below in the paragraph 'Screening for modulators'. Briefly, the constitutively active G protein coupled receptor of a ⁇ l-herpesvirus is made accessible to the compound, the compound to be screened is added to the receptor and contacting the receptor. The signal of said constitutively active G protein coupled receptor is then measured.
  • % inhibition of the signal can be calculated as:
  • background signal the signal measured in the assay of choice without addition/activation of the receptor
  • any search for therapeutic compounds should start by screening compounds against the ligand-independent active state.
  • Screening candidate compounds against the constitutively activated receptors of the present invention allows for the direct identification of candidate compounds which act at these receptors, without requiring any prior knowledge or use of the receptor's endogenous ligand.
  • By determining areas within the body where such receptors are expressed and/or over-expressed it is possible to determine related disease/disorder states which are associated with the expression and/or over-expression of these receptors; such an approach is disclosed in this application.
  • BILFl Human EBV encoded BILFl is glycosylated in the N-terminal. It has previously been descriped that receptor glycosylation can be important for a correct function of the protein. Especially ligand binding to a GPCR seems to be affected by alterations in receptor glycosylation. For example, it has been shown, that certain chemotactic cytokines (chemokines), e.g. chemokines binding to the CCR5 chemokine receptor, are dependent on receptor glycosylation to be able to bind and activate the receptor.
  • chemokines chemotactic cytokines
  • the present invention therefore comprises a method for specifically interfering with BILFl glycosylation, that being inhibiting receptor glycosylation, deglycosylating the receptor, or binding of a compound to the glycosylation moieties to inhibit the activity of the receptor or to inhibit the interaction of the receptor to a natural ligand.
  • the invention relates to a method wherein the compound is modifying the signal of the constitutively active G protein coupled receptor or a functional part thereof by interfering with receptor glycosylation.
  • modifying the signal of a GPCR relates to altering the signal of said receptor, such as, reducing, blocking, inhibiting, or even enhancing said signal.
  • the invention relates to a method, wherein the compound is modifying the signal of the constitutively active G protein coupled receptor or a functional part thereof by binding to the receptor or to a functional part thereof.
  • determining the affinity of a compound capable of binding to said receptor is a part of the herein presented screening method.
  • the invention relates to a method, wherein the compound binds to the constitutively active G protein coupled receptor or a functional part thereof with an affinity wherein the value of k, or k d is at most 1000 nM, such as e.g. at most 900 nM, or such as e.g. at most 800 nM, or such as e.g. at most 700 nM, or such as e.g. at most 600 nM, or such as e.g. at most 500 nM, or such as e.g. at most 400 nM, or such as e.g.
  • At most 300 nM or such as e.g. at most 250 nM, or such as e.g. at most 200 nM, or such as e.g. at most 150 nM, or such as e.g. at most 100 nM, or such as e.g. at most 90 nM, or such as e.g. at most 80 nM, or such as e.g. at most 70 nM, or such as e.g. at most 60 nM, or such as e.g. at most 50 nM, or such as e.g. at most 40 nM, or such as e.g. at most 30 nM, or such as e.g. at most 20 nM, or such as e.g. at most 10 nM.
  • Said affinity being obtained in a receptor binding assay.
  • the invention relates to a method, wherein the compound in a receptor binding assay exhibits an IC50 value of less than 1000 nM, such as e.g. less than 900 nM, or such as e.g. less than 800 nM, or such as e.g. less than 700 nM, or such as e.g. less than 600 nM, or such as e.g. less than 500 nM, or such as e.g. less than 400 nM, or such as e.g. less than 300 nM, or such as e.g. less than 200 nM, or such as e.g. less than 100 nM, or such as e.g.
  • less than 90 nM or such as e.g. less than 80 nM, or such as e.g. less than 70 nM, or such as e.g. less than 60 nM, or such as e.g. less than 50 nM, or such as e.g. less than 40 nM, or such as e.g. less than 30 nM, or such as e.g. less than 20 nM, or such as e.g. less than 10 nM.
  • Receptor binding assay can be selected from the group consisting of competition binding assay, saturation binding assay, fluorescence polarization assay, Biacore assay and surface plasmon resonance based assay as described further below.
  • One screening method could be a competition binding assay known to the skilled addressee, and a compound with an affinity higher than 50 nM are preferable.
  • These compounds may be antibodies, peptides, binders generated through phage display or chemical compound screening.
  • the present invention relates to a method for identifying a compound capable of modifying a signal of a constitutively active G protein coupled receptor of a ⁇ l-herpesvirus, wherein said method is adapted to a high-through- put screening system.
  • the present invention relates to a method for identifying a ⁇ l-herpesvirus in a mammal, said method comprising determining the presence of a constitutively active G protein coupled receptor of a ⁇ l-herpesvirus in a sample obtained from said mammal.
  • a constitutively active G protein coupled receptor of a ⁇ l-herpesvirus in a sample obtained from said mammal.
  • the presence of BILF-I in patients with ⁇ l-herpesvirus related diseases such as e.g. Post transplant lymphoproliferative disease, nasopharayngeal carcinoma, non Hodgkin lymphoma, burkitt's lymphoma and Gastric carcinoma is shown in the examples.
  • the invention relates to a method for identifying a ⁇ l-herpesvirus in a mammal, said method comprising
  • step (b) evaluating the level of said constitutively active G protein coupled receptor measured in step (a) relative to a reference value for said receptor of said mammal.
  • the mammal has the risk of developing malignant transformation and/or tumorgenesis.
  • the ⁇ l-herpesvirus is an Epstein-Barr virus. In a preferred embodiment, the ⁇ l-herpesvirus is a human Epstein-Barr virus.
  • the constitutively active G protein coupled receptor has at least 80% identity to amino acid sequence of human BILF-I (SEQ ID NO: 9), such as e.g. at least 85 % identity, or such as e.g. at least 90 % identity, or such as e.g. at least 91 % identity, or such as e.g. at least 92 % identity, or such as e.g. at least 93% identity, or such as e.g. at least 94 % identity, or such as e.g. at least 95% identity, or such as e.g. at least 96 % identity, or such as e.g. at least 97 % identity, or such as e.g. at least 98 % identity, or such as e.g. at least 99 % identity, or such as e.g. 100 % identity.
  • SEQ ID NO: 9 amino acid sequence of human BILF-I
  • the constitutively active G protein coupled receptor is encoded by a nucleotide sequence having at least 80% identity to the nucleotide sequence of human BILFl (SEQ ID NO: 1) such as e.g. at least 85 % identity, or such as e.g. at least 90 % identity, or such as e.g. at least 91 % identity, or such as e.g. at least 92 % identity, or such as e.g. at least 93% identity, or such as e.g. at least 94 % identity, or such as e.g. at least 95% identity, or such as e.g. at least 96 % identity, or such as e g.
  • the level of said constitutively active G protein coupled receptor measured in step (a) is increased at least 5 % compared to the reference value for the receptor of said mammal, such as e.g. at least 10 %, or such as e.g. at least 15 %, or such as e.g. at least 20 %, or such as e.g. at least 25 %, or such as e.g. at least 30 %, or such as e.g. at least 35 %, or such as e.g.
  • At least 40 % or such as e.g. at least 50%, or such as e.g. at least 60 %, or such as e.g. at least 70%, or such as e.g. at least 80 , or such as e.g. at least 90 %, or such as e.g. at least 100 % compared to the reference value for the receptor of said mammal.
  • the receptor expression level correlates to the risk for malignant transformation and tumorgenesis in the infected mammals, and thus all cancer diseases related to EBV infection are within the scope of malignant transformation described herein.
  • the means for evaluating the detectable level of a constitutively active G protein coupled receptor in a sample obtained from said mammal measured involves a reference or reference means.
  • the reference also makes it possible to count in assay and method variations, kit variations, handling variations and other variations not related directly or indirectly to level of a constitutively active G protein coupled receptor.
  • the reference value is a value which has been determined by measuring the level of said constitutively active G protein coupled receptor in both a healthy control population and a population with known ⁇ l-herpesvirus associated disease thereby determining the reference value which identifies the ⁇ l-herpesvirus associated disease population with either a predetermined specificity or a predetermined sensitivity based on an analysis of the relation between the level of said constitutively active G protein coupled receptor and the known clinical data of the healthy control population and the ⁇ l-herpesvirus associated disease patient population.
  • the reference value determined in this manner is valid for the same experimental setup in future individual tests.
  • the ideal screening test is a test that has 100% specificity, i.e., only detects diseased individuals and therefore no false positive results, and 100% sensitivity, i.e., detects all diseased individuals and therefore no false negative results.
  • 100% specificity i.e., only detects diseased individuals and therefore no false positive results
  • 100% sensitivity i.e., detects all diseased individuals and therefore no false negative results.
  • the chosen specificity determines the percentage of correctly identified negative cases (i.e., disease free) and false positive cases that can be accepted in a given study/population and by a given institution. By decreasing specificity, an increase in sensitivity is achieved.
  • a 95% specificity for a 100 individuals screening sample means that 5 individuals will undergo further physical examination in order to detect one (1) ⁇ l-herpesvirus associated disease case if the sensitivity of the test is 100%.
  • a way of using the information obtained by measuring the level of the bio-markers, such as the level of a constitutively active G protein coupled receptor, of the present invention to identify the discriminating value is comprised by the following steps:
  • ROC receiver operating characteristics
  • the term "reference” relates to a standard in relation to quantity, quality or type, against which other values or characteristics can be compared, such as e.g. a standard curve.
  • the reference means is an internal reference means and/or an external reference means.
  • the term "internal reference means” relates to a reference which is not handled by the user directly for each determination but which is incorporated into a device for the determination of the level of a constitutively active G protein coupled receptor, whereby only the 'final result 1 or the 'final measurement' is presented.
  • the terms the "final result” or the “final measurement” relates to the result presented to the user when the reference value has been taken into account.
  • the internal reference means is provided in connection to a device used for the determination of the level of a constitutively active G protein coupled receptor.
  • the term "external reference means” relates to a reference which is handled directly by the user in order to determine the level of a constitutively active G protein coupled receptor, before obtaining the 'final result' or the 'final measurement'.
  • external reference means are selected from the group consisting of a table, a diagram and similar reference means where the user can compare the measured signal to the selected reference means.
  • the external reference means relate to a reference used as a calibration, value reference, information object, etc. for the level of a constitutively active G protein coupled and which has been excluded from the device used.
  • a G protein receptor When a G protein receptor becomes constitutively active, it binds to a G protein (e.g., Gq, Gs, Gi/o and G12/13) and stimulates the binding of GTP to the G protein.
  • a constitutively active receptor is contained in a active conformation that preferably allows interactions with already activated (GTP-bound) G proteins.
  • the G protein then acts as a GTPase and hydrolyzes the GTP to GDP, whereby the receptor, under normal conditions, becomes deactivated.
  • constitutively activate receptors continue to interact with (and/oractivate) active G-proteins.
  • G proteins can be quite bewildering.
  • Gi, G ⁇ i, Gi/o and G ⁇ i/o all relates to the same class, whereas Gq, Gs and G12/13 are distinct classes.
  • the invention relates to a method, wherein the constitutive activity is mediated though G ⁇ i.
  • One aspect of the present invention relates to a method for modifying the signal of a constitutively active G protein coupled receptor in a ⁇ l-herpesvirus infected mammal e.g. having a risk of developing a ⁇ l-herpesvirus associated disease, comprising administrating, to the mammal, a substance capable of specifically binding to said constitutively active G protein coupled receptor, the substance being administered in an amount effective to modify the signal.
  • the compound is as defined above.
  • ORF74 mediated activity for ⁇ 2 herpesvirus replication and thereby develop.
  • the present inventors have surprisingly discovered that a similar mechanism is in fact responsible for the oncogenic ⁇ l-herpesviruses.
  • BILF-I influence cellular transformation and oncogenesis, a process normally associated with latent genes only. BILF-I is therefore a target for ⁇ l-herpesvirus related diseases such as but no limited to
  • XiIi T and NK cell lymphomas xiv. Nasopharyngeal carcinoma xv. Undifferentiated carcinomas of nasopharyngeal type (UCNT) xvi. Gastric carcinomas
  • XVIi Follicular dendritic cell tumors and of inflammatory "pseudotumorsor other diseases known to the skilled addressee. Table 2 shows detailed descriptions of some of the mentioned diseases.
  • Gastric UCNT >30 y post-EBV 100 carcinoma Adenocarcinoma >30 y post-EBV 5-15 EBNAl, LMP2 I/II
  • T-cell VAHS-asso ⁇ ated 1-2 y post-EBV 100 lymphoma Nasal NK and T-cell >30 y post-EBV 100 EBNAl, [LMPl] LMP2 I/II
  • PTLD-iike Immunodeficiency ⁇ 3 mo post-EBV 100 lymphoma Posttransplantation ⁇ 1 y posttransplantation >90 EBNA 1, 2, 3A, 3B, 3C, III
  • AIDS-associated posttransplantation ?100 ? ⁇ 3y post EBV a Typ ⁇ cal latent period between EBV infection and tumor development, or where appropriate, between onset of T cell impaiment (transplantation or HIV infection) and tumor development
  • leiomyosarcoma is a tumor typically seen in infants who are congenitally immunodeficient or who were transplanted or became HIV infected early in infancy
  • Percentage of tumors that are EVB genome positive e g , sporadic Burkitt s lymphoma, keratinizing nasopharyngeal carcinoma
  • the strength of the EBV association varies with geographic location, hence the wide percentage range
  • c Ant ⁇ gen expression is identified by monoclonal antibody staining or is inferred from analysis of latent gene transcripts Where there is variability between tumors in terms of antigen status, the antigen is shown in brackets Note that in the case of immunoblastic lymphomas, monoclonal antibody staining may show som
  • AIDS acquired immunodeficiency syndrome
  • UCNT undifferentiated carcinomas of nasopharyngeal type
  • VAHS virus-associated hemophagocytic syndrome
  • NK natural killer cell
  • HIV human immunodeficiency virus
  • another aspect for the present invention relates to a method of treating or preventing a ⁇ l-herpesvirus related disease comprising modifying a constitutively active G protein coupled receptor of the ⁇ l-herpesvirus.
  • said modification of the signal is an inhibition of said signal.
  • the invention relates to a method of treating or preventing a ⁇ l-herpesvirus related disease comprising modifying a constitutively active G protein coupled receptor of the ⁇ l- herpesvirus, wherein the ⁇ l-herpesvirus related disease is selected from the group consisting of Infectious Mononucleosis, X-linked Lymphoprohferative Syndrome, Fatal Infectious Mononucleosis, Virus-Associated Hemophagocytic Syndrome, Chronic Active Epstein-Barr Virus Infection, Clinically Apparent Virus Replicative Lesions, Lymphomas in Congenitally Immunodeficient Patients, Posttransplantation Lymphomas / post-transplant lymphoprohferative disease (PTLD), Acquired Immunodeficiency Syndrome Lymphomas, Smooth Muscle Cell Tumors, Burkitt's lymphoma, Hodgkin's disease, B-cell lymphomas, T and NK cell lymphomas, Nasopharyngeal carcinoma, Undifferenti
  • the invention relates to a method of treating or preventing a ⁇ l- herpesvirus related disease comprising modifying a constitutively active G protein coupled receptor of the ⁇ l-herpesvirus, wherein the constitutively active G protein coupled receptor has at least 80% identity to the ammo acid sequence of human BILF-I (SEQ ID NO: 9) such as e.g. at least 85 % identity, or such as e.g. at least 90 % identity, or such as e.g. at least 91 % identity, or such as e.g at least 92 % identity, or such as e.g. at least 93% identity, or such as e.g. at least 94 % identity, or such as e.g.
  • identity at least 95% identity, or such as e.g. at least 96 % identity, or such as e.g. at least 97 % identity, or such as e.g. at least 98 % identity, or such as e.g. at least 99 % identity, or such as e.g. 100 % identity.
  • the invention relates to a method of treating or preventing a ⁇ l- herpesvirus related disease comprising modifying a constitutively active G protein coupled receptor of the ⁇ l-herpesvirus, wherein the constitutively active G protein coupled receptor is encoded by a nucleotide sequence having at least 80% identity to the nucleotide sequence of human BILFl (SEQ ID NO: 1) such as e.g. at least 85 % identity, or such as e.g. at least 90 % identity, or such as e.g. at least 91 % identity, or such as e.g. at least 92 % identity, or such as e.g. at least 93% identity, or such as e.g.
  • At least 94 % identity or such as e.g. at least 95% identity, or such as e.g. at least 96 % identity, or such as e.g. at least 97 % identity, or such as e.g. at least 98 % identity, or such as e.g. at least 99 % identity, or such as e.g. 100 % identity.
  • a ⁇ l-herpesvirus infected mammal having a risk of developing a ⁇ l- herpesvirus associated disease relates to any mammal that contains a component of the ⁇ l- herpesvirus, being DNA, RNA and/or protein components or that contains at least one antibody against a ⁇ l-herpesvirus viral protein and/or a T-cell response/TCR against a ⁇ l- herpesvirus specific epitope, and are in risk of developing a ⁇ l-herpesvirus associated disease e.g. such as diseases described herein.
  • Endogenous shall mean a material that a mammal naturally produces.
  • Endogenous in reference to, for example and not limitation, the term "receptor,” shall mean that which is naturally produced by a mammal (for example, and not limitation, a human) or a virus.
  • the term NON-ENDOGENOUS in this context shall mean that which is not naturally produced by a mammal (for example, and not limitation, a human) or a virus.
  • a receptor which is not constitutively active in its endogenous form, but when manipulated becomes constitutively active is most preferably referred to herein as a "non-endogenous, constitutively activated receptor.”
  • Both terms can be utilized to describe both "in vivo" and “in vitro” systems.
  • the endogenous or non-endogenous receptor may be in reference to an in vitro screening system.
  • screening of a candidate for example, and not limitation, where the genome of a mammal has been manipulated to include a non-endogenous constitutively activated receptor, screening of a candidate. [ 35 SJGTP.gamma.S assay
  • a non-hydrolyzable analog of GTP [ 3S S]GTP. gamma. S, can be used to monitor enhanced binding to membranes which express constitutively activated receptors. It is reported that [ 35 SJGTP.gamma.S can be used to monitor G protein coupling to membranes in the absence and presence of ligand (Harrison et al.).
  • G ⁇ q Phosporlipase C
  • PPC Phosporlipase C
  • PAG 1,2-diacylglycerol
  • IP3 inositol 1,4,5 triphosphate
  • IP3 further induce an increase in intracellular calcium that further leads to activation of NFAT.
  • PPC Protein kinase C
  • PLD phospholipase D
  • G ⁇ q also activates the phosphoinositide 3- kinase (PI3K) and generates phosphatidylinositol-3,4,5-triphosphate (PI3,4,5P3), which in turn activates the phosphoinositide dependent kinase 1 (PDKl) and the AKT protein kinase/Protein kinase B (PKB). AKT/PKB further activates IKK and NF- ⁇ B.
  • PI3K phosphoinositide 3- kinase
  • PI3,4,5P3 phosphatidylinositol-3,4,5-triphosphate
  • PDKl phosphoinositide dependent kinase 1
  • PKT protein kinase/Protein kinase B PKT protein kinase/Protein kinase B
  • Activated G protein of the s-class activates adenylyl cyclase (AC) which leads to the generation of cyclic APM (cAMP).
  • cAMP further activates the protein kinase A (PKA) which interacts with multible second messenger molecules, e.g the phosphodiesterase (PDE), c- Src ⁇ Papl GTPase ⁇ B-Raf ⁇ the mitogen activated protein kinase (MEK), the phosphorylase kinase, and the cyclic AMP response element binding protein (CREB) ⁇ CRE activation.
  • PDE protein kinase A
  • PDE protein kinase A
  • MEK mitogen activated protein kinase
  • CREB cyclic AMP response element binding protein
  • Activated G protein of the i-class inhibits adenylyl cyclase (AC) and thereby inhibits the generation of cyclic AMP (cAMP
  • Ga subunits leads to the dissociation of ⁇ -subunits.
  • the ⁇ subunits have multiple effects and activates several second messenger pathways, including MAPK, induction of intracellular calcium, activation of PLC and induction of multiple GTPases, including Rho.
  • a compound identified by the "generic" assay may not bind to the receptor, but may instead merely e.g. "uncouple” the G protein from the intracellular domain.
  • GPR3, GPR4, GPR6, GPR12, GPR21, GHSR, OGRl, RE2 and AL022171 it has been determined that these receptors couple the G protein Gs.
  • Gs stimulates the enzyme adenylyl cyclase (Gi, on the other hand, inhibits this enzyme).
  • Adenylyl cyclase catalyzes the conversion of ATP to cAMP; thus, because these receptors are activated in their endogenous forms, increased levels of cAMP are associated therewith (on the other hand, endogenously activated receptors which couple the Gi protein are associated with decreased levels of cAMP). See, generally, "Indirect Mechanisms of Synaptic Transmission,” Chpt. 8, From Neuron To Brain (3 rd Ed.) Nichols, J. G. et al eds. Sinauer Associates, Inc. (1992).
  • assays that detect cAMP can be utilized to determine if a candidate compound is an inverse agonist to the receptor i.e., such a compound which contacts the receptor would decrease the levels of cAMP relative to the uncontacted receptor.
  • cAMP cAMP-responsive DNA binding protein or transcription factor (CREB), which then binds to the promoter at specific sites called cAMP response elements and drives the expression of the gene.
  • Reporter systems can be constructed, which have a promoter containing multiple cAMP response elements before the reporter gene, e.g., ⁇ -galactosidase or luciferase.
  • an activated Gs receptor such as GPR3 causes the accumulation of cAMP which then activates the gene and expression of the reporter protein.
  • the reporter protein such as ⁇ -galactosidase or luciferase can then be detected using standard biochemical assays.
  • a cAMP assay is particularly preferred.
  • the foregoing specific assay approach can, of course, be utilized to initially directly identify candidate compounds, rather than by using the generic assay approach. Such a selection is primarily a matter of choice of the artisan, see also (Wainer et al.).
  • Detection of cAMP with Alpha Screen is based on competition between cAMP produced by cells and a biotinylated cAMP probe that is recognized by the streptavidin-Donor and anti- cAMP conjugated Acceptor beads. The beads are brought into proximity and a signal is detected. Increased intracellular concentrations of cAMP foilowsG ⁇ s coupled GPCR activation by an agonist results in the displacement of the biotinylated cAMP probe and leads to a proportional decrease in signal. The effect of antagonists and inverse (reverse) agonists can similarly be detected. GaI coupled receptor activation can be detected after prestimulating cells with forskolin or analogous compounds.
  • Fluorescence Polarization is an empirical fluorescence detection technique that measures the parallel and perpendicular components of fluorescence emission to the plane of a polarized excitation source. Polarization values (measured in mP units) for any fluorophore-labeled complex are inversely related to the speed of molecular rotation of that complex. Since molecular rotation is, in turn, inversely related to its molecular volume, a fluorescent tracer possesses a higher polarization value when it interacts with any molecule large enough to slow its rate of molecular rotation (e.g., an antibody). The magnitude of the polarization signal is thus used to quantitatively determine the extent of fluorescent tracer binding without the need for any filtration or wash separation step.
  • Generation of IP3 can be measured in whole cells, e.g COS-7 cells expressing or transfected with the GPCR of interest. One day after transfection the cells are transferred to assay-plates and incubated for 24 hours with myo-[3H]inositol (Amersham TRK911) in complete growth medium.
  • IP-buffer (20 mM HEPES buffer (pH 7.4) supplemented with 140 mM NaCI, 5 mM KCI, 1 mM MgSO4, 1 mM CaCI2, 10 mM glucose, and 0.05% (w/v) bovine serum albumin) and incubated in IP-buffer supplemented with 10 mM LiCI at 37°C for 90 min. After incubation the buffer was removed and accumulated inositol phosphates were extracted for 30 min on ice in 1.0 ml 1OmM formic acid. The generated [3H]inositol phosphates (IP3) were purified on Dowex 1X8 anion-exchange resin and radioactivity was counted in a scintillation counter. Radioactivity values are given as counts per minute (CPM).
  • IP3 [3H]inositol phosphates
  • IP3 Detection of IP3 with Alphascreen is based on the competition between IP3 produced by cells and a biotinylated IP3 analog (b-IP3) binding to a GST-tagged IP3 binding protein (GST-IP3 bp).
  • the b-IP3 and GST-IP3 bp are recognized by the streptavidin-Donor and anti-GST conjugated Acceptor beads, respectively. The beads are brought into proximity and a signal is detected. Increased intracellular concentrations of IP3 following GPCR activation by an agonist results in the displacement of the b-IP3 and leads to a proportional decrease in the signal.
  • an endogenous, constitutively activated GPCR for use in screening of candidate compounds for the direct identification of inverse agonists, agonists and partial agonists provides a unique challenge in that, by definition, the endogenous receptor is active even in the absence of an endogenous ligand bound thereto.
  • an approach be utilized that can enhance such differentiation.
  • a preferred approach is the use of a GPCR Fusion Protein.
  • an endogenous orphan GPCR is constitutively active, using the assay techniques set forth above (as well as others), it is possible to determine the predominant G protein that couples with the endogenous GPCR. Coupling of the G protein to the GPCR provides a signaling pathway that can be assessed. Because it is most preferred that screening take place by use of a mammalian expression system, such a system will be expected to have endogenous G protein therein. Thus, by definition, in such a system, the endogenous, constitutively active orphan GPCR will continuously signal.
  • this signal be enhanced such that in the presence of, e.g., an inverse agonist to the receptor, it is more likely that one will be able to more readily differentiate, particularly in the context of screening, between the receptor when it is or is not contacted with the inverse agonist.
  • the GPCR Fusion Protein is intended to enhance the efficacy of G protein coupling with the endogenous GPCR.
  • the GPCR Fusion Protein appears to be important for screening with an endogenous, constitutively activated GPCR because such an approach increases the signal that is most preferably utilized in such screening techniques. Facilitating a significant "signal to noise" ratio is important for the screening of candidate compounds as disclosed herein.
  • GPCR Fusion Protein The construction of a construct useful for expression of a GPCR Fusion Protein is within the purview of those having ordinary skill in the art. Commercially available expression vectors and systems offer a variety of approaches that can fit the particular needs of an investigator.
  • One important criterion for such a GPCR Fusion Protein construct is that the endogenous GPCR sequence and the G protein sequence both be in-frame (preferably, the sequence for the endogenous GPCR is upstream of the G protein sequence) and that the "stop" codon of the GPCR must be deleted or replaced such that upon expression of the GPCR, the G protein can also be expressed.
