WO2005118637A1 - Treatment of inflammatory conditions - Google Patents

Abstract

The present invention relates to non-GAG binding chemokine receptor agonists, which may be used to treat inflammatory conditions. The non-GAG binding chemokine receptor agonist may be a mutant CCL7 or a functional derivative thereof characterised in that at least one lysine residue at positions 44, 46 or 49 from the sequence of human mature CCL7 is substituted for a different amino acid.

Description

TREATMENT OF INFLAMMATORY CONDITIONS

The present invention relates to the treatment of inflammatory conditions with mutant chemokines and derivatives thereof.

The cell mediated immune response is critically dependent on patterns of leukocyte migration and activation within target tissues. The vascular endothelium plays a central role in the recruitment of blood borne cells to the subendothelial tissues during inflammation by facilitating a cascade process involving intravascular arrest of certain cell types and directed extravasation of responsive cells. It is becoming increasingly clear that this process is principally regulated by cytokine molecules termed chemokines.

Chemokines are members of a superfamily of small proteins that play key roles in many aspects of the immune and inflammatory responses, primarily by attracting and activating leukocytes. A growing body of evidence suggests that these proteins also control a range of other functions that extend well beyond the regulation of leukocyte migration.

At present, about 50 chemokines have been identified in humans. These molecules share a secondary structure with a flexible N-terminal segment followed by three antiparallel β-sheets and a C-terminal α-helix, and according to the relative position of cysteine residues, have been classified into four families (CXC, CC, C and CX₃C).

CC chemokines are the most numerous and diverse family, including at least 25 ligands which bind to 11 signaling receptors in humans. The four Monocyte Chemoattractant Proteins (termed CCL2, CCL8, CCL7 and CCL13) constitute a discrete group within the CC chemokine family. There is 65 - 70% amino acid sequence homology between the four MCP chemokines, compared with only around 40% homology between the non-MCP CC chemokines. Despite this homology, the MCP chemokines differ in specific receptor usage and, hence, in their biological activities.

Many different cell types including parenchymal cells, leukocytes and tumour cells can produce CCL7, with pro-inflammatory cytokines including IL-lβ and TNF-α increasing expression. CCL7 binds to at least four different chemokine receptors (CCR1, CCR2, CCR3 and CCR5). CCL7 appears to be an antagonist for CCR5 since no significant signaling through CCR5 was observed in CCR5 transfectants following stimulation by CCL7. The tertiary structure of human CCL7 has been resolved by H-NMR spectroscopy. In contrast to most chemokines, CCL7 exists as a monomer at concentrations up to 2mg/ml; however, dimers have been observed at higher concentrations.

CCL7 has been implicated in several immunological diseases, including non-atopic and atopic asthma, primary biliary cirrhosis, ulcerative colitis and multiple sclerosis. It has also been shown that the expression of CCL7 can activate an anti-tumour immune response. The distribution of chemokine receptors on different CCL7-responsive cells, including monocytes (CCR1, 2 and 5), eosinophils (CCR3), Thl lymphocytes (CCR2, CCR5), Th2 lymphocytes (CCR2 and 3), basophils (CCR3) and immature dendritic cells (CCR1, 2 and 5), highlights the potential role of CCL7 in regulating cell traffic and immune function.

In addition to their interaction with specific receptors, chemokines also interact with glycosaminoglycans (GAG). GAGs are linear polysaccharides present on all animal cell surfaces and in the extracellular matrix, where they are usually attached covalently to core proteins to form the proteoglycan family. The predominant GAG associated with endothelial cells is heparan sulphate (HS). Several lines of evidence point to the importance of HS in promoting chemokine activity. Firstly, almost all chemokines studied to date appear to bind HS in vitro, suggesting that this is a fundamental property of these proteins. Secondly, the finding that T lymphocytes secrete CC chemokine as a complex with proteoglycans in vivo, indicates that this form is physiologically relevant. Finally, it is known that the association between chemokines and HS allows stable cis or trans presentation, which can provide robust vectorial cues for migrating leukocytes.

The BBXB and BXBXXB motifs, where B represents a basic amino acid residue, have been shown to be common heparin-binding sites for several proteins. The binding sites for CXCL12 (SDF-1), CCL3 (MlP-lα), CCL4 (MlP-lβ) and CCL5 (RANTES) conform to the BBXB motif. On the other hand, the principal heparin-binding residues in CXCL8 (IL-8) and CCL2 (MCP-1) are spatially separate. It has been reported that cell-surface GAG expression is not essential for chemokine activation of the same cell in vitro, but GAGs can play a role in chemokine sequestration. Disruption of the GAG binding site has no effect on either specific receptor binding or cell activation by CXCL8, CXCL12 or CCL4, but does have a profound effect on the binding of both CCL3 and CCL5 to CCR1. Significantly, a series of recent studies have demonstrated that chemokine interaction with GAGs may play an important role during transendothelial leukocyte migration in vitro, and during the development of inflammation.

From the above it will be appreciated that Chemokines represent a good pharmacological target for modulating inflammatory conditions. A number of patent applications have recently been filed that purport to disclose clinically useful mutants of chemokines. For instance, WO 03/051921 discloses mutants of CC-chemokines containing a non-conservative substitution in a conserved consensus sequence. These mutants (e.g. CCL-5 G32N) are reported to act as chemokine antagonists and are therefore useful for treating inflammatory conditions, autoimunne disease, cancer or bacterial and viral infections. WO 03/084993 also discloses CC-chemokine mutants. In this case mutants of Monocyte chemoattractant protein 1 (MCP-1 which is an alternative name for CCL2) are disclosed with substitutions at least at positions 18 and 19 (e.g. MCP-1 R18A K19A -¹⁸AA¹⁹). These mutants are also reported to act as chemokine antagonists and are therefore suggested to be useful for treating the same sort of conditions as CCL-5 G32N. Mutants (e.g. ⁴⁴AANA⁴⁷ RANTES) have also been developed based on CCL5 (RANTES).

However, these prior art mutants have a number of drawbacks that make them less than ideal for clinical use. For instance, the affinity for heparin of the RANTES mutant ⁴⁴AANA⁴⁷ and of the MCP-1 mutant ¹⁸AA¹⁹ is reduced but not eliminated at physiological salt concentrations, with both mutants retaining 25-30% of the binding capacity of their respective wild-type protein sequences. The ⁴⁴AANA⁴⁷ RANTES mutant has a normal affinity for CCR5 but shows a 200-fold decrease in its affinity for CCR1. The ¹⁸AA¹⁹ MCP-1 mutant shows a 20- fold reduction in affinity for its specific receptor CCR2. Furthermore a ⁵AASA⁴⁸ mutant of MIP-1/3 (MIP-1/3 is an alternative name for CCL4) has no affinity for heparin but this sequence variation also disrupts specific receptor binding. All three mutant proteins have a reduced potential to recruit cells in vivo but the mechanism for this is not clear as perturbations of affinity for both GAG and specific receptors could play contributory roles.

It will therefore be appreciated that there remains a need to develop new and improved agents for treating conditions involving an immune or inflammatory component. It is an object of the present invention to provide mutants and derivatives of CC-Chemokines that may be used as medicaments.

According to a first aspect of the present invention, there is provided a mutant CCL7 or a functional derivative thereof characterised in that at least one lysine residue at position 44, 46 or 49 from the sequence of human mature CCL7 is substituted for a different amino acid.

According to a second aspect of the present invention, there is provided a mutant CCL7 or derivatives thereof according to the first aspect of the invention and a pharmaceutically acceptable carrier for use as a medicament.

According to a third aspect of the invention there is provided the use of a mutant CCL7 or derivatives thereof according to the first aspect of the invention in the manufacture of a medicament for the treatment of inflammatory conditions.

According to a fourth aspect of the present invention, there is provided a method for the treatment of inflammatory conditions comprising administering to a subject in need of such treatment a therapeutically effective amount of a mutant CCL7 or derivatives thereof according to the first aspect of the invention.

By "inflammatory condition" we mean a medical condition at least partially characterised by the secretion of inflammatory mediators (e.g. CC-chemokines) into an affected tissue. Examples where such inflammatory conditions occur include, but are not limited to, atheroma development, allergic reactions, autoimmune diseases, cancer, infections and injury. Specific disease states include Rheumatoid Arthritis, vasculitis, non-atopic and atopic asthma, cirrhosis, ulcerative colitis, multiple sclerosis, Crohn's Disease, stroke and head injury, organ transplant rejection, atheroma development, and burns.

By "CCL7" we mean the CC chemokine also known as Monocyte Chemoattractant Protein 3 (MCP-3).

Human Wild type MCP-3 (Accession CAA51055^') has the amino acid sequence: QPNGl^TSTTCCYRFINE-KffKQRLESYPΛTTSSHCPREANlEKTKLDKEICADPTQKWV QDFMKHLDKKTQTPKL (SEQ. ID No. 1) MCP-3 cDNA sequence: X72308 (Accession number) sig peptide 299..397 /gene="MCP-3" mat peptide 398..625 /gene="MCP-3" /product- 'monocyte chemotactic protein-3" polvA signal 806..810 /gene="MCP-3" ORIGIN 1 ggtttctatt gacttgggtt aatcgtgtga ccgcggtggc tggcacgaaa ttgaccaacc 61 ctggggttag tatagcttag ttaaactttc gtttattgct aaaggttaat cactgctgtt 121 tcccgtgggg gtgtggctag gctaagcgtt ttgagctgca ttgctgcgtg cttgatgctt 181 gtcccttttg atcgtggtga tttagagggt gaactcactg gaatggggat gcttgcatgt 241 gtaatcttac taagagctaa tagaaaggct aggaccaaac cagaaacctc caattctcat 301 gtggaagccc atgccctcac cctccaacat gaaagcctct gcagcacttc tgtgtctgct 361 gctcacagca gctgctttca gcccccaggg gcttgctcag ccagttggga ttaatacttc 421 aactacctgc tgctacagat ttatcaataa gaaaatccct aagcagaggc tggagagcta 481 cagaaggacc accagtagcc actgtccccg ggaagctgta atcttcaaga ccaaactgga 541 caaggagatc tgtgctgacc ccacacagaa gtgggtccag gactttatga agcacctgga 601 caagaaaacc caaactccaa agctttgaac attcatgact gaactgaaaa caagccatga 661 cttgagaaac aaataatttg tataccctgt cctttctcag agtggttctg agattatttt 721 aatctaattc taaggaatat gagctttatg taataatgtg aatcatggtt tttcttagta 781 gattttaaaa gttattaata ttttaattta atcttccatg gattttggtg ggttttgaac 841 ataaagcctt ggatgtatat gtcatctcag tgctgtaaaa actgtgggat gctcctccct 901 tctctacctc atgggggtat tgtataagtc cttgcaagaa tcagtgcaaa gatttgcttt 961 aattgttaag atatgatgtc cctatggaag catattgtta ttatataatt acatatttgc 1021 atatgtatga ctcccaaatt ttcacataaa atagattttt gtataacaaa aaaaaaaaaa 1081 aaaaa (SEQ. ID No.2)