  • the GPCR can be linked directly to the G protein, or there can be spacer residues between the two (preferably no more than about 12, although this number can be readily ascertained by one of ordinary skill in the art).
  • the present inventors have evaluated both approaches, and in terms of measurement of the activity of the GPCR, the results are substantially the same; however, there is a preference (based upon convenience) of use of a spacer in that some restriction sites that are not used will, effectively, upon expression, become a spacer.
  • the G protein that couples to the endogenous GPCR will have been identified prior to the creation of the GPCR Fusion Protein construct. Because there are only a few G proteins that have been identified, it is preferred that a construct comprising the sequence of the G protein (i.e., a universal G protein construct) be available for insertion of an endogenous GPCR sequence therein; this provides for efficiency in the context of large-scale screening of a variety of different endogenous GPCRs having different sequences
  • BRET Bioluminiscence Resonance Energy Transfer
  • PerkinElmer BRETT is an advanced, non-destructive, assay technology that is designed to monitor protein-protein interactions and intracellular signalling events in living cells. This technology is based on the transfer of resonant energy from a bioluminescent donor protein to a fluorescent acceptor protein using e.g Renilla luciferase (Rluc) as the donor and a mutant of the Green Fluorescent Protein (GFP) as the acceptor molecule.
  • Rluc Renilla luciferase
  • GFP Green Fluorescent Protein
  • the BRET signal is generated by th eoxidation of e.g. DeepBlueC, a coelentarazine derivative that maximizes spectral resolution for better sensitivity.
  • the BRET technology is analogous to fluorescence resonance energy transfer (FRET), but eliminates the need for an excitationlight source and its associated problems.
  • a GPCR signal can be diverged from on G protein pathway (G ⁇ q, Gas, G ⁇ i, G ⁇ l2/13) to another by using chimeric G proteins consisting of e.g. G ⁇ qs5 and G ⁇ 6qi4myr are recombinant G ⁇ q proteins with switched receptor specificity from wild type G ⁇ q interacting GPCRs to Gas and G ⁇ i interacting receptors respectively; G ⁇ qs5 have replaced the 5 C- terminal amino acids of wild type G ⁇ q with the 5 corresponding C-terminal amino acids from Gas, and G ⁇ 6qi4myr lacks the first six N-terminal amino acids, have replaced the 4 C-terminal amino acids of wild type G ⁇ q with the corresponding 4 C-terminal amino acids from G ⁇ i, and include an N-terminal myristoylation site.
  • G ⁇ qs5 and G ⁇ 6qi4myr are recombinant G ⁇ q proteins with switched receptor specificity from wild type G ⁇ q interacting GPCRs to Gas and G ⁇ i interacting receptors respectively; G
  • a receptor that is signalling through e.g. G ⁇ i can then bind and activate recombinant G ⁇ q.
  • the signal mediated by the receptor, being ligand dependent or constitutive can be measures by a G ⁇ q activity assay such as the IP3-assay described above.
  • a receptor that is signalling through e.g. Gas can then bind and activate recombinant G ⁇ q.
  • the signal mediated by the receptor, being ligand dependent or constitutive can be measured by a G ⁇ q activity assay such as the IP3-assay described above, see also Milligan et a!.
  • Cyclic AMP drives gene expression by promoting the binding of a cAMP-responsive DNA binding protein or transcription factor (CREB) which then binds to the promoter at specific sites called cAMP response elements and drives the expression of the gene.
  • CREB cAMP-responsive DNA binding protein or transcription factor
  • Several GPCR with specificity towards both G ⁇ q, Gas, Gai, Gal2/13 activates distinct and overlapping transcription factors.
  • Gas activates the cAMP response element (CRE) (which is inhibited by G ⁇ i), G ⁇ i (and ⁇ subunits) activates Serum response element (SRE) and G ⁇ q activates API (fos/jun), NFAT and NF- ⁇ B.
  • Reporter systems can be constructed which have a promoter containing multiple transcription factor binding sites/response elements before the reporter gene, e.g., ⁇ -galactosidase, luciferase or GFP.
  • the reporter protein such as ⁇ -galactosidase or luciferase can then be detected using standard biochemical assays.
  • This invention encompasses splice variants of the BILFl gene.
  • the BILFl splice variant polypeptides including polypeptide fragments, homologs thereof, retain BILFl activity.
  • BILFl activity is to have a similar level of functional activity as the BILFl polypeptide. This activity includes but is not limited to, immunologic, oncogenic and pharmacological activity.
  • the invention further encompasses polynucleotides encoding functionally equivalent variants and derivatives of the BILFl splice variant polypeptides and functionally equivalent fragments thereof which may enhance, decrease or not significantly affect properties of the polypeptides encoded thereby.
  • the invention further encompasses the BILFl splice variant polynucleotide sequences contained in a vector molecule or an expression vector and operably linked to a promoter element if necessary.
  • the invention further comprises a complementary strand to the polynucleotide encoding the BILFl splice variant polypeptide.
  • the complementary strand may be a polymeric form of nucleotides of any length, which contain deoxyribonucleotides, ribonucleotides, and analogs in any combination.
  • the present invention also relates to a kit for use in an assay or method as defined in the present application.
  • the receptors described herein may be produced by any suitable method known in the art. Such methods include constructing a nucleotide sequence encoding the receptor and expressing the sequence in a suitable transformed or transfected host.
  • a nucleotide sequence encoding the receptors described herein may be constructed by isolating or synthesizing a nucleotide sequence encoding the desired receptor or a functional part thereof.
  • the nucleotide sequence may be prepared by chemical synthesis, e.g.
  • oligonucleotide synthesizer by using an oligonucleotide synthesizer, wherein oligonucleotides are designed based on the amino acid sequence of the desired recpetor, and preferably selecting those codons that are favored in the host cell in which the receptor will be produced.
  • oligonucleotides are designed based on the amino acid sequence of the desired recpetor, and preferably selecting those codons that are favored in the host cell in which the receptor will be produced.
  • several small oligonucleotides coding for portions of the desired receptor may be synthesized and assembled by PCR, ligation or ligation chain reaction (LCR).
  • LCR ligation or ligation chain reaction
  • the individual oligonucleotides typically contain 5' or 3' overhangs for complementary assembly.
  • nucleotide sequence encoding the desired receptor is inserted into a recombinant vector and operably linked to control sequences necessary for expression of the receptor in the desired transformed host cell.
  • vectors and expression control sequences function equally well to express the nucleotide sequence encoding the receptors described herein. Neither will all hosts function equally well with the same expression system. However, one of skill in the art may make a selection among these vectors, expression control sequences and hosts without undue experimentation. For example, in selecting a vector, the host must be considered because the vector must replicate in it or be able to integrate into the chromosome. The vector's copy number, the ability to control that copy number, and the expression of any other proteins encoded by the vector, such as antibiotic markers, should also be considered. In selecting an expression control sequence, a variety of factors should also be considered.
  • Hosts should be selected by consideration of their compatibility with the chosen vector, the toxicity of the product coded for by the nucleotide sequence, their secretion characteristics, their ability to fold the receptor correctly, and their fermentation or culture requirements.
  • the recombinant vector may be an autonomously replicating vector, i.e. a vector, which exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g. a plasmid.
  • the vector is one which, when introduced into a host cell, is integrated into the host cell genome and replicated together with the chromosome(s) into which it has been integrated.
  • the vector is preferably an expression vector, in which the nucleotide sequence encoding the desired recpetor is operably linked to additional segments required for transcription of the nucleotide sequence.
  • the vector is typically derived from plasmid or viral DNA. A number of suitable expression vectors for expression in the host cells mentioned herein are commercially available or described in the literature.
  • Useful expression vectors for eukaryotic hosts include, for example, vectors comprising expression control sequences from SV40, bovine papilloma virus, adenovirus and cytomegalovirus. Specific vectors are, e.g., pCDNA3.1(+) ⁇ Hyg (Invitrogen, Carlsbad, CA, USA) and pCI-neo (Stratagene, La JoIa, CA, USA).
  • Useful expression vectors for bacterial hosts include known bacterial plasmids, such as plasmids from E.
  • yeast cells include the 2 ⁇ plasmid and derivatives thereof, the POTl vector (US 4,931,373), the pJSO37 vector described in (Okkels, Ann. New York Acad. Sci.
  • Useful vectors for insect cells include pVL941, pBG311 (Cate et al., "Isolation of the Bovine and Human Genes for Mullerian Inhibiting Substance And Expression of the Human Gene In Animal Cells", Cell, 45, pp. 685-98 (1986), pBluebac 4.5 and pMelbac (both available from Invitrogen).
  • vectors for use in this invention include those that allow the nucleotide sequence encoding the receptors described herein to be amplified in copy number.
  • amplifiable vectors are well known in the art. They include, for example, vectors able to be amplified by DHFR amplification (see, e.g., Kaufman, U.S. Pat. No. 4,470,461, Kaufman and Sharp, "Construction Of A Modular Dihydrafolate Reductase cDNA Gene: Analysis Of Signals Utilized For Efficient Expression", MoI. Cell. Biol., 2, pp. 1304-19 (1982)) and glutamine synthetase ("GS”) amplification (see, e.g., US 5,122,464 and EP 338 841).
  • the recombinant vector may further comprise a DNA sequence enabling the vector to replicate in the host cell in question.
  • a DNA sequence enabling the vector to replicate in the host cell in question.
  • An example of such a sequence is the SV40 origin of replication.
  • suitable sequences enabling the vector to replicate are the yeast plasmid 2 ⁇ replication genes REP 1-3 and origin of replication.
  • the vector may also contain a selectable marker, e.g. a gene the product of which complements a defect in the host cell, such as the gene coding for dihydrofolate reductase (DHFR) or the Schizosaccharomyces pombe TPI gene (described by P. R. Russell, Gene 40, 1985, pp. 125-130), or one which confers resistance to a drug, e.g. ampicillin, kanamycin, tetracyclin, chloramphenicol, neomycin, hygromycin or methotrexate.
  • selectable markers include amdS. pyrG, arcB, niaP, sC.
  • expression control sequences may be used in the present invention.
  • useful expression control sequences include the expression control sequences associated with structural genes of the foregoing expression vectors as well as any sequence known to control the expression of genes of prokaryotic or eukaryotic cells or their viruses, and various combinations thereof.
  • control sequences for directing transcription in mammalian cells include the early and late promoters of SV40 and adenovirus, e.g. the adenovirus 2 major late promoter, the MT-I (metallothionein gene) promoter, the human cytomegalovirus immediate-early gene promoter (CMV), the human elongation factor l ⁇ (EF-l ⁇ ) promoter, the Drosophila minimal heat shock protein 70 promoter, the Rous Sarcoma Virus (RSV) promoter, the human ubiquitin C (UbC) promoter, the human growth hormone terminator, SV40 or adenovirus EIb region polyadenylation signals and the Kozak consensus sequence (Kozak, M. J MoI Biol 1987 Aug 20;196(4):947-50).
  • adenovirus 2 major late promoter e.g. the adenovirus 2 major late promoter, the MT-I (metallothionein gene) promoter, the human cytomegalo
  • a synthetic intron may be inserted in the 5' untranslated region of the nucleotide sequence encoding the receptor.
  • An example of a synthetic intron is the synthetic intron from the plasmid pCI-Neo (available from Promega Corporation, WI, USA).
  • control sequences for directing transcription in insect cells include the polyhedrin promoter, the PlO promoter, the Autographa californica polyhedrosis virus basic protein promoter, the baculovirus immediate early gene 1 promoter and the baculovirus 39K delayed-early gene promoter, and the SV40 polyadenyiation sequence.
  • control sequences for use in yeast host cells include the promoters of the yeast ⁇ -mating system, the yeast triose phosphate isomerase (TPI) promoter, promoters from yeast glycolytic genes or alcohol dehydogenase genes, the ADH2-4c promoter and the inducible GAL promoter.
  • TPI yeast triose phosphate isomerase
  • suitable control sequences for use in filamentous fungal host cells include the ADH3 promoter and terminator, a promoter derived from the genes encoding Aspergillus oryzae TAKA amylase triose phosphate isomerase or alkaline protease, an A. niger ⁇ - amylase, A. niger or A. nidulans glucoamylase, A. nidulans acetamidase, Rhizomucor miehei aspartic proteinase or lipase, the TPIl terminator and the ADH3 terminator.
  • suitable control sequences for use in bacterial host cells include promoters of the lac system, the trp system, the TAC or TRC system and the major promoter regions of phage lambda.
  • the nucleotide sequence may or may not also include a nucleotide sequence that encode a signal peptide.
  • the signal peptide is present when the receptor is to be secreted from the cells in which it is expressed. Such signal peptide, if present, should be one recognized by the cell chosen for expression of the polypeptide variant.
  • the signal peptide may be homologous (e.g. be that normally associated with the receptor) or heterologous (i.e. originating from another source than the receptor) to the receptor or may be homologous or heterologous to the host cell, i.e. be a signal peptide normally expressed from the host cell or one which is not normally expressed from the host cell.
  • the signal peptide may be prokaryotic, e.g. derived from a bacterium such as E. coli, or eukaryotic, e.g. derived from a mammalian, or insect or yeast cell.
  • any suitable host may be used to express the receptors described herein, including bacteria, fungi (including yeasts), plant, insect, mammal, or other appropriate animal cells or cell lines, as well as transgenic animals or plants.
  • the host cell is an eukaryotic host cell, such as a mammalian host cell capable of glycosylation.
  • bacterial host cells include grampositive bacteria such as strains of Bacillus, e.g. B. brevis or B. subtilis, Pseudomonas or Streptomyces , or gramnegative bacteria, such as strains of E. coli.
  • the introduction of a vector into a bacterial host cell may, for instance, be effected by protoplast transformation (see, e.g., Chang and Cohen, 1979, Molecular General Genetics 168: 111-115), using competent cells (see, e.g., Young and Spizizen, 1961, Journal of Bacteriology 81: 823-829, or Dubnau and Davidoff-Abelson, 1971, Journal of Molecular Biology 56: 209-221), electroporation (see, e.g., Shigekawa and Dower, 1988, Biotechniques 6: 742-751), or conjugation (see, e.g., Koehler and Thome, 1987, Journal of Bacteriology 169: 5771-5278).
  • protoplast transformation see, e.g., Chang and Cohen, 1979, Molecular General Genetics 168: 111-115
  • competent cells see, e.g., Young and Spizizen, 1961, Journal of Bacteriology 81: 823-829, or Dubn
  • filamentous fungal host cells examples include strains of Aspergillus, e.g. A. oryzae, A. niger, or A. nidulans, Fusarium or Trichoderma.
  • Fungal cells may be transformed by a process involving protoplast formation, transformation of the protoplasts, and regeneration of the cell wall in a manner known per se.
  • Suitable procedures for transformation of Aspergillus host cells are described in EP 238 023 and US 5,679,543.
  • Suitable methods for transforming Fusarium species are described by Malardier et al., 1989, Gene 78: 147-156 and WO 96/00787.
  • Yeast may be transformed using the procedures described by Becker and Guarente, In Abelson, 3. N.
  • yeast host cells examples include strains of Saccharomyces, e.g. S. cerevisiae, Schizosaccharomyces, Kluyveromyces, Pichia, such as P. pastoris or P. methanolica, Hansenula, such as H. Polymorpha or Yarrowia.
  • suitable insect host cells include a Lepidoptora cell line, such as Spodoptera frugiperda (Sf9 or Sf21) or Trichoplusioa ni cells (High Five) (US 5,077,214).
  • a Lepidoptora cell line such as Spodoptera frugiperda (Sf9 or Sf21) or Trichoplusioa ni cells (High Five) (US 5,077,214).
  • Transformation of insect cells and production of heterologous polypeptides therein may be performed as described by Invitrogen.
  • Suitable mammalian host cells include Chinese hamster ovary (CHO) cell lines, (e.g. CHO-Kl; ATCC CCL-61), Green Monkey cell lines (COS) (e.g. COS 1 (ATCC CRL- 1650), COS 7 (ATCC CRL-1651)); mouse cells (e.g. NS/O), Baby Hamster Kidney (BHK) cell lines (e.g. ATCC CRL-1632 or ATCC CCL-10), and human cells (e.g. HEK 293 (ATCC CRL-1573)), as well as plant cells in tissue culture.
  • COS Green Monkey cell lines
  • BHK Baby Hamster Kidney
  • HEK 293 ATCC CRL-1573
  • Additional suitable cell lines are known in the art and available from public depositories such as the American Type Culture Collection, Rockville, Maryland.
  • the mammalian cell such as a CHO cell
  • sialyltransferase e.g. 1,6-sialyltransferase, e.g. as described in US 5,047,335, in order to provide improved glycosylation of the receptor.
  • Methods for introducing exogenous DNA into mammalian host cells include calcium phosphate-mediated transfection, electroporation, DEAE-dextran mediated transfection, liposome-mediated transfection, viral vectors and the transfection method described by Life Technologies Ltd, Paisley, UK using Lipofectamin 2000. These methods are well known in the art and e.g. described by Ausbel et al. (eds.), 1996, Current Protocols in Molecular Biology, John Wiley & Sons, New York, USA. The cultivation of mammalian cells are conducted according to established methods, e.g. as disclosed in (Animal Cell
  • the metal binding site in BILFl is a metal-ion binding site that has been introduced into the protein by artificial means such as, e. g., engineering means.
  • the method provides a molecular approach for rapidly and selectively identifying small organic molecule ligands, i. e. compounds, that are capable of interacting with and binding to specific sites BILFl.
  • the method makes it possible to construct and screen libraries of compounds specifically directed against predetermined epitopes on BILFl.
  • the compounds are initially constructed to be bifunctional, i. e. having both a metal-ion binding moiety, which conveys them with the ability to bind to the artificially constructed metal-ion binding site described above as well as a variable moiety, which is varied chemically to probe for interactions with specific parts of BILFl located spatially adjacent to the metal-ion binding site.
  • Compounds may subsequently be further modified to bind to the unmodified biological target molecule without help of the bridging metal-ion.
  • the metal-ion site is used as an anchor-point for the initial parts of the medicinal chemistry drug-discovery process, during which test compounds can be synthesized, which due to their specific interaction with the metal-ion binding site can be deliberately directed towards interaction with specific, functionally interesting parts of BILFl.
  • the test compounds are subsequently structurally optimised for interaction with spatially neighbouring parts of BILFl (that is, interaction with the side chains or backbone of one or more neighbouring amino acid residues). These compounds can then be utilized as leads or starting points for the construction of ligands binding to wild-type BILFl.
  • the binding site of a compound predetermine the binding site of a compound to a particular location BILFl and thereby target the optimised compounds to sites where binding of the compound will alter the biological activity of the BILFl in a desired way, for example to decrease its biological activity.
  • the metal-ion binding portion of the test compounds may subsequently be removed or altered to no longer posses metal-ion binding properties, and the test compounds, as well as chemical derivatives thereof may be constructed to interact with side chains of other amino acids in the vicinity of the artificial metal ion binding site, and tested for binding to the wild-type BILFl protein which does not include a metal ion binding site.
  • the method relates to a drug discovery process for identification of a small organic compound that is able to bind to BILFl, the method comprising mutating BILFl in such a way that at least one amino acid residue capable of binding a metal ion is introduced so as to obtain a metal ion binding site as an anchor point in the mutated biological target molecule.
  • Mutated BILFl may furthermore be contacted with a test compound which comprises a moiety including at least two heteroatoms for chelating a metal ion, under conditions permitting non-covalent binding of the test compound to the introduced metal ion binding site of the mutated BILFl, and then followed by detection of any change in the activity of the mutated BILFl or determination of the binding affinity of the test compound to the mutated BILFl.
  • a serpentine diagram of the BILFl receptor showing the 7 trans-membrane helices. Differences between Human EBV and Rhesus EBV are indicated in black on grey and identical amino acids are indicated in black on white. Computer predicted glycosylation sites are indicated with g and predicted phosphorylation sites indicated with p. The alternative ⁇ DRY box', ⁇ EKT' is marked with a rectangle.
  • FIG. 2 Multiple sequence alignment of BILFl related sequenced identified using BLAST. The alignment was done using ClustalW version 1.8, and shading was done using Boxshade version 3.21 available at http://www.ch.embnet.org/software/BOX form.html.
  • Abbreviations used in this figure are PLHV: Porcine lymphotropic herpesvirus, CHV3: Callitrichine herpesvirus 3 (also known as marmoset EBV), AHV: Alcelaphine herpesvirus and EHV: Equine herpesvirus.
  • the rectangle indicates the 1 DRY' box region. Positions sharing 50% amino acid identity or more are indicated in white on black. Positions sharing 50% amino acids identity or more are indicated in black on grey. Positions with less than 50% amino acid identity or identity are indicated in black on white. Consensus line asterisk (*) indicates 100% conserved positions and dots (.) indicates positions with 50% or more identity.
  • the BILFl receptor family is highlighted in bold and consist of porcine lymphotrophic herpesvirus (PLHV) 1,2 and 3 ORF-A5, alcelaphine herpesvirus 1 (AHV) ORF-E5, equine herpesvirus 2 (EHV2) ORF-E6 rhesus Epstein-Barr virus (RhEBV) ORF-BILFl, human Epstein-Barr virus (EBV) ORF-BILFl and callitrichine herpesvirus 3 (CHV3) ORF-6.
  • PHV porcine lymphotrophic herpesvirus
  • HBV alcelaphine herpesvirus 1
  • EHV2 equine herpesvirus 2
  • RhEBV rhesus Epstein-Barr virus
  • EBV Epstein-Barr virus
  • CHV3 callitrichine herpesvirus 3
  • Figure 5 show representative images of (A) HuBILFl and (B) RhBILFl expressing 293 cells, fixed, permeabillized and stained with an anti HA antibody. The images are taken with a 6OX oil immersion objective. The images show a distinct receptor membrane association.
  • HuBILFl induction of inositol phosphate accumulation COS-7 cells were transfected with an increasing amount of HuBILFl DNA together with 5 ⁇ g of different chimeric Ga protein DNA or empty expression vector DNA.
  • the recombinant G proteins G ⁇ qs5 and G ⁇ ⁇ 6q i 4myr have switched receptor specificity from wild type G ⁇ q interacting receptors to G ⁇ s and Gocj interacting receptors respectively, but all signal via activation of PLC leading to accumulation inositol phosphates (IP3).
  • Panel A show the activity as percent of maximum obtained activity.
  • HuBILFl + control DNA open square
  • HuBILFl + wild type G ⁇ q DNA black diamond
  • HuBILFl + G ⁇ qs5 DNA black triangle
  • HuBILFl + G ⁇ ⁇ 6qi4l ⁇ yr DNA Black square.
  • Data are means and standard deviations (error bars) of four independent experiments, each experiment carried out in duplicate.
  • panel B and C show the actual counts from one representative experiment out of four.
  • Cells were transfected with 10 ⁇ g receptor DNA and 5 ⁇ g G protein DNA and stimulated with ligands according to the tables under the graphs. Bars illustrate means and error bars illustrate standard deviations of one experiment carried out in duplicate.
  • BILFl HuBILFl
  • ORF74 is the KSHV encoded GPCR
  • qi4 is G ⁇ ⁇ 6qi4myr
  • qwt is wild type G ⁇ q
  • qs5 is G ⁇ qs5
  • GIP (receptor) is the glucose-dependent insulinotropic peptide receptor
  • ⁇ OP receptor
  • GIP ligand
  • Dyn ligand
  • GIP and dynorphin were added to a final concentration of 10 "7 M.
  • RhBILFl induction of inositol phosphate accumulation COS-7 cells were transfected with 6 ⁇ g BILFl DNA together with 5 ⁇ g of different chimeric Ga protein DNA or empty expression vector DNA according to the table under the graph. The figure shows actual counts from one representative experiment out of four. Bars illustrate means and error bars illustrate standard deviations of one experiment carried out in duplicate.
  • COS-7 cells were seeded in 96-well plates and co-transfected with a reporter-cDNA cocktail consisting of 6ng pFA2-CREB and 50ng pFR-Luc reporter plasmids and increasing amounts of HuBILFl DNA with (black squares) or without (open squares) 30ng of G ⁇ ⁇ 6q ⁇ 4rnyr DNA. Data points illustrate means and error bars illustrate standard deviations of one experiment out of four, each carried out in triplicate. Luciferase activity is presented as relative light units (RLU).
  • RLU relative light units
  • the figure shows normalised data from one representative experiment out of four. Bars illustrate means and error bars illustrate standard deviations of one experiment carried out in duplicate.
  • the cloning succeeded with number 2. 3) the position of the forward primer used.
  • Primer positions of gp350 primers for cloning process. 1+2) are the two different reverse primer used. When using reverse primer 1 both gp220 and gp350 are included. Only cloning with reverse primer 1 succeeded. 3) position of forward primer Figure 12
  • Figure 12 shows BILFlstandard curve with a 10-fold dilution series. The cycle number where the largest change in fluorescence is detected is plotted against the logarithm to the concentration.
  • the standard curve should have a slope of approximately -3.5. When using the primer set chosen to amplify and quantify BILFl the standard curve generated has a slope of -3.79, which is acceptable.
  • FIG. 13 The negative controls have different melting point. This diagram show that even though the negative control gives a fluorescent read out this is not the BILFl fragment, which is detected but primer-dimers. The colours represent the same number of copies as figure 6.
  • the negative control sample also results a positive readout.
  • this readout is caused by primer-dimer formation, as evident from the melting curve (fig. 13), and is not caused by template contamination, or from amplification of un-specific cDNAs.
  • Primer- dimers have a lower melting point than the amplified fragment. Samples with a positive signal, but with a lower melting point than the fragment can be considered to be negative. To see if all fragment are of the right size, the products are run on a 2% agarose gel for analysis. This shows that the fragments are of the right size.
  • gp350 is a late gene. Diagram of gp350 expression with logarithm to the number of mRNA detected by LightCyler in the two different cell line Akata+ and B95.8. White bars are the unstimulated cells grey bars stimulated cells and black bars stimulated cells added PAA.
  • BZLFl is an early gene.
  • the expression of BZLFl is given by the logarithm to the number of mRIMA copies detected.
  • White bars are the unstimulated cells grey bars stimulated cells and black bars stimulated cells added PAA
  • Expressionpattern of EBNA3C diagram of EBNA3 expression pattern in three different cell lines, Akata+, B95 and P3HR1. white bars are unstimulated cells, grey stimulated cells and the black bars represent the cells stimulated and added PAA
  • BILFl expression Diagram of BILFl expresion, with the logarithm to the number of copies detected by LightCycler. White bars ar the unstimulated cells, grey are stimulated cells and black bars cells stimulated and added PAA.
  • G ⁇ qs5 and G ⁇ ⁇ 6qi4m y r have switched receptor specificity from wild type G ⁇ q interacting receptors to G ⁇ s and Ga, interacting receptors respectively;