Mature cDNA sequence for MCP-3: 398 cag ccagttggga ttaatacttc 421 aactacctgc tgctacagat ttatcaataa gaaaatccct aagcagaggc tggagagcta 481 cagaaggacc accagtagcc actgtccccg ggaagctgta atcttcaaga ccaaactgga 541 caaggagatc tgtgctgacc ccacacagaa gtgggtccag gactttatga agcacctgga 601 caagaaaacc caaactccaa agctt (SEQ. LD No.3) The inventors have found that CCL7 mutants according to the first aspect of the invention are of great benefit in the treatment of inflammatory conditions. They have established that such mutants and derivatives thereof have surprising efficacy for preventing or reducing an inflammatory reaction. The mutants have improved efficacy and a broader spectrum of activity than chemokine antagonists already known to the art.

Although the inventors do not wish to be bound by any hypothesis, they believe that the advantageous properties of CCL7 mutants according to the invention may be explained by a specific combination of receptor interactions. CCL7 can potentially bind to at least 4 different receptor subtypes. The inventors have found that mutants according to the invention compete with natural chemokines for interaction with their specific receptors but do not bind glycosaminoglycans (GAG). This reduces leukocyte migration, thereby reducing inflammation. Positions 44, 46 and 49 are within a putative GAG binding motif identified by the inventors and their experiments (see the Example) were designed to investigate the effect their mutants would have on the GAG binding. However, as well as modulating GAG binding, they also surprisingly found that the mutants or derivatives thereof according to the first aspect of the invention inhibit the inflammatory activity of all leukocytes (as opposed to specific types for prior art anti-inflammatory mutant chemokines). Furthermore the inventors have found that the mutants or derivatives thereof unexpectedly reduce the inflammatory effects of chemokines that act through receptors independent of known CCL7 receptors (as well as abrogating the effects of wild-type CCL7 and other chemokines that act through the same cytokine receptors). The inventors believe that this beneficial effect may be explained by the fact that mutants according to the invention may be acting as an agonist at receptors that stimulate common down-stream signaling pathways which act to desensitize leukocytes to a wider spectrum of chemokines. The inventors believe this "double activity" may explain the surprising utility of mutants according to the invention whereby the mutant is antagonistic to GAG binding but also acts as a broad spectrum agonist of a desensitization pathway.

It will be appreciated that the amino acid substitution at positions 44, 46 or 49 may be any amino acid that disrupts the activity of wild type CCL7 in this region. Preferred amino acids used to make the substitution at positions 44, 46 or 49 may be selected from alanine, glycine, serine, threonine, proline, aspartic acid, asparagines, glutamic acid or glutamine. It is most preferred that the lysine residue at positions 44, 46 or 49 is substituted with an alanine residue. Accordingly most preferred single mutants according to the invention are CCL7 K44A; CCL7 K46A; and CCL7 K49A.

It is preferred that at least two of the lysine residues at position 44, 46 or 49 are substituted with alanine, glycine, serine, threonine, proline, aspartic acid, asparagines, glutamic acid or glutamine. Accordingly preferred double mutants according to the invention include CCL7 K44A K46A; CCL7 K44A K49A; and CCL7 K46A K49A.

It is more preferred that the mutant according to the invention is a triple mutant of the form CCL7 K44X K46X K49X (wherein X = any amino acid other than lysine and is preferably alanine, glycine, serine, threonine, proline, aspartic acid, asparagines, glutamic acid or glutamine).

A most preferred mutant according to the first aspect of the invention is CCL7 K44A

K46A K49A and has the following amino acid sequence

QPNGINTSTTCCYP^INKjfOPKQRLESYRRTTSSHCPREANIFATALDAEICADPTQKWN QDFMKHLDKKTQTPKL (SEQ. LO No. 4)

It will be appreciated that functionally active fragments of CCL7 mutants are encompassed by the present invention. Accordingly functionally active mutants with truncations at the N or C terminal are preferred derivatives according to the invention. It will be appreciated that a number of functional derivatives may be formed - provided that the motif comprising mutations of positions 44 and/or 46 and/or 49 are retained in the fragment. For instance the inventors believe the activity of the mutant or derivative thereof will be maintained if upto 10 N- terminal amino acids are removed. Alternatively the fragment may be based on a protein comprising the mutant_44 and or 46 and/or 49 motif and also the N-loop of MCP-3 (residues 1- 22). The N-loop is believed to be involved in receptor binding and activation of CCR3 as well as CCR1/2 receptors.

The foregoing mainly contemplates mutants according to the invention based on human wild type CCL7. Such mutants will be most useful in human therapy. However it will also be appreciated that the invention is equally applicable for the treatment of animals of veterinary interest. For instance, horses, cattle, sheep, pigs, cats or dogs suffering from inflammatory conditions (e.g. tendonitis in race horses) may be treated according to a further aspect of the invention. Mutants based on human CCL7 may be used in such animals although it is preferred that mutants based on species-specific CCL7 homologues are used. It will be appreciated that a skilled person may easily prepare an alignment plot of CCL7 sequences from different species and thereby generate species-specific mutants for use according to the invention. Figure 6 illustrates an alignment plot for CCL7 homologues from Macaque, Human, Guinea Pig, Rat and Mouse. Similar alignment plots may be used to prepare CCL7 mutants from other species of veterinary interest by using the plots to identify amino acids in those other species that are equivalent to human CCL7 at positions 44, 46 and 49.

Preferred derivatives of the mutant CCL7 include proteins that may comprise other mutations (relative to the wild type) that nevertheless do not alter the activity of the mutant. In accordance with the present invention, preferred further changes in the mutants are commonly known as "conservative" or "safe" substitutions, (these may involve non-basic residues). Conservative amino acid substitutions are those with amino acids having sufficiently similar chemical properties, in order to preserve the structure and the biological function of the molecule. It is clear that insertions and deletions of amino acids may also be made in the above defined sequences without altering their function, particularly if the insertions or deletions only involve a few amino acids, e.g. under ten and preferably under five, and do not remove or displace amino acids which are critical to the functional conformation of a protein or a peptide. The literature provide many models on which the selection of conservative amino acids substitutions can be performed on the basis of statistical and physico-chemical studies on the sequence and/or the structure of a natural protein.

Derivatives of mutants according to the first aspect of the invention may include derivatives that increase or decrease the polypeptide's half-life in vivo. Examples of derivatives capable of increasing the half-life of polypeptides according to the invention include peptoid derivatives, D-amino acid derivatives and peptide-peptoid hybrids.

The CCL7 mutants may be subject to degradation by a number of means (such as protease activity at an inflammatory site). Such degradation may limit the bioavailabihty of the mutant and hence their therapeutic utility. There are a number of well-established techniques by which peptide derivatives that have enhanced stability in biological contexts can be designed and produced. Such peptide derivatives may have improved bioavailabihty as a result of increased resistance to protease-mediated degradation. Preferably, a derivative suitable for use according to the invention is more protease-resistant than the CCL7 point mutant from which it is derived. Protease-resistance of a peptide derivative and the mutant from which it is derived may be evaluated by means of well-known protein degradation assays. The relative values of protease resistance for the peptide derivative and peptide may then be compared.

Peptoid derivatives of CCL7 mutants or derivatives thereof may be readily designed from knowledge of the structure of the mutant according to the first aspect of the invention. Commercially available software may be used to develop peptoid derivatives according to well- established protocols.

Retropeptoids, (in which all amino acids are replaced by peptoid residues in reversed order) are also able to mimic CCL7 mutants according to the invention. A retropeptoid is expected to bind in the opposite direction in the hgand-binding groove, as compared to a peptide or peptoid-peptide hybrid containing one peptoid residue. As a result, the side chains of the peptoid residues are able to point in the same direction as the side chains in the original peptide.

A further embodiment of a modified form of CCL7 mutant according to the invention comprises D-amino acid forms. In this case, the order of the amino acid residues is reversed. The preparation of peptides using D-amino acids rather than L-amino acids greatly decreases any unwanted breakdown of such derivative by normal metabolic processes, decreasing the amounts of the derivative which needs to be administered, along with the frequency of its administration.

Preferably, the N-terminal residue of the CCL7 mutant is not modified. For example, the CCL7 mutant according to the invention does not comprise an N-terminal methionine residue. Preferably, the CCL7 mutant according to the invention is substantially non-GAG binding, preferably in vivo. Preferably, the CCL7 mutant is a chemokine receptor agonist. It will be appreciated that the therapeutic effects of CCL7 mutants and derivatives thereof according to the first aspect of the invention may be mediated "indirectly" by agents that increase their activity. The present invention also provides a medical use for such agents. Thus, according to a fifth aspect of the invention, there is provided an agent capable of increasing the biological activity of CCL7 mutants and derivatives thereof for use as a medicament.

Agents capable of increasing the biological activity of CCL7 mutants and derivatives thereof may achieve their effect by a number of means. For instance, such agents may increase the expression of the mutant or peptide derivatives (if expressed within a cell - see below). Alternatively (or in addition), such agents may increase the half-life of the mutant or a polypeptide fragment or derivative thereof.

The inventors have found that the abovementioned mutants and derivatives thereof are useful for treating a surprisingly large number of inflammatory conditions as outlined previously.

The mutants and derivatives thereof may be used to treat inflammatory conditions as a monotherapy (i.e. use of the mutant alone or in combination with other compounds or treatments used in the treatment of inflammation (e.g. NSAIDS)).

The medicaments according to the second or third aspects of the invention may take a number of different forms depending, in particular on the manner in which the medicament is to be used. Thus, for example, the medicament may be in the form of a powder, tablet, capsule, liquid, ointment, cream, gel, hydrogel, aerosol, spray, micelle, liposome or any other suitable form that may be administered to a person or animal. It will be appreciated that the vehicle of the medicament of the invention should be one which is well tolerated by the subject to whom it is given and enables delivery of the agents to the effected site.

Therapy may be effected in a number of ways. For instance, systemic administration may be required in which case the mutant or derivative thereof may be contained within a medicament, which may, for example, be ingested orally in the form of a tablet, capsule or liquid. Alternatively, the medicament may be administered by injection into the blood stream. Injections may be intravenous (bolus or infusion) or subcutaneous (bolus or infusion). The CCL7 mutant may also be administered by inhalation (e.g. intranasally). Alternatively it may be administered transdermally by way of patches.

The mutant and derivatives thereof may also be incorporated within a slow or delayed release device. Such devices may, for example, be inserted under the skin and the agent may be released over weeks or even months. The devices may be particularly advantageous when frequent administration is necessary (e.g. at least daily ingestion of a tablet or daily injection).

It will be appreciated that the amount of a CCL7 mutant or derivative thereof (or an agent according to the fifth aspect of the invention) required is determined by biological activity and bioavailabihty which in turn depends on the mode of administration, the physicochemical properties of the mutant or agent employed and whether it is being used as a monotherapy or in a combined therapy. The frequency of administration will also be influenced by the abovementioned factors and particularly the half-life of the mutant or agent within the subject being treated.

Known procedures, such as those conventionally employed by the pharmaceutical industry (e.g. in vivo experimentation, clinical trials etc), may be used to establish specific formulations of medicaments and precise therapeutic regimes (such as daily doses of the agents and the frequency of administration).

Generally, a daily dose of between O.Olμg/kg of body weight and l.Og/kg of body weight of an agent according to first or second aspects of the invention may be used for the treatment of inflammatory conditions depending upon which specific mutant, mutant derivative or agent is used. More preferably the daily dose is between O.Olmg/kg of body weight and lOOmg/kg of body weight.

When administered by an intrathecal (injected in cerebrospinal fluid) route it is preferred that approximately lng/ml is provided in the CSF. Such doses are believed to be particularly effective when the condition to be treated is Multiple Sclerosis.

When administered by an intra-articular (injected in synovium) route it is preferred that between about 0.1 and 50ng/ml is provided in the synovium and more preferably between about 0.5 and 30ng/ml. Such doses are believed to be particularly effective when the condition to be treated is Rheumatoid Arthritis.

When administered by an intravenous route it is preferred that a subject receives between about 5-250 micrograms/Kg and more preferably between about 30-100 micrograms/Kg.

The agents will provide cardioprotective and endothelial protective effects when between 10 and 100 micrograms and more preferably about50 micrograms of the agent are given as bolus.

It will be appreciated that the required dose will be influenced by the route of administration. For instance when a mutant CCL7 or agent is given topically the preferred dose may be different than when given intravenously or by oral administration.

Daily doses may be given as a single administration (e.g. daily application of an ointment containing the active ingredient or as a single daily injection). Alternatively administration may be required twice or more times during a day. A patient receiving treatment may take a first dose upon waking and then a second dose in the evening (if on a two dose regime) or at 3 or 4 hourly intervals thereafter. Alternatively a slow release device may be used to provide optimal doses to a patient without the need to administer repeated doses.

The polypeptides, analogues, or derivatives of the invention represent products that may advantageously be expressed by biological cells. Thus, the present invention also provides, in a sixth aspect, a nucleic acid sequence encoding a mutant CCL7 or polypeptide derivative or fragment thereof, according to the first aspect of the invention.

Preferred mutants according to the invention have the following DNA sequences:

K44A: 398 cag ccagttggga ttaatacttc 421 aactacctgc tgctacagat ttatcaataa gaaaatccct aagcagaggc tggagagcta 481 cagaaggacc accagtagcc actgtccccg ggaagctgta atcttcgcga ccaaactgga 541 caaggagatc tgtgctgacc ccacacagaa gtgggtccag gactttatga agcacctgga 601 caagaaaacc caaactccaa agctt (SEQ. ID No. 5) K46A: 398 cag ccagttggga ttaatacttc 421 aactacctgc tgctacagat ttatcaataa gaaaatccct aagcagaggc tggagagcta 481 cagaaggacc accagtagcc actgtccccg ggaagctgta atcttcaaga ccgcactgga 541 caaggagatc tgtgctgacc ccacacagaa gtgggtccag gactttatga agcacctgga 601 caagaaaacc caaactccaa agctt (SEQ. ID No. 6)

K49 A: 398 cag ccagttggga ttaatacttc 421 aactacctgc tgctacagat ttatcaataa gaaaatccct aagcagaggc tggagagcta 481 cagaaggacc accagtagcc actgtccccg ggaagctgta atcttcaaga ccaaactgga 541 cgcggagatc tgtgctgacc ccacacagaa gtgggtccag gactttatga agcacctgga 601 caagaaaacc caaactccaa agctt (SEQ. LD No. 7)

K44A K46AK49A: 398 cag ccagttggga ttaatacttc 421 aactacctgc tgctacagat ttatcaataa gaaaatccct aagcagaggc tggagagcta 481 cagaaggacc accagtagcc actgtccccg ggaagctgta atcttcgcga ccgcactgga 541 cgcggagatc tgtgctgacc ccacacagaa gtgggtccag gactttatga agcacctgga 601 caagaaaacc caaactccaa agctt (SEQ. ID No. 8)

A potential means of using CCL7 mutants according to the invention is to deliver proteins or peptides to the inflammatory site by means of gene therapy. Therefore according to a seventh aspect of the present invention there is provided a delivery system for use in a gene therapy technique, said delivery system comprising a DNA molecule according to the sixth aspect of the invention and being capable of being transcribed to allow the expression of said protein and thereby treat an inflammatory condition.

The delivery systems according to the seventh aspect of the invention are highly suitable for achieving sustained levels of a CCL7 mutant protein over a longer period of time than is possible for most conventional therapeutic regimes. The delivery system may be used to induce continuous protein expression from cells in the region of the inflammation that have been transfected with the DNA molecule. Therefore, even if the protein has a very short half- life as an agent in vivo, therapeutically effective amounts of the protein may be continuously expressed from the treated tissue. Furthermore, the delivery system of the invention may be used to provide the DNA molecule (and thereby the protein which is an active therapeutic agent) without the need to use conventional pharmaceutical vehicles such as those required in tablets, capsules or liquids.

The DNA molecule may be contained within a suitable vector to form a recombinant vector. The vector may for example be a plasmid, cosmid or phage. Such recombinant vectors are highly useful in the delivery systems of the invention for transforming cells with the DNA molecule. The vector may, for instance be the pBKSII plasmid (Stratagene).

Recombinant vectors may also include other functional elements. For instance, recombinant vectors can be designed such that the vector will autonomously replicate in the cell, hi this case elements, which induce DNA replication may be required in the recombinant vector. Alternatively the recombinant vector may be designed such that the vector and recombinant DNA molecule integrates into the genome of a cell. In this case DNA sequences, which favour targeted integration (e.g. by homologous recombination) are desirable. Recombinant vectors may also have DNA coding for genes that may be used as selectable markers in the cloning process.

The recombinant vector may also further comprise a promoter or regulator to control expression of the gene as required.

The DNA molecule may (but not necessarily) be one, which becomes incorporated in the DNA of cells of the subject being treated. Undifferentiated cells may be stably transformed leading to the production of genetically modified daughter cells (in which case regulation of expression in the subject may be required e.g. with specific transcription factors or gene activators). Alternatively, the delivery system may be designed to favour unstable or transient transformation of differentiated cells in the subject being treated. When this is the case, regulation of expression may be less important because expression of the DNA molecule will stop when the transformed cells die or stop expressing the protein (ideally when the inflammatory condition has been treated or prevented).

The delivery system may provide the DNA molecule to the subject without it being incorporated in a vector. For instance, the DNA molecule may be incorporated within a liposome or virus particle. Alternatively the "naked" DNA molecule may be inserted into a subject's cells by a suitable means e.g. direct endocytotic uptake.

The DNA molecule may be transferred to the cells of a subject to be treated by transfection, infection, microinjection, cell fusion, protoplast fusion or ballistic bombardment. For example, transfer may be by ballistic transfection with coated gold particles, liposomes containing the DNA molecule, viral vectors (e.g. adeno virus) and means of providing direct DNA uptake (e.g. endocytosis) by application of the DNA molecule directly to the cancer or prospective site of cancer, either topically or by injection.

According to an eighth aspect of the invention there is provided an antibody directed against an epitope comprising amino acids 44, 46 and 49 of human mature CCL7.

The inventors have appreciated that such antibodies may be used to inhibit the activity of native CCL7 and will therefore be effective for treating inflammatory conditions in much the same way as the mutant CCL7 discussed previously.

It is preferred that the antibody is effective for preventing CCL7 from binding GAG whilst at the same time not compromising other functions of CCL7 (e.g. receptor binding activity as discussed above in relation to the mutant according to the invention). Accordingly it is preferred that the antibody (in combination with wild type CCL7) will have the same therapeutic effect as the mutant CCL7 according to the first aspect of the invention.

It will be appreciated that conventional antibody technology (whether for the generation of polyclonal or monoclonal antibodies) may be employed to generate antibodies according to the eighth aspect of the invention. If the antibody is generated in non-humans it will be appreciated that humanization of the antibody may be required for use in people.

It will be appreciated (e.g. as described in the Examples) that the inventors have demonstrated mutation of the chemokine CCL7 (also known as MCP-3) can produce a mutant or derivative thereof according to the first aspect, which is a full and specific chemokine receptor agonist (i.e. it stimulates receptor activation), which does not bind to glycosaminoglycans (GAG). MCP-3 receptors are present on all major leukocyte classes and the normal wild-type chemokine ligand for the MCP-3 receptor activates the receptor while also binding to GAGs (and thereby contributing to a chemotactic gradient). Importantly, because the mutant CCL7 chemokine or derivative thereof according to the invention does not bind to GAGs, it cannot drive normal immune cell chemotaxis across endothelial cell monolayers, and so effectively prevents the occurrence of inflammation. In addition, the inventors have demonstrated that the mutant CCL7 can also prevent the chemotactic activity of wild-type MCP-3. Surprisingly, this biological antagonism extends to the inhibition of inflammatory activity mediated by chemokines, which do not share specific receptors with MCP-3.