  • G ⁇ qs5 have replaced the 5 C-terminal amino acids of wild type G ⁇ q with the 5 corresponding C- terminal amino acids from G ⁇ s , and
  • Ga Mqi4myr lacks the first six N-terminal amino acids, have replaced the 4 C-terminal amino acids of wild type G ⁇ q with the corresponding 4 C- terminal amino acids from GOC J , and include an N-terminal myristoylation site (Conklin et al., Kostenis et al.
  • T-REx-293 cell line (Invitrogen R710-07) were grown in DMEM (Invitrogen 31966-021) + 10% FBS and penicillin/streptomycin (Invitrogen 15140-022) with the addition of 15 ⁇ g/ml Blasticidin S (Invitrogen R210-01) and 100 ⁇ g/ml Zeocin (Invitrogen R250-01) or 150 ⁇ g/ml Hygromycin B (Invitrogen 10687- 5 010) at 37°C, 5% CO 2 .
  • COS-7 cells were grown in DMEM (Invitrogen 21885-025), 10% FBS and penicillin/streptomycin, at 37°C, 10% CO 2 .
  • Human and rhesus EBV BILFl were inserted into 5 pcDNA5/FRT/TO (Invitrogen V6520-20) by cohesive end ligation.
  • the resulting human- and rhesus-EBV BILFl constructs (SI-.Fl-pcDNA5/FRT/TO) are hereafter called HuBILFl and RhBILFl respectively.
  • the constructs also contain the hygromycin resistance gene with a FIp Recombination Target (FRT) site embedded in the 5 'coding region.
  • the hygromycin resistance gene lacks a promoter and the ATG initiation codon.
  • Stable, tetracycline (Tet) -inducible BILFl cell lines were generated using the FIp-In T-Rex Core kit (Invitrogen K6500-01) by FIp recombinase mediated integration.
  • the 293 T-REx cell line contains one integrated FRT site originally encoded by the pFRT//acZeo vector 5 (Invitrogen V6015-20) and expresses the Tet-repressor originally encoded by the pcDNA6/TR vector (Invitrogen V1025-01).
  • the FRT site is maintained by selection for zeocin resistance and the Tet-repressor is maintained by selection for blasticidin resistance.
  • the integrated FRT site is contained just downstream of the ATG initiation codon of the lacZ-Zeocin fusion gene.
  • T-REx-293 cells were transfected with 0 HuBILFl or RhBILFl and pOG44 (Invitrogen V6005-20) for transient expression of the FIp recombinase using the Fugene-6 transfection reagent (Roche 1814433) according to the manufactures protocol.
  • the FIp recombinase mediates homologous recombination between the FRT site, so that BILFl is inserted into the genome at the already integrated FRT site.
  • the CMV/TetO 2 promoter is inactive in cells expressing the Tet-repressor (T-REx-293 cell line) where it is activated by the addition of Tet. It should be noted that the CMV/TetO 2 promoter is fully active in cells not expressing the tet repressor.
  • Triton X-114 is soluble in aqueous solutions at 0°C but not at 37°C. This property makes is suitable for separating membrane fractions (and the embedded receptors), from water-soluble proteins. Briefly, cells were lysed on ice for 15 min and centrifuged for 30 min at 5500 rpm at 4°C. The supernatant was incubated at 37°C until unclear and spun for 10 min at 4000 rpm at R/T to separate the detergent phase (DF) from the aqueous phase (upper phase). The DF was supplemented with 0,1M tris HCI pH 8.1 to starting volume and incubated on ice until clarified and the phase separation was repeated.
  • DF detergent phase
  • the DF was again supplemented with 0.1M tris HCI pH 8.1 to starting volume and clarified with 2.5 ⁇ l 10% CHAPS.
  • the supernatant DF was separated from the aqueous phase by centrifugation for 15 min at 4000 rpm at 4°C.
  • Receptor de-glycosylation was done using glycopeptidase F (SIGMA G5166) according to the manufactures protocol and proteins analysed by western blotting using anti HA-antibody (Biosite HA.ll).
  • HuBILFl and RhBILFl cell lines were grown on CC2 treated Lab-Tek Chamber glass slides (Nalge Nunc International 154917). 24 hours after Tet stimulation cells were fixed in 3.7% formaldehyde, washed in PBS and permeabillized in 0.2% Triton X-100 for 20 min on ice. Cells were blocked in PBS containing 1% BSA and 5% goat serum for 30 min at R/T and incubated with anti HA antibody (Biosite HA.ll) for 1 hour at R/T. Cells were washed and incubated with FITC conjugated goat anti mouse antibody (Kirkegaard & Perry Laboratories 02-18-06) for 1 hour at R/T.
  • COS-7 cells were transfected using the calcium phosphate precipitation method (Rosenkilde et al.)- Briefly, 20 ⁇ l 2M CaCI 2 , DNA and TE buffer to a 5 total volume of 160 ⁇ l were mixed and added drop-wise to 160 ⁇ l 2X HBS buffer. After 45 min incubation the mixture was added to the cells and incubated with the addition of 100 ⁇ M chloroquine for 5 hours. One day after transfection the cells were transferred to 6 well plates (5 x 10 5 cells/well) and incubated for 24 hours with 4 ⁇ Ci of myo-[ 3 H]inositol (Amersham TRK911) in 0.8 ml of complete medium/well. Cells were washed twice in IP-
  • 10 buffer (20 mM HEPES buffer (pH 7.4) supplemented with 140 mM NaCI, 5 mM KCI, 1 mM MgSO 4 , 1 mM CaCI 2 , 10 mM glucose, and 0.05% (w/v) bovine serum albumin) and incubated in 1.0 ml of IP-buffer supplemented with 10 mM LiCI at 37 0 C for 90 min. GIP and dynorphin were added to a final concentration of 10 '7 M after 15 min pre-incubation. After incubation the buffer was removed and accumulated inositol phosphates were extracted for
  • IP3 [ 3 H]inositol phosphates
  • Cyclic AMP (cAMP) response element binding protein (CREB) reporter assay 20 Cyclic AMP (cAMP) response element binding protein (CREB) reporter assay.
  • COS-7 cells (35,000 cells/well) were seeded in 96-well plates and transfected with a reporter-cDNA cocktail consisting of 6ng pFA2-CREB and 50ng pFR-Luc reporter plasmids (PathDetect CREB trans-Reporting system; Stratagene) and various amounts of receptor and G protein DNA using Lipofectamine 2000 (Invitrogen)
  • Luminescence values are given as relative light units (RLU).
  • AKata B-cells were stimulated for 3 hours with or without the addition of 300 ⁇ g/ml 35 phosphonoacetic acid (PAA) (SIGMA SP6909) with 0,5% (V/V) IgG (DAKO A042410).
  • Total RNA were isolated using the RNAqueous-4PCR kit for isolation of DNA free RNA (Ambion 1914 according to the manufactures protocol. Reverse transcription first strand BILFl cDNA synthesis were done on 4.0 ⁇ g total RNA using Superscript II RT (Invitrogen 18064- 14) and reverse primer 5 'ctatcagcctgacatccatt in a total volume of 2OuI.
  • BILFl contains several additional characteristics of GPCRs. These include conserved cysteines in the amino (N) -terminal, and in the extra cellular loops (Figure 1), which are known to form structurally and functionally important disulfide bonds in GPCRs 19 . Furthermore, BILFl is predicted to contain seven N-terminal glycosylation sites, which are important for both GPCR-ligand interactions and for receptor expression and cellular
  • BILFl belongs to a novel receptor sub-family
  • BILFl is not only encoded by human EBV, but also by other ⁇ l-herpesviruses. Together, this group of BILFl related sequences constitute a new family of related GPCRs, exclusively encoded by, and a trait for, ⁇ l-herpesviruses ( Figure 2). Indeed, BILFl is one of just six genes present only in ⁇ l-herpesviruses. This genomic evidence suggests that BILFl plays an important role in the lifecycle of ⁇ l-herpesviruses.
  • the present inventors cloned human EBV and Rhesus EBV BILFl and inserted the receptor reading frames into pCDNA5/FRT/TO generating HuBILFl and RhBILFl respectively.
  • the BILFl sequences were confirmed by sequence analysis and corresponded to nucleotide 152161 -153099 in the Human herpesvirus 4, complete genome (GenBank accession NC_001345) and to nucleotide 147746 -148684 in the Rhesus EBV (Cercopithicine herpesvirus 15), complete genome (GenBank accession AY037858).
  • the present inventors generated several clonal cell lines of both HuBILFl and RhBILFl.
  • Tet-dose experiments showed that 0.1 ⁇ g Tet/ml media were sufficient to induce maximal BILFl expression 24 hours post stimulation (data not shown).
  • BILFl is heavily glycosylated
  • BILFl is localized to the plasma membrane Tet-induced HuBILFl and RhBILFl cell lines were stained with an anti HA-tag antibody and receptor localization was studied by confocal microscopy.
  • both human- (A) and rhesus- (B) EBV BILFl mainly localizes to the plasma membrane. This is concurrent with the expression pattern of most GPCRs, but is in contrast to the predominantly intracellular localization of many vGPCRs. It further supports our prediction that BILFl is indeed a membrane protein and therefore a target for drug intervention.
  • the present inventors tested the activation of a variety of Ga proteins.
  • G ⁇ q proteins comprising the three major types of Ga subunits; Ga q , Ga 5 and Ga 1 .
  • COS-7 cells were transfected with an increasing amount of HuBILFl DNA together with a constant quantity of different Ga DNA or empty expression vector DNA.
  • Figure 6A shows, that BILFl did not activate PLC through endogenous G ⁇ q .
  • the present inventors transfected COS-7 cells with ORF74, which constitutively activates G ⁇ q .
  • ORF74 constitutively activates G ⁇ q .
  • transfected COS- 7 cells were fully capable of activating PLC through endogenous G ⁇ q .
  • Co-transfection with G ⁇ qs5 revealed that BILFl does not signal via activation of G protein ⁇ subunits of the s- class ( Figure 6A).
  • the present inventors co- transfected COS-7 cells with G ⁇ qs5 and the GIP receptor (which activates G ⁇ s upon ligand engagement), and stimulated transfected cells with GIP.
  • the present inventors co- transfected COS-7 cells with the ⁇ -op ⁇ at receptor and G ⁇ ⁇ 6q ⁇ 4myr , and stimulated transfected cells with dynorphin.
  • G ⁇ ⁇ 6qi4myr was also fully capable of activating PLC after ⁇ -op ⁇ at receptor activation.
  • none of the chimeric and endogenous G proteins were active without concurrent receptor expression (figure 6A, B and C).
  • the present inventors further tested whether also the rhesus EBV encoded BILFl were constitutively active, and whether rhesus EBV BILFl activated the same G protein as the human EBV BILFl.
  • Co-transfection of RhBILFl with the same chimeric G proteins as described above revealed that also rhesus EBV BILFl is constitutively active, and like the human EBV homolog, mediates its signal through activation of Ga 1 .
  • Figure 7 shows a representative example of 4 independent experiments. Besides revealing homologous Ga subunit activation, the RhBILFl activity level was very similar to the activity of HuBILFl (compare figure 6B and 7). Thus, both human and rhesus EBV BILFl signals constitutively via Ga, and with similar efficacies.
  • BILFl activates endogenous i-class G proteins
  • BILFl could activate endogenous Ga 1
  • the present inventors tested the ability of BILFl to inhibit forskolin stimulated CREB activity.
  • COS-7 cells were transfected with increasing amounts of HuBILFl DNA together with a reporter-cDNA cocktail consisting of 6ng pFA2-CREB and 50ng pFR-Luc reporter plasmids. After transfection cells were stimulated with 10 ⁇ M forskolin with or without the addition of PTx.
  • Figure 8B show that BILFl almost completely inhibited forskolin induced CREB activity in a dose dependent manner.
  • BILFl mediated signalling can be inhibited by addition of PTx, a potent inhibitor of G ⁇ r .
  • BILFl expression To study whether BILFl is expressed in EBV infected cells, the present inventors measured the numbers of BILFl specific RNA copies using Real Time PCR. Latently EBV infected Akata B-cells were either kept untreated (latent) or stimulated with IgG to induce lytic EBV replication cycle. As shown in figure 9, the induction of lytic replication strongly induced expression of BILFl RNA, indicating that BILFl is a lytic gene and not a latent gene. To study whether BILFl is expressed as an early or late gene during EBV lytic replication cycle, IgG induced Akata B-cells were further treated with phosphonoacetic acid (PAA). PAA inhibit viral DNA replication.
  • PAA phosphonoacetic acid
  • Late lytic genes are defined as genes who's expression are dependent on viral DNA replication. As shown in figure 9, BILFl expression is inhibited by PAA, suggesting that BILFl is a late lytic transcript in EBV infected Akata B- cells.
  • vGPCRs encode vGPCRs with unusual pharmacological and cellular properties and with significant biological functions.
  • the present inventors have identified a new sub-family of vGPCRs, the BILFl receptors, encoded by EBV and other ⁇ l- herpesviruses.
  • EBV a major human oncogenic herpesvirus
  • ORF74 the significance of the KSHV encoded GPCR
  • ORF74 One interesting function of ORF74 may be to increase the efficiency of KSHV reactivation. This observation is interesting since ORF74 is regarded as an early lytic gene and is not expressed in the vast majority of otherwise latently infected cells, and suggests that some level of lytic replication can activate latently infected cells, presumably through paracrine mechanisms. Intriguingly, it has been proposed that dysregulation of the KSHV gene program caused by HIV-I Tat, inflammation or aborted lytic replication may indeed lead to non-lytic expression of ORF74.
  • BILFl is a lytic gene. Furthermore, the present inventors show that BILFl expression is dependent on viral DNA replication, since the expression is inhibited by PAA. This shows that BILFl plays a role during the formation of viral particles in Akata infected B-cells. This function could be directly involved in the formation of viral particles, e.g. induce transcription of structural viral proteins, it could be involved in changing the intracellular milieu e.g. to increase the fitness of the virus, or it could be involved in changing the extracellular environment e.g. to assist viral dissemination in the host or counteract the host antiviral immune response.
  • EBV infection is the most common cause of infectious mononucleosis, and by adulthood, nearly all humans are asymptomatic carriers of EBV. Besides causing mononucleosis, EBV infection is associated with endemic Burkitt's lymphoma, nasopharyngeal carcinoma, Hodgkin's disease, gastric carcinoma, leiomyosarcoma and AIDS- and transplant-associated B cell lymphomas.
  • Burkitt's lymphoma and Hodgkin's lymphoma occur in patients without immunosuppression. Additionally, chromosomal abnormalities and somatic hypermutation of cellular oncogenes, have been hypothesized to act in concert with EBV infection to cause malignancies.
  • EBV associated malignancies are characterised by a mainly latently infected cell population, and several latently expressed genes have been shown to cause ceil transformation in vitro. Nevertheless, in a population of latently EBV infected cells, a small fraction of cells are spontaneously permissive for lytic replication.
  • BILFl contribute to control both the level of reactivation, and is involved in EBV tumorgenesis, by acting on uninfected or latently infected cells through paracrine mechanisms.
  • vGPCR e.g. UL33, US27, US28 and M78
  • vGPCR are characterized by an unusual cellular localization pattern.
  • Detailed analysis of US28 showed that US28 underwent constitutive endocytosis and recycling to the plasma membrane. It has been suggested that the constitutive endocytosis and recycling of US28 could be a mechanism for sequestering host CC-chemokines providing a sink for clearing pro-inflammatory CC-chemokines from the tissue surrounding the CMV infected cell, thereby antagonizing the recruitment of cells involved in the immune response against CMV.
  • BILFl function as a regulatory switch for other GPCRs expressed in EBV infected cells.
  • EBV also control the transcriptional regulation of host GPCRs.
  • EBI EBV-induced
  • EBI-I is now known as the chemokine receptor CCR7
  • EBI-2 is still an orphan.
  • EBV immortalized B-cells have altered chemokine receptor expression pattern, which could be responsible for the distorted migration of infected B-cells to germinal centers 39.
  • EBV seems to control the GPCR settings on many levels, emphasizing the importance of both endogenous GPCRs and vGPCR for viral replication, dissemination and immune evasion.
  • BILFl itself does not display any particular similarities to know chemokine receptors.
  • ORF74 stimulates a broad range of signalling pathways has been taken into account for the transforming properties of this receptor, and it has been suggested that the transforming effects of ORF74 may be mediated cooperatively by G ⁇ q and G ⁇ i signalling.
  • the present inventors show that the EBV encoded GPCR, BILFl, constitutively activates G ⁇ i.
  • the present inventors show that EBV encoded BILFl through its highly constitutive signalling is the central player in EBV associated cell transformation.
  • BILFl diagnostic Measure the Expression of BILFl RNA using real-time PCR.
  • EBV nuclear antigens EBNA
  • LMPs latent membrane proteins
  • latency I only few of the genes are expressed among them EBNAl. Latency II is lacking EBNA2 expression but EBNAl and the LMP's are expressed. In latency III all the latent genes, including EBNAl, are being expressed.
  • EBV infects human B lymphocytes in vitro it results in latency III (6).
  • EBNA3C has a down-regulating effect on the viral Cp promoter and a down -or upregulating effect on the LMP promoter. Further more EBNA3C up-regulates the cellular CD21 promotor and thereby inducing expression of CD21(10).
  • EBNA3C also has a function as a repressor of EBNA2 mediated activation of transcription (11).
  • BILFl is an early or late viral lytic gene.
  • the definition on an early gene is a gene that it is independent on the viral DNA replication, whereas a late gene is dependent on the viral DNA replication.
  • PAA phosphonoacetic acid
  • BZLFl is known to be an immediately early gene (7). Thus BZLFl is not dependent on the viral DNA replication.
  • BZLFl has two introns and 3 exons. The ZEBRA protein is encoded by all three exons, but there also is a protein encoded only by exon 1 and exon 3.
  • BZLFl and BRLFl together encodes three proteins, again is BZLFl splices differently, so in total BZLFl encodes five different protein, but the ZEBRA protein is the most common (8).
  • the primers used in the experiments detect all the mRNA transcribed from BZLFl genes (see figure 10 for BZLFl transcripts).
  • the viral envelope glycoprotein gp350 is chosen (3).
  • EBV binding to CD21 results in an increase in blast formation, cell adhesion and an increase in RNA synthesis (9).
  • gp350 and gp220 are both coded for by the open reading frame BLLFl.
  • the LightCycler measure the fluorescence at the end of the elongation phase.
  • a known problem with this technique is that even though there is no template in the reaction, the LightCycler often produce a signal. However it is well known that this signal most often is caused by the formation of primer-dimers.
  • the formation of primer-dimer can be detected by looking at the melting curve, presented by the LightCycler instrument. Primer-dimers have a melting point at approximately 78 0 C, whereas the fragments in the experiments have melting points from 82 - 86 0 C. Furthermore the amplification products can be analyzed on an agarose gel. The melting curve is created after the final cycle.
  • the LightCycler heat from 55 to 95 0 C, measuring the fluorescence every 0.2 0 C.
  • the melting curve is visualized by taking -dF/dT. But the easiest way to see the melting point is by a melting peak is by plotting -dF/dT against the temperature.
  • the LightCycler can detect from 10 - 10 10 copies of DNA. The sensitivity is dependent on the quality of the template, primer design and the optimizing of PCR condition. For quantification we use a sample (template) with a known copy number, which can be compared to a standard curve for calculation of the number of copies in the experimental samples.
  • RNA isolated from immortalized B-cells The cell lines used are the EBV negative Akata cells (Akata-) used as negative control, and the EBV positive cell lines Akata (Akata+), B95.8 an EBV positive lymphoblastoid cell line (1) and P3HR1, a Burkitt's lymphoma-derived cell line (4).
  • RNA extractions from the following samples provided by Prof.dr. Jaap M. Middeldorp and Dr. Servi J. C. Stevens. All clinical RNA samples are isolated from frozen tissue specimens, except where indicated (cell lines). RNA was isolated using the RNAzol method (until and including the isopropanol step and then stored at -80 0 C.
  • Induction of lytic replication in EBV B-c ⁇ ll lines We grow cells in RPMI 1640 medium + L-glutamine (Invitrogen Life Tecnology, 21875- 034) with 10% fetal bovine serum (Invitrogen) and 100 units pr ml penicillin and streptavidin (Invitrogen, 15070-063). The cells are incubated at 37°C, and 5% CO 2 . The cells are split when they reach a density of approximately 10 6 cells/ml. Akata cells: approximately 10 7 cells are used for each assay. Prior to stimulation cells are pelleted by centrifugation at 1500 rpm for 5 min. The cells are resuspended in fresh media so the final concentration was 10 6 cells/ml.
  • the Akata cells are stimulated with 0.5% v/v IgG antibody (DAKO, A042410), or IgG antibody plus 300 ⁇ g/ml PAA to inhibit viral DNA replication.
  • B95.8 cells are stimulated with butyric acid and the phorbol ester 12-O-tetradecanoyl- phorbol-13-acetate (TPA). NaOH are added to neutralize pH.
  • TPA phorbol ester 12-O-tetradecanoyl- phorbol-13-acetate
  • NaOH are added to neutralize pH.
  • three different concentrations of butyric acid and TPA are used in different combinations.
  • the butyric acid concentration is 3-, 6- or 12 mM and TPA is added so the final amount is 10-, 20- or 30 ng pr ml.
  • Half of the cells are also incubated with PAA (300 ⁇ g/ml).
  • unstimulated cells are included in the experiment to study latent gene expression. After 3 hours of incubation at 37 0 C, 5% CO 2 the samples are pelleted by centrifugation at 1500rpm for 5 minutes and resuspended in new medium. PAA are again added to the cells, which were previously incubated with PAA. The cells are then incubated for 48 hours at 37 0 C. After 48 hours the cells are pelleted and washed in PBS before RNA is isolated.
  • RNAqoues 4-PCR kit AMBION, cat no. 1914
  • 96% ethanol were used instead of 100% ACS grade ethanol.
  • RNAqoues 4-PCR kit AMBION, cat no. 1914
  • the samples are treated with DNase I by adding 0.1 volume of DNase I buffer and 1 ⁇ l DNase I provided with the kit.
  • the DNase I is inactivated and the supernatant is transferred to a new RNase free Eppendorph tube. The amount of RNA recovered is determined by spectrophotometry at OD 260 .
  • RNA samples are isolated from frozen tissue specimens, except cell lines. RNA was isolated using the RNAzol method (until and including the isopropanol step and then stored at -80 0 C.
  • the present inventors precipitated and pelleted the RNA from the isopropanol by centrifugation of the isopropanol-RNA solution for 30 minutes at 13000 rpm in standard bench-top centrifuge at 4°C. Then the supernatant was removed and the pelleted RNA was washed in 500 ⁇ l of cold 75% ethanol. The RNA was pelleted by centrifugation at 13000 rpm for 5 minutes and supernatant was removed and the pellet air-dried for 15-30 minutes The pelleted RNA was resuspended in 12 ⁇ l H 2 O.
  • cDNA synthezing cDNA is synthesized using "First Strand Transcription cDNA synthesis Kit” from Roche (Cat no. 04379012001). The amount of RNA varies between 1 and 3 ⁇ g. The final primer concentration is 1 nM, water is added to 13 ⁇ l and heated 10 min at 65 0 C.
  • the primer sequence for BILFl is 5'-CTATCAGCCTGACATCCATT-S', BZLFl 5'- GGAACACCAATGTCTGCTAG-3', gp350 5'-TGTCAGCTGGCCAAAGTCAA-S' and EBNA3C 5'- TTTCTTGCTCTCTTGGTCCA-3'. After heating in 10 min dNTP is added to a final concentration of ImM. Ix reverse transcriptase buffer, 20 Units RNase inhibitor and 10 units reverse transcriptase enzyme is also added and we heat up the samples for 30 min at 55 0 C followed by 5 min at 85 0 C to inactivate the reverse transcriptase.
  • Real-time PCR is run on a LightCycler using the "LightCycler - FastStart DNA Master SYBR green I kit" from Roche (Cat No. 2239264). The final MgCI 2 concentration is 3 mM.
  • the reverse primers and the forward primers are: BILFl 5'- GTCAATGCAACGGAAGATGC-3', BZLFl 5'-CTCCGACATAACCCAGAATC-S', gp350: 5'- TACACCATCCAGAGCCTGAT-3' and EBNA3C ⁇ '-GGGATATCGTACAGCAACAC-S'. All primers are designed to have an annealing temperature of approximately 60 0 C.
  • the primers are designed to give PCR fragments with a length between 120-180 bp, which is recommended by the manufacturer.
  • For standard curves a series of 10 fold dilutions were prepared, from 10 2 to 10 8 copies of the plasmid containing the gene of interest (BILFl, BZLFl, gp350 or ENBA3C). 5 ⁇ l of plasmid DNA is added for the standard curves and for characterization and quantification 2 ⁇ l of cDNA is added.
  • the standard curve is used to determine the number of copies in the experimental samples.
  • the negative control contains water in place of template DNA.
  • the LightCycler gives the results as the logarithm of the fluorescence detected during the amplification plotted against cycle number.
  • the LightCycler can measure from 10 to 10 10 copies.
  • the cycle number is plotted against logarithm the concentration.
  • results from the real-time PCR are presented as number of copies of each specific mRNA in each capillary.
  • Table 2 gives the logarithm to the number of copies mRNA pr ⁇ g RNA, from the different genes in the different cell lines, and if the decrease in the difference between the number of copies in the stimulated cells and the cells added PAA is significant.
  • the results of gp350 show, as expected that gp350 is a late gene and is inhibited of PAA in both Akata+ cells and as previously shown in B95.8 cells (figure 15). Unstimulated cells Stimulatec J cells Stimulated cells +
  • Tabel 2 Logarithm to the number of copies pr ⁇ g RNA and the standard deviation.
  • BZ The significance tested on a 5% significance level. LFl show no inhibition when adding PAA, which is expected, since BZLFl is a well known early viral gene (figure 16).
  • Figure 17 shows how the latent gene EBNA3C is expressed in the three cell lines Akata+ and B95.8 and P3HR1 in samples of unstimulated, stimulated and stimulated +PAA cells. It shows that there is not the big difference between the unstimulated and stimulated cells.
  • PTLD Post transplant lymphoproliferative disease
  • NPC Nasopharyngeal carcinoma
  • T cell lymphoma T cell lymphoma
  • BL Burkitt's lymphoma
  • BILFl is present in the following tumor types:
  • T cell lymphoma T cell lymphoma
  • BILFl cDIMA and cDNA encoding the relevant chimeric G-protein (e.g. G ⁇ qi5 ,G ⁇ qi4 , G ⁇ qz5 , G ⁇ qi4myr , G ⁇ qi4myr and similar chemeric proteins which lacks the first six N- terminal acids) into COS-7 cells by the standard calcium phosphate transfection method or other methods of transfection (e.g. lipofectamine, superfect, effectene etc.).
  • the cells Two days post-transfection the cells are assayed for phosphorlipase C activity using an inositole phosphate turnover assay, briefly, One day after transfection the cells are transferred to 6 well plates (5 x 10 5 cells/well) and incubated for 24 hours with 4 ⁇ Ci of myo-[ 3 H]inositol (Amersham TRK911) in 0.8 ml of complete medium/well.
  • IP- buffer (20 mM HEPES buffer (pH 7.4) supplemented with 140 mM NaCI, 5 mM KCI, 1 mM MgSO 4 , 1 mM CaCI 2 , 10 mM glucose, and 0.05% (w/v) bovine serum albumin) and incubated in 1.0 ml of IP-buffer supplemented with 10 mM LiCl at 37°C for 90 min.
  • Metal ions e.g Zn ++ in the form of ZnCI 2
  • concentrations 15 min pre ⁇ incubation are added.
  • IP3 [ 3 H]inositol phosphates
  • the Epstein-Barr virus BILFl gene encodes a G protein-coupled receptor that inhibits phosphorylation of RNA-dependent protein kinase. J Virol 79: 441-449, 2005.
  • BZLFl an Epstein-Barr virus immediate-early protein, induces p65 nuclear translocation while inhibiting p65 transcriptional function.
  • Tanner JE, Alfieri C, Chatila TA, and az-Mitoma F Induction of interleukin-6 after stimulation of human B-cell CD21 by Epstein-Barr virus glycoproteins gp350 and gp220. J Virol 70: 570-575, 1996. Wang F, Gregory C, Sample C, Rowe M, Liebowitz D, Murray R, Rickinson A, and Kieff E: Epstein-Barr virus latent membrane protein (LMPl) and nuclear proteins 2 and 3C are effectors of phenotypic changes in B lymphocytes: EBNA-2 and LMPl cooperatively induce CD23. J Virol 64: 2309-2318, 1990.
  • Epstein-barr virus nuclear antigen 3C activates the latent membrane protein 1 promoter in the presence of Epstein-Barr virus nuclear antigen 2 through sequences encompassing an spi-1/Spi-B binding site. J Virol 74: 5151-5160, 2000.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Virology (AREA)
  • Medicinal Chemistry (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Organic Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Microbiology (AREA)
  • Food Science & Technology (AREA)
  • Cell Biology (AREA)
  • Biotechnology (AREA)
  • Analytical Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Genetics & Genomics (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The present inventors have identified a new sub-family of vGPCRs, the BILF1 receptors, encoded by EBV and other Ϝl-herpesviruses. The studies presented in the present application of human EBV BILF1 and the closely related homolog from rhesus EBV show that these receptors are functional GPCRs, constitutively signalling through Gαj. The present application furthermore discloses the use of this sub-family of GPCRs for screening of compounds capable of treating Ϝ1-herpesviruses related diseases and diagnostic and prognostic methods.

Description

BILFl A , CONSTITUTIVE ACTIVE G-PROTEIN RECEPTOR
FIELD OF THE INVENTION
The present invention relates to a novel constitutively active G protein coupled receptor of γl-herpesviruses. The invention further relates to a method for identifying a compound capable of modifying a signal of the constitutively active G protein coupled receptor of a γl- herpesvirus, to a method for identifying a γl-herpesvirus in a mammal, to a method for modifying the signal of the constitutively active G protein coupled receptor in a γl- herpesvirus infected mammal, and to a method of treating a γl-herpesvirus related disease.
BACKGROUND OF THE INVENTION
The family of guanine nucleotide-binding (G) protein-coupled receptors (GPCRs) has been estimated to be comprised of as many as 1000 members, fully more than 1.5% of all the proteins encoded in the human genome, that are thought to regulate function of virtually every cell in the body. Furthermore, it has been estimated that more than 50% of the drugs in use clinically in humans at the present time are directed at GPCRs.
Many β- and γ-herpesviruses have acquired GPCRs, some of which are functional chemokine receptors. While all members of the β-herpesvirus family, e.g. cytomegalovirus (CMV) encode GPCR homologs, it is the general notion that γl-herpesviruses, e.g. EBV, unlike γ2-herpesviruses, e.g. Kaposis sarcoma associated herpesvirus (KSHV), do not encode GPCR homologs (Rickinson, A. and E. Kieff).
In general, GPCRs require agonist binding for activation. Constitutive (or agonist- independent) signalling activity in mutant receptors has been well documented, but only a few GPCRs have been shown to exhibit agonist-independent activity in the wild type (or native) form.
Most virus encoded GPCRs (vGPCR), including UL33, M33, R33, UL78, M78, R78, US27 and US28 are dispensable for viral growth in tissue culture. However, several in vivo studies have revealed that vGPCRs are highly significant for viral replication and for virus induced pathogenesis in the natural hosts.
Murine γHV68 ORF74 knock out virus for example suffers from decreased efficiency of reactivation from latency both in vitro and in vivo compared to wild type virus. This is surprising since ORF74 is regarded as an early lytic gene and is not expressed in the vast majority of otherwise latently infected cells. This suggests that lytic replication can transform latently infected cells, presumably through paracrine mechanisms. The activities and biological effects of the KSHV encoded chemokine receptor ORF74 are well characterized.
ORF74 is highly constitutively active and mediates its signals through several different Ga proteins and by activating βγ-subunits. As a result, ORF74 triggers several of the major signalling transduction pathways, including the phospholipase C (PLC) and protein kinase C pathways (PKC), the phosphoinosital-3'-kinase (PI3K) - AKT/protein kinase B (PKB) pathway, and the mitogen activated protein kinase (MAPK) pathways; JNK, p38 and p44/p42 MAPK.
Consequently, ORF74 induces various growth factors and angiogenic and proinflammatory cytokines. Through activation of VEGF, ORF74 stimulates the proliferation of transfected cells and induce angiogenesis of human umbilical vein endothelial cells (HUVECs). Injection of ORF74 expressing mouse fibroblasts into the flank of nude mice causes vascularized tumors, and most significantly, transgenic mice expressing ORF74 ubiquitously or within hematopoietic or endothelial cells develop Kaposi's sarcoma (KS) -like lesions in multiple organs.
Therefore ORF74 is considered the key viral oncogene in KS pathogenesis.
The EBV genome was sequenced and annotated twenty years ago (Baer, R., et al.).
The EBV annotation is based on a BamHI fragments, and the BILFl ORF is localized to the small I BamHI-fragment. At least two lytic transcripts, a 1.1kb and a 1.4 kb transcript, are known to be expressed from this region (Hummel, M. and E. Kieff).
Epstein-Barr virus (EBV) is a human gammaherpesvirus that causes severe and sometimes lethal lymphoproliferative diseases, such as Hodgkin's disease, which is the most common lymphoma in the Western world.
SUMMARY OF THE INVENTION
Although numerous studies have addressed many aspects of the biology of EBV, it is striking that a potentially crucial viral gene has hitherto escaped attention. This gene, which was originally designated BILFl, is unique to EBV, and the present inventors discovered that it encodes a GPCR homolog. This is the first time a function is related to this sequence. The present inventors surprisingly discovered that BILF-I encodes a GPCR which constitutively signals through G α (alpha) proteins of the i-class (Gαi), and describes that the oncogenicy of the γl-herpesviruses like γ2-herpesviruses may be due to constitutively active GPCRs, thus BILF-I is a target for drug discovery of γl-herpesviruses related diseases.
The present application thus relates to a method for identifying a compound capable of modifying a signal of a constitutively active G protein coupled receptor of a γl-herpesvirus, said method comprising a) contacting the constitutively active G protein coupled receptor or a functional part thereof with a compound to be screened, and b) determining whether the signal of said constitutively active G protein coupled receptor or a functional part thereof is modified by said compound.
The invention further provides a method for identifying a γl-herpesvirus in a mammal, said method comprising determining the presence of a constitutively active G protein coupled receptor of a γl-herpesvirus in a sample obtained from said mammal.
Moreover, the invention relates to a method for identifying a γl-herpesvirus in a mammal, said method comprising a) determining the level of a constitutively active G protein coupled receptor of a γl-herpesvirus in a sample obtained from said mammal, and b) evaluating the level of said constitutively active G protein coupled receptor measured in step (a) relative to a reference value for said receptor of said mammal.
Another aspect of the present invention relates to a method for modifying the signal of a constitutively active G protein coupled receptor in a γl-herpesvirus infected mammal, comprising administrating, to the mammal, a compound capable of specifically binding to said constitutively active G protein coupled receptor, the compound being administered in an amount effective to modify the signal.
The invention also provides a method of treating or preventing a γl-herpesvirus related disease comprising modifying a constitutively active G protein coupled receptor of the γl- herpesvirus.
DETAILED DESCRIPTION OF THE INVENTION
"Operably linked" refers to the covalent joining of two or more nucleotide sequences, by means of enzymatic ligation or otherwise, in a configuration relative to one another such that the normal function of the sequences can be performed. For example, the nucleotide sequence encoding a presequence or secretory leader is operably linked to a nucleotide sequence for a polypeptide if it is expressed as a preprotein that participates in the secretion of the polypeptide: a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence; a ribosome binding site is operably linked to a coding sequence if it is positioned so as to facilitate translation. Generally, "operably linked" means that the nucleotide sequences being linked are contiguous and, in the case of a secretory leader, contiguous and in reading phase. Linking is accomplished by ligation at convenient restriction sites. If such sites do not exist, then synthetic oligonucleotide adaptors or linkers are used, in conjunction with standard recombinant DNA methods.
The term "control sequences" is defined herein to include all components, which are necessary or advantageous for the expression of a polypeptide of the present invention. Each control sequence may be native or foreign to the nucleotide sequence encoding the polypeptide. Such control sequences include, but are not limited to, a leader, polyadenylation sequence, propeptide sequence, promoter, signal peptide sequence, and transcription terminator. At a minimum, the control sequences include a promoter, and transcriptional and translational stop signals. The control sequences may be provided with linkers for the purpose of introducing specific restriction sites facilitating ligation of the control sequences with the coding region of the nucleotide sequence encoding a polypeptide.
In the present context, the term "expression vector" covers a DNA molecule, linear or circular, that comprises a segment encoding a polypeptide, and which is operably linked to additional segments that provide for its transcription.
The term "host cell", as used herein, includes any cell type which is susceptible to transformation with a nucleic acid construct.
Ki,
IC50 Ki =
1+([L]/Kd)
Kd, The Kd value is the equilibrium dissociation constant: K-! [L] x [R]
Kd =
Figure imgf000006_0001
It is apparent that [R] equals [LR] when Kd equals [L]
K-1 = dissociation rate constant K+1 = association rate constant
The dissociation and association rate constants are defined according to the equilibrium:
K+1 [L] + [R] «-> [LR]
Figure imgf000006_0002
[L] = the concentration of the free ligand [R] = the concentration of free receptor [LR] = the concentration of receptor ligand complex
IC50: The inhibition concentration 50%, the IC50 value is the concentration of an inhibitor ligand that reduces the binding of a radio- (labelled) ligand/substrate with 50%
The present application describes that the EBV encoded ORF, BILFl encodes a functional GPCR.
The present inventors surprisingly discovered that BILFl contained several hallmarks of GPCRs, including seven hydrophobic trans-membrane domains, conserved cysteines in the amino terminal and in the extra cellular loops, amino-terminal glycosylation sites and intracellular phosphorylation sites, and thus set out to test, whether BILFl was a functional GPCR.
The present inventors here show that BILFl is expressed as a heavily glycosylated membrane protein and that BILFl is a highly potent GPCR, constitutively signalling through Ga1.
Given the importance of ORF74 mediated activity for γ2 herpesvirus replication and for the development of KS, it is intriguing that also the oncogenic γl-herpesviruses encode constitutively active GPCRs. Thus, BILF-I influence cellular transformation and oncogenesis, a process conventionally believed to be associated with latent genes only. BILF-I is therefore a target for intervention against e.g. endemic Burkitt's lymphoma, nasopharyngeal carcinoma, Hodgkin's disease, gastric carcinoma, leiomyosarcoma and AIDS- and transplant- associated B cell lymphomas.
The present invention relates to a method for identifying a compound capable of modifying a signal of a constitutively active G protein coupled receptor of a γl-herpesvirus, said method comprising
a) contacting the constitutively active G protein coupled receptor or a functional part thereof with a compound to be screened, and
b) determining whether the signal of said constitutively active G protein coupled receptor or a functional part thereof is modified by said compound.
In a presently preferred embodiment the present invention relates to a method according to the present invention, wherein said γl-herpesvirus is an Epstein-Barr virus. In a more preferred embodiment, the γl-herpesvirus is a human Epstein-Barr virus.
Herpesvirus
Membership in the family Herpesviridae is based on the architecture of the virion. The members of the family Herpesviridae were initially classified into three subfamilies, the Alphaherpesvirinae, the Betaherpesvirinae, and the Gammaherpesvirinae on the basis of biologic properties.
Gamma herpesvirus The experimental host range of the members of the subfamily Gammaherpesvirinae is limited to the family or order to which the natural host belongs. In vitro, all members replicate in lymphoblastoid cells, and some also cause lytic infections in some types of epithelioid and fibroblastic cells. Viruses in this group are usually specific for either T or B lymphocytes. Latent virus is frequently demonstrated in lymphoid tissue. This subfamily contains two genera: γl-herpesvirus (Lymphocryptovirus) , and γ2-herpesvirus (Rhadinovirus). γl -herpesvirus
EBV is the only presently known human γl-herpesvirus, and the recently discovered Kaposi's sarcoma-associated herpesvirus (KSHV) is the only presently known human γ2- herpesvirus.
The γl-herpesvirus genomes are very similar to each other in structure and gene organization. In general, their DNAs are composed of colinearly homologous sequences. The γl-herpesvirus share structural features such as similar 0.5-kbp terminal (TR), 3-kbp internal (IRl), and short internal (IR2, IR4) tandem direct repeats. The γl-herpesvirus open reading frames (ORFs) also encode colinearly homologous, antigenically related, structural and nonstructural proteins.
A dendrogram of herpesvirus encoded G protein-coupled receptors based on their amino acid identities are shown in figure 3.
γl-herpesvirus genomes include genes that are shared by most herpesviruses, genes that are shared among gamma herpesviruses but not with other herpesviruses, and a number of genes that are characteristic only of γl-herpesvirus, including homologs of EBV BALFl, BILFl, EBNA-I, BZLFl, BZLF2 and gp350.
γl-herpesvirus and γ2-herpesvirus are clearly distinct genera. The sequence homology between e.g. EBV and KSHV is insufficient to detect significant cross-reactive antibody or T-cell responses. Primates including humans can be persistently systemically infected by viruses of both genera. Whereas γl-herpesvirus are able to efficiently immortalise B lymphocytes of their natural host, γ2-herpesvirus lack similar activity.
Epstein Barr
The EBV variants EBV-I and EBV-2 differ markedly in several nuclear antigen (EBNA) gene sequences. The differences lead to differences in some biologic properties, including transforming potential. However, (a) the variants do not occupy distinct ecologic niches, (b) the differences map to a small number of genes, and (c) intermediates carrying one variant allele at one locus and the other variant allele at another locus have been detected. Thus the EBV variants must be recognized as allelic variants of the same species.
Taxonomists have renamed EBV as human herpesvirus 4 (HHV4).
Modification of the signal of the receptors
As the skilled addressee would recognise, a constitutively active signal in a G protein coupled receptor may be modified by a ligand, such ligand may reduce or induce the signal of said receptor. Thus, the present invention also relates to receptors according to the present invention, which can be modified by such ligands. Such ligands can e.g. be agonists, neutral ligands or invers agonists (negative antagonists).
In the present context the term "modifying the signal of a GPCR" relates to altering the signal of said receptor, such as, reducing, blocking, inhibiting, or even enhancing said signal. As described above said modification could e.g. be mediated by a ligand.
The receptors of the present invention In the present context a "G protein coupled receptor (GPCR)" is a 7 transmembrane receptor that is able to couple to at least one GTP binding protein/GTPase (G protein).
In the present context, the term "a constitutively active G protein coupled" relates to a G protein coupled receptor that mediates a signal without activation by a receptor ligand (agonist).
An active GPCR bind to at least one active G protein. A G protein is active when it is bound to GTP. Hydrolysis of GTP to GDP regenerates the resting state of the G protein.
More specifically, a γl-herpesvirus G protein coupled receptor according to the present invention comprises a G protein coupled receptor, which contains seven hydrophobic transmembrane domains and at least 4 conserved cysteins placed as follows:
1. in the N-terminal extracellular domain 2. in the extracellular loop 1, situated in beginning of the transmembrane domain
3,
3. in the extracellular loop 2,
4. in the extracellular loop 3
and is constitutively active.
Receptor sequences
The receptors of the present invention all disclose a new distinct family and a dendrogram of herpesvirus encoded G protein-coupled receptors based on their amino acid identities are shown in figure 3. Thus, in one preferred embodiment such receptor comprises at least one nucleotide sequence selected from the group consisting of a) SEQ ID NO.: 1; and b) a sequence having at least 80% sequence identity to a)
In another embodiment such receptor comprises at least one nucleotide sequence sequence selected from the group consisting of a) SEQ ID NO.: 2-8 and b) a sequence having at least 80% sequence identity to a)
In another preferred embodiment such receptor comprises at least one amino acid sequence selected from the group consisting of a) SEQ ID NO. : 9; and b) a sequence having at least 80% sequence identity to a)
In another embodiment such receptor comprises at least one amino acid sequence selected from the group consisting of a) SEQ ID NO.: 10-16 and b) a sequence having at least 80% sequence identity to a)
Overview of sequences related to the present invention obtained for the current online databases:
Table 1
Figure imgf000010_0001
Figure imgf000011_0001
nt = nucleotide number according to the given genbank sequence accession number
In a presently preferred embodiment, the present invention relates to a method according to the present invention, wherein said constitutively active G protein coupled receptor has at least 80% identity to the amino acid sequence of human BILF-I (SEQ ID NO: 9). In another preferred embodiment, the constitutively active G protein coupled receptor has at least 95 % identity to amino acid sequence of human BILF-I (SEQ ID NO: 9). In yet another preferred embodiment, the constitutively active G protein coupled receptor is encoded by a nucleotide sequence having at least 80% identity to the nucleotide sequence of human BILFl (SEQ ID NO: 1).
In the present context the term "at least 80% identity" relates to sequence similarities such as at least 81% identity, such as at least 82% identity, such as at least 83% identity, such as at least 84% identity, such as at least 85% identity, such as at least 86% identity, such as at least 87% identity, such as at least 88% identity, such as at least 89% identity, such as at least 90% identity, such as at least 91% identity, such as at least 92% identity, such as at least 93% identity, such as at least 94% identity, such as at least 95% identity, such as at least 96% identity, such as at least 97% identity, such as at least 98% identity, such as at least 99% identity or even 100% identity.
The term "identical" or "identity," in the context of two or more nucleic acid or polypeptide sequences, refers to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same, when compared and aligned for maximum correspondence, as measured using one of the following sequence comparison algorithms or by visual inspection.
"Sequence identity" is a measure of identity between polypeptides at the amino acid level and a measure of identity between nucleic acids at nucleotide level. The protein sequence identity may be determined by comparing the amino acid sequence in a given position in each sequence when the sequences are aligned. Similarly, the nucleic acid sequence identity may be determined by comparing the nucleotide sequence in a given position in each sequence when the sequences are aligned To determine the percent identity of two amino acid sequences or of two nucleic acids, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in the sequence of a first amino acid or nucleic acid sequence for optimal alignment with a second amino or nucleic acid sequence). The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences (i.e., % identity # of identical positions/total # of positions (e.g., overlapping positions) x 100). In one embodiment the two sequences are the same length.
Alignment of two sequences for the determination of percent identity is to be accomplished by using a mathematical algorithm published (Tatusova and Madden, 1999). BLAST nucleotide alignments is be performed with the blastn program, with the parameters
"Reward for a match" = 1, "Penalty for a mismatch" = -2, "Strand option" = both strands, "Open gap" = 5, "Extension gap" = 2, "gapx_dropoff" = 50, "expect" = 10.0, "word size" = 11 and "Filter" = on.
BLAST protein searches can be performed with the blastp program applying the "BLOSUM26" matrix, with the parameters "Reward for a match" = 1, "Penalty for a mismatch" = -2, "Open gap" = 11, "Extension gap" = 1, "gapx_dropoff" = 50, "expect" = 10.0, "word size" = 3 and "Fliter" = on.
Both programs can be accessed from National Center for Biotechnological Information's web page at http://www.ncbi.nlm.nih.gov/blast/bl2seq/bl2.html
In all polypeptide or amino acid based embodiments of the invention the percentage of sequence identity between one or more sequences is based on alignment of the respective sequences as performed by clustalW software (http:/www. ebi.ac.uk/clustalW/index. htm!) using the default settings of the program. These settings are as follows: Alignment=3Dfull, Gap Open 10.00, Gap Ext. 0.20, Gap separation Dist. 4, Protein weight matrix: Gonnet. With respect to the nucleotide-based embodiments of the invention, the percentage of sequence identity between one or more sequences is also based on alignments using the clustalW software with default settings. For nucleotide sequence alignments these settings are: Alignment=3Dfull, Gap Open 10.00, Gap Ext. 0.20, Gap separation Dist. 4, DNA weight matrix: identity (IUB). Functional part of the constitutively active G protein coupled receptor
In another embodiment only a part of the constitutively active G protein coupled receptor could be made accessible to the compound. E.g. the N-terminal extracellular part of the receptor could be used as a target for screening of compounds for high affinity to that part of the receptor. High affinity hits could then subsequently be tested for binding to the whole receptor, e.g. expressed in cells.
Thus in one embodiment, the invention relates to a method, wherein the functional part of said receptor has at least 80 % identity such as e.g. at least 85%, or such as e.g. or such as e.g. 90%, or such as e.g. or such as e.g. 95 %, or such as e.g. at least 96%, or such as e.g. at least 97%, or such as e.g. at least 98%, or such as e.g. at least 99 % or such as e.g. 100% to an amino acid sequence selected from the group consisting of the amino acid sequence defined by amino acid No. 1 to amino acid No. 24 of human BILF-I (SEQ ID NO: 9), the amino acid sequence defined by amino acid No. 1 to amino acid No. 30 of human BILF-I (SEQ ID NO: 9), the amino acid sequence defined by amino acid No. 5 to amino acid No. 30 of human BILF-I (SEQ ID NO: 9), the amino acid sequence defined by amino acid No. 1 to amino acid No. 60 of human BILF-I (SEQ ID NO: 9), the amino acid sequence defined by amino acid No. 1 to amino acid No. 91 of human BILF-I (SEQ ID NO: 9), the amino acid sequence defined by amino acid No. 1 to amino acid No. 220 of human BILF-I (SEQ ID NO: 9), the amino acid sequence defined by amino acid No. 91 to amino acid No. 220 of human BILF-I (SEQ ID NO: 9), the amino acid sequence defined by amino acid No. 91 to amino acid No. 312 of human BILF-I (SEQ ID NO: 9), the amino acid sequence defined by amino acid No. 221 to amino acid No. 312 of human BILF-I (SEQ ID NO: 9), the amino acid sequence defined by amino acid No. 261 to amino acid No. 312 of human BILF-I (SEQ ID NO: 9), the amino acid sequence defined by amino acid No. 291 to amino acid No. 312 of human BILF-I (SEQ ID NO: 9).
Candidate compound Various candidate compounds can be screened for their effectiveness as modulators of the constitutively active GPCRs of the present invention. Candidate compounds can be, for example, traditional chemical compounds or peptides and any suitable test substance can be screened in the subject methods of the present invention.
Compounds of the present invention includes any such which is amenable to a screening technique. Compounds of the present invention includes any such which is able to inhibit a possible natural ligand.
Preferably, the "candidate compound" does not include compounds which were publicly known to be compounds selected from the group consisting of inverse agonist, agonist or antagonist to a receptor, as previously determined by an indirect identification process ("indirectly identified compound"); more preferably, not including an indirectly identified compound which has previously been determined to have therapeutic efficacy in at least one mammal; and, most preferably, not including an indirectly identified compound which has previously been determined to have therapeutic utility in humans.
Directly identifying or directly identified, in relationship to the phrase "candidate compound", shall mean the screening of a candidate compound against a constitutively activated receptor of the present invention, and assessing the compound efficacy of such compound. This phrase is, under no circumstances, to be interpreted or understood to be encompassed by or to encompass the phrase "indirectly identifying" or "indirectly identified".
In a presently preferred embodiment of the invention, the compound modifies the signal of the constitutively active G protein coupled receptor or a functional part thereof by inhibiting said signal.
Inhibiting the constitutively active G protein coupled receptor of the γl-herpesvirus according to the present invention may also be obtained by blocking said receptor by a ligand as described above, or by destroying the overall receptor structure by e.g. enzymatic degradation, deglycosylation, or cleavage, or by inhibiting the expression of said receptor e.g. by using siRNA, synthetic antisense nucleotides or other strategies known to the skilled addressee, or by blocking the signal transduction e.g. specifically inhibiting the interaction between the receptor and the g-protein or the down stream pathways.
In a presently preferred embodiment, the present invention relates to a method according to the present invention, wherein the modification is a inhibition of the signal of at least 5%, such as at least 6% inhibition of the signal, such as at least 7% inhibition of the signal, such as at least 8% inhibition of the signal, such as at least 9% inhibition of the signal, such as at least 10% inhibition of the signal, such as at least 15% inhibition of the signal, such as at least 20% inhibition of the signal, such as at least 25% inhibition of the signal, such as at least 30% inhibition of the signal, such as at least 35% inhibition of the signal, such as at least 40% inhibition of the signal, such as at least 45% inhibition of the signal, such as at least 50% inhibition of the signal, such as at least 55% inhibition of the signal, such as at least 60% inhibition of the signal, such as at least 65% inhibition of the signal, such as at least 70% inhibition of the signal, such as at least 75% inhibition of the signal, such as at least 80% inhibition of the signal, such as at least 85% inhibition of the signal, such as at least 90% inhibition of the signal, such as at least 95% inhibition of the signal, such as at least 96% inhibition of the signal, such as at least 97% inhibition of the signal, such as at least 98% inhibition of the signal, such as at least 99% inhibition of the signal, or such as 100% inhibition of the signal.
Inhibition of the signal can be measured by, but not limited to, one of the methods described below in the paragraph 'Screening for modulators'. Briefly, the constitutively active G protein coupled receptor of a γl-herpesvirus is made accessible to the compound, the compound to be screened is added to the receptor and contacting the receptor. The signal of said constitutively active G protein coupled receptor is then measured.
'The receptor signal above the background signal in the presence of the compound' (RL) is compared to 'the signal above the background signal generated by the receptor alone' (R).
% inhibition of the signal can be calculated as:
100 - (RL/R) X 100
background signal = the signal measured in the assay of choice without addition/activation of the receptor
Screening for modulators
The traditional study of receptors has always proceeded from the a priori assumption (historically based) that the endogenous ligand must first be identified before discovery could proceed to find antagonists and other molecules that could affect the receptor. Even in cases where an antagonist might have been known first, the search immediately extended to looking for the endogenous ligand. This mode of thinking has persisted in receptor research even after the discovery of constitutively activated receptors.
What has not been heretofore recognized is that it is the active state of the receptor that is most useful for discovering agonists, partial agonists, and inverse agonists of the receptor. For those diseases, which result from an overly active receptor, what is desired in a therapeutic drug is a compound which acts to diminish the active state of a receptor, not necessarily a drug which is an antagonist to the endogenous ligand. This is because a compound (drug) that reduces the activity of the active receptor state need not bind at the same site as the endogenous ligand.
Thus, as taught by the methods of this invention, any search for therapeutic compounds should start by screening compounds against the ligand-independent active state.
Screening candidate compounds against the constitutively activated receptors of the present invention, allows for the direct identification of candidate compounds which act at these receptors, without requiring any prior knowledge or use of the receptor's endogenous ligand. By determining areas within the body where such receptors are expressed and/or over-expressed, it is possible to determine related disease/disorder states which are associated with the expression and/or over-expression of these receptors; such an approach is disclosed in this application.
Human EBV encoded BILFl is glycosylated in the N-terminal. It has previously been descriped that receptor glycosylation can be important for a correct function of the protein. Especially ligand binding to a GPCR seems to be affected by alterations in receptor glycosylation. For example, it has been shown, that certain chemotactic cytokines (chemokines), e.g. chemokines binding to the CCR5 chemokine receptor, are dependent on receptor glycosylation to be able to bind and activate the receptor.
The present invention therefore comprises a method for specifically interfering with BILFl glycosylation, that being inhibiting receptor glycosylation, deglycosylating the receptor, or binding of a compound to the glycosylation moieties to inhibit the activity of the receptor or to inhibit the interaction of the receptor to a natural ligand. Thus , the invention relates to a method wherein the compound is modifying the signal of the constitutively active G protein coupled receptor or a functional part thereof by interfering with receptor glycosylation.
As described above, the term "modifying the signal of a GPCR" relates to altering the signal of said receptor, such as, reducing, blocking, inhibiting, or even enhancing said signal. In one embodiment the invention relates to a method, wherein the compound is modifying the signal of the constitutively active G protein coupled receptor or a functional part thereof by binding to the receptor or to a functional part thereof.
In a particular preferred embodiment, determining the affinity of a compound capable of binding to said receptor is a part of the herein presented screening method. In one embodiment, the invention relates to a method, wherein the compound binds to the constitutively active G protein coupled receptor or a functional part thereof with an affinity wherein the value of k, or kd is at most 1000 nM, such as e.g. at most 900 nM, or such as e.g. at most 800 nM, or such as e.g. at most 700 nM, or such as e.g. at most 600 nM, or such as e.g. at most 500 nM, or such as e.g. at most 400 nM, or such as e.g. at most 300 nM, or such as e.g. at most 250 nM, or such as e.g. at most 200 nM, or such as e.g. at most 150 nM, or such as e.g. at most 100 nM, or such as e.g. at most 90 nM, or such as e.g. at most 80 nM, or such as e.g. at most 70 nM, or such as e.g. at most 60 nM, or such as e.g. at most 50 nM, or such as e.g. at most 40 nM, or such as e.g. at most 30 nM, or such as e.g. at most 20 nM, or such as e.g. at most 10 nM. Said affinity being obtained in a receptor binding assay.
In another embodiment, the invention relates to a method, wherein the compound in a receptor binding assay exhibits an IC50 value of less than 1000 nM, such as e.g. less than 900 nM, or such as e.g. less than 800 nM, or such as e.g. less than 700 nM, or such as e.g. less than 600 nM, or such as e.g. less than 500 nM, or such as e.g. less than 400 nM, or such as e.g. less than 300 nM, or such as e.g. less than 200 nM, or such as e.g. less than 100 nM, or such as e.g. less than 90 nM, or such as e.g. less than 80 nM, or such as e.g. less than 70 nM, or such as e.g. less than 60 nM, or such as e.g. less than 50 nM, or such as e.g. less than 40 nM, or such as e.g. less than 30 nM, or such as e.g. less than 20 nM, or such as e.g. less than 10 nM.
Receptor binding assay can be selected from the group consisting of competition binding assay, saturation binding assay, fluorescence polarization assay, Biacore assay and surface plasmon resonance based assay as described further below.
One screening method could be a competition binding assay known to the skilled addressee, and a compound with an affinity higher than 50 nM are preferable. These compounds may be antibodies, peptides, binders generated through phage display or chemical compound screening.
In a presently preferred embodiment the present invention relates to a method for identifying a compound capable of modifying a signal of a constitutively active G protein coupled receptor of a γl-herpesvirus, wherein said method is adapted to a high-through- put screening system.
Diagnostic method In one aspect the present invention relates to a method for identifying a γl-herpesvirus in a mammal, said method comprising determining the presence of a constitutively active G protein coupled receptor of a γl-herpesvirus in a sample obtained from said mammal. The presence of BILF-I in patients with γl-herpesvirus related diseases such as e.g. Post transplant lymphoproliferative disease, nasopharayngeal carcinoma, non Hodgkin lymphoma, burkitt's lymphoma and Gastric carcinoma is shown in the examples.
In a further aspect, the invention relates to a method for identifying a γl-herpesvirus in a mammal, said method comprising
a) determining the level of a constitutively active G protein coupled receptor of a γl-herpesvirus in a sample obtained from said mammal,
b) evaluating the level of said constitutively active G protein coupled receptor measured in step (a) relative to a reference value for said receptor of said mammal.
In one embodiment, the mammal has the risk of developing malignant transformation and/or tumorgenesis.
In yet a further embodiment, the γl-herpesvirus is an Epstein-Barr virus. In a preferred embodiment, the γl-herpesvirus is a human Epstein-Barr virus.
In one embodiment, the constitutively active G protein coupled receptor has at least 80% identity to amino acid sequence of human BILF-I (SEQ ID NO: 9), such as e.g. at least 85 % identity, or such as e.g. at least 90 % identity, or such as e.g. at least 91 % identity, or such as e.g. at least 92 % identity, or such as e.g. at least 93% identity, or such as e.g. at least 94 % identity, or such as e.g. at least 95% identity, or such as e.g. at least 96 % identity, or such as e.g. at least 97 % identity, or such as e.g. at least 98 % identity, or such as e.g. at least 99 % identity, or such as e.g. 100 % identity.
In another embodiment, the constitutively active G protein coupled receptor is encoded by a nucleotide sequence having at least 80% identity to the nucleotide sequence of human BILFl (SEQ ID NO: 1) such as e.g. at least 85 % identity, or such as e.g. at least 90 % identity, or such as e.g. at least 91 % identity, or such as e.g. at least 92 % identity, or such as e.g. at least 93% identity, or such as e.g. at least 94 % identity, or such as e.g. at least 95% identity, or such as e.g. at least 96 % identity, or such as e g. at least 97 % identity, or such as e.g. at least 98 % identity, or such as e.g. at least 99 % identity, or such as e.g. 100 % identity. In a further embodiment, the level of said constitutively active G protein coupled receptor measured in step (a) is increased at least 5 % compared to the reference value for the receptor of said mammal, such as e.g. at least 10 %, or such as e.g. at least 15 %, or such as e.g. at least 20 %, or such as e.g. at least 25 %, or such as e.g. at least 30 %, or such as e.g. at least 35 %, or such as e.g. at least 40 %, or such as e.g. at least 50%, or such as e.g. at least 60 %, or such as e.g. at least 70%, or such as e.g. at least 80 , or such as e.g. at least 90 %, or such as e.g. at least 100 % compared to the reference value for the receptor of said mammal.