In validation experiments discussed in Example 2, the inventors have also shown that addition of the mutant MCP-3 molecule according to the first aspect of the invention, to chemokine-rich biological fluids (e.g. synovial fluid from patients with rheumatoid arthritis), effectively inhibits the potential of naturally produced chemotactic agents in such fluids to recruit leukocytes. Hence, while the inventors do not wish to be bound by any hypothesis, they have realised that these results surprisingly demonstrate a therapeutic application for any molecule that is a non-GAG binding agonist of chemokine receptors. Accordingly the present invention should not be limited mutants according to the first aspect of the invention. The inventors have established that any non-GAG binding chemokine receptor agonist may be used as a powerful, broad spectrum agent which may block the biological effect on multiple chemokines, and not just chemokines having receptors for MCP-3.

As mentioned above, surprisingly, the inventors have shown that the mutant CCL-7 chemokine according to the first aspect of the invention can be used as an effective anti- inflammatory agent. The inventors believe that this surprising efficacy of the mutant CCL-7 chemokine is due to it's "double activity", whereby it prevents GAG binding, but also acts as a broad spectrum agonist of the desensitisation pathway of the chemotactic response. As discussed in Example 2 with reference to Figure 7 and 10, the inventors suggest a mechanism for the de-sensitisation pathway, which they believe may be used to explain the therapeutic potential of any non-GAG binding chemokine receptor agonist.

The inventors believe that the non-GAG binding mutant CCL-7 chemokine according to the invention is preferably adapted to induce "homologous desensitization", "semi- homologous desensitisation", and/or "heterologous receptor desensitization". By the term "Homologous desensitization", we mean the capacity of the non-GAG binding mutant chemokine to reduce the activity of the wild-type form of the same chemokine.

By the term "Semi-homologous desensitization", we mean the capacity of the non- GAG binding mutant chemokine to reduce the activity of wild-type form of a different chemokine, which shares the same receptors.

By the term "Heterologous desensitization", we mean the capacity of the non-GAG binding mutant chemokine to reduce ^" the activity of the wild-type form of a different chemokine which does not share the same receptors.

It will be appreciated that the successful demonstration of heterologous desensitization discussed above is important for efficient anti-inflammatory therapy in a medicine. This is because it would be most advantageous for a therapeutic chemokine to be able to reduce the activity of the wild-type form of a different chemokine, which does not share the same receptors in addition to being able to reduce the activity of the wild-type form of the same chemokine.

Therefore, according to a ninth aspect of the invention, there is provided a non-GAG binding chemokine receptor agonist for use as a medicament.

Furthermore, in a tenth aspect, there is provided use of a non-GAG binding chemokine receptor agonist, for the manufacture of a medicament for the treatment of an inflammatory condition.

By the term "non-GAG binding", we mean the agonist molecule is unable to bind to a GAG (glycosaminoglycan) molecule in vivo. This is in contrast to the normal ligand for a chemokine receptor, which will be GAG binding in vivo.

The inflammatory condition may be a medical condition at least partially characterised by secretion of inflammatory mediators into an affected tissue. The inflammatory condition may be an autoimunne disease, cancer or infection. For example, the inflammatory condition may be Rheumatoid Arthritis, vasculitis, non-atopic and atopic asthma, cirrhosis, ulcerative colitis, multiple sclerosis or Crohn's Disease, stroke, head injury, organ transplant rejection, atheroma development, or a burn.

The agonist may or may not be a known chemokine. However, it is preferred that the agonist is adapted to induce signal transduction through a chemokine receptor. Suitable target chemokine receptors will be known to the skilled technician. For example, the agonist may be an agonist of a CCL7 binding receptor (for example, CCR1, CCR2, CCR3, or CCR5).

Preferably, the agonist is a non-GAG binding chemokine receptor antibody. The antibody may be monoclonal or polyclonal. It will be appreciated that once the skilled technician lαiows the sequence of a suitable chemokine receptor, conventional antibody technology (whether for the generation of polyclonal or monoclonal antibodies) may be employed to generate antibodies, which act as an agonist of that receptor.

It is preferred that the antibody is substantially stable in biological fluids, preferably in vivo. Hence, the antibody may be 'humanised'. The inventors believe that appropriate, agonistic anti-chemokine receptor antibodies have the potential to act as long-lived anti- inflammatory molecules when used therapeutically. Furthermore, by targeting specific receptors, the inventors believe that it may be possible to sculpt the nature of any inflammatory infiltrate to engineer beneficial effects. For example, targeting CXCR3 (a chemokine receptor) may reduce the migration of Thl lymphocytes, which are implicated in a number of tissue damaging processes. Other chemokine receptors include CXCR1, CXCR2, CXCR3, CXCR4, or CXCR5, and CCR1, CCR2, CCR3, CCR4, CCR5, CCR6, CCR7, CCR8, CCR9, or CCR10.

Agonist according to the ninth or tenth aspects of the invention may be formulated and used as described in connection with the first to fourth aspects of the invention.

Embodiments of the invention will now be further described, by way of example only, with reference to the following Examples and figures in which:-

Figure 1 shows data generated from heterologous binding competition assays carried out using HEK-293 cells stably expressing CCR2b and ^{1 5}IMCP-1 as the radio labeled ligand and a variable concentration of the corresponding unlabelled chemokines. Figure 2 shows Ca2+ influx data illustrated by: (A) Representative changes in the intracellular Ca²⁺ concentration following CCL7 (100 nM) stimulation of peripheral blood mononuclear cells; and (B) Dose response showing changes in the maximal intracellular (Ca2+) measured in peripheral blood mononuclear cells following stimulation with CCL7 and its mutant. The mean values are plotted as a ratio of the fluorescence emission 440/530.

Figure 3 illustrates in vitro chemotaxis experiments demonstrating migration across the filter (trans-filter) or across the endothelial cells grown on filter (trans-endothelial). Human monocytic cells (THP-1) were stimulated with varying concentrations of chemokines at 37 for 90 minutes (trans filter) and 2h (trans-endothelium) respectively. Negative controls include migration in the absence of chemokines. Data is expressed as means + SEM from a representative experiment (N=3).

Figure 4: illustrated the ability of the CCL7 and its mutant to recruit cells in the murine air pouch: (A) Recruitment of cells in response to CCL7 and its mutant at concentrations of 10 μg each. Mice were sacrificed at 6 and 24 h respectively. Mice injected with PBS were used as control to account for background infiltration. (B) Homologous competition in vivo: Mice were injected with CCL7, Mutant CCL7 and equimolar mixture of CCL7 and mutant (10 μg each). Recruitment of cells was evaluated 24 h after administration of chemokines. Basal recruitment was accounted by PBS injection. (C) Heterologous comptetion in vivo: Mice were injected with various chemokines individually i.e mutant CCL7, CXCL12, CCL5 (5μg each) or equimolar mixtures of CXCL12 and Mutant CCL7or CCL5 and mutant CCL7 (5μg each). Mice were sacrificed 24 h post administration to evaluate the cell recruitment.

Figure 5 illustrates histological evaluation of the murine air pouch. Ten micron cryostat sections of the dissected air pouch were taken at 24hr post administration of chemokines. The left panel represents sections taken from mice injected with CCL7 and the right from mutant CCL7 according to the present invention. Sections were stained with haemotoxylin (a,b); polyclonal antibody to CD3 (c,d) and monocytes/macrophages (e,f) as described in the Example.

Figure 6 illustrates an alignment plot for CCL7 homologues from macaque, Human, Guinea Pig, Rat and Mouse. Figure 7 illustrates data generated from Radioligand binding assays. Results from a representative heterologous cold competition binding assay carried out using HEK-293 cells transfected to stably express CCR3, ¹²⁵I-CCL5 as the radio-labeled ligand, and a variable concentration of either unlabelled wt CCL7 (A) or mutant CCL7 (■) as competitors.

Figure 8 illustratates data generated from In vitro chemotaxis experiments. Examination of monocyte migration across resting endothelial cells in response to wt CCL7, mutant CCL7 and a mixture of both sequences. All assays were performed in triplicate and the number of migrant cells per high power field (x400) was counted for each membrane; data is presented as mean ± SEM.

Figure 9 Inhibition of the chemotactic response of mononuclear cells towards synovial fluid from 3 patients with active rheumatoid arthritis. The transendothelial migration of PBMC (a) or THP-1 monocytes (b, c) towards synovial fluid (1:10 dilution) was measured in the presence 10, 100 and lOOOng/ml of non-GAG-binding mutant CCL7. Each graph shows data using synovial fluid from a separate patient (a, b and c). Data in graph a demonstrate that addition of wt CCL7 did not alter migration towards the synovial fluid. All bars show the mean number of migrant cells per field ± SEM.

Figure 10 Demonstration of Homologous and Heterologous Desensitization of the Chemotactic Response. Results from trans-filter chemotaxis assays performed using resting or chemokine pre-treated monocytes which are subsequently stimulated with either medium (open bars), lOOng/ml wt CCL7 (black bars), lOOng/ml mutant CCL7 (shaded bars) or lOOng/ml CXCL12 (hatched bars). The bars show mean values which, for comparison, are normalised to baseline control levels ± SEM; the data are representative of 3 similar assays.

EXAMPLE 1

Experiments were conducted firstly to identify the major GAG binding site of the chemokine CCL7. This site was then disrupted by mutating to alanine the lysine residues at positions 44, 46 and 49 to produce a non-GAG-binding variant. A range of in vitro and in vivo assays were then performed to assess the functional significance of this change. A final series of experiments was performed to determine whether the non-GAG binding mutant form of CCL7 could antagonize the function of a range of normal chemokines using an in vivo model of tissue inflammation. The experiments illustrated the surprising broad specifically of mutants and derivatives thereof according to the invention.