The receptor expression level correlates to the risk for malignant transformation and tumorgenesis in the infected mammals, and thus all cancer diseases related to EBV infection are within the scope of malignant transformation described herein.
The reference
In order to determine the risk of malignant transformation, e.g. Burkitts lymphoma the means for evaluating the detectable level of a constitutively active G protein coupled receptor in a sample obtained from said mammal measured involves a reference or reference means. The reference also makes it possible to count in assay and method variations, kit variations, handling variations and other variations not related directly or indirectly to level of a constitutively active G protein coupled receptor.
The reference value is a value which has been determined by measuring the level of said constitutively active G protein coupled receptor in both a healthy control population and a population with known γl-herpesvirus associated disease thereby determining the reference value which identifies the γl-herpesvirus associated disease population with either a predetermined specificity or a predetermined sensitivity based on an analysis of the relation between the level of said constitutively active G protein coupled receptor and the known clinical data of the healthy control population and the γl-herpesvirus associated disease patient population. The reference value determined in this manner is valid for the same experimental setup in future individual tests.
In determining the reference value distinguishing individuals with a high versus low probability of having a γl-herpesvirus associated disease, a person skilled in the art has to predetermine the level of specificity. The ideal screening test is a test that has 100% specificity, i.e., only detects diseased individuals and therefore no false positive results, and 100% sensitivity, i.e., detects all diseased individuals and therefore no false negative results. However, due to biological diversity no method can be expected to be 100% sensitive without including a substantial number of false positive results. The chosen specificity determines the percentage of correctly identified negative cases (i.e., disease free) and false positive cases that can be accepted in a given study/population and by a given institution. By decreasing specificity, an increase in sensitivity is achieved. One example is a specificity of 95% which will result in a 5% rate of false positive cases, or 95% of true negatives. With a given prevalence of 1% of a γl- herpesvirus associated disease in a screening population, a 95% specificity for a 100 individuals screening sample means that 5 individuals will undergo further physical examination in order to detect one (1) γl-herpesvirus associated disease case if the sensitivity of the test is 100%.
A way of using the information obtained by measuring the level of the bio-markers, such as the level of a constitutively active G protein coupled receptor, of the present invention to identify the discriminating value is comprised by the following steps:
a) determining a level of a constitutively active G protein coupled receptor in a sample isolated from the individual;
b) constructing a percentile plot of the constitutively active G protein coupled receptor level obtained from a non-cancer population;
c) constructing a ROC (receiver operating characteristics) curve based on the constitutively active G protein coupled receptor levels determined in a non-diseased population and a diseased population;
d) selecting a desired sensitivity;
e) determining from the ROC curve the specificity corresponding to the desired sensitivity;
f) determining from the percentile plot the constitutively active G protein coupled receptor level value corresponding to the determined specificity
and finally indicating the individual as likely to have a γl-herpesvirus associated disease if the constitutively active G protein coupled receptor level in the sample which is isolated from the individual is equal to or higher than said constitutively active G protein coupled receptor level value corresponding to the determined specificity and indicating the individual as unlikely to have a γl-herpesvirus associated disease if the constitutively active G protein coupled receptor level in the sample isolated from the individual is lower than said constitutively active G protein coupled receptor level value corresponding to the determined specificity.
In the context of the present invention, the term "reference" relates to a standard in relation to quantity, quality or type, against which other values or characteristics can be compared, such as e.g. a standard curve.
In one preferred embodiment of the present invention, the reference means is an internal reference means and/or an external reference means.
In the present context, the term "internal reference means" relates to a reference which is not handled by the user directly for each determination but which is incorporated into a device for the determination of the level of a constitutively active G protein coupled receptor, whereby only the 'final result1 or the 'final measurement' is presented. The terms the "final result" or the "final measurement" relates to the result presented to the user when the reference value has been taken into account.
In a further embodiment of the present invention, the internal reference means is provided in connection to a device used for the determination of the level of a constitutively active G protein coupled receptor.
In the present context, the term "external reference means" relates to a reference which is handled directly by the user in order to determine the level of a constitutively active G protein coupled receptor, before obtaining the 'final result' or the 'final measurement'.
In yet a further embodiment of the present invention external reference means are selected from the group consisting of a table, a diagram and similar reference means where the user can compare the measured signal to the selected reference means. The external reference means relate to a reference used as a calibration, value reference, information object, etc. for the level of a constitutively active G protein coupled and which has been excluded from the device used.
G protein of the G protein coupled receptor
When a G protein receptor becomes constitutively active, it binds to a G protein (e.g., Gq, Gs, Gi/o and G12/13) and stimulates the binding of GTP to the G protein. Alternatively, a constitutively active receptor is contained in a active conformation that preferably allows interactions with already activated (GTP-bound) G proteins. The G protein then acts as a GTPase and hydrolyzes the GTP to GDP, whereby the receptor, under normal conditions, becomes deactivated. However, constitutively activate receptors continue to interact with (and/oractivate) active G-proteins.
Please note that the notation of G proteins can be quite bewildering. In the present context Gi, Gαi, Gi/o and Gαi/o all relates to the same class, whereas Gq, Gs and G12/13 are distinct classes.
In one embodiment, the invention relates to a method, wherein the constitutive activity is mediated though Gαi.
Method for modifying the signal of a constitutively active G protein coupled receptor in a γl- herpesvirus infected mammal
One aspect of the present invention relates to a method for modifying the signal of a constitutively active G protein coupled receptor in a γl-herpesvirus infected mammal e.g. having a risk of developing a γl-herpesvirus associated disease, comprising administrating, to the mammal, a substance capable of specifically binding to said constitutively active G protein coupled receptor, the substance being administered in an amount effective to modify the signal. In a preferred embodiment, the compound is as defined above.
Diseases
As described above, ORF74 mediated activity for γ2 herpesvirus replication and thereby develop. The present inventors have surprisingly discovered that a similar mechanism is in fact responsible for the oncogenic γl-herpesviruses.
BILF-I influence cellular transformation and oncogenesis, a process normally associated with latent genes only. BILF-I is therefore a target for γl-herpesvirus related diseases such as but no limited to
i. Infectious Mononucleosis ii. X-linked Lymphoproliferative Syndrome and Fatal Infectious
Mononucleosis iii. Virus-Associated Hemophagocytic Syndrome iv. Chronic Active Epstein-Barr Virus Infection v. Clinically Apparent Virus Replicative Lesions vi. Lymphomas in Congenitally Immunodeficient Patients vii. Posttransplantation Lymphomas / post-transplant lymphoproliferative disease (PTLD) ViIi. Acquired Immunodeficiency Syndrome Lymphomas ix. Smooth Muscle Cell Tumors x. Burkitt's lymphoma xi. Hodgkin's disease
XH. B-cell lymphomas (not x and xι)
XiIi. T and NK cell lymphomas xiv. Nasopharyngeal carcinoma xv. Undifferentiated carcinomas of nasopharyngeal type (UCNT) xvi. Gastric carcinomas
XVIi. Follicular dendritic cell tumors and of inflammatory "pseudotumorsor other diseases known to the skilled addressee. Table 2 shows detailed descriptions of some of the mentioned diseases.
Table 2
TABLE 2 Overview of EBV associated malignancies
EBV association EBV antigen
Tumor Subtype Typical latent peπoda (%)b expression0 Latency
Burkitt's Endemic 3-8 y post-EBV 100 lymphoma Sporadic 3-8 y post-EBV 15-85 EBNAl I
AIDS-associated 3 8 y post-HIV 30-40
Gastric UCNT >30 y post-EBV 100 carcinoma Adenocarcinoma >30 y post-EBV 5-15 EBNAl, LMP2 I/II
Nasopharyngeal Nonkeratinizing >30 y post-EBV 100 carcinoma Keratinizing >30 y post-EBV 30-100 EBNAl, [LMPl] LMP2 I/II
T-cell VAHS-assoαated 1-2 y post-EBV 100 lymphoma Nasal NK and T-cell >30 y post-EBV 100 EBNAl, [LMPl] LMP2 I/II
Hodgkin's Mixed cell, >10 y post-EBV 60-80 disease lymphocyte depleted
Nodular sclerosing >10 y post-EBV 20-40 EBNAl, LMPl, LMP2 II
PTLD-iike Immunodeficiency <3 mo post-EBV 100 lymphoma Posttransplantation <1 y posttransplantation >90 EBNA 1, 2, 3A, 3B, 3C, III
AIDS-associated >8 y post-HIV >80 -LP, LMPl, LMP2
Leiomyosar¬ Immunodeficiency ?<3 y post-EBV ?100 coma Posttransplantation ?<3 y ?100
AIDS-associated posttransplantation ?100 ?<3y post EBV aTypιcal latent period between EBV infection and tumor development, or where appropriate, between onset of T cell impaiment (transplantation or HIV infection) and tumor development Note that leiomyosarcoma is a tumor typically seen in infants who are congenitally immunodeficient or who were transplanted or became HIV infected early in infancy bPercentage of tumors that are EVB genome positive Note that for some tumors (e g , sporadic Burkitt s lymphoma, keratinizing nasopharyngeal carcinoma) the strength of the EBV association varies with geographic location, hence the wide percentage range cAntιgen expression is identified by monoclonal antibody staining or is inferred from analysis of latent gene transcripts Where there is variability between tumors in terms of antigen status, the antigen is shown in brackets Note that in the case of immunoblastic lymphomas, monoclonal antibody staining may show som heterogeneity within a tumor in terms of latency patterns, but most cells exhibit Latency III Small numbers of lytic antigen-positive cells are present within some tumors, but this is not recorded in the table because such cells are always in a minority and will presumably be lost from the proliferating malignant clone
AIDS, acquired immunodeficiency syndrome, UCNT, undifferentiated carcinomas of nasopharyngeal type, VAHS, virus- associated hemophagocytic syndrome, NK, natural killer cell, HIV, human immunodeficiency virus
Thus, another aspect for the present invention relates to a method of treating or preventing a γl-herpesvirus related disease comprising modifying a constitutively active G protein coupled receptor of the γl-herpesvirus.
In a presently preferred embodiment said modification of the signal is an inhibition of said signal.
The invention relates to a method of treating or preventing a γl-herpesvirus related disease comprising modifying a constitutively active G protein coupled receptor of the γl- herpesvirus, wherein the γl-herpesvirus related disease is selected from the group consisting of Infectious Mononucleosis, X-linked Lymphoprohferative Syndrome, Fatal Infectious Mononucleosis, Virus-Associated Hemophagocytic Syndrome, Chronic Active Epstein-Barr Virus Infection, Clinically Apparent Virus Replicative Lesions, Lymphomas in Congenitally Immunodeficient Patients, Posttransplantation Lymphomas / post-transplant lymphoprohferative disease (PTLD), Acquired Immunodeficiency Syndrome Lymphomas, Smooth Muscle Cell Tumors, Burkitt's lymphoma, Hodgkin's disease, B-cell lymphomas, T and NK cell lymphomas, Nasopharyngeal carcinoma, Undifferentiated carcinomas of nasopharyngeal type (UCNT), Gastric carcinomas, Follicular dendritic cell tumors and inflammatory "pseudotumors".
In one embodiment, the invention relates to a method of treating or preventing a γl- herpesvirus related disease comprising modifying a constitutively active G protein coupled receptor of the γl-herpesvirus, wherein the constitutively active G protein coupled receptor has at least 80% identity to the ammo acid sequence of human BILF-I (SEQ ID NO: 9) such as e.g. at least 85 % identity, or such as e.g. at least 90 % identity, or such as e.g. at least 91 % identity, or such as e.g at least 92 % identity, or such as e.g. at least 93% identity, or such as e.g. at least 94 % identity, or such as e.g. at least 95% identity, or such as e.g. at least 96 % identity, or such as e.g. at least 97 % identity, or such as e.g. at least 98 % identity, or such as e.g. at least 99 % identity, or such as e.g. 100 % identity.
In another embodiment, the invention relates to a method of treating or preventing a γl- herpesvirus related disease comprising modifying a constitutively active G protein coupled receptor of the γl-herpesvirus, wherein the constitutively active G protein coupled receptor is encoded by a nucleotide sequence having at least 80% identity to the nucleotide sequence of human BILFl (SEQ ID NO: 1) such as e.g. at least 85 % identity, or such as e.g. at least 90 % identity, or such as e.g. at least 91 % identity, or such as e.g. at least 92 % identity, or such as e.g. at least 93% identity, or such as e.g. at least 94 % identity, or such as e.g. at least 95% identity, or such as e.g. at least 96 % identity, or such as e.g. at least 97 % identity, or such as e.g. at least 98 % identity, or such as e.g. at least 99 % identity, or such as e.g. 100 % identity.
In the present context, a γl-herpesvirus infected mammal having a risk of developing a γl- herpesvirus associated disease relates to any mammal that contains a component of the γl- herpesvirus, being DNA, RNA and/or protein components or that contains at least one antibody against a γl-herpesvirus viral protein and/or a T-cell response/TCR against a γl- herpesvirus specific epitope, and are in risk of developing a γl-herpesvirus associated disease e.g. such as diseases described herein.
Endogenous shall mean a material that a mammal naturally produces. Endogenous in reference to, for example and not limitation, the term "receptor," shall mean that which is naturally produced by a mammal (for example, and not limitation, a human) or a virus. By contrast, the term NON-ENDOGENOUS in this context shall mean that which is not naturally produced by a mammal (for example, and not limitation, a human) or a virus. For example, and not limitation, a receptor which is not constitutively active in its endogenous form, but when manipulated becomes constitutively active, is most preferably referred to herein as a "non-endogenous, constitutively activated receptor." Both terms can be utilized to describe both "in vivo" and "in vitro" systems. For example, and not limitation, in a screening approach, the endogenous or non-endogenous receptor may be in reference to an in vitro screening system. As a further example and not limitation, where the genome of a mammal has been manipulated to include a non-endogenous constitutively activated receptor, screening of a candidate. [35 SJGTP.gamma.S assay
A non-hydrolyzable analog of GTP, [3S S]GTP. gamma. S, can be used to monitor enhanced binding to membranes which express constitutively activated receptors. It is reported that [35 SJGTP.gamma.S can be used to monitor G protein coupling to membranes in the absence and presence of ligand (Harrison et al.).
An example of this monitoring, among other examples well-known and available to those in the art, was reported by Traynor and Nahorski in 1995. The preferred use of this assay system is for initial screening of candidate compounds because the system is generically applicable to all G protein-coupled receptors regardless of the particular G protein that interacts with the intracellular domain of the receptor.
Once candidate compounds are identified using the "generic" G protein-coupled receptor assay, further screening to confirm that the compounds have interacted at the receptor site is preferred.
The following pathways are merely illustrative examples and not shall be regarded as limiting examples of the present invention.
GPCR major pathways
Activated G protein of the q-class (Gαq) activates Phosporlipase C (PLC) and generates phosphatidyinositol-4,5-bisphosphate (PIP2), 1,2-diacylglycerol (DAG) and inositol 1,4,5 triphosphate (IP3). IP3 further induce an increase in intracellular calcium that further leads to activation of NFAT. Furthermore Calcium and DAG activated Protein kinase C (PKC) which in turn activates phospholipase D (PLD). Gαq also activates the phosphoinositide 3- kinase (PI3K) and generates phosphatidylinositol-3,4,5-triphosphate (PI3,4,5P3), which in turn activates the phosphoinositide dependent kinase 1 (PDKl) and the AKT protein kinase/Protein kinase B (PKB). AKT/PKB further activates IKK and NF-κB.
Activated G protein of the s-class (Gas) activates adenylyl cyclase (AC) which leads to the generation of cyclic APM (cAMP). cAMP further activates the protein kinase A (PKA) which interacts with multible second messenger molecules, e.g the phosphodiesterase (PDE), c- Src → Papl GTPase → B-Raf → the mitogen activated protein kinase (MEK), the phosphorylase kinase, and the cyclic AMP response element binding protein (CREB) → CRE activation. Activated G protein of the i-class (Gαi) inhibits adenylyl cyclase (AC) and thereby inhibits the generation of cyclic AMP (cAMP). Consequently Gαi inhibit PKA and CREB activity.
Activation of Ga subunits leads to the dissociation of βγ-subunits. The βγ subunits have multiple effects and activates several second messenger pathways, including MAPK, induction of intracellular calcium, activation of PLC and induction of multiple GTPases, including Rho.
Examples of GPCR activity assays CAM P assay
For example, a compound identified by the "generic" assay may not bind to the receptor, but may instead merely e.g. "uncouple" the G protein from the intracellular domain. In the case of GPR3, GPR4, GPR6, GPR12, GPR21, GHSR, OGRl, RE2 and AL022171, it has been determined that these receptors couple the G protein Gs. Gs stimulates the enzyme adenylyl cyclase (Gi, on the other hand, inhibits this enzyme). Adenylyl cyclase catalyzes the conversion of ATP to cAMP; thus, because these receptors are activated in their endogenous forms, increased levels of cAMP are associated therewith (on the other hand, endogenously activated receptors which couple the Gi protein are associated with decreased levels of cAMP). See, generally, "Indirect Mechanisms of Synaptic Transmission," Chpt. 8, From Neuron To Brain (3rd Ed.) Nichols, J. G. et al eds. Sinauer Associates, Inc. (1992).
Thus, assays that detect cAMP can be utilized to determine if a candidate compound is an inverse agonist to the receptor i.e., such a compound which contacts the receptor would decrease the levels of cAMP relative to the uncontacted receptor.
A variety of approaches known in the art for measuring cAMP can be utilized; a most preferred approach relies upon the use of anti-cAMP antibodies. Another type of assay that can be utilized is a whole cell second messenger reporter system assay. Promoters on genes drive the expression of the proteins that a particular gene encodes. Cyclic AMP drives gene expression by promoting the binding of a cAMP-responsive DNA binding protein or transcription factor (CREB), which then binds to the promoter at specific sites called cAMP response elements and drives the expression of the gene. Reporter systems can be constructed, which have a promoter containing multiple cAMP response elements before the reporter gene, e.g., β-galactosidase or luciferase. Thus, an activated Gs receptor such as GPR3 causes the accumulation of cAMP which then activates the gene and expression of the reporter protein. The reporter protein such as β-galactosidase or luciferase can then be detected using standard biochemical assays. A cAMP assay is particularly preferred. The foregoing specific assay approach can, of course, be utilized to initially directly identify candidate compounds, rather than by using the generic assay approach. Such a selection is primarily a matter of choice of the artisan, see also (Wainer et al.).
Examples of cAMP high throughput assays
AlphaScreen cAMP assay (PerkinElmer).
Detection of cAMP with Alpha Screen is based on competition between cAMP produced by cells and a biotinylated cAMP probe that is recognized by the streptavidin-Donor and anti- cAMP conjugated Acceptor beads. The beads are brought into proximity and a signal is detected. Increased intracellular concentrations of cAMP foilowsGαs coupled GPCR activation by an agonist results in the displacement of the biotinylated cAMP probe and leads to a proportional decrease in signal. The effect of antagonists and inverse (reverse) agonists can similarly be detected. GaI coupled receptor activation can be detected after prestimulating cells with forskolin or analogous compounds.
[FP]2 Fluorescence Polarization cAMP assay (PerkinElmer, NEN)
Fluorescence Polarization is an empirical fluorescence detection technique that measures the parallel and perpendicular components of fluorescence emission to the plane of a polarized excitation source. Polarization values (measured in mP units) for any fluorophore-labeled complex are inversely related to the speed of molecular rotation of that complex. Since molecular rotation is, in turn, inversely related to its molecular volume, a fluorescent tracer possesses a higher polarization value when it interacts with any molecule large enough to slow its rate of molecular rotation (e.g., an antibody). The magnitude of the polarization signal is thus used to quantitatively determine the extent of fluorescent tracer binding without the need for any filtration or wash separation step.
IP3-assay Activation of GPCRs or constitutively active GPCRs that activates G proteins of the q-class (Gαq) leads to formation of IP3. Generation of IP3 can be measured in whole cells, e.g COS-7 cells expressing or transfected with the GPCR of interest. One day after transfection the cells are transferred to assay-plates and incubated for 24 hours with myo-[3H]inositol (Amersham TRK911) in complete growth medium. Cells are washed in IP-buffer (20 mM HEPES buffer (pH 7.4) supplemented with 140 mM NaCI, 5 mM KCI, 1 mM MgSO4, 1 mM CaCI2, 10 mM glucose, and 0.05% (w/v) bovine serum albumin) and incubated in IP-buffer supplemented with 10 mM LiCI at 37°C for 90 min. After incubation the buffer was removed and accumulated inositol phosphates were extracted for 30 min on ice in 1.0 ml 1OmM formic acid. The generated [3H]inositol phosphates (IP3) were purified on Dowex 1X8 anion-exchange resin and radioactivity was counted in a scintillation counter. Radioactivity values are given as counts per minute (CPM).
Examples of IP3 high throughput assays
AlphaScreβn IP3 assay (PerkinElmer).
Detection of IP3 with Alphascreen is based on the competition between IP3 produced by cells and a biotinylated IP3 analog (b-IP3) binding to a GST-tagged IP3 binding protein (GST-IP3 bp). The b-IP3 and GST-IP3 bp are recognized by the streptavidin-Donor and anti-GST conjugated Acceptor beads, respectively. The beads are brought into proximity and a signal is detected. Increased intracellular concentrations of IP3 following GPCR activation by an agonist results in the displacement of the b-IP3 and leads to a proportional decrease in the signal.
GPCR Fusion Protein approach
The use of an endogenous, constitutively activated GPCR for use in screening of candidate compounds for the direct identification of inverse agonists, agonists and partial agonists provides a unique challenge in that, by definition, the endogenous receptor is active even in the absence of an endogenous ligand bound thereto. Thus, in order to differentiate between, e.g., the endogenous receptor in the presence of a candidate compound and the endogenous receptor in the absence of that compound, with an aim of such a differentiation to allow for an understanding as to whether such compound may be an inverse agonist, agonist, partial agonist or have no affect on such a receptor, it is preferred that an approach be utilized that can enhance such differentiation.
A preferred approach is the use of a GPCR Fusion Protein. Generally, once it is determined that an endogenous orphan GPCR is constitutively active, using the assay techniques set forth above (as well as others), it is possible to determine the predominant G protein that couples with the endogenous GPCR. Coupling of the G protein to the GPCR provides a signaling pathway that can be assessed. Because it is most preferred that screening take place by use of a mammalian expression system, such a system will be expected to have endogenous G protein therein. Thus, by definition, in such a system, the endogenous, constitutively active orphan GPCR will continuously signal. In this regard, it is preferred that this signal be enhanced such that in the presence of, e.g., an inverse agonist to the receptor, it is more likely that one will be able to more readily differentiate, particularly in the context of screening, between the receptor when it is or is not contacted with the inverse agonist. The GPCR Fusion Protein is intended to enhance the efficacy of G protein coupling with the endogenous GPCR. The GPCR Fusion Protein appears to be important for screening with an endogenous, constitutively activated GPCR because such an approach increases the signal that is most preferably utilized in such screening techniques. Facilitating a significant "signal to noise" ratio is important for the screening of candidate compounds as disclosed herein.
The construction of a construct useful for expression of a GPCR Fusion Protein is within the purview of those having ordinary skill in the art. Commercially available expression vectors and systems offer a variety of approaches that can fit the particular needs of an investigator. One important criterion for such a GPCR Fusion Protein construct is that the endogenous GPCR sequence and the G protein sequence both be in-frame (preferably, the sequence for the endogenous GPCR is upstream of the G protein sequence) and that the "stop" codon of the GPCR must be deleted or replaced such that upon expression of the GPCR, the G protein can also be expressed. The GPCR can be linked directly to the G protein, or there can be spacer residues between the two (preferably no more than about 12, although this number can be readily ascertained by one of ordinary skill in the art).
The present inventors have evaluated both approaches, and in terms of measurement of the activity of the GPCR, the results are substantially the same; however, there is a preference (based upon convenience) of use of a spacer in that some restriction sites that are not used will, effectively, upon expression, become a spacer. Most preferably, the G protein that couples to the endogenous GPCR will have been identified prior to the creation of the GPCR Fusion Protein construct. Because there are only a few G proteins that have been identified, it is preferred that a construct comprising the sequence of the G protein (i.e., a universal G protein construct) be available for insertion of an endogenous GPCR sequence therein; this provides for efficiency in the context of large-scale screening of a variety of different endogenous GPCRs having different sequences
Detection of GPCR and β-arrestin interaction as a measure of of GPCT activity.
BRET (Bioluminiscence Resonance Energy Transfer) (PerkinElmer) BRETT is an advanced, non-destructive, assay technology that is designed to monitor protein-protein interactions and intracellular signalling events in living cells. This technology is based on the transfer of resonant energy from a bioluminescent donor protein to a fluorescent acceptor protein using e.g Renilla luciferase (Rluc) as the donor and a mutant of the Green Fluorescent Protein (GFP) as the acceptor molecule. The BRET signal is generated by th eoxidation of e.g. DeepBlueC, a coelentarazine derivative that maximizes spectral resolution for better sensitivity. The BRET technology is analogous to fluorescence resonance energy transfer (FRET), but eliminates the need for an excitationlight source and its associated problems.
The Use of recombinant G-proteins
A GPCR signal can be diverged from on G protein pathway (Gαq, Gas, Gαi, Gαl2/13) to another by using chimeric G proteins consisting of e.g. Gαqs5 and GαΔ6qi4myr are recombinant Gαq proteins with switched receptor specificity from wild type Gαq interacting GPCRs to Gas and Gαi interacting receptors respectively; Gαqs5 have replaced the 5 C- terminal amino acids of wild type Gαq with the 5 corresponding C-terminal amino acids from Gas, and GαΔ6qi4myr lacks the first six N-terminal amino acids, have replaced the 4 C-terminal amino acids of wild type Gαq with the corresponding 4 C-terminal amino acids from Gαi, and include an N-terminal myristoylation site. By using recombinant G proteins with switched receptor specificities, it is possible to diverge a signal from one G-protein pathway to another. A receptor that is signalling through e.g. Gαi, can then bind and activate recombinant Gαq. Thereby the signal mediated by the receptor, being ligand dependent or constitutive, can be measures by a Gαq activity assay such as the IP3-assay described above. A receptor that is signalling through e.g. Gas, can then bind and activate recombinant Gαq. Thereby the signal mediated by the receptor, being ligand dependent or constitutive, can be measured by a Gαq activity assay such as the IP3-assay described above, see also Milligan et a!.
Reporter assays
As mentioned above, Cyclic AMP drives gene expression by promoting the binding of a cAMP-responsive DNA binding protein or transcription factor (CREB) which then binds to the promoter at specific sites called cAMP response elements and drives the expression of the gene. Several GPCR with specificity towards both Gαq, Gas, Gai, Gal2/13 activates distinct and overlapping transcription factors. Gas activates the cAMP response element (CRE) (which is inhibited by Gαi), Gαi (and βγ subunits) activates Serum response element (SRE) and Gαq activates API (fos/jun), NFAT and NF-κB. Reporter systems can be constructed which have a promoter containing multiple transcription factor binding sites/response elements before the reporter gene, e.g., β-galactosidase, luciferase or GFP.
The reporter protein such as β-galactosidase or luciferase can then be detected using standard biochemical assays. Splice variants
This invention encompasses splice variants of the BILFl gene.
The BILFl splice variant polypeptides, including polypeptide fragments, homologs thereof, retain BILFl activity. To "retain BILFl activity" is to have a similar level of functional activity as the BILFl polypeptide. This activity includes but is not limited to, immunologic, oncogenic and pharmacological activity.
The invention further encompasses polynucleotides encoding functionally equivalent variants and derivatives of the BILFl splice variant polypeptides and functionally equivalent fragments thereof which may enhance, decrease or not significantly affect properties of the polypeptides encoded thereby.
These functionally equivalent variants, derivatives, and fragments display the ability to retain BILFl activity. For instance, changes in a DNA sequence that do not change the encoded amino acid sequence, as well as those that result in conservative substitutions of amino acid residues, one or a few amino acid deletions or additions, and substitution of amino acid residues by amino acid analogs are those which will not significantly affect properties of the encoded polypeptide. Conservative amino acid substitutions are glycine/alanine; valine/isoleucine/leucine; asparagine/glutanine; aspartic acid/glutamic acid; serine/threonine/methionine; lysine/arginine; and phenylalanine/tyrosine/tryptophan.
The invention further encompasses the BILFl splice variant polynucleotide sequences contained in a vector molecule or an expression vector and operably linked to a promoter element if necessary.
The invention further comprises a complementary strand to the polynucleotide encoding the BILFl splice variant polypeptide.
The complementary strand may be a polymeric form of nucleotides of any length, which contain deoxyribonucleotides, ribonucleotides, and analogs in any combination.
In another aspect, the present invention also relates to a kit for use in an assay or method as defined in the present application.
Method of production of the constitutively active G protein coupled receptor of the invention The receptors described herein may be produced by any suitable method known in the art. Such methods include constructing a nucleotide sequence encoding the receptor and expressing the sequence in a suitable transformed or transfected host. A nucleotide sequence encoding the receptors described herein may be constructed by isolating or synthesizing a nucleotide sequence encoding the desired receptor or a functional part thereof. The nucleotide sequence may be prepared by chemical synthesis, e.g. by using an oligonucleotide synthesizer, wherein oligonucleotides are designed based on the amino acid sequence of the desired recpetor, and preferably selecting those codons that are favored in the host cell in which the receptor will be produced. For example, several small oligonucleotides coding for portions of the desired receptor may be synthesized and assembled by PCR, ligation or ligation chain reaction (LCR). The individual oligonucleotides typically contain 5' or 3' overhangs for complementary assembly.
Once assembled the nucleotide sequence encoding the desired receptor is inserted into a recombinant vector and operably linked to control sequences necessary for expression of the receptor in the desired transformed host cell.
It should of course be understood that not all vectors and expression control sequences function equally well to express the nucleotide sequence encoding the receptors described herein. Neither will all hosts function equally well with the same expression system. However, one of skill in the art may make a selection among these vectors, expression control sequences and hosts without undue experimentation. For example, in selecting a vector, the host must be considered because the vector must replicate in it or be able to integrate into the chromosome. The vector's copy number, the ability to control that copy number, and the expression of any other proteins encoded by the vector, such as antibiotic markers, should also be considered. In selecting an expression control sequence, a variety of factors should also be considered. These include, for example, the relative strength of the sequence, its controllability, and its compatibility with the nucleotide sequence encoding the receptor, particularly as regards potential secondary structures. Hosts should be selected by consideration of their compatibility with the chosen vector, the toxicity of the product coded for by the nucleotide sequence, their secretion characteristics, their ability to fold the receptor correctly, and their fermentation or culture requirements.
The recombinant vector may be an autonomously replicating vector, i.e. a vector, which exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g. a plasmid. Alternatively, the vector is one which, when introduced into a host cell, is integrated into the host cell genome and replicated together with the chromosome(s) into which it has been integrated. The vector is preferably an expression vector, in which the nucleotide sequence encoding the desired recpetor is operably linked to additional segments required for transcription of the nucleotide sequence. The vector is typically derived from plasmid or viral DNA. A number of suitable expression vectors for expression in the host cells mentioned herein are commercially available or described in the literature. Useful expression vectors for eukaryotic hosts, include, for example, vectors comprising expression control sequences from SV40, bovine papilloma virus, adenovirus and cytomegalovirus. Specific vectors are, e.g., pCDNA3.1(+)\Hyg (Invitrogen, Carlsbad, CA, USA) and pCI-neo (Stratagene, La JoIa, CA, USA). Useful expression vectors for bacterial hosts include known bacterial plasmids, such as plasmids from E. co\\, including pBR.322, pET3a and pET12a (both from Novagen Inc., WI, USA), wider host range plasmids, such as RP4, phage DNAs, e.g., the numerous derivatives of phage lambda, e.g. , NM989, and other DNA phages, such as M13 and filamentous single stranded DNA phages. Useful expression vectors for yeast cells include the 2μ plasmid and derivatives thereof, the POTl vector (US 4,931,373), the pJSO37 vector described in (Okkels, Ann. New York Acad. Sci. 782, 202-207, 1996) and pPICZ A, B or C (Invitrogen). Useful vectors for insect cells include pVL941, pBG311 (Cate et al., "Isolation of the Bovine and Human Genes for Mullerian Inhibiting Substance And Expression of the Human Gene In Animal Cells", Cell, 45, pp. 685-98 (1986), pBluebac 4.5 and pMelbac (both available from Invitrogen).