Materials and Methods

Production of Chemokines

Wt and mutant CCL7 (K44AK46AR49A) were synthesized by the Merrifield solid phase method on a fully automated peptide synthesizer by Albachem (Scotland, UK). Final purity of wt or mutant CCL7 was analyzed by high pressure liquid chromatography and was found to be greater than 95%. The molecular weight of each sequence was verified by electrospray- ionization mass spectrometry (ABI/Sciex QTrap; University of Newcastle Proteomics Unit). Each of the reagents used for preparation of the proteins was certified as endotoxin-free (<0.02 EU/ml).

Generation of Non-heparin Binding CCL7 Point Mutants

Human CCL7 cDNA (see previously) was cloned into the pBKS II plasmid (Stratagene) and verified by sequencing. The point mutations were introduced by inverse polymerase chain reaction as described previously by Wain et al. (Wain JH, Palmer JM, Kirby JA, Ali S (2003). Rapid site-directed mutagenesis of chemokines and their purification from a bacterial expression system. Journal of Immunological methods, 279: 233-249). In brief, the DNA was alkali-denatured and diluted to a concentration of 100 pg/reaction to avoid incorporation of unmutated DNA into the transformation reaction. The mutagenesis primers used are shown below with the mutated bases shown in bold:

K44A(sense)5'GCTGTAATCTTCGCGACCAAACTGGAC3' (SEQ ID No. 9); (anti-sense) 5'TTCCCGGGGACAGTGGCTACTGGTGGTC3'(SEQ ID No. 10);

K46A(sense) 5 'ATCTTCAAGACCGC ACTGGACAAGGAG (SEQ ID No. 11); (anti-sense)5'TACAGCTTCCCGGGGACAGTGGCTACT3' (SEQ ID No. 12);

K49A(sense)5'ACCAAACTGGACGCGGAGATCTGTGCTG3'(SEQ ID No. 13); (anti-sense)5'CTTGAAGATTACAGSTTCCCGGGGACAG 3'(SEQ ID No. 14) Amplification was performed in a DNA thermal cycler (Hybaid, Ashford, Middlesex, UK) for 35 cycles using pfu Turbo DNA polymerase. Polymerase chain reaction products were purified and DNA was ligated and transformed into Epicurian coli competent cells. The sequence of the mutants was verified by DNA sequence analysis using AB377 DNA sequencer XL (Applied Biosystems, California, USA).

The mutant proteins were purified as described previously (Wain et al. supra) The purity and authenticity of the mutants was verified by reverse-phase HPLC and mass spectroscopy.

Heparin-Sepharose Chromatography Each chemokine (lOμg) was injected on a 1ml HiTrap Heparin HP column (Amersham Pharmacia Biotech) connected to an FPLC system and submitted to gradient elution from 0-2 M NaCl in lOmM sodium phosphate, pH 7, at a flow rate of 0.5 ml/min. Detection was carried out at 280 nM. Elution fractions corresponding to absorbance peaks were further verified by western blotting.

MonoS (Cation exchange) Chromatography 10 μg of CCL7 and the mutants were loaded onto a Mono S prepacked cation exchange column equilibrated in 10 mM sodium phosphate, pH 7. Protein was eluted with a 0-2 M NaCl gradient at a flow rate of 0.5 ml min.

Ca²* Mobilisation Intracellular concentrations of Ca²⁺ were measured using frιdo-1/AM. PBMCs were isolated from fresh anticoagulant-treated blood using Ficoll-Hypaque (Pharmacia-Biotech), washed twice in HBSS and resuspended in HBSS containing ImM Ca²⁺, ImM MgCl₂, and 1% Foetal calf serum. The cells were loaded with 3μM Indo-1/AM for 45 min at room temperature. Following this, they were washed, resuspended in the same buffer at a concentration of 10⁶ cells/ml and temperature equilibrated at 37 C for 5 minutes.

Chemokines were added at concentrations between 1 and lOOnM, intracellular Ca²⁺ concentration was measured by monitoring light emission at 405 and 490 nm to an excitation wavelength of 350 nm, using a dual-laser FACS (BD LSRIL Becton Dickinson). Treatment with Ionomycin (lOμg/ml; Sigma) was used as a positive control. Each experiment was repeated three times on different days.

Radioligand Binding Assay HEK-293 cells stably transfected with human CCR2B generated earlier (ClinExp Immunol, 2002) were used for ligand binding experiments. Confluent cells were detached with PBS containing 3mM EDTA, washed and resuspended in binding buffer (HBSS, lOmM HEPES, 0.1% BSA) at a concentration of 5x10⁶ cells/ml. Cold-ligand competition assays were performed in a total volume of 150μl binding buffer using lOOpM ¹²⁵I-MCP-1, 150,000 cells/sample and a variable concentration of the corresponding unlabelled chemokines. After incubation of the cells at 37C for 90 minutes with shaking, the cells were harvested using a vacuum manifold with 0.8 μm pore cellulose acetate filter strips (Costar). The cells were further washed twice with HBSS containing lOmM HEPES and 0.5M NaCl to remove the unbound ¹²⁵I chemokines. The filters were then dried, transferred to test tubes, and the radioactivity was measured in a γ-counter. Radioligand-binding parameters were calculated using Prism 3 software (GraphPad).

In vitro Chemotaxis Assays The ability of wild-type (wt) and mutant CCL7 to stimulate chemotaxis of THP-1 cells (human myelomonocytic cell line) was assessed using a 24-well transwell system (Falcon). Chemokines were dissolved at 10 μg/ml in sterile phosphate buffered saline (PBS) and diluted between lnM and lOOnM in HEPES-buffered RPMI-1640 supplemented with 1% BSA. This chemokine was placed in the lower well of a 24-well transwell system (800μl). The upper compartments were filled with a THP-1 cell suspension (300μl) at a concentration of 0.5xl0⁶/ml. The cells were allowed to migrate through a 3μm-pore polyvinlypyrrolidone-treated polycarbonate membrane for 90 min. After this time the filter was stripped to remove cells from the upper surface and the cells on the underside were fixed with methanol and stained with haemotoxylin. Quantification of the chemotaxis was performed by counting the mean number of migrant cells per high power field. All assays were performed in triplicate.

For some experiments, THP-1 monocytes were incubated with no chemokine or with either wt or mutant CCL7 at lOOng/ml in free-solution for 30 min and then washed by centrifugation. These cells were then used in chemotaxis assays with either lOOng/ml wt CCL7, mutant CCL7 or CXCL12 (Peprotech) in the lower compartment. Flow cytometric studies were also performed to assess the potential of both wt and mutant CCL7 to modulate the cell-surface expression of CCR1 and CXCR4 using monoclonal antibody reagents (clone 53504 and 44716; R and D Systems) together with appropriate fluorochrome-conjugated secondary antibodies and isotype-matched control reagents.

Transendothelial Chemotaxis In the modified chemotaxis assay (whereby a process of haptotaxis is imitated) endothelial cells (Human microvascular endothelial cells (HMEC-1)) were grown on transwell filters of 3.0 μm pore size (Falcon) overnight to establish a monolayer. These cells were then stimulated for 24 h with TNF-α (100 IU/ml) and IFN-γ (100 IU/ml) as a model for inflamed vascular endothelium because these cells express the major adhesive ligand found on many inflamed venules {Luscinskas, 1996 #384}. Chemokine was placed at varying concentrations in the lower well of a 24-well transwell system (Falcon) in 800μl RPMI 1640. THP-1 cells (monocytic cell line, treated with IFN-γ; 300 IU/ml for 24 h) were added at a concentration of 5xl0⁵ cells/well in a total volume of 300μl to the upper well of the transwell system. The chamber was incubated at 37°C for 2h. Quantification of chemotaxis was performed by counting the mean number of migrant cells per high power field. All assays were performed in triplicate.

Cell Recruitment in Murine Air Pouches 8 week old female mice were obtained from Charles Rivers UK. Air pouches were generated in female BALB/c mice according to a previously described method (Edwards, J. C. Sedgwick, A. D. Willoughby, D. The formation of a structure with the features of synovial lining by subcutaneous injection of air: an in vivo tissue culture system. 1981, J Pathology, 134: 147-56). Briefly, an air pouch was induced on the back of mice by injecting 3 ml of sterile air subcutaneously followed by 1 ml of air on three separate occasions (days 2, 4 and 5 respectively) to establish stable fluid-filled pouches. On day 6, each pouch was injected with 200 μl ml PBS containing either wild-type CCL7 (lOμg) or non-GAG binding variant of CCL7. Identical age-matched control mice were injected with PBS alone. Six and 24 hour later, recruited cells were recovered by gently lavaging the pouch with 1 ml of PBS containing 1 mM EDTA. The exudates were centrifuged at 3,000 rpm (5min), and the supematants were removed. Cell pellets were suspended in PBS (1 ml) for enumeration and assessed for viability. 200μl of each cell suspension was mixed with 150 μl PBS and then centrifuged onto microscope slides at 1000 rpm for 3 min and fixed with ice cold methanol. Differential cell counts were performed using cytospins stained with Diff Quick (Dade: Baxter Healthcare Ltd) to assess morphological criteria: polymorphonuclear leukocytes (PML) and total cells were counted in 3 representative fields at x40 to determine the proportion of PML. Further cytospins were stained with antibodies specific to T cells (anti CD3 AB, Serotec) and Monocytes/macrophages (F4/80, Serotec) both raised in rat. Stained and unstained cells in cytospin preparations were counted in 3 representative fields for each cytospin to determine the proportions of T cells and monocytes/macrophages in the air-pouch lavage.

Additional competition experiments were performed in order to monitor the cell migration in response to CCL7, CCL5 and CXCL12 in presence of mutant CCL7 (5μg each). In all cases a group size of 3-5 was used to allow experimental outcomes to be assessed reliably.

Immunohistochemistry Ten micron cryostat sections of dissected 'air-pouch' tissue on lysine-coated slides and cytospin preparations were immunostained to detect T cells and monocytes/macrophages: using antibodies to CD3 and F4/80 (Serotec) both raised in rat, as previously described { Jones, D. E., Palmer, J. M., Bennett, K., Robe, A. J., Yeaman, S. J., Robertson, H., Bassendine, M. F., Burt, A. D., Kirby, J. Investigation of a mechanism for accelerated breakdown of immune tolerance to the primary biliary cirrhosis- associated autoantigen, pyruvate dehydrogenase complex. 2002 Lab Investigation, 82: 211-9). Briefly, sections/cytospins were fixed in acetone/methanol, treated to minimize endogenous peroxidase activity (0.02 M sodium azide in PBS) and non-specific binding of secondary antibody (20% normal lamb serum in TBS: NLS, 1 hour at 4C) prior to overnight incubation with primary antibodies (CD3, 1/50 in NLS and F4/80, 1/25 in NLS) overnight at 4C. The secondary antibody, biotinylated sheep anti-rat IgG was diluted 1/200 and incubated overnight at 4C in NLS containing 5% normal mouse serum to eliminate cross reactivity with mouse immunoglobulins. Following incubation of sections/cytospins with secondary antibody, the immune complex was visualised with streptavidin-biotin-peroxidase complex (SABPx:Dako) and nickel-enhanced diaminobenzidine (NiDAB). Negative control sections/cytospins were incubated with non-immune lamb serum in place of primary antibody.

Synovial Fluid Samples Following informed consent, synovial fluid was collected into sterile tubes from the knee joint of patients with active rheumatoid arthritis undergoing therapeutic aspiration. The samples were centrifuged and the cell-free supernatant was stored at -20°C. The fluid was diluted 1:10 into PBS for use in the lower chamber of transendothelial chemotaxis assays, as described above.

Statistical Tests All results are expressed as mean ± SD (or SEM) of the corresponding replicates, the significance of changes in receptor affinity by various ligands was assessed by the application of Student's t-test. Data was stored and analysed using Prism 3 software.

Results Summary CCL7/MCP-3 plays a key role in many aspects of the immune and inflammatory response. In addition to its interaction with specific receptors, it also interacts with cell surface glycosaminoglycans (GAG) which is thought to be essential for efficient presentation to leukocytes for chemotaxis. In this study we generated a non-GAG binding CCL7 variant by mutating basic amino acids within a putative GAG-binding domain BXBXXB to alanine. Wild type (wt) CCL7 bound to heparin sepharose whereas the mutant lost its ability to interact with heparin. The mutant was tested for its integrity by receptor binding assays as well as its ability to induce an intracytoplasmic Ca2+ flux and cellular chemotaxis. The mutant surprisingly bound to the CCR2b receptor and showed a potential to mobilize Ca2+ with an affinity similar to the wild type protein. It was found that the mutant induced a similar leukocyte chemotactic response within a concentration gradient generated by free solute diffusion. However, it showed a significantly reduced potential to stimulate chemotaxis across a monolayer of endothelial cells.

Using a murine air pouch model of inflammation, we found that the number of cells recruited in response to the mutant was reduced by 85% compared to the wt-CCL7. At equimolar ratio with wt protein this mutant could significantly suppress CCL7-mediated leukocyte recruitment. Similar antagonism of inflammation was observed using a semi- heterologous mixture of mutant CCL7 and wild-type CCL5 (a combination of chemokines which share the specific receptors CCR1, 2 and 3), and the completely heterologous mixture of mutant CCL7 and CXCL12 (which share no common receptors). These data show not only that GAG-binding is required for chemokine driven inflammation, but also show that the mutants according to the invention have non-GAG binding chemokine receptor agonist activity and can block the normal vectorial migration of leukocytes required for the generation of an inflammatory infiltrate.

Identification of the Heparin Binding Site in CCL7 As discussed above, proteoglycan binding sites generally comprise clusters of basic amino acid residues. Hence, by aligning the amino acid sequence of a number of β- chemokines, we have identified conserved basic amino acid sequences (residues 44, 46 and 49) within the CCL7 sequence. In addition, alignment of chemokine sequences based on the three- dimensional structure fit also implicated the residues K46 and K49. Therefore in an effort to examine the relative contribution of the consensus basic amino acids, K44, 46 or 49 were separately mutated to alanine by inverse PCR. As described earlier these mutants and wt CCL7 were then transformed into E. coli and expressed as polyhistidine tag recombinant proteins. The mass of the purified proteins was verified by Εlectrospray Ionisation Mass Spectrometry (wt CCL7 12,018Da, K44A 11962Da, K46A 11961Da and K49A 11961Da respectively). The potential involvement of basic amino acids within the CCL7 BXBXXB domain in HS binding was assessed using HiTrap Heparin HP columns. It was found that wt CCL7 eluted from the columns at a salt concentration of 0.8M ± 0.01M. Elution of the K44A mutant from the column was not significantly different to the wt protein (0.817M ± 0.012M; p<0.9537). However, both the K46A and K49A CCL7 mutants were eluted from the column at a significantly lower salt concentration than the wt CCL7 (0.76M + 0.007M, p<0.0142 and 0.764M ± 0.004M, p<0.0235 respectively).

Generation ofNon-heparin Binding Variant of CCL7 Molecular modeling studies (http://www.expasy.org/swissmod/SWISS-MODEL.html) show that combined mutation of all 3 conserved residues should result in severe abrogation of the normal electrostatic potential of CCL7, indicating a localized reduction in the net positive charge of the chemokine. Hence, in addition to the single site mutants, we went on to create a triple mutation of this domain. The K44A/K46A/K49A (⁴⁴ATALDA⁴⁹) mutant protein and wt CCL7 were chemically synthesized, the proteins were both >95% pure as estimated by reverse- phase HPLC (Table 1). Table 1 Mass spectrometric analysis of the CCL7 and its mutant

To assess the impact of this mutation on the proteoglycan binding by CCL7 we passed this molecule down heparin affinity columns and examined its binding properties. The results show (Table 2) that whilst the wild-type protein binds to heparin affinity columns and requires up to 0.56 M NaCl for elution, ⁴⁴ATALDA⁴⁹ shows no significant affinity for heparin and the majority remains unbound. Furthermore, to evaluate the specificity of the interactions, wt and ⁴⁴ATALDA⁴⁹ protein was passed through a cation exchange column. Removal of basic residues resulted in a decrease in NaCl concentration required to elute the mutant from Mono S column. The difference in NaCl concentration required for elution from the Mono S column and that required for elution from the heparin column for ⁴⁴ATALDA⁴⁹ was 0.45. This positive value indicates that these residues may play a role in the specific interaction with heparin. These results suggest therefore that interference with the three conserved amino acids results in a variant of CCL7 which is unable to bind to heparin.

Table 2 Heparin Sepharose data for CCL7 and its mutant: Molarity of NaCl required for elution from heparin and Mono S (cation exchange) columns

ΛNaCl^HepS is the difference in the NaCl concentration required to elute wt compared to the mutant CCL7. ΔΔNaCl is the effect of the mutation on binding to heparin Sepharose after subtraction of non-specific electrostatic effects, as determined from ΔNaCl^MonoS; ΔΔ NaCl= ΔNaCl^HepS - ΔNaCl^MonoS.

Receptor Binding of a Non-heparin Binding Variant ofCCL7 Initially it was thought that the receptor and GAG-binding domain were spatially separated. However, as the GAG-binding motifs for more chemokines are mapped, it appears that this is not a rigid rule. Hence, we carried out a series of radioligand binding experiments to determine the impact of mutation on its receptor affinity. Experiments were carried out using HEK-293 cells stably expressing CCR2b and ¹²⁵JJVICP-1 as the radio labeled ligand. CCL7 had an IC₅₀ of 5.8 ± 1.19 nM (n=3) for CCR2b and mutant CCL7 had an IC₅₀ of 59.1 + 34 nM (n=3), in these heterologous binding competition assays (Fig 1). In all the experiments performed the mutant protein showed a 10-14 fold loss of affinity for CCR2b compared to the wt CCL7.

Signal Transduction in Response to a Non-heparin Binding CCL7 Mutant Ca²⁺-Flux: To investigate a possible linkage between GAG-binding capacity and cell activation, w.t. CCL7 and mutant protein were tested for their ability to stimulate an increase in intracellular free calcium in human mononuclear leukocytes in a dose response experiment. Indo-1 -loaded peripheral blood mononuclear cells were incubated with varying concentrations of chemokine, and the number of cells displaying the elevations in intracellular free calcium concentration was determined. We were surprised to note no significant difference between the mutant and wt CCL7 (Fig 2). Additional experiment was performed to determine the extent of intracellular calcium flux in response to equimolar mixture of CCL7 and Mutant (100 nM each). It was found that the response generated was not significantly different compared to the treatment with individual chemokines at 100 nM concentration. This suggested that the mutants were antagonists for GAG binding but were still capable of activating down stream signal cascades.

Chemotaxis: A series of experiments was performed to determine how mutation of the GAG binding site altered the ability of CCL7 to stimulate leukocyte chemotaxis. The in vitro assay involves the establishment of an artificial gradient, produced in a standard chemotaxis apparatus by placing chemokines in lower chamber and cells in upper chamber, separated by porous membrane. Restricting the chemokine to microchamber, coupled with lack of flow conditions, apparently eliminates the need for immobilization on GAGs. At 10 and 100 ng/ml the number of cells stimulated to migrate by CCL7 was not significantly different from the mutant (p>0.05 in each case). Thus the mutant, despite showing significantly compromised GAG binding, show robust chemotaxis profiles in vitro (Fig 3). Ability of mutant to induce transendothelial chemotaxis: A series of assays was then performed to compare the potential for stimulation of transendothelial leukocyte migration of wt CCL7 and the mutant. In these experiments the human microvascular endothelial cell line (HMEC-1) was cultured to confluency on the porous filter used previously, each of the chemokine species were added below the filter. Figure 3 shows the effect of increasing concentration of chemokines; it was found that at all the concentrations 10, 100 and 1000 ng/ml, the mutant stimulated a response that was 60 % (pO.OOl), 45% (pO.OOl ) and 45 % (pO.OOl) less than the response produced by wt CCL7 under the same conditions. Thus the mutant CCL7 elicited reduced TEM over a range of concentration compared to wt CCL7.

Cell recruitment in vivo: An air pouch model was used to further elucidate the relevance of chemokine-GAG interaction with respect to biological activity in vivo. Air pouches formed by subcutaneous injection of air into the back of mouse develop a lining layer resembling synovial membrane. This has been identified as a useful model for evaluation of response to various proteins/chemicals, providing cellular infiltration and mediators of inflammation. Maximal recruitment occurred 24 h post injection of 10 μg of wt CCL7. Experiments were performed at two time points, 6 h (to monitor early infiltration) and 24 h (maximal infiltration) respectively. As shown in figure 4 the wt CCL7 induced a robust increase in the number of recruited cells to a level approximately 3 fold greater than the PBS control. The population of cells recruited included predominantly polymorphs(43%),monocytes (29%) and T cells (28%). However, recruitment by CCL7 mutant was reduced by 71% compared to wt CCL7 and it was equivalent to the response elicited by injection of PBS [(0.5 + 0.1) x 10⁶ cells/pouch]. We did not observe suppression of any particular cell type with mutant CCL7, rather it was uniform suppression of all the cell types. Sections of the dissected air pouch were stained with antibodies specific for T cells and macrophages (fig 5).

In an attempt to understand the mechanism by which the mutant CCL7 inhibited the leukocyte recruitment in vivo we first tested the ability of the mutant CCL7 to inhibit wt CCL7 (homologous competition). Equimolar mixture of CCL7 and mutant (10 μg each) at 24 h reduced the number of cells recruited to the basal level i.e number of cells recruited by PBS alone. Secondly, we assessed the potential of mutant to perform semi-heterologous competition i.e. with CCL5 with which it shares its receptors (CCR1, 2 and 3). A significant number of cells were recruited in air pouch in response to CCL5 (233,300 + 52040); however, in presence of CCL7 the cells recruited by CCL5 were reduced by 85 % (figure 4c). To further explore whether the inhibitory effect of the mutant was specific for the chemokines with which it shares its receptors or was it capable of inhibiting other chemokines, we carried out additional experiments. Heterologous competition experiments were carried out with the CXC chemokine CXCL12, at an equimolar ratio (5 μg each) the mutant effectively inhibited the leukocyte recruitment by 88 % compared to CXCL12 alone (Fig 4c).

Table 3 Number of leukocytes present in pouch

Injections Monocytes/Macrophages Eosinophils/basophils T cells

Table 3 illustrates CCL7 and its non-GAG binding variant induced leukocyte infiltration in murine air pouches. Air pouched were raised as described in Materials and Methods. Each mouse was injected with 200 μl PBS containing CCL7 (lOμg), mutant CCL7 (lOμg) or CCL7 + mutant CCL7 (1:1, 10 μg each). Leukocyte infiltration was determined at 24 h post injection. Results present the mean of three different mice.

The results are also shown in Table 5 below.

Table 5 - Leukocyte infiltration of murine air pouches after the injection of wt and mutant CCL7.

The air pouch on each mouse was injected with 1ml PBS containing wt CCL7 (lOμg), mutant CCL7 (lOμg) or wt CCL7 + mutant CCL7 (1:1; 10 μg of each). All leukocytes were lavaged from each pouch after 24 hours. Results show mean values from three mice in each group.

EXAMPLE 2 Further experiments were carried out in order to investigate the efficacy of the CCL7 mutant. The potential of the mutant sequence to modulate inflammation was investigated by testing its ability to inhibit the chemotactic response generated in vitro by synovial fluid from patients with active rheumatoid arthritis. A further series of experiments were also carried out to investigate whether the non-GAG-binding mutant protein could potentially induce receptor desensitisation.

Results Receptor Ligation of a Non-heparin Binding Variant ofCCL7 A further series of radio-ligand binding experiments was performed to determine the impact of mutation of the three basic amino acid residues on the affinity of CCL7 for its specific receptors CCR1, CCR2b and CCR3. A representative heterologous competition assay for CCR3 is shown in Figure 7, and indicates IC₅₀ values of 1.6nM for wt CCL7 and 0.9nM for the mutant sequence. The summary results in Table 4 are derived from 3 separate assays for each receptor and ligand permutation and indicate a marginally higher affinity of the mutant than the wt sequence for CCR1 (3.5-fold) and CCR3 (2-fold), whilst the wt protein had a 3.7-fold higher affinity than the mutant for CCR2b; in no case did these differences reach statistical significance (all p>0.05).

Table 4 - Heterologous competition radioligand binding assays to compare receptor affinity for wt and mutant CCL7

Trans-endothelial Chemotaxis A further series of transendothelial migration assays was performed using non-cytokine stimulated HMEC-1 cells. Whilst the background number of cells migrating across the resting endothelium was lower than that for stimulated cells, the overall results were similar to those observed for cytokine-activated endothelial cells with wt CCL7 stimulating significant chemotaxis (p<0.05) and the mutant chemokine inducing no migration above background (p>0.05; Figure 8). Importantly, it was also found that a 1:1 mixture of wt and mutant CCL7 (either 50ng/ml or lOOng/ml of each protein) induced no more migration than lOOng/ml of the mutant protein alone (p>0.05; Figure 8).

Examination of the Potential of Mutant CCL7 to Inhibit the Chemotactic Potential of Synovial Fluid from Rheumatoid Arthritis

Synovial fluid from patients with active rheumatoid arthritis is known to contain a range of chemoattractant factors, including several chemokines. Each of 3 synovial fluid samples was shown to induce significant trans-endothelial migration of PBMC (Figure 9a) or THP-1 monocytes (Figures 9b, c) when used at a 1:10 dilution (all pθ.01). Addition of lOOOng/ml of wt CCL7 did not enhance the migratory response (p>0.05; Figure 9a) suggesting a maximal response was generated by the synovial fluid alone; addition of wt CCL7 also had no effect on monocyte migration towards synovial fluid sample b (p>0.05; not shown) but marginally increased migration towards sample c (p<0.05; not shown). Importantly, the addition of mutant CCL7 significantly inhibited almost all this chemotactic activity (Figure 9a, b, c) when present at final concentrations of lOOOng/ml (mean 94.3 ± 1.9% inhibition), lOOng/ml (92.9 ± 2.4% inhibition) and lOng/ml (74.3 ± 9.3% inhibition).

Examination of the Antagonistic Activity of Mutant CCL7

Receptor Modulation: It was found that the expression of cell-surface CCR1 was reduced by between 10 and 20% following incubation of mononuclear cells at 37°C for 120 min with either lOOng/ml of wt or mutant CCL7; this reduced labeling was not observed when the cells were stimulated with chemokine at 4°C. Neither CCL7 sequence caused any reduction in the expression of CXCR4 (data not shown).

Homologous and Heterologous Desensitization of the Chemotactic Response: Figure 10 shows the results of trans-filter chemotaxis assays using monocytes which had first been incubated for 30 minutes in suspension with either lOOng/ml of wt or mutant CCL7 before removal of the chemokine by washing. As expected, it was found that untreated cells migrated efficiently when stimulated using lOOng/ml of either wt or mutant CCL7 or CXCL12 in the lower compartment. However, cells which had been pre-treated with either wt or mutant CCL7 showed no significant migration above background levels when stimulated with either CCL7 sequence or CXCL12, suggesting induction of tolerance to stimulation of 'homologous' CCL7 receptors and the 'heterologous' receptor, CXCR4.

Discussion Chemokines are involved in the selective activation and recruitment of cells in inflammation and routine immunosurveillance. To direct the migration of cells it has been suggested that cells migrate along gradients of attractants that are formed by the interaction of chemokine with matrix components and proteoglycans. The expression of glycosaminoglycans is regulated at the site of inflammation and this may be one of the ways that the cellular recruitment is targeted. The work presented here implicates basic amino acids in a conserved motif (containing amino acid 44, 46 and 49 of CCL7) as critical for the association of the CC chemokine CCL7 with glycosaminoglycans.

The BBXB and BXBXXB motifs, where B represents a basic residue, are believed to be a common heparin-binding motif for several proteins. The binding of chemokines to heparin Sepharose columns is a widely accepted technique for assessment of HS-binding ability. Individual CCL7 mutants were all able to bind a heparin-Sepharose column but K46A and K49A mutants eluted at lower concentration of NaCl than the wt protein. Surprisingly, the triple mutant of the 40' s cluster abrogated most of its heparin binding capacity. The specificity of the interaction was further verified by passing it through a cation exchange column. A potential shortcoming of this assay is the use of heparin rather than a physiologically relevant cell surface GAG such as heparan sulphate. However, heparin is believed to be sufficiently similar, both structurally and chemically, to heparan sulphate to provide a good substitute at least in the first instance. Furthermore, chemokine binding to extracellular matrix and other structures has been shown to correlate strongly with the avidity of binding to heparin in vitro. Thus, the heparin assays appear to be a reasonable predictor of the behavior of the mutants towards other types of GAGs. The inventors therefore established that mutants according to the first aspect of the invention have reduced GAG binding and are able to antagonise (prevent) the binding of wt CCL7 and other chemokines to GAG.

The data relating to GAG binding may be considered surprising because it was thought for some time that the receptor binding region of chemokines was located in the flexible-N- terminal segment and in 20s loop, whereas GAG binding was located in the C-terminal region of these proteins. However, as the GAG-binding motifs for more chemokines are mapped, it appears that it is not a rigid rule. Functional studies of the non-heparin binding mutant of CCL7 indicate that it has lost 10-14 fold affinity for CCR2b compared to the wt CCL7. However, a recent study has identified the N-terminal loop of CCL7 as critical for binding and activation to CCR3 as well as CCR1/CCR2. Hence, one possible explanation is that the region mutated is not in itself directly involved in receptor binding but is a region of the molecule important as a structural determinant without which the structure of the molecule becomes sufficiently altered. This is of course difficult to predict, and non-obvious.

The results presented in this work surprisingly indicate that the wt CCL7 and the mutant are indistinguishable in assays of calcium flux and monocyte chemotaxis in free diffusion gradient. From this we can infer that the two proteins interact with, and generate normal signals through one or more of the receptors on THP-1 monocytic cells. Furthermore, these interactions do not depend on cell surface GAGs.

A more physiologically relevant model was developed in which chemotaxis was studied across the endothelial monolayer. Using this system it was found that the CCL7 was able to support efficient TEM but the mutant elicited significantly reduced migration across a range of concentrations. These results are in agreement with our previously published results on CCL5 non-GAG binding mutants which induced a leukocyte chemotactic response within a concentration gradient generated by free solute diffusion similar to the wt CCL5 (Ali S, Sarah J Fritchley, Benjamin Chaffey and John A Kirby (2002). Contribution of the Putative Heparan Sulphate Binding Motif BBXB of CC chemokines to Trans-endothelial Migration. Glycobiology 12; 535-543). However, mutant K45A had a significantly reduced potential to stimulate chemotaxis across a monolayer of microvascular endothelial cells. Hence, these results suggest that the interaction between CCL7 and GAGs is not necessary for specific receptor engagement, signal transduction or leukocyte migration. However, this interaction is required for the induction of efficient chemotaxis through the extracellular matrix between confluent endothelial cells.

Using a well-defined subcutaneous air pouch model of inflammation, we found that injection of wt CCL7 led to significant recruitment of monocytes, polymorphs and T cells, however the number of cells recruited in response to the non-GAG binding CCL7 variant was significantly smaller at both 6 and 24 h respectively. To further elucidate the mechanism by which the mutant inhibits leukocyte recruitment in vivo, we first tested the ability of mutant to inhibit CCL7 mediated leukocyte recruitment. At equimolar ratio, mutant CCL7 completely abrogated CCL7 mediated leukocyte recruitment. Though in vitro equimolar mixture of CCL7 and mutant generated calcium flux which was not significantly different from flux generated by either chemokine on its own. This excludes the possibility that the mutant is contaminated with inhibitory substances or that the combination of the CCL7 with mutant renders it inactive due to abnormal aggregation/oligomerisation.

Secondly, we investigated the possibility that the mutant could suppress the leukocyte recruitment by chemokines such as CCL5 with which it shares receptors (CCRl, 2 & 3). In presence of mutant CCL7 the number of cells recruited by the CCL5 was reduced by 85%. Finally competition experiments were carried with CXCL12. It was found that the mutant was capable of inhibiting cell recruitment by CXCL12 possibly by heterologous desensitization.

In this study we have demonstrated that a non-GAG binding variant of CCL7 can interact with specific chemokine receptors to generate a normal Ca2+ flux, and normal directional leukocyte migration in a concentration gradient produced by free diffusion. Furthermore, treatment of cells with a mixture of the mutant and wild-type forms of CCL7 did not antagonise the generation of a nonnal Ca²⁺ flux, demonstrating the retention of a potential for receptor ligation in this system. However, it was found that the non-GAG binding mutant protein did not promote transendothelial leukocyte migration in vitro. A similar reduction in cell migration has been reported previously for transmigration assays performed using wild- type chemokine but monolayers of non-GAG expressing mutant cells. As predicted by their hypothesis, the series of in vivo experiments showed that injection of wild-type CCL7 resulted in effective recruitment of a mixed inflammatory leukocyte population within the air pouch system; inflammation was also produced by injection of either CCL5 or CXCL12. However, it was observed that injection of the non-GAG binding form of CCL7 produced no significant inflammation. This result is consistent with that from the transendothelial migration assay performed in vitro, and suggests that the presentation of GAG-bound chemokine is required to promote the physiological leukocyte migration which leads to inflammation.

Importantly, it was also found that injection of a mixture of the non-GAG binding mutant and wild-type forms of CCL7 produced a powerful homologous antagonism of the normal inflammatory response. Similar, antagonism of inflammation was observed using a semi-heterologous mixture of mutant CCL7 and wild-type CCL5 (a combination of chemokines which share the specific receptors CCRl, 2 and 3), and the completely heterologous mixture of mutant CCL7 and CXCL12 (which share no common receptors). These data suggest not only that GAG-binding is required for chemokine driven inflammation, but also show that the presence of non-GAG binding chemokine receptor agonists can block the normal vectorial migration of leukocytes required for the generation of an inflammatory infiltrate. This observation is consistent with a model in which inappropriate leukocyte receptor stimulation by non-sequestered chemokines can overcome the response to directional cues provided normally by GAG-bound chemokines. This lead us to realise that the application of a non-GAG binding mutant form of the chemokine CCL7 is a particularly powerful anti- inflammatory agent possibly acting through desensitisation of the chemotactic response of a wide range of leukocyte sub-populations.

In order to investigate the potential of non-GAG-binding mutant CCL7 to antagonise the inflammatory activity of a patho-physiological mixture of chemokines, a series of transendothelial migration experiments was performed using synovial fluid recovered from patients with active rheumatoid arthritis. It is known that this fluid contains a wide range of chemokines, which actively promote chemotaxis in vitro. Significantly, the addition of as little as lOng/ml of the mutant chemokine was sufficient to inhibit the powerful transendothelial migration of either PBMC or a monocyte cell line which was produced by unmodified synovial fluid samples. This inhibitory effect was not caused by saturation of the chemotactic response as addition of up to lOOOng/ml of wt CCL7 either had either no effect on, or increased the leukocyte chemotaxis induced by the synovial fluid.

Results in this study suggest that chemokine receptor ligation by non-GAG-bound agonists can tolerise receptor-bearing cells to vectorial stimuli provided subsequently by normal chemokines presented, for example, on the apical surface of endothelial cells in vitro. While the inventors do not wish to be bound by any hypothesis, they believe that one candidate mechanism for this is modulation of receptor expression following receptor ligation by non- GAG-bound chemokines. hi this study it was found that both wt and mutant CCL7 were equally effective at reducing the expression of CCRl.

Summary The inventors believe that CCL7 mutants according to the first aspect of the invention (i.e. non-GAG binding chemokine receptor agonists) represent new and useful anti- inflammatory drugs for use according to the second and third aspect of the invention.

Non-GAG-binding mutant CCL7 is a powerful reagent as it binds to a broad range of chemokine receptors of which one or more is expressed by most leukocyte classes. The inventors believe that the inhibitory effect of non-GAG-binding CCL7 is caused by receptor ligation in solution, resulting in homologous and heterologous receptor desensitisation before the leukocytes encounter chemokine ligands presented by GAGs on the apical surface of endothelial cells. The potential for non-GAG-bound (and hence, non-vectorial) GPCR ligands to cause heterologous desensitisation of a range of chemokine receptors suggests a route to the development of powerful drugs.

Work with mutant CCL7 lead the inventors to appreciate that other non-GAG binding chemokine receptor agonists may also be used as anti-inflammatory drugs (e.g. receptor activating antibodies or highly specific small molecule chemokine receptor antagonists). Therefore, in its broadest sense, the present invention relates to non-GAG binding chemokine receptor agonists (whether mutant CCL7, a small molecule agonist, antibody or otherwise) as anti-inflammatory agents. The inventors believe that the trigger of chemokine receptors on leukocytes with such agonists in the absence of GAG bound chemokine (required for development of stable chemokine concentration gradients through subendothelial tissues, which are necessary for vectorial leukocyte migration towards sites of developing inflammation) results in desensitising the cell to vectorial stimuli subsequently provided by normal chemokines presented, for example, on the wall of blood vessels.

The present invention, relating to the use of non-GAG binding receptor agonists, is distinguished over prior art disclosures that relate to different molecules. The prior art molecules act as non-GAG binding receptor antagonists that do not signal through the receptor or effect the oligomerisation of chemokines which have been shown to be essential for biological activity of certin chemokines. However, CCL7 has been shown to be a monomer at high concentrations. Therefore, such prior art molecules are incapable of the cross- desensitisation which is advantageously and surprisingly exhibited by the agonists of the present invention.

Claims

1. A non-GAG binding chemokine receptor agonist for use as a medicament.

2. A non-GAG binding chemokine receptor agonist, wherein the agonist is an agonist of the CCL7 receptor.

3. The non-GAG binding chemokine receptor agonist according to claim 2 wherein the agonist is a mutant CCL7 or a functional derivative thereof characterised in that at least one lysine residue at positions 44, 46 or 49 from the sequence of human mature CCL7 is substituted for a different amino acid.

4. The non-GAG binding chemokine receptor agonist according to claim 3 wherein the at least one lysine residue is substituted with alanine, glycine, serine, threonine, proline, aspartic acid, asparagines, glutamic acid or glutamine.

5. The non-GAG binding chemokine receptor agonist according to claim 3 wherein the at least one lysine residue is substituted with an alanine residue.

6. The non-GAG binding chemokine receptor agonist according to any one of claims 3 - 5 wherein a single lysine residue is substituted.

7. The non-GAG binding chemokine receptor agonist according to claim 6 wherein the mutant is CCL7 K44A, CCL7 K46A or CCL7 K49A.

8. The non-GAG binding chemokine receptor agonist according to any one of claims 3 - 5 wherein two lysine residues are substituted.

9. The non-GAG binding chemokine receptor agonist according to claim 8 wherein the mutant is CCL7 K44A K46A, CCL7 K44A K49A or CCL7 K46A K49A.

10. The non-GAG binding chemokine receptor agonist according to any one of claims 3 - 5 wherein each of the lysine residues is substituted.

11. The non-GAG binding chemokine receptor agonist according to claim 10 wherein the mutant is CCL7 K44A K46A K49A.

12. The non-GAG binding chemokine receptor agonist according to claim 3 wherein the agonist is a derivative of the agonists defined by any one of claims 4-11 independently selected from a group of derivatives comprising: a protease resistant derivative, a peptoid derivative, D- amino acid derivative or a peptide-peptoid hybrid.

13. The non-GAG binding chemokine receptor agonist according to any preceding claim, wherein the agonist is an antibody.

14. A mutant CCL7 or derivative thereof as defined by any one of claims 3 - 13.

15. Use of an agonist defined by any one of claims 1-13 in the manufacture of a medicament for the treatment of inflammatory conditions.

16. The use according to claim 15 wherein the inflammatory condition is medical condition at least partially characterised by secretion of inflammatory mediators into an affected tissue.

17. The use according to claim 16 wherein the inflammatory condition is an autoimunne disease, cancer or infection.

18. The use according to claim 16 wherein the inflammatory condition is Rheumatoid Arthritis, vasculitis, non-atopic and atopic asthma, cirrhosis, ulcerative colitis, multiple sclerosis or Crohn's Disease, stroke, head injury, organ transplant rejection, atheroma development, or a burn.

19. A nucleic acid sequence encoding a mutant CCL7 or polypeptide derivative or fragment thereof according to claim 14.

20. A delivery system for use in a gene therapy technique, said delivery system comprising a DNA molecule according to claim 19 and being capable of being transcribed to allow the expression of said protein and thereby treat an inflammatory condition.

21. An antibody directed against an epitope comprising amino acids 44, 46 and 49 of human mature CCL7.

22. The use of an antibody according to claim 21 in the manufacture of a medicament for the treatment of inflammatory conditions.