Other vectors for use in this invention include those that allow the nucleotide sequence encoding the receptors described herein to be amplified in copy number. Such amplifiable vectors are well known in the art. They include, for example, vectors able to be amplified by DHFR amplification (see, e.g., Kaufman, U.S. Pat. No. 4,470,461, Kaufman and Sharp, "Construction Of A Modular Dihydrafolate Reductase cDNA Gene: Analysis Of Signals Utilized For Efficient Expression", MoI. Cell. Biol., 2, pp. 1304-19 (1982)) and glutamine synthetase ("GS") amplification (see, e.g., US 5,122,464 and EP 338 841).
The recombinant vector may further comprise a DNA sequence enabling the vector to replicate in the host cell in question. An example of such a sequence (when the host cell is a mammalian cell) is the SV40 origin of replication. When the host cell is a yeast cell, suitable sequences enabling the vector to replicate are the yeast plasmid 2μ replication genes REP 1-3 and origin of replication.
The vector may also contain a selectable marker, e.g. a gene the product of which complements a defect in the host cell, such as the gene coding for dihydrofolate reductase (DHFR) or the Schizosaccharomyces pombe TPI gene (described by P. R. Russell, Gene 40, 1985, pp. 125-130), or one which confers resistance to a drug, e.g. ampicillin, kanamycin, tetracyclin, chloramphenicol, neomycin, hygromycin or methotrexate. For filamentous fungi, selectable markers include amdS. pyrG, arcB, niaP, sC.
A wide variety of expression control sequences may be used in the present invention. Such useful expression control sequences include the expression control sequences associated with structural genes of the foregoing expression vectors as well as any sequence known to control the expression of genes of prokaryotic or eukaryotic cells or their viruses, and various combinations thereof.
Examples of suitable control sequences for directing transcription in mammalian cells include the early and late promoters of SV40 and adenovirus, e.g. the adenovirus 2 major late promoter, the MT-I (metallothionein gene) promoter, the human cytomegalovirus immediate-early gene promoter (CMV), the human elongation factor lα (EF-lα) promoter, the Drosophila minimal heat shock protein 70 promoter, the Rous Sarcoma Virus (RSV) promoter, the human ubiquitin C (UbC) promoter, the human growth hormone terminator, SV40 or adenovirus EIb region polyadenylation signals and the Kozak consensus sequence (Kozak, M. J MoI Biol 1987 Aug 20;196(4):947-50).
In order to improve expression in mammalian cells a synthetic intron may be inserted in the 5' untranslated region of the nucleotide sequence encoding the receptor. An example of a synthetic intron is the synthetic intron from the plasmid pCI-Neo (available from Promega Corporation, WI, USA).
Examples of suitable control sequences for directing transcription in insect cells include the polyhedrin promoter, the PlO promoter, the Autographa californica polyhedrosis virus basic protein promoter, the baculovirus immediate early gene 1 promoter and the baculovirus 39K delayed-early gene promoter, and the SV40 polyadenyiation sequence.
Examples of suitable control sequences for use in yeast host cells include the promoters of the yeast α-mating system, the yeast triose phosphate isomerase (TPI) promoter, promoters from yeast glycolytic genes or alcohol dehydogenase genes, the ADH2-4c promoter and the inducible GAL promoter.
Examples of suitable control sequences for use in filamentous fungal host cells include the ADH3 promoter and terminator, a promoter derived from the genes encoding Aspergillus oryzae TAKA amylase triose phosphate isomerase or alkaline protease, an A. niger α- amylase, A. niger or A. nidulans glucoamylase, A. nidulans acetamidase, Rhizomucor miehei aspartic proteinase or lipase, the TPIl terminator and the ADH3 terminator. Examples of suitable control sequences for use in bacterial host cells include promoters of the lac system, the trp system, the TAC or TRC system and the major promoter regions of phage lambda.
The nucleotide sequence may or may not also include a nucleotide sequence that encode a signal peptide. The signal peptide is present when the receptor is to be secreted from the cells in which it is expressed. Such signal peptide, if present, should be one recognized by the cell chosen for expression of the polypeptide variant. The signal peptide may be homologous (e.g. be that normally associated with the receptor) or heterologous (i.e. originating from another source than the receptor) to the receptor or may be homologous or heterologous to the host cell, i.e. be a signal peptide normally expressed from the host cell or one which is not normally expressed from the host cell. Accordingly, the signal peptide may be prokaryotic, e.g. derived from a bacterium such as E. coli, or eukaryotic, e.g. derived from a mammalian, or insect or yeast cell.
Any suitable host may be used to express the receptors described herein, including bacteria, fungi (including yeasts), plant, insect, mammal, or other appropriate animal cells or cell lines, as well as transgenic animals or plants. In a preferred embodiment, however, the host cell is an eukaryotic host cell, such as a mammalian host cell capable of glycosylation. Examples of bacterial host cells include grampositive bacteria such as strains of Bacillus, e.g. B. brevis or B. subtilis, Pseudomonas or Streptomyces , or gramnegative bacteria, such as strains of E. coli. The introduction of a vector into a bacterial host cell may, for instance, be effected by protoplast transformation (see, e.g., Chang and Cohen, 1979, Molecular General Genetics 168: 111-115), using competent cells (see, e.g., Young and Spizizen, 1961, Journal of Bacteriology 81: 823-829, or Dubnau and Davidoff-Abelson, 1971, Journal of Molecular Biology 56: 209-221), electroporation (see, e.g., Shigekawa and Dower, 1988, Biotechniques 6: 742-751), or conjugation (see, e.g., Koehler and Thome, 1987, Journal of Bacteriology 169: 5771-5278).
Examples of suitable filamentous fungal host cells include strains of Aspergillus, e.g. A. oryzae, A. niger, or A. nidulans, Fusarium or Trichoderma. Fungal cells may be transformed by a process involving protoplast formation, transformation of the protoplasts, and regeneration of the cell wall in a manner known per se. Suitable procedures for transformation of Aspergillus host cells are described in EP 238 023 and US 5,679,543. Suitable methods for transforming Fusarium species are described by Malardier et al., 1989, Gene 78: 147-156 and WO 96/00787. Yeast may be transformed using the procedures described by Becker and Guarente, In Abelson, 3. N. and Simon, M. L, editors, Guide to Yeast Genetics and Molecular Biology, Methods in Enzymology, Volume 194, pp 182-187, Academic Press, Inc., New York; Ito et al., 1983, Journal of Bacteriology 153: 163; and Hinnen et al., 1978, Proceedings of the National Academy of Sciences USA 75: 1920.
Examples of suitable yeast host cells include strains of Saccharomyces, e.g. S. cerevisiae, Schizosaccharomyces, Kluyveromyces, Pichia, such as P. pastoris or P. methanolica, Hansenula, such as H. Polymorpha or Yarrowia. Methods for transforming yeast cells with heterologous DNA and producing heterologous polypeptides therefrom are disclosed by Clontech Laboratories, Inc, Palo Alto, CA, USA (in the product protocol for the Yeastmaker™ Yeast Tranformation System Kit), and by Reeves et al., FEMS Microbiology Letters 99 (1992) 193-198, Manivasakam and Schiestl, Nucleic Acids Research, 1993, Vol. 21, No. 18, pp. 4414-4415 and Ganeva et al., FEMS Microbiology Letters 121 (1994) 159- 164.
Examples of suitable insect host cells include a Lepidoptora cell line, such as Spodoptera frugiperda (Sf9 or Sf21) or Trichoplusioa ni cells (High Five) (US 5,077,214).
Transformation of insect cells and production of heterologous polypeptides therein may be performed as described by Invitrogen.
Examples of suitable mammalian host cells include Chinese hamster ovary (CHO) cell lines, (e.g. CHO-Kl; ATCC CCL-61), Green Monkey cell lines (COS) (e.g. COS 1 (ATCC CRL- 1650), COS 7 (ATCC CRL-1651)); mouse cells (e.g. NS/O), Baby Hamster Kidney (BHK) cell lines (e.g. ATCC CRL-1632 or ATCC CCL-10), and human cells (e.g. HEK 293 (ATCC CRL-1573)), as well as plant cells in tissue culture. Additional suitable cell lines are known in the art and available from public depositories such as the American Type Culture Collection, Rockville, Maryland. Also, the mammalian cell, such as a CHO cell, may be modified to express sialyltransferase, e.g. 1,6-sialyltransferase, e.g. as described in US 5,047,335, in order to provide improved glycosylation of the receptor.
Methods for introducing exogenous DNA into mammalian host cells include calcium phosphate-mediated transfection, electroporation, DEAE-dextran mediated transfection, liposome-mediated transfection, viral vectors and the transfection method described by Life Technologies Ltd, Paisley, UK using Lipofectamin 2000. These methods are well known in the art and e.g. described by Ausbel et al. (eds.), 1996, Current Protocols in Molecular Biology, John Wiley & Sons, New York, USA. The cultivation of mammalian cells are conducted according to established methods, e.g. as disclosed in (Animal Cell
Biotechnology, Methods and Protocols, Edited by Nigel Jenkins, 1999, Human Press Inc, Totowa, New Jersey, USA and Harrison MA and Rae IF, General Techniques of Cell Culture, Cambridge University Press 1997). A method of identifying liqands of BILFl.
The method involving a chemical"anchor"by making use of a metal binding site in BILFl as well a metal binding site in a chemical compound. The metal binding site in BILFl is a metal-ion binding site that has been introduced into the protein by artificial means such as, e. g., engineering means.
The method provides a molecular approach for rapidly and selectively identifying small organic molecule ligands, i. e. compounds, that are capable of interacting with and binding to specific sites BILFl. The method makes it possible to construct and screen libraries of compounds specifically directed against predetermined epitopes on BILFl. The compounds are initially constructed to be bifunctional, i. e. having both a metal-ion binding moiety, which conveys them with the ability to bind to the artificially constructed metal-ion binding site described above as well as a variable moiety, which is varied chemically to probe for interactions with specific parts of BILFl located spatially adjacent to the metal-ion binding site. Compounds may subsequently be further modified to bind to the unmodified biological target molecule without help of the bridging metal-ion.
The metal-ion site is used as an anchor-point for the initial parts of the medicinal chemistry drug-discovery process, during which test compounds can be synthesized, which due to their specific interaction with the metal-ion binding site can be deliberately directed towards interaction with specific, functionally interesting parts of BILFl. The test compounds are subsequently structurally optimised for interaction with spatially neighbouring parts of BILFl (that is, interaction with the side chains or backbone of one or more neighbouring amino acid residues). These compounds can then be utilized as leads or starting points for the construction of ligands binding to wild-type BILFl. In this way it is possible to predetermine the binding site of a compound to a particular location BILFl and thereby target the optimised compounds to sites where binding of the compound will alter the biological activity of the BILFl in a desired way, for example to decrease its biological activity. The metal-ion binding portion of the test compounds may subsequently be removed or altered to no longer posses metal-ion binding properties, and the test compounds, as well as chemical derivatives thereof may be constructed to interact with side chains of other amino acids in the vicinity of the artificial metal ion binding site, and tested for binding to the wild-type BILFl protein which does not include a metal ion binding site. Accordingly, relatively small chemical libraries may be made, the compounds in which may be designed to interact with the specific amino acid residues found in the wild-type protein at or spatially surrounding the location where the metal ion site had initially been engineered. Accordingly, the method relates to a drug discovery process for identification of a small organic compound that is able to bind to BILFl, the method comprising mutating BILFl in such a way that at least one amino acid residue capable of binding a metal ion is introduced so as to obtain a metal ion binding site as an anchor point in the mutated biological target molecule. Mutated BILFl may furthermore be contacted with a test compound which comprises a moiety including at least two heteroatoms for chelating a metal ion, under conditions permitting non-covalent binding of the test compound to the introduced metal ion binding site of the mutated BILFl, and then followed by detection of any change in the activity of the mutated BILFl or determination of the binding affinity of the test compound to the mutated BILFl.
We subject the nucleotide sequence encoding BILFl to site-directed mutagenesis in order to introduce the amino acid residue, which includes the metal-ion binding site. We perform site-directed mutagenesis according to well-known techniques. We test BILFl with respect to the ability to still constitute a functional, although altered, molecule through the use of an IP3 assay.
Although preferred embodiments have been depicted and described in detail herein, it will be apparent to those skilled in the relevant art that various modifications, additions, substitutions and the like can be made without departing from the spirit of the invention and these are therefore considered to be within the scope of the invention as defined in the claims which follows.
It should be understood that any feature and/or aspect discussed above in connection with the methods according to the invention apply by analogy to the uses according to the invention.
As will be apparent, preferred features and characteristics of one aspect of the invention may be applicable to other aspects of the invention.
All patent and non-patent references cited in the present application, are hereby incorporated by reference in their entirety.
Throughout this specification the word "comprise", or variations such as "comprises" or
"comprising", will be understood to imply the inclusion of a stated element, integer or step, or group of elements, integers or steps, but not the exclusion of any other element, integer or step, or group of elements, integers or steps.
The invention will hereinafter be described by way of the following non-limiting Figures and
Examples. FIGURE LEGENDS
Figure 1
A serpentine diagram of the BILFl receptor showing the 7 trans-membrane helices. Differences between Human EBV and Rhesus EBV are indicated in black on grey and identical amino acids are indicated in black on white. Computer predicted glycosylation sites are indicated with g and predicted phosphorylation sites indicated with p. The alternative λDRY box', λEKT' is marked with a rectangle.
Figure 2 Multiple sequence alignment of BILFl related sequenced identified using BLAST. The alignment was done using ClustalW version 1.8, and shading was done using Boxshade version 3.21 available at http://www.ch.embnet.org/software/BOX form.html. Abbreviations used in this figure are PLHV: Porcine lymphotropic herpesvirus, CHV3: Callitrichine herpesvirus 3 (also known as marmoset EBV), AHV: Alcelaphine herpesvirus and EHV: Equine herpesvirus. The rectangle indicates the 1DRY' box region. Positions sharing 50% amino acid identity or more are indicated in white on black. Positions sharing 50% amino acids identity or more are indicated in black on grey. Positions with less than 50% amino acid identity or identity are indicated in black on white. Consensus line asterisk (*) indicates 100% conserved positions and dots (.) indicates positions with 50% or more identity.
Figure 3
Dendrogram of herpesvirus encoded G protein-coupled receptors based on their amino acid identities. Receptor alignment was generated in Clustal X (1.81) and phylogenetic tree visualized using TreeView. The length of each branch reflects amino acid discrepancies. Each entry consists of the virus name abbreviation followed by the name of the reading frame encoding the receptor. The BILFl receptor family is highlighted in bold and consist of porcine lymphotrophic herpesvirus (PLHV) 1,2 and 3 ORF-A5, alcelaphine herpesvirus 1 (AHV) ORF-E5, equine herpesvirus 2 (EHV2) ORF-E6 rhesus Epstein-Barr virus (RhEBV) ORF-BILFl, human Epstein-Barr virus (EBV) ORF-BILFl and callitrichine herpesvirus 3 (CHV3) ORF-6.
Figure 4
Western blot of tetracyclin induced HuBILFl cell lines. Detergent phase samples were either (A) kept untreated, (B) boiled, (C) reduced with 10 mM DTT, or boiled and reduced (D) without or (E) with PNGase-F treatment prior to SDS-PAGE separation and Western blotting. Non-deglycosylated BILFl is expressed as an approximately 50 kDa protein. PNGase F treatment reduced the apparent mass to approximately 33 kDa. Figure 5
Cellular localization of human- and rhesus-EBV BILFl. Figure 5 show representative images of (A) HuBILFl and (B) RhBILFl expressing 293 cells, fixed, permeabillized and stained with an anti HA antibody. The images are taken with a 6OX oil immersion objective. The images show a distinct receptor membrane association.
Figure 6
HuBILFl induction of inositol phosphate accumulation. COS-7 cells were transfected with an increasing amount of HuBILFl DNA together with 5μg of different chimeric Ga protein DNA or empty expression vector DNA. The recombinant G proteins Gαqs5 and GαΔ6qi4myr have switched receptor specificity from wild type Gαq interacting receptors to Gαs and Gocj interacting receptors respectively, but all signal via activation of PLC leading to accumulation inositol phosphates (IP3). Panel A show the activity as percent of maximum obtained activity. HuBILFl + control DNA (open square), HuBILFl + wild type Gαq DNA (black diamond), HuBILFl + Gαqs5 DNA (black triangle) and HuBILFl + GαΔ6qi4lτιyr DNA (Black square). Data are means and standard deviations (error bars) of four independent experiments, each experiment carried out in duplicate. To illustrate both the magnitude and specificity of the BILFl mediated response, panel B and C show the actual counts from one representative experiment out of four. Cells were transfected with 10μg receptor DNA and 5μg G protein DNA and stimulated with ligands according to the tables under the graphs. Bars illustrate means and error bars illustrate standard deviations of one experiment carried out in duplicate. BILFl is HuBILFl, ORF74 is the KSHV encoded GPCR, qi4 is GαΔ6qi4myr, qwt is wild type Gαq, qs5 is Gαqs5, GIP (receptor) is the glucose-dependent insulinotropic peptide receptor, κOP (receptor) is the kappa-opiat receptor, GIP (ligand) is the glucose-dependent insulinotropic peptide and Dyn (ligand) is dynorphin. GIP and dynorphin were added to a final concentration of 10"7M.
Figure 7
RhBILFl induction of inositol phosphate accumulation. COS-7 cells were transfected with 6 μg BILFl DNA together with 5 μg of different chimeric Ga protein DNA or empty expression vector DNA according to the table under the graph. The figure shows actual counts from one representative experiment out of four. Bars illustrate means and error bars illustrate standard deviations of one experiment carried out in duplicate.
Figure 8
CREB mediated transcription regulation. (Panel A) COS-7 cells were seeded in 96-well plates and co-transfected with a reporter-cDNA cocktail consisting of 6ng pFA2-CREB and 50ng pFR-Luc reporter plasmids and increasing amounts of HuBILFl DNA with (black squares) or without (open squares) 30ng of GαΔ6qι4rnyr DNA. Data points illustrate means and error bars illustrate standard deviations of one experiment out of four, each carried out in triplicate. Luciferase activity is presented as relative light units (RLU). (Panel B) COS-7 cells were seeded in 96-well plates and co-transfected with a reporter-cDNA cocktail consisting of 6ng pFA2-CREB and 50ng pFR-Luc reporter plasmids and increasing amounts of receptor DNA and incubated in the presence of lOμM forskolin to stimulate the adenylyl cyclase, with (white bars) or without (black bars) the addition of O.lμg/ml PTx to inhibit endogenous Ga1. Data are presented as percentage of the CREB activity generated by lOμM forskolin alone above values obtained for unstimulated HuBILFl transfected cells.
Figure 9
BILFl RNA quantification using Real Time PCR.
Normalised BILFl RNA expression data (IgG stimulated = 100%, 0 = 0%). Latently infected AKata B-cells were kept un-stimulated (minor squares) or stimulated for 3 hours with (larger squares) or without (ruled) the addition of phosphonoacetic acid (PAA) with 0,5% (V/V) IgG. Total RNA were isolated and reverse transcribed using Superscript II RT and reverse primer 5 'ctatcagcctgacatccatt. Real Time PCR were done on 5,0 μl RT (reverse transcribed) cDNA corresponding to reverse transcripts from 1,0 μg of total RNA/capillary using 0,5 μM forward primer 5 'gtcaatgcaacggaagatgc and 0,5 μM reverse primer (as above), 3mM MgCI2 and 2 μl LightCycler SYBR Green I reaction mix in lightCycler capillaries. The standard curve was made from the Hu-BILFl plasmid in a 1OX serial dilution ranging from 108 - 101 copies/capillary. Datawere analysed using LightCycler software version 3 (Idho Technologies Inc.).
The figure shows normalised data from one representative experiment out of four. Bars illustrate means and error bars illustrate standard deviations of one experiment carried out in duplicate.
Figure 10
The primer position for cloning of BZLFl. 1 +2) the two different reverse primers used.
The cloning succeeded with number 2. 3) the position of the forward primer used.
Figure 11
Primer positions of gp350 primers for cloning process. 1+2) are the two different reverse primer used. When using reverse primer 1 both gp220 and gp350 are included. Only cloning with reverse primer 1 succeeded. 3) position of forward primer Figure 12
Figure 12 shows BILFlstandard curve with a 10-fold dilution series. The cycle number where the largest change in fluorescence is detected is plotted against the logarithm to the concentration. The standard curve should have a slope of approximately -3.5. When using the primer set chosen to amplify and quantify BILFl the standard curve generated has a slope of -3.79, which is acceptable.
Figure 13 The negative controls have different melting point. This diagram show that even though the negative control gives a fluorescent read out this is not the BILFl fragment, which is detected but primer-dimers. The colours represent the same number of copies as figure 6.
Figure 14 Abbreviation used in agarose gels
M: size Marker nc: negative control pc: positive control
U: unstimulated cells S: stimulated cells
SP: stimulated cells added PAA
The negative control sample also results a positive readout. However, this readout is caused by primer-dimer formation, as evident from the melting curve (fig. 13), and is not caused by template contamination, or from amplification of un-specific cDNAs. Primer- dimers have a lower melting point than the amplified fragment. Samples with a positive signal, but with a lower melting point than the fragment can be considered to be negative. To see if all fragment are of the right size, the products are run on a 2% agarose gel for analysis. This shows that the fragments are of the right size.
Figure 15
Figure 15. gp350 is a late gene. Diagram of gp350 expression with logarithm to the number of mRNA detected by LightCyler in the two different cell line Akata+ and B95.8. White bars are the unstimulated cells grey bars stimulated cells and black bars stimulated cells added PAA.
Figure 16 BZLFl is an early gene. The expression of BZLFl is given by the logarithm to the number of mRIMA copies detected. White bars are the unstimulated cells grey bars stimulated cells and black bars stimulated cells added PAA
Figure 17
Expressionpattern of EBNA3C. diagram of EBNA3 expression pattern in three different cell lines, Akata+, B95 and P3HR1. white bars are unstimulated cells, grey stimulated cells and the black bars represent the cells stimulated and added PAA
Figure 18
BILFl expression. Diagram of BILFl expresion, with the logarithm to the number of copies detected by LightCycler. White bars ar the unstimulated cells, grey are stimulated cells and black bars cells stimulated and added PAA.
EXAMPLES
Materials and Methods
Bioinformatics
The Blast programme available at http://www.ncbi.nlm.nih.gov/BLAST/ was used to identify EBV encoded sequences with similarities to known GPCRs. The programme TMHMM was used to predict trans membrane helices, NetNGlyc and NetOGIyc to predict N-linked and O-GalNAc glycosylation sites respectively, and NetPhos to predict phosphorylation sites. All prediction programmes are available at http://www.cbs.dtu.dk/services/.
Cell culture, reagents and plasmids
Human EBV DNA (strain B95.8) and Rhesus EBV DNA were kindly provided by Dr. Fred Wang, Harvard University, MA, USA. The glucose-dependent insulinotropic peptide (GIP) receptor, the κ-opiat receptor, the wild type Gαq expression construct, GIP and dynorphin were kindly provided by Dr. Christian Elling, 7TM-pharma, Hoersholm, Denmark. The recombinant G proteins Gαqs5 and GαΔ6qi4myr were kindly provided by Dr. Evi Kostenis, 7TM- pharma, Hoersholm, Denmark. Gαqs5 and GαΔ6qi4myr have switched receptor specificity from wild type Gαq interacting receptors to Gαs and Ga, interacting receptors respectively; Gαqs5 have replaced the 5 C-terminal amino acids of wild type Gαq with the 5 corresponding C- terminal amino acids from Gαs, and GaMqi4myr lacks the first six N-terminal amino acids, have replaced the 4 C-terminal amino acids of wild type Gαq with the corresponding 4 C- terminal amino acids from GOCJ, and include an N-terminal myristoylation site (Conklin et al., Kostenis et al. and Schulz et al.)- The T-REx-293 cell line (Invitrogen R710-07) were grown in DMEM (Invitrogen 31966-021) + 10% FBS and penicillin/streptomycin (Invitrogen 15140-022) with the addition of 15μg/ml Blasticidin S (Invitrogen R210-01) and 100 μg/ml Zeocin (Invitrogen R250-01) or 150μg/ml Hygromycin B (Invitrogen 10687- 5 010) at 37°C, 5% CO2. COS-7 cells were grown in DMEM (Invitrogen 21885-025), 10% FBS and penicillin/streptomycin, at 37°C, 10% CO2.
Receptor cloning
Cloning of Human and rhesus EBV BILFl and receptor HA-tagging was done using standard 0 PCR techniques using pfu polymerase (Stratagene) (human EBV BILFl: forward primer: 5 ' -taqaaqcttatgtacccafacσacαtøccaαactacαcactctccaccatqqccccc and reverse primer 5 '- taqctcqaqtcaqqtqqactqgctaqqc, rhesus EBV BILFl: forward primer 5 '- taqaaqcttatofacccatøcσacσfaccagacfacgcactctccaccctqqcccc and reverse primer 5 '- taqctcqaqtcaqqtqqactgqqtqqac). Human and rhesus EBV BILFl were inserted into 5 pcDNA5/FRT/TO (Invitrogen V6520-20) by cohesive end ligation. The resulting human- and rhesus-EBV BILFl constructs (SI-.Fl-pcDNA5/FRT/TO) are hereafter called HuBILFl and RhBILFl respectively. The constructs also contain the hygromycin resistance gene with a FIp Recombination Target (FRT) site embedded in the 5 'coding region. The hygromycin resistance gene lacks a promoter and the ATG initiation codon. 0
Generation of stable, BILFl inducible cell lines
Stable, tetracycline (Tet) -inducible BILFl cell lines were generated using the FIp-In T-Rex Core kit (Invitrogen K6500-01) by FIp recombinase mediated integration. The 293 T-REx cell line contains one integrated FRT site originally encoded by the pFRT//acZeo vector 5 (Invitrogen V6015-20) and expresses the Tet-repressor originally encoded by the pcDNA6/TR vector (Invitrogen V1025-01). The FRT site is maintained by selection for zeocin resistance and the Tet-repressor is maintained by selection for blasticidin resistance. The integrated FRT site is contained just downstream of the ATG initiation codon of the lacZ-Zeocin fusion gene. Briefly, T-REx-293 cells were transfected with 0 HuBILFl or RhBILFl and pOG44 (Invitrogen V6005-20) for transient expression of the FIp recombinase using the Fugene-6 transfection reagent (Roche 1814433) according to the manufactures protocol. Upon co-transfection, the FIp recombinase mediates homologous recombination between the FRT site, so that BILFl is inserted into the genome at the already integrated FRT site. This insertion brings the SV40 promotor and the ATG initiation 5 codon (from the lacZ-Zeocin fusion gene) into proximity and in frame with the ATG minus hygromycin resistance gene, and at the same time inactivates the lacZ-Zeocin fusion gene. Stable BILFl clones were selected for blasticidin and hygromycin resistance and controlled for zeocin sensitivity and screened for the lack of β-galactosidase activity. The resulting HuBILFl and RhBILFl cell lines therefore contain the BILFl ORFs under the control of a Tet-regulated hybrid CMV/TetO2 promoter. The CMV/TetO2 promoter is inactive in cells expressing the Tet-repressor (T-REx-293 cell line) where it is activated by the addition of Tet. It should be noted that the CMV/TetO2 promoter is fully active in cells not expressing the tet repressor.
Immunoblotting and receptor de-glycosylation
For receptor studies, cells were stimulated with Tet (Invitrogen Q100-19) to induce receptor expression. For Western blotting, cells were lysed in RIPA lysisbuffer (5OmM (tris- HCI, pH 7.4, 15OmM Nad, ImM EDTA, 1% NP-40, 0.25% Na-deoxycholate, 0.1% SDS with the addition of protease inhibitors (PMSF, aprotenin, leupeptin, pepstatin), and phosphatase inhibitors (activated Na3VO4 and NaF). For receptor glycosylation studies cells were lysed in 0.1M tris-HCI, 1OmM EDTA, 1% Triton X-114 and PMSF. Triton X-114 is soluble in aqueous solutions at 0°C but not at 37°C. This property makes is suitable for separating membrane fractions (and the embedded receptors), from water-soluble proteins. Briefly, cells were lysed on ice for 15 min and centrifuged for 30 min at 5500 rpm at 4°C. The supernatant was incubated at 37°C until unclear and spun for 10 min at 4000 rpm at R/T to separate the detergent phase (DF) from the aqueous phase (upper phase). The DF was supplemented with 0,1M tris HCI pH 8.1 to starting volume and incubated on ice until clarified and the phase separation was repeated. The DF was again supplemented with 0.1M tris HCI pH 8.1 to starting volume and clarified with 2.5μl 10% CHAPS. The supernatant DF was separated from the aqueous phase by centrifugation for 15 min at 4000 rpm at 4°C. Receptor de-glycosylation was done using glycopeptidase F (SIGMA G5166) according to the manufactures protocol and proteins analysed by western blotting using anti HA-antibody (Biosite HA.ll).
Immunocytochemistry and confocal microscopy
For immune staining HuBILFl and RhBILFl cell lines were grown on CC2 treated Lab-Tek Chamber glass slides (Nalge Nunc International 154917). 24 hours after Tet stimulation cells were fixed in 3.7% formaldehyde, washed in PBS and permeabillized in 0.2% Triton X-100 for 20 min on ice. Cells were blocked in PBS containing 1% BSA and 5% goat serum for 30 min at R/T and incubated with anti HA antibody (Biosite HA.ll) for 1 hour at R/T. Cells were washed and incubated with FITC conjugated goat anti mouse antibody (Kirkegaard & Perry Laboratories 02-18-06) for 1 hour at R/T. Cells were mounted with Fluoromount-G (Southern Biotechnology Associates 0100-01). Confocal fluorescence microscopy was done on an inverse Zeiss Axiovert 200 fluorescence microscope equipped with a Coolsnap charge-coupled device camera. Digital images were transferred to Adobe Photoshop and used without further processing. Inositol phosphate production
For inositol phosphate turnover, COS-7 cells were transfected using the calcium phosphate precipitation method (Rosenkilde et al.)- Briefly, 20μl 2M CaCI2, DNA and TE buffer to a 5 total volume of 160 μl were mixed and added drop-wise to 160μl 2X HBS buffer. After 45 min incubation the mixture was added to the cells and incubated with the addition of 100μM chloroquine for 5 hours. One day after transfection the cells were transferred to 6 well plates (5 x 105 cells/well) and incubated for 24 hours with 4μCi of myo-[3H]inositol (Amersham TRK911) in 0.8 ml of complete medium/well. Cells were washed twice in IP-
10 buffer (20 mM HEPES buffer (pH 7.4) supplemented with 140 mM NaCI, 5 mM KCI, 1 mM MgSO4, 1 mM CaCI2, 10 mM glucose, and 0.05% (w/v) bovine serum albumin) and incubated in 1.0 ml of IP-buffer supplemented with 10 mM LiCI at 370C for 90 min. GIP and dynorphin were added to a final concentration of 10'7M after 15 min pre-incubation. After incubation the buffer was removed and accumulated inositol phosphates were extracted for
15 30 min on ice in 1.0 ml 1OmM formic acid. The generated [3H]inositol phosphates (IP3) were purified on Dowex 1X8 anion-exchange resin and radioactivity was counted in a scintillation counter (Rosenkilde et al.). Radioactivity values are given as counts per minute (CPM).
20 Cyclic AMP (cAMP) response element binding protein (CREB) reporter assay.
For luciferase reporter assays, COS-7 cells (35,000 cells/well) were seeded in 96-well plates and transfected with a reporter-cDNA cocktail consisting of 6ng pFA2-CREB and 50ng pFR-Luc reporter plasmids (PathDetect CREB trans-Reporting system; Stratagene) and various amounts of receptor and G protein DNA using Lipofectamine 2000 (Invitrogen)
25 according to the manufactures protocol. Following transfections, cells were treated with the respective compounds (lOμM forskolin or 10μM forskolin + O.lμg/ml PTx) in an assay volume of lOOμl for 24 hours. The assay was terminated by washing the cells twice with PBS, and adding lOOμl PBS supplemented with ImM MgCI2 and CaCI2 and lOOμl of luciferase assay reagent (LucLite; Packard). Luminescence was measured in a TopCounter
30 (Top Count NXT; Packard) for 5 sec. Luminescence values are given as relative light units (RLU).
Quantification of BILFl RNA in EBV infected B-cells
AKata B-cells were stimulated for 3 hours with or without the addition of 300 μg/ml 35 phosphonoacetic acid (PAA) (SIGMA SP6909) with 0,5% (V/V) IgG (DAKO A042410). Total RNA were isolated using the RNAqueous-4PCR kit for isolation of DNA free RNA (Ambion 1914 according to the manufactures protocol. Reverse transcription first strand BILFl cDNA synthesis were done on 4.0 μg total RNA using Superscript II RT (Invitrogen 18064- 14) and reverse primer 5 'ctatcagcctgacatccatt in a total volume of 2OuI. Real Time PCR were done on 5,0 μl RT (reverse transcribed) cDNA corresponding to reverse transcripts from 1,0 μg of total RNA/ capillary. Briefly 5 μl cDNA sample was added to 15 μl containing 0,5 μM forward primer 5 'gtcaatgcaacggaagatgc 0,5 μM reverse primer (as above), 3mM 5 MgCI2 and 2 μl LightCycler SYBR Green I reaction mix (Roche 2 239 264) (containing
FastStart Taq DNA polymerase, reaction buffer, dNTP mix, SYBR Green I and 1OmM MgCI2) in lightCycler capillaries. The standard curve was made from the Hu-BILFl plasmid in a 1OX serial dilution ranging from 108 - 101 copies/capillary. The amplification were done on a LightCycler (Roche) under the following conditions: Preincubation and denaturation at 10 95C for 10 min, 45 amplification cycles of 95C for 10 sec, 6OC for 5 sec and 72 sec for 10 sec and a melting curve analysis from 7OC to 95C with a slope of 0,lC/sec. Datawere analysed using LightCycler software version 3 (Idho Technologies Inc.)
Results
15 EBV encodes a GPCR homolog
Initially, blast analysis uncovered that the equine herpesvirus-2 encoded GPCR homolog, ORF E6 contained limited sequence identity (17% amino acid identity, PAM250 similarity matrix) to the EBV ORF BILFl. Trans membrane helices analysis clearly demonstrated that BILFl contains seven hydrophobic helices (Figure 1), a hallmark for all GPCRs. In addition,
20 BILFl contains several additional characteristics of GPCRs. These include conserved cysteines in the amino (N) -terminal, and in the extra cellular loops (Figure 1), which are known to form structurally and functionally important disulfide bonds in GPCRs 19. Furthermore, BILFl is predicted to contain seven N-terminal glycosylation sites, which are important for both GPCR-ligand interactions and for receptor expression and cellular
25 localization (Ludwig et al.), as well as four intracellular phosphorylation sites (Figure 1), which are important for GPCR mediated signalling, receptor regulation and intracellular targeting 35. Interestingly, the DRY (aspartic acid, arginine, tyrosine) motif at the intracellular end of TM-III, which is conserved in most rhodopsin-like GPCRs, is substituted with an EKT (glutamic acid, lysine, threonine) motif in BILFl. However, this conservative
30 amino acid substitution (i.e. same order of acidic, basic and polar side chains) can be considered an alternative DRY motif (Figure 1 and 2). It should be noted that alternative 'DRY' box motifs are present in numerous vGPCRs.
BILFl belongs to a novel receptor sub-family
35 Further Blast analysis revealed that BILFl is not only encoded by human EBV, but also by other γl-herpesviruses. Together, this group of BILFl related sequences constitute a new family of related GPCRs, exclusively encoded by, and a trait for, γl-herpesviruses (Figure 2). Indeed, BILFl is one of just six genes present only in γl-herpesviruses. This genomic evidence suggests that BILFl plays an important role in the lifecycle of γl-herpesviruses. Multiple sequence alignment of eight BILFl related sequences with a wide range of vGPCRs, belonging to the US28, UL33, UL78, UL51 and ORF74 subfamilies revealed that all BILFl sequences group together and constitute a separate vGPCR subfamily (Figure 3)
Cloning and generation of cell lines
The present inventors cloned human EBV and Rhesus EBV BILFl and inserted the receptor reading frames into pCDNA5/FRT/TO generating HuBILFl and RhBILFl respectively. The BILFl sequences were confirmed by sequence analysis and corresponded to nucleotide 152161 -153099 in the Human herpesvirus 4, complete genome (GenBank accession NC_001345) and to nucleotide 147746 -148684 in the Rhesus EBV (Cercopithicine herpesvirus 15), complete genome (GenBank accession AY037858). The present inventors generated several clonal cell lines of both HuBILFl and RhBILFl. For our expression studies the present inventors selected clones with the lowest BILFl background expression that could be induced to express high levels of BILFl after Tet induction. Tet-dose experiments showed that 0.1 μg Tet/ml media were sufficient to induce maximal BILFl expression 24 hours post stimulation (data not shown).
BILFl is heavily glycosylated
To study receptor glycosylation, membrane samples from Tet-induced HuBILFl expressing cell lines were either kept untreated or treated with PNGase-F to remove N-Iinked glycosylation sites prior to SDS-PAGE separation and Western blotting. Staining with anti HA-antibody showed that BILFl is expressed as a heterogeneous approximately 50 kDa heavily glycosylated protein since PNGase F treatment reduced the apparent mass to approximately 33 kDa, which is close to the calculated MW of 34.5 kDa (Figure 4). These data support the computer-based prediction of N-terminal glycosylation sites in BILFl.
BILFl is localized to the plasma membrane Tet-induced HuBILFl and RhBILFl cell lines were stained with an anti HA-tag antibody and receptor localization was studied by confocal microscopy. As shown in figure 5, both human- (A) and rhesus- (B) EBV BILFl mainly localizes to the plasma membrane. This is concurrent with the expression pattern of most GPCRs, but is in contrast to the predominantly intracellular localization of many vGPCRs. It further supports our prediction that BILFl is indeed a membrane protein and therefore a target for drug intervention. BILFl signals constitutively through Ga1 To study whether human EBV BILFl is a functional GPCR, the present inventors tested the activation of a variety of Ga proteins. To facilitate these studies of constitutive, i.e. ligand independent, BILFl mediated signalling, the present inventors used chimeric Gαq proteins comprising the three major types of Ga subunits; Gaq, Ga5 and Ga1. Both the wild type and the chimeric Gαq proteins, Gαqs5 and GαΔ6qι4myr signal via activation of PLC leading to accumulation IP3. COS-7 cells were transfected with an increasing amount of HuBILFl DNA together with a constant quantity of different Ga DNA or empty expression vector DNA. Figure 6A shows, that BILFl did not activate PLC through endogenous Gαq.
As a positive control for endogenous Gαq function, the present inventors transfected COS-7 cells with ORF74, which constitutively activates Gαq. As seen in figure 6B, transfected COS- 7 cells were fully capable of activating PLC through endogenous Gαq. Co-transfection with Gαqs5 revealed that BILFl does not signal via activation of G protein α subunits of the s- class (Figure 6A). As a positive control for Gαs function, the present inventors co- transfected COS-7 cells with Gαqs5 and the GIP receptor (which activates Gαs upon ligand engagement), and stimulated transfected cells with GIP. As seen in figure 6C, GαqsS was fully capable of activating PLC after GIP-receptor activation. Finally, the present inventors investigated whether BILFl could signal through G protein α subunits of the i-class. Co- transfection with GαΔ6qι4myr revealed that BILFl indeed signals through G protein α subunits of the i-class. Figure 6A show that increasing doses of BILFl increase PLC activity only when co-transfected with chimeric G protein with specificity towards Ga1 activating receptors. As an additional positive control for Ga1 function the present inventors co- transfected COS-7 cells with the κ-opιat receptor and GαΔ6qι4myr, and stimulated transfected cells with dynorphin. As seen in figure 6C, GαΔ6qi4myr was also fully capable of activating PLC after κ-opιat receptor activation. Importantly, none of the chimeric and endogenous G proteins were active without concurrent receptor expression (figure 6A, B and C).
To further test the specificity of the system, and to ensure that our results were not merely a result of G protein over-expression, the present inventors co-transfected BILFl with wild type Gαq. Transfection with Gαq did not result in an increased basic level of PLC activity, nor did it cause any measurable BILFl activity (figure 6A and B), whereas over expression of Gαq slightly increased ORF74 mediated signalling (figure 6B). Overall, these data show that BILFl is constitutively active and mediates its signal through G protein α subunits of the i-class.
The present inventors further tested whether also the rhesus EBV encoded BILFl were constitutively active, and whether rhesus EBV BILFl activated the same G protein as the human EBV BILFl. Co-transfection of RhBILFl with the same chimeric G proteins as described above revealed that also rhesus EBV BILFl is constitutively active, and like the human EBV homolog, mediates its signal through activation of Ga1. Figure 7 shows a representative example of 4 independent experiments. Besides revealing homologous Ga subunit activation, the RhBILFl activity level was very similar to the activity of HuBILFl (compare figure 6B and 7). Thus, both human and rhesus EBV BILFl signals constitutively via Ga, and with similar efficacies.
As an additional readout for BILFl driven Ga, activity the present inventors measured the generation of CREB stimulated luciferace reporter activity. COS-7 cells were transfected with an increasing amount of HuBILFl DNA together with a constant quantity of GαΔ6qι4rnyt. DNA or empty expression vector and a reporter-cDNA cocktail consisting of 6ng pFA2-CREB and 50ng pFR-Luc reporter plasmids. Figure 8A show that BILFl activates CREB through GαΔ6qι4myr in a dose dependent manor. Furthermore, it is evident that BILFl does not activate CREB without co-transfection with GαΔ6φ4rnyr. This result therefore confirms the inositol phosphate data, validating that BILFl signals constitutively through Ga1
BILFl activates endogenous i-class G proteins
To study whether BILFl could activate endogenous Ga1, the present inventors tested the ability of BILFl to inhibit forskolin stimulated CREB activity. COS-7 cells were transfected with increasing amounts of HuBILFl DNA together with a reporter-cDNA cocktail consisting of 6ng pFA2-CREB and 50ng pFR-Luc reporter plasmids. After transfection cells were stimulated with 10μM forskolin with or without the addition of PTx. Figure 8B show that BILFl almost completely inhibited forskolin induced CREB activity in a dose dependent manner. Furthermore, BILFl mediated signalling can be inhibited by addition of PTx, a potent inhibitor of Gαr. The addition of PTx restored CREB activity to approximately 60% of maximum forskolin stimulated CREB activity. These data confirms that BILFl constitutively activates endogenous G proteins of the i-class causing the diseases described in the claims of this application.
BILFl expression To study whether BILFl is expressed in EBV infected cells, the present inventors measured the numbers of BILFl specific RNA copies using Real Time PCR. Latently EBV infected Akata B-cells were either kept untreated (latent) or stimulated with IgG to induce lytic EBV replication cycle. As shown in figure 9, the induction of lytic replication strongly induced expression of BILFl RNA, indicating that BILFl is a lytic gene and not a latent gene. To study whether BILFl is expressed as an early or late gene during EBV lytic replication cycle, IgG induced Akata B-cells were further treated with phosphonoacetic acid (PAA). PAA inhibit viral DNA replication. Early lytic genes are defined as genes who's expression are independent on viral DNA replication. Late lytic genes are defined as genes who's expression are dependent on viral DNA replication. As shown in figure 9, BILFl expression is inhibited by PAA, suggesting that BILFl is a late lytic transcript in EBV infected Akata B- cells.
Discussion
Several large DNA viruses encode vGPCRs with unusual pharmacological and cellular properties and with significant biological functions. The present inventors have identified a new sub-family of vGPCRs, the BILFl receptors, encoded by EBV and other γl- herpesviruses.
The studies presented in the present application of human EBV BILFl and the closely related homolog from rhesus EBV show that these receptors are functional GPCRs, constitutively signalling through Gα|.
Additionally, the present inventors show that BILFl is heavily glycosylated and is localized to the plasma membrane in stable expressing epithelial cell lines. It is intriguing that EBV, a major human oncogenic herpesvirus, encodes a constitutively active GPCR, considering the significance of the KSHV encoded GPCR, ORF74, for the development of KS. However, even though the significance of ORF74 for KS pathogenesis is well established, many questions regarding its significance for viral replication still remain unanswered.
One interesting function of ORF74 may be to increase the efficiency of KSHV reactivation. This observation is intriguing since ORF74 is regarded as an early lytic gene and is not expressed in the vast majority of otherwise latently infected cells, and suggests that some level of lytic replication can activate latently infected cells, presumably through paracrine mechanisms. Intriguingly, it has been proposed that dysregulation of the KSHV gene program caused by HIV-I Tat, inflammation or aborted lytic replication may indeed lead to non-lytic expression of ORF74.
Like ORF74, the present inventors show that BILFl is a lytic gene. Furthermore, the present inventors show that BILFl expression is dependent on viral DNA replication, since the expression is inhibited by PAA. This shows that BILFl plays a role during the formation of viral particles in Akata infected B-cells. This function could be directly involved in the formation of viral particles, e.g. induce transcription of structural viral proteins, it could be involved in changing the intracellular milieu e.g. to increase the fitness of the virus, or it could be involved in changing the extracellular environment e.g. to assist viral dissemination in the host or counteract the host antiviral immune response. Primary EBV infection is the most common cause of infectious mononucleosis, and by adulthood, nearly all humans are asymptomatic carriers of EBV. Besides causing mononucleosis, EBV infection is associated with endemic Burkitt's lymphoma, nasopharyngeal carcinoma, Hodgkin's disease, gastric carcinoma, leiomyosarcoma and AIDS- and transplant-associated B cell lymphomas.
The viral and host factors implicated in the development of EBV associated malignancies were until now poorly understood. The degree of immunosuppression is one risk factor for some malignancies but immune-suppression alone is not sufficient for the development of other types of malignancies.
Indeed both Burkitt's lymphoma and Hodgkin's lymphoma occur in patients without immunosuppression. Additionally, chromosomal abnormalities and somatic hypermutation of cellular oncogenes, have been hypothesized to act in concert with EBV infection to cause malignancies.
Like KSHV, EBV associated malignancies are characterised by a mainly latently infected cell population, and several latently expressed genes have been shown to cause ceil transformation in vitro. Nevertheless, in a population of latently EBV infected cells, a small fraction of cells are spontaneously permissive for lytic replication.
Based on the results described in this application BILFl, contribute to control both the level of reactivation, and is involved in EBV tumorgenesis, by acting on uninfected or latently infected cells through paracrine mechanisms.
Many vGPCR (e.g. UL33, US27, US28 and M78) are characterized by an unusual cellular localization pattern. Detailed analysis of US28 showed that US28 underwent constitutive endocytosis and recycling to the plasma membrane. It has been suggested that the constitutive endocytosis and recycling of US28 could be a mechanism for sequestering host CC-chemokines providing a sink for clearing pro-inflammatory CC-chemokines from the tissue surrounding the CMV infected cell, thereby antagonizing the recruitment of cells involved in the immune response against CMV.
Furthermore, It has been speculated that the intracellular localization of many vGPCR could facilitate incorporation of the vGPCRs into the maturing virion envelopes. Indeed, UL33, M78 and US27 have all been identified on viral particles. The localization of BILFl to the plasma membrane, distinguish BILFl from the UL33, US27, US28 and M78 vGPCR subfamilies. However, BILFl localizes similar to ORF74. This parallel could reflect that BILFl and ORF74 have similar functions during γ-herpesvirus replication.
Several receptors from the US28, UL33 and ORF74 receptor subgroups have been characterized as being constitutively active. As described in the introduction, the KSHV encoded oncogene ORF74 is both highly constitutively active and responds to ligand engagement. Additionally, UL33, M33 and R33 all constitutively stimulates phospholipase C (PLC) whereas only the rodent CMV receptors, M33 and R33 activates NF-κB driven transcription. UL33 and M33 activate CREB through activation of Gαs and the mitogen activated protein (MAP) kinase, p38, whereas R33 inhibits forskolin stimulated CREB through Ga1. US28 also activates several different signal transduction pathways both constutively and ligand mediated.
Even though a lot is known about vGPCR pharmacology in general and about which signalling pathways that are activated, only little is know about the significance of the constitutive activity for viral replication. Besides regulating downstream second messenger systems, control viral and host gene transcription and direct cell morphology and motility, the constitutive activity of vGPCRs may directly regulate the signalling mediated by other GPCRs.
Therefore, the present inventors show that BILFl function as a regulatory switch for other GPCRs expressed in EBV infected cells. EBV also control the transcriptional regulation of host GPCRs.
Originally EBV was shown to induce expression of two orphan GPCRs, EBV-induced (EBI) 1 and 2 9. EBI-I is now known as the chemokine receptor CCR7, whereas EBI-2 is still an orphan. In addition, it has been shown that EBV immortalized B-cells have altered chemokine receptor expression pattern, which could be responsible for the distorted migration of infected B-cells to germinal centers 39. Thereby EBV seems to control the GPCR settings on many levels, emphasizing the importance of both endogenous GPCRs and vGPCR for viral replication, dissemination and immune evasion. It should be noted, that BILFl itself does not display any particular similarities to know chemokine receptors.
Since many receptors activate overlapping second messenger systems, it is difficult to predict which vGPCR activated pathways that are responsible for cellular transformation. It was recently shown that the Akt signalling pathway plays a central role in ORF74 mediated oncogenesis. Furthermore, it has been shown, that ORF74 constitutively activates Akt via Gαi and PLC 11,17,53. It is therefore likely that Gαi activity is directly involved in KSHV mediated cell transformation, though it is unlikely to be the only signalling pathway involved. Other non-transforming vGPCR (e.g. R33 and US28) also activates Gαi, and ORF74 activates several additional pathways. Indeed, the fact that ORF74 stimulates a broad range of signalling pathways has been taken into account for the transforming properties of this receptor, and it has been suggested that the transforming effects of ORF74 may be mediated cooperatively by Gαq and Gαi signalling. In this application the present inventors show that the EBV encoded GPCR, BILFl, constitutively activates Gαi. In this application the present inventors show that EBV encoded BILFl through its highly constitutive signalling is the central player in EBV associated cell transformation.
BILFl diagnostic: Measure the Expression of BILFl RNA using real-time PCR.
Background
During latent EBV infection only nine genes are expressed. Six of these are the EBV nuclear antigens (EBNA) and three are the latent membrane proteins (LMPs) (5). There are three different types of latency. In latency I only few of the genes are expressed among them EBNAl. Latency II is lacking EBNA2 expression but EBNAl and the LMP's are expressed. In latency III all the latent genes, including EBNAl, are being expressed. When EBV infects human B lymphocytes in vitro it results in latency III (6). We use EBNA3C as a control for latency. EBNA3C has a down-regulating effect on the viral Cp promoter and a down -or upregulating effect on the LMP promoter. Further more EBNA3C up-regulates the cellular CD21 promotor and thereby inducing expression of CD21(10). EBNA3C also has a function as a repressor of EBNA2 mediated activation of transcription (11).
We determine whether BILFl is an early or late viral lytic gene. The definition on an early gene is a gene that it is independent on the viral DNA replication, whereas a late gene is dependent on the viral DNA replication. To determine this we use phosphonoacetic acid (PAA), which inhibits viral DNA replication. To determine whether BILFl is an early or late gene a group of control genes is used for comparison. BZLFl is known to be an immediately early gene (7). Thus BZLFl is not dependent on the viral DNA replication. BZLFl has two introns and 3 exons. The ZEBRA protein is encoded by all three exons, but there also is a protein encoded only by exon 1 and exon 3. Furthermore BZLFl and BRLFl together encodes three proteins, again is BZLFl splices differently, so in total BZLFl encodes five different protein, but the ZEBRA protein is the most common (8). The primers used in the experiments detect all the mRNA transcribed from BZLFl genes (see figure 10 for BZLFl transcripts). As a late gene the viral envelope glycoprotein gp350 is chosen (3). When EBV enters the B-cell gp350 binds to the receptor CD21 (2). EBV binding to CD21 results in an increase in blast formation, cell adhesion and an increase in RNA synthesis (9). gp350 and gp220 are both coded for by the open reading frame BLLFl. We use the three control genes EBNA3C, BZLFl and gp350. Thus, we control for early, late and latent infection, and we therefore determine whether BILFl is an early lytic, late lytic or latent gene, and furthermore we associate the expression pattern of EBI- II to a distinct part of the viral replication cycle. (Figure 11 shows gp350 and gp220 transcripts)
Principles of LightCycler
We investigate BILFl expression and compare the expression to the expression of BZLFl, gp350 and EBNA3C. This is being investigated by real-time PCR using a LightCycler instrument. The LightCycler is measuring fluorescence intensity (F). The LightCycler determine the incorporation of SYBR Greenl. SYBR Greenl only binds to and fluoresces when the DNA is double stranded. Thus after denaturation there is only a weak signal. During annealing the SYBR Greenl can bind to DNA, and gives a signal. During elongation more SYBR Green 1 can bind, so in the end of elongation the maximum amount is bound. The LightCycler measure the fluorescence at the end of the elongation phase. A known problem with this technique is that even though there is no template in the reaction, the LightCycler often produce a signal. However it is well known that this signal most often is caused by the formation of primer-dimers. The formation of primer-dimer can be detected by looking at the melting curve, presented by the LightCycler instrument. Primer-dimers have a melting point at approximately 78 0C, whereas the fragments in the experiments have melting points from 82 - 86 0C. Furthermore the amplification products can be analyzed on an agarose gel. The melting curve is created after the final cycle. The LightCycler heat from 55 to 95 0C, measuring the fluorescence every 0.2 0C. The melting curve is visualized by taking -dF/dT. But the easiest way to see the melting point is by a melting peak is by plotting -dF/dT against the temperature. The LightCycler can detect from 10 - 1010 copies of DNA. The sensitivity is dependent on the quality of the template, primer design and the optimizing of PCR condition. For quantification we use a sample (template) with a known copy number, which can be compared to a standard curve for calculation of the number of copies in the experimental samples.
Materials and methods
Cell lines
We use RNA isolated from immortalized B-cells. The cell lines used are the EBV negative Akata cells (Akata-) used as negative control, and the EBV positive cell lines Akata (Akata+), B95.8 an EBV positive lymphoblastoid cell line (1) and P3HR1, a Burkitt's lymphoma-derived cell line (4).
We further analyse RNA extractions from the following samples provided by Prof.dr. Jaap M. Middeldorp and Dr. Servi J. C. Stevens. All clinical RNA samples are isolated from frozen tissue specimens, except where indicated (cell lines). RNA was isolated using the RNAzol method (until and including the isopropanol step and then stored at -800C.
Induction of lytic replication in EBV B-cβll lines We grow cells in RPMI 1640 medium + L-glutamine (Invitrogen Life Tecnology, 21875- 034) with 10% fetal bovine serum (Invitrogen) and 100 units pr ml penicillin and streptavidin (Invitrogen, 15070-063). The cells are incubated at 37°C, and 5% CO2. The cells are split when they reach a density of approximately 106 cells/ml. Akata cells: approximately 107 cells are used for each assay. Prior to stimulation cells are pelleted by centrifugation at 1500 rpm for 5 min. The cells are resuspended in fresh media so the final concentration was 106 cells/ml. The Akata cells are stimulated with 0.5% v/v IgG antibody (DAKO, A042410), or IgG antibody plus 300μg/ml PAA to inhibit viral DNA replication. B95.8 cells are stimulated with butyric acid and the phorbol ester 12-O-tetradecanoyl- phorbol-13-acetate (TPA). NaOH are added to neutralize pH. To optimize the stimulation of the cells three different concentrations of butyric acid and TPA are used in different combinations. The butyric acid concentration is 3-, 6- or 12 mM and TPA is added so the final amount is 10-, 20- or 30 ng pr ml. Half of the cells are also incubated with PAA (300μg/ml). For ail cell lines, unstimulated cells are included in the experiment to study latent gene expression. After 3 hours of incubation at 37 0C, 5% CO2 the samples are pelleted by centrifugation at 1500rpm for 5 minutes and resuspended in new medium. PAA are again added to the cells, which were previously incubated with PAA. The cells are then incubated for 48 hours at 37 0C. After 48 hours the cells are pelleted and washed in PBS before RNA is isolated.
RNA isolation
To isolate RNA from EBV infected B-cell lines we use the "RNAqoues 4-PCR" kit (AMBION, cat no. 1914) according to the manufactures instructions with the exception that 96% ethanol were used instead of 100% ACS grade ethanol. We elute RNA in 60μl H2O. After isolation of RNA, the samples are treated with DNase I by adding 0.1 volume of DNase I buffer and 1 μl DNase I provided with the kit. After the DNase treatment, the DNase I is inactivated and the supernatant is transferred to a new RNase free Eppendorph tube. The amount of RNA recovered is determined by spectrophotometry at OD260.
Clinical Samples RNA extractions from the following 22 samples were provided by Prof.dr. Jaap M.
Middeldorp. All RNA samples are isolated from frozen tissue specimens, except cell lines. RNA was isolated using the RNAzol method (until and including the isopropanol step and then stored at -800C.
Figure imgf000058_0001
The present inventors precipitated and pelleted the RNA from the isopropanol by centrifugation of the isopropanol-RNA solution for 30 minutes at 13000 rpm in standard bench-top centrifuge at 4°C. Then the supernatant was removed and the pelleted RNA was washed in 500 μl of cold 75% ethanol.The RNA was pelleted by centrifugation at 13000 rpm for 5 minutes and supernatant was removed and the pellet air-dried for 15-30 minutes The pelleted RNA was resuspended in 12 μl H2O.
cDNA synthezing cDNA is synthesized using "First Strand Transcription cDNA synthesis Kit" from Roche (Cat no. 04379012001). The amount of RNA varies between 1 and 3μg. The final primer concentration is 1 nM, water is added to 13 μl and heated 10 min at 65 0C. The primer sequence for BILFl is 5'-CTATCAGCCTGACATCCATT-S', BZLFl 5'- GGAACACCAATGTCTGCTAG-3', gp350 5'-TGTCAGCTGGCCAAAGTCAA-S' and EBNA3C 5'- TTTCTTGCTCTCTTGGTCCA-3'. After heating in 10 min dNTP is added to a final concentration of ImM. Ix reverse transcriptase buffer, 20 Units RNase inhibitor and 10 units reverse transcriptase enzyme is also added and we heat up the samples for 30 min at 55 0C followed by 5 min at 85 0C to inactivate the reverse transcriptase.
Real-time PCR
Real-time PCR is run on a LightCycler using the "LightCycler - FastStart DNA Master SYBR green I kit" from Roche (Cat No. 2239264). The final MgCI2 concentration is 3 mM. We use the previously mentioned reverse primers and the forward primers are: BILFl 5'- GTCAATGCAACGGAAGATGC-3', BZLFl 5'-CTCCGACATAACCCAGAATC-S', gp350: 5'- TACACCATCCAGAGCCTGAT-3' and EBNA3C Ξ'-GGGATATCGTACAGCAACAC-S'. All primers are designed to have an annealing temperature of approximately 60 0C. The primers are designed to give PCR fragments with a length between 120-180 bp, which is recommended by the manufacturer. For standard curves a series of 10 fold dilutions were prepared, from 102 to 108 copies of the plasmid containing the gene of interest (BILFl, BZLFl, gp350 or ENBA3C). 5μl of plasmid DNA is added for the standard curves and for characterization and quantification 2μl of cDNA is added. We use amplification settings: 95 0C for 10.00 min followed by 45 cycles of 95 0C for 10 sec 60 0C 5 sec and 72 0C for 10 sec. In each run up to 32 samples are included. Finally melting curves are determined by gradually heating all the samples to 95 0C. In each run both positive and negative controls are included. The standard curve is used to determine the number of copies in the experimental samples. The negative control contains water in place of template DNA. The LightCycler gives the results as the logarithm of the fluorescence detected during the amplification plotted against cycle number. The LightCycler can measure from 10 to 1010 copies. In the standard curves the cycle number is plotted against logarithm the concentration. To see if the amplified fragments have the right length, the capillaries are put in an Eppendorph tube and spun down for a couple of seconds to transfer the sample to the Eppendorph tubes. The products are controlled on agarose gels.
LightCydes We generated standard curves of all the genes to be investigated.
LightCydes on cDNA
The results from the real-time PCR are presented as number of copies of each specific mRNA in each capillary. Table 2 gives the logarithm to the number of copies mRNA pr μg RNA, from the different genes in the different cell lines, and if the decrease in the difference between the number of copies in the stimulated cells and the cells added PAA is significant. The results of gp350 show, as expected that gp350 is a late gene and is inhibited of PAA in both Akata+ cells and as previously shown in B95.8 cells (figure 15). Unstimulated cells Stimulatec J cells Stimulated cells +
Latent Lytic induction + PAA
Logarithm Standard Logarithm Standard Logarithm Standard Is the to deviation to deviation to deviation inhibition number number number significant of copies of copies of copies
RNA RNA RNA
Akata+
BILFl 4.0 0.07 5.4 0.04 4.8 0.03 yes
EBNA3C 6.9 0.09 7.1 0.001 6.5 0.002 no gp350 1.7 0.3 4.4 0.07 3.05 0.16 yes
BZLFl 2.0 0.02 2.8 0.4 3.6 0.02 no
B95.8
BILFl 5.1 0.02 6.3 0.17 6.1 O.I no
EBNA3C 7.0 0.09 7.1 0.03 7.3 0.02 no gp350 5.7 0.18 7.4 0.13 5.1 0.002 yes
BZLFl 5.9 0.2 7.2 0.07 7.3 0.02 no
Tabel 2: Logarithm to the number of copies pr μg RNA and the standard deviation.
BZ The significance tested on a 5% significance level. LFl show no inhibition when adding PAA, which is expected, since BZLFl is a well known early viral gene (figure 16). Figure 17 shows how the latent gene EBNA3C is expressed in the three cell lines Akata+ and B95.8 and P3HR1 in samples of unstimulated, stimulated and stimulated +PAA cells. It shows that there is not the big difference between the unstimulated and stimulated cells.
The results on BILFl strongly indicate that BILFl is a late gene in the Akata+ cells.
Interestingly, when it comes to the B95.8 cells the data is not so clear (figure 18). There is a small inhibition but not at all as evident as with the Akata+ cells. With a significant level at 5% there are no differences between the mean values of the stimulated and stimulated +PAA for these cells. For P3HR1 cells it looks like an increase of BILFl expression when inhibiting the viral DNA replication, but it is not significant. These results indicate that BILFl is expressed differently in the cell lines, being a late gene in Akata+ cells and an early gene in B95.8 and P3HR1 cells. The inventors' results on the expression of BILFl suggest that BILFl is expressed differently in different cell-lines.
Figure imgf000060_0001
Figure imgf000061_0001
nd = not detectable x = low expression xx = low intermediate expression xxx = intermediate expression xxxx = high intermediate expression xxxxx = high expression
Post transplant lymphoproliferative disease (PTLD) Nasopharyngeal carcinoma (NPC) T cell lymphoma (TCL) Burkitt's lymphoma (BL)
The present inventors are thus showing that BILFl is present in the following tumor types:
1) Post transplant lymphoproliferative disease 2) Nasopharayngeal carcinoma 3) Non Hodgkin lymphoma 4) Burkitt's lymphoma
5) Gastric carcinoma ■„
T cell lymphoma
Example of a method of identifying ligands of BILFl
We generate the following amino acid substitutions in human EBV BILFl (aa numbering according to sequence np_039907):
1) Q187H 2) G188H
3) L189H
4) K190H
5) A191H
6) G192H 7) C193H
8) Y194H
9) L195H 10) Q187H, A191H 11) G188H, G192H 12) L189H, C193H
13) K190H, Y194H
14) A191H, L195H
15) A251H
16) G252H 17) S253H
18) L254H
19) G255H
We generate all the amino acid substitutions (single and double) number 1-19 alone. Furthermore we generate all the amino acid substitutions (single and double) number 1-19 and in combination with all single amino acid substitutions 6-10.
We introduce BILFl cDIMA and cDNA encoding the relevant chimeric G-protein (e.g. Gαqi5 ,Gαqi4, Gαqz5 , Gαqi4myr, Gαqi4myr and similar chemeric proteins which lacks the first six N- terminal acids) into COS-7 cells by the standard calcium phosphate transfection method or other methods of transfection (e.g. lipofectamine, superfect, effectene etc.). Two days post-transfection the cells are assayed for phosphorlipase C activity using an inositole phosphate turnover assay, briefly, One day after transfection the cells are transferred to 6 well plates (5 x 105 cells/well) and incubated for 24 hours with 4μCi of myo-[3H]inositol (Amersham TRK911) in 0.8 ml of complete medium/well. Cells are washed twice in IP- buffer (20 mM HEPES buffer (pH 7.4) supplemented with 140 mM NaCI, 5 mM KCI, 1 mM MgSO4, 1 mM CaCI2, 10 mM glucose, and 0.05% (w/v) bovine serum albumin) and incubated in 1.0 ml of IP-buffer supplemented with 10 mM LiCl at 37°C for 90 min. Metal ions (e.g Zn++ in the form of ZnCI2) are added at various concentrations 15 min pre¬ incubation. After incubation the buffer was removed and accumulated inositol phosphates were extracted for 30 min on ice in 1.0 ml 1OmM formic acid. The generated [3H]inositol phosphates (IP3) were purified on Dowex 1X8 anion-exchange resin and radioactivity is counted in a scintillation counter Radioactivity values are given as counts per minute (CPM).
REFERENCES
Baer, R., A. T. Bankier, M. D. Biggin, P. L. Deininger, P. J. Farrell, T. J. Gibson, G. Hatfull, G. S. Hudson, S. C. Satchwell, C. Seguin, and . 1984. DNA sequence and expression of the B95-8 Epstein-Barr virus genome. Nature 310:207-211.
Conklin, B. R., Z. Farfel, K. D. Lustig, D. Julius, and H. R. Bourne. 1993. Substitution of three amino acids switches receptor specificity of Gq alpha to that of Gi alpha. Nature 363:274-276.
Harrison, C. and Traynor J. R. 2003. The [35S]GTPγS binding assay: approaches and applications in pharmacology. Life Sciences 74: 489-508.
Hummel, M. and E. Kieff. 1982. Epstein-Barr virus RNA. VIII. Viral RNA in permissively infected B95-8 cells. J. Virol. 43:262-272.
Kostenis, E. 2001. Is Galphal6 the optimal tool for fishing iigands of orphan G-protein- coupled receptors? Trends Pharmacol. Sci. 22:560-564.
Ludwig, A., J. E. Ehlert, H. D. Flad, and E. Brandt. 2000. Identification of distinct surface- expressed and intracellular CXC-chemokine receptor 2 glycoforms in neutrophils: N- glycosylation is essential for maintenance of receptor surface expression. J. Immunol. 165: 1044-1052.
Milligan G. and Rees, S. 1999. Chimaeric Ga proteins: their potential use in drug discovery. TIPS 20: 118-124
Rickinson, A. and E. Kieff. 2001. Epstein-Barr Virus, p. 2575. In D. M. Knipe and P. M. Howley (eds.), Fields Virology, vol.2. Lippincott Williams & Wilkins
Rosenkilde, M. M., T. N. Kledal, H. Brauner-Osborne, and T. W. Schwartz. 1999. Agonists and inverse agonists for the herpesvirus 8-encoded constitutively active seven- transmembrane oncogene product, ORF-74. J. Biol. Chem. 274:956-961.
Schulz, A. and T. Schoneberg. 2003. The structural evolution of a P2Y-like G-protein- coupled receptor. J. Biol. Chem. 278:35531-35541. Wainer, I. W., Farideh, B. and Moaddel, R. 2003. High-throughput Screening using G- protein-coupled Receptors as the Target. Business Briefing: Pharmatech 2003.
Reference List
1 Beisser PS, Verzijl D, Gruijthuijsen YK, Beuken E, Smit MJ, Leurs R, Bruggeman CA, and Vink C: The Epstein-Barr virus BILFl gene encodes a G protein-coupled receptor that inhibits phosphorylation of RNA-dependent protein kinase. J Virol 79: 441-449, 2005.
2 Birkenbach M, Tong X, Bradbury LE, Tedder TF, and Kieff E: Characterization of an Epstein-Barr virus receptor on human epithelial cells. J Exp Med 176: 1405- 1414, 1992.
3 Germi R, Morand P, Brengel-Pesce K, Fafi-Kremer S, Genoulaz O, Ginevra C, Bailout
M, Bargues G, and Seigneurin JM: Quantification of gp350/220 Epstein-Barr virus (EBV) mRNA by real-time reverse transcription-PCR in EBV-associated diseases. Clin Chem 50: 1814-1817, 2004.
4 Ghosh D and Kieff E: cis-acting regulatory elements near the Epstein-Barr virus latent-infection membrane protein transcriptional start site. J Virol 64: 1855- 1858, 1990.
5 Inman GJ, Binne UK, Parker GA, Farrell PJ, and Allday MJ: Activators of the Epstein- Barr virus lytic program concomitantly induce apoptosis, but lytic gene expression protects from cell death. J Virol 75: 2400-2410, 2001.
6 Kieff, E. and Rickinson, A. Epstein-Barr virus and its replication. Knipe, D., Howley, P,
Griffin, D, Lamp, R, Martin M, Roizman, B, and Straus, S. 2511-2573. 2001. Ref Type: Generic
7 Morrison TE and Kenney SC: BZLFl, an Epstein-Barr virus immediate-early protein, induces p65 nuclear translocation while inhibiting p65 transcriptional function. Virology 328: 219-232, 2004.
8 Speck SH, Chatila T, and Flemington E: Reactivation of Epstein-Barr virus: regulation and function of the BZLFl gene. Trends Microbiol 5: 399-405, 1997.
9 Tanner JE, Alfieri C, Chatila TA, and az-Mitoma F: Induction of interleukin-6 after stimulation of human B-cell CD21 by Epstein-Barr virus glycoproteins gp350 and gp220. J Virol 70: 570-575, 1996. Wang F, Gregory C, Sample C, Rowe M, Liebowitz D, Murray R, Rickinson A, and Kieff E: Epstein-Barr virus latent membrane protein (LMPl) and nuclear proteins 2 and 3C are effectors of phenotypic changes in B lymphocytes: EBNA-2 and LMPl cooperatively induce CD23. J Virol 64: 2309-2318, 1990.
Zhao B and Sample CE: Epstein-barr virus nuclear antigen 3C activates the latent membrane protein 1 promoter in the presence of Epstein-Barr virus nuclear antigen 2 through sequences encompassing an spi-1/Spi-B binding site. J Virol 74: 5151-5160, 2000.

Claims

1. A method for identifying a compound capable of modifying a signal of a constitutively active G protein coupled receptor of a γl-herpesvirus, said method comprising
a) contacting the constitutively active G protein coupled receptor or a functional part thereof with a compound to be screened, and
b) determining whether the signal of said constitutively active G protein coupled receptor or a functional part thereof is modified by said compound.
2. A method according to claim 1, wherein said γl-herpesvirus is an Epstein-Barr virus.
3. A method according to claim 2, wherein the Epstein-Barr virus is a human Epstein-Barr virus.
4. A method according to any of the preceding claims, wherein the constitutively active G protein coupled receptor has at least 80% identity to the amino acid sequence of human BILF-I (SEQ ID IMO: 9).
5. A method according to any of the preceding claims, wherein the constitutively active G protein coupled receptor has at least 95 % identity to amino acid sequence of human BILF- 1 (SEQ ID NO: 9).
6. A method according to any of claims 1-3, wherein the constitutively active G protein coupled receptor is encoded by a nucleotide sequence having at least 80% identity to the nucleotide sequence of human BILFl (SEQ ID NO: 1).
7. A method according to any of claims 1-3, wherein the functional part of said receptor has at least 80 % identity to the amino acid sequence defined by amino acid No. 1 to amino acid No. 24 of human BILF-I (SEQ ID NO: 9).
8. A method according to any of claims 1-3, wherein the functional part of said receptor has at least 80 % identity to the amino acid sequence defined by amino acid No. 1 to amino acid No. 30 of human BILF-I (SEQ ID NO: 9).
9. A method according to any of claims 1-3, wherein the functional part of said receptor has at least 80 % identity to the amino acid sequence defined by amino acid No. 5 to amino acid No. 30 of human BILF-I (SEQ ID NO: 9).
10. A method according to any of claims 1-3, wherein the functional part of said receptor has at least 80 % identity to the amino acid sequence defined by amino acid No. 1 to amino acid No. 60 of human BILF-I (SEQ ID NO: 9).
5 11. A method according to any of claims 1-3, wherein the functional part of said receptor has at least 80 % identity to the amino acid sequence defined by amino acid No. 1 to amino acid No. 91 of human BILF-I (SEQ ID NO: 9).
12. A method according to any of claims 1-3, wherein the functional part of said receptor 10 has at least 80 % identity to the amino acid sequence defined by amino acid No. 1 to amino acid No. 220 of human BILF-I (SEQ ID NO: 9).
13. A method according to any of claims 1-3, wherein the functional part of said receptor has at least 80 % identity to the amino acid sequence defined by amino acid No. 91 to
15 amino acid No. 220 of human BILF-I (SEQ ID NO: 9).
14. A method according to any of claims 1-3, wherein the functional part of said receptor has at least 80 % identity to the amino acid sequence defined by amino acid No. 91 to amino acid No. 312 of human BILF-I (SEQ ID NO: 9).
20
15. A method according to any of claims 1-3, wherein the functional part of said receptor has at least 80 % identity to the amino acid sequence defined by amino acid No. 221 to amino acid No. 312 of human BILF-I (SEQ ID NO: 9).
25 16. A method according to any of claims 1-3, wherein the functional part of said receptor has at least 80 % identity to the amino acid sequence defined by amino acid No. 261 to amino acid No. 312 of human BILF-I (SEQ ID NO: 9).
17. A method according to any of claims 1-3, wherein the functional part of said receptor 30 has at least 80 % identity to the amino acid sequence defined by amino acid No. 291 to amino acid No. 312 of human BILF-I (SEQ ID NO: 9).
18. A method according to any of the preceding claims, wherein the compound modifies the signal of the constitutively active G protein coupled receptor or a functional part
35 thereof by inhibiting said signal.
19. A method according to claim 18, wherein the compound inhibits the signal of the constitutively active G protein coupled receptor or a functional part thereof by at least 5 %.
20 A method according to claim 19, wherein the compound inhibits the signal of the constitutively active G protein coupled receptor or a functional part thereof by at least 20 % 5
21. A method according to claim 20, wherein the compound inhibits the signal of the constitutively active G protein coupled receptor or a functional part thereof by at least 50 %.
10 22. A method according to any of the preceding claims wherein the compound is modifying the signal of the constitutively active G protein coupled receptor or a functional part thereof by interfering with receptor glycosylation.
23. A method according to any of the preceding claims, wherein the compound is
15 modifying the signal of the constitutively active G protein coupled receptor or a functional part thereof by binding to the receptor or to a functional part thereof.
24. A method according to any of the preceding claims, wherein the compound binds to the constitutively active G protein coupled receptor or a functional part thereof with an
20 affinity wherein the value of k, or kd is at most 1000 nM, said affinity being obtained in a receptor binding assay.
25. A method according to claim 24, wherein the value of k, or kd is at most 100 nM.
25 26. A method according to claim 25, wherein the value of k, or kd is at most 50 nM.
27. A method according to claim 26, wherein the value of k, or kd is at most 10 nM.
28. A method according to any of claims 1-23, wherein the compound in a receptor binding 30 assay exhibits an IC50 value of less than 1000 nM.
29. A method according to claim 28, wherein the compound in a receptor binding assay exhibits an IC50 value of less than 100 nM.
35 30. A method according to claim 29, wherein the compound in a receptor binding assay exhibits an IC50 value of less than 50 nM.
31. A method according to claim 30, wherein the compound in a receptor binding assay exhibits an IC50 value of less than 10 nM.
32. A method according to any of claims 24-31, wherein said receptor binding assay is selected from the group consisting of competition binding assay, saturation binding assay, fluorescence polarization assay, Biacore assay and surface plasmon resonance based
5 assay.
33. A method according to any of the preceding claims, wherein said method is adapted to a high-through-put screening system.
10 34. A method for identifying a γl-herpesvirus in a mammal, said method comprising determining the presence of a constitutively active G protein coupled receptor of a γl- herpesvirus in a sample obtained from said mammal.
35. A method for identifying a γl-herpesvirus in a mammal, said method comprising 15 a) determining the level of a constitutively active G protein coupled receptor of a γl-herpesvirus in a sample obtained from said mammal,
b) evaluating the level of said constitutively active G protein coupled receptor 20 measured in step (a) relative to a reference value for said receptor of said mammal.
36. A method according to any of claims 34 or 35, wherein said γl-herpesvirus is an Epstein-Barr virus.
25
37. A method according to claim 36, wherein the γl-herpesvirus is a human Epstein-Barr virus.
38. A method according to any of claims 34-37, wherein said constitutively active G
30 protein coupled receptor has at least 80% identity to amino acid sequence of human BILF- 1 (SEQ ID NO: 9).
39. A method according to claims 34-38, wherein said constitutively active G protein coupled receptor has at least 95 % identity to amino acid sequence of human BILF-I (SEQ 5 ID NO: 9).
40. A method according to any of claims 34-37, wherein said constitutively active G protein coupled receptor is encoded by a nucleotide sequence having at least 80% identity to the nucleotide sequence of human BILFl (SEQ ID NO: 1).
41. A method according to any of claims 35-40, wherein the level of said constitutively active G protein coupled receptor measured in step (a) is increased at least 5 % compared to the reference value for the receptor of said mammal.
5
42. A method according to any of the preceding claims, wherein the constitutive activity is mediated though Gαi.
43. A method for modifying the signal of a constitutively active G protein coupled receptor 10 in a γl-herpesvirus infected mammal, comprising administrating, to the mammal, a compound capable of specifically binding to said constitutively active G protein coupled receptor, the compound being administered in an amount effective to modify the signal.
44. A method according to claim 43, wherein the compound is as defined in any of claims 15 18-32.
45. A method of treating or preventing a γl-herpesvirus related disease comprising modifying a constitutively active G protein coupled receptor of the γl-herpesvirus.
20 46. A method according to claim 45, wherein the γl-herpesvirus related disease is selected from the group consisting of Infectious Mononucleosis, X-linked Lymphoproliferative Syndrome, Fatal Infectious Mononucleosis, Virus-Associated Hemophagocytic Syndrome, Chronic Active Epstein-Barr Virus Infection, Clinically Apparent Virus Replicative Lesions, Lymphomas in Congenitally Immunodeficient Patients, Posttransplantation Lymphomas /
25 post-transplant lymphoproliferative disease (PTLD), Acquired Immunodeficiency Syndrome Lymphomas, Smooth Muscle Cell Tumors, Burkitt's lymphoma, Hodgkin's disease, B-cell lymphomas, T and NK cell lymphomas, Nasopharyngeal carcinoma, Undifferentiated carcinomas of nasopharyngeal type (UCNT), Gastric carcinomas, Follicular dendritic cell tumors and inflammatory "pseudotumors".
30
47. A method according to claim 46, wherein the γl-herpesvirus related disease is Infectious Mononucleosis.
48. A method according to any of claims 46 or 47, wherein the γl-herpesvirus related 35 disease is Fatal Infectious Mononucleosis.
49. A method according to claim 46, wherein the γl-herpesvirus related disease is X-linked Lymphoproliferative Syndrome.
50. A method according claim 46, wherein the γl-herpesvirus related disease is Chronic Active Epstein-Barr Virus Infection.
51. A method according to claim 46, wherein the γl-herpesvirus related disease is 5 Lymphomas in Congenitally Immunodeficient Patients.
52. A method according to claim 46, wherein the γl-herpesvirus related disease is Posttransplantation Lymphomas / post-transplant lymphoproliferative disease (PTLD).
10 53. A method according to claim 46, wherein the γl-herpesvirus related disease is Burkitt's lymphoma.
54. A method according to claim 46, wherein the γl-herpesvirus related disease is Hodgkin's disease.
15
55. A method according to claim 46, wherein the γl-herpesvirus related disease is T and NK cell lymphomas.
56. A method according to claim 46, wherein the γl-herpesvirus related disease is 20 Nasopharyngeal carcinoma.
57. A method according to claim 46, wherein the γl-herpesvirus related disease is Gastric carcinomas.
25 58. A method according to any of claims 43-57, wherein the γl-herpesvirus is an Epstein- Barr virus.
59. A method according to any of claims 43-58, wherein the γl-herpesvirus is a human Epstein-Barr virus.
30
60. A method according to any of claims 43-59, wherein the constitutively active G protein coupled receptor has at least 80% identity to the amino acid sequence of human BILF-I (SEQ ID NO: 9).
35 61. A method according to any of claims 43-60, wherein the constitutively active G protein coupled receptor has at least 95 % identity to amino acid sequence of human BILF-I (SEQ ID NO: 9).
62. A method according to any of claims 43-59, wherein the constitutively active G protein coupled receptor is encoded by a nucleotide sequence having at least 80% identity to the nucleotide sequence of human BILFl (SEQ ID NO: 1).
5 63. A nucleic acid construct comprising a nucleotide sequence encoding an amino acid sequence as defined in any of claims 4, 5 or 7-17 operably linked to one or more control sequences that direct the production of the constitutively active G protein coupled receptor or a functional part thereof in a suitable host.
10 64. A recombinant expression vector comprising the nucleic acid construct as defined in claim 63.
65. A recombinant host cell comprising the nucleic acid construct as defined in claim 63 or the recombinant expression vector as defined in claim 64.
15
66. A recombinant host cell according to claim 65, wherein said host cell is an eukaryotic host cell.
PCT/DK2005/000509 2004-07-23 2005-07-22 Bilf1, a constitutive active g-protein coupled receptor WO2006007857A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DKPA200401144 2004-07-23
DKPA200401144 2004-07-23

Publications (1)

Publication Number Publication Date
WO2006007857A1 true WO2006007857A1 (en) 2006-01-26

Family

ID=34956523

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/DK2005/000509 WO2006007857A1 (en) 2004-07-23 2005-07-22 Bilf1, a constitutive active g-protein coupled receptor

Country Status (1)

Country Link
WO (1) WO2006007857A1 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB2468006B (en) * 2007-12-20 2013-05-15 Heptares Therapeutics Ltd Screening
WO2013113370A1 (en) * 2012-01-31 2013-08-08 Canvax Biotech S.L Gpcr with improved cell surface expression

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998031828A1 (en) * 1997-01-22 1998-07-23 Cornell Research Foundation, Inc. Constitutively active g protein coupled receptor of hhv 8 and method

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998031828A1 (en) * 1997-01-22 1998-07-23 Cornell Research Foundation, Inc. Constitutively active g protein coupled receptor of hhv 8 and method

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
BAER ET AL: "DNA sequence and expression of the B95-8 Epstein-Barr virus genome", NATURE, NATURE PUBLISHING GROUP, LONDON, GB, vol. 310, 19 July 1984 (1984-07-19), pages 207 - 211, XP002118569, ISSN: 0028-0836 *
BAISSER P S ET AL: "The Epstein-Barr virus BILF1 gene encodes a G protein-coupled receptor that inhibits phosphorylation of RNA-dependent protein kinase", JOURNAL OF VIROLOGY 2005 UNITED STATES, vol. 79, no. 1, 2005, pages 441 - 449, XP008045396, ISSN: 0022-538X *
BANKIER ET AL: "Sequence analysis of the 17,166 base-pair Eco-RI fragment C of B95-8 Epstein-Barr virus", MOLECULAR BIOLOGY AND MEDICINE, LONDON, GB, vol. 1, no. 1, July 1983 (1983-07-01), pages 21 - 45, XP002105956 *
DATABASE EM-VI 6 December 1983 (1983-12-06), "Epstein-Barr virus (EBV) genome, strain B95-8.", Database accession no. V01555 *
DATABASE UniProt 5 July 2004 (2004-07-05), "Membrane Protein", XP002352651, Database accession no. Q777B2 *
GOLTZ M ET AL: "Sequence Analysis of the Genome of Porcine Lymphotropic Herpesvirus 1 and Gene Expression during Posttransplant Lymphoproliferative Disease of Pigs", VIROLOGY, ACADEMIC PRESS,ORLANDO, US, vol. 294, no. 2, 15 March 2002 (2002-03-15), pages 383 - 393, XP004467136, ISSN: 0042-6822 *
PAULSEN SARAH J ET AL: "Epstein-Barr virus-encoded BILF1 is a constitutively active G protein-coupled receptor.", JOURNAL OF VIROLOGY. JAN 2005, vol. 79, no. 1, January 2005 (2005-01-01), pages 536 - 546, XP008045397, ISSN: 0022-538X *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB2468006B (en) * 2007-12-20 2013-05-15 Heptares Therapeutics Ltd Screening
WO2013113370A1 (en) * 2012-01-31 2013-08-08 Canvax Biotech S.L Gpcr with improved cell surface expression
CN104093736A (en) * 2012-01-31 2014-10-08 坎瓦克斯生物技术公司 GPCR with improved cell surface expression
CN104093736B (en) * 2012-01-31 2016-10-19 坎瓦克斯生物技术公司 There is the GPCR of the cell surface expression of improvement
US9499584B2 (en) 2012-01-31 2016-11-22 Canvax Biotech S.L GPCR with improved cell surface expression

Similar Documents

Publication Publication Date Title
Paulsen et al. Epstein-Barr virus-encoded BILF1 is a constitutively active G protein-coupled receptor
Margulies et al. Identification of the human cytomegalovirus G protein-coupled receptor homologue encoded by UL33 in infected cells and enveloped virus particles
Chung et al. A27L protein mediates vaccinia virus interaction with cell surface heparan sulfate
Beisser et al. Deletion of the R78 G protein-coupled receptor gene from rat cytomegalovirus results in an attenuated, syncytium-inducing mutant strain
Krzyzaniak et al. HCMV‐encoded glycoprotein M (UL100) interacts with Rab11 effector protein FIP4
Avitabile et al. Cross talk among the glycoproteins involved in herpes simplex virus entry and fusion: the interaction between gB and gH/gL does not necessarily require gD
Tschische et al. Heteromerization of human cytomegalovirus encoded chemokine receptors
Wakeling et al. Characterization of the murine gammaherpesvirus 68 ORF74 product: a novel oncogenic G protein-coupled receptor
Venkatachari et al. Human immunodeficiency virus type 1 Vpr: oligomerization is an essential feature for its incorporation into virus particles
Chen et al. Ephrin receptor A4 is a new Kaposi’s sarcoma-associated herpesvirus virus entry receptor
Nador et al. Expression of Kaposi's sarcoma-associated herpesvirus G protein-coupled receptor monocistronic and bicistronic transcripts in primary effusion lymphomas
FI113298B (en) Diagnostic reagent, method and kit for detection of EBV antibodies
Schultz et al. Scanning mutagenesis of human cytomegalovirus glycoprotein gH/gL
Margulies et al. The chemokine receptor homologue encoded by US27 of human cytomegalovirus is heavily glycosylated and is present in infected human foreskin fibroblasts and enveloped virus particles
Plate et al. Mapping regions of Epstein–Barr virus (EBV) glycoprotein B (gB) important for fusion function with gH/gL
Martínez-Martín et al. Herpes simplex virus particles interact with chemokines and enhance cell migration
Stapleton et al. Receptor chimeras demonstrate that the C-terminal domain of the human cytomegalovirus US27 gene product is necessary and sufficient for intracellular receptor localization
WO2006007857A1 (en) Bilf1, a constitutive active g-protein coupled receptor
Ball-Goodrich et al. Validation of an enzyme-linked immunosorbent assay for detection of mouse parvovirus infection in laboratory mice
Tomkowicz et al. Human herpesvirus-8 encoded Kaposin: subcellular localization using immunofluorescence and biochemical approaches
Chen et al. Proteomic analysis of host cellular proteins co-immunoprecipitated with duck enteritis virus gC
Seo et al. Phosphorylation of tegument protein pp28 contributes to trafficking to the assembly compartment in human cytomegalovirus infection
DK1981904T3 (en) Peptide domain from the enclosure of a HERV-W virus, which is required for reaction with a hASCT receptor
Lv et al. Overexpression of inactive tetherin delGPI mutant inhibits HIV-1 Vpu-mediated antagonism of endogenous tetherin
Isegawa et al. Characterization of the human herpesvirus 6 U69 gene product and identification of its nuclear localization signal

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KM KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NG NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SM SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU LV MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase