WO2005116216A1

WO2005116216A1 - Oral vaccine against protozoiasis using genetically modified plant

Info

Publication number: WO2005116216A1
Application number: PCT/JP2005/009851
Authority: WO
Inventors: Akira Ito; Toru Gotanda; Shigeki Kobayashi; Katsumi Kume; Takeshi Matsumura
Original assignee: The Kitasato Institute; National Institute Of Advanced Industrial Science And Technology
Priority date: 2004-05-31
Filing date: 2005-05-30
Publication date: 2005-12-08
Also published as: US8617575B2; JP4898432B2; CA2567952C; EP1767639A4; AU2005248233A1; DK1767639T3; CA2567952A1; AU2005248233B8; US20080003243A1; JPWO2005116216A1; AU2005248233C1; ATE547526T1; EP1767639B1; EP1767639A1; AU2005248233B2

Abstract

Potato leaf transformed by a vector which expresses an immunogenic protein gene R7 originating in the second generation schizont of Leucocytozoon caulleryi is administered as an oral vaccine to chickens. As a result, the antibody titer of the chickens can be successfully elevated.

Description

Specification

Antigenic worm disease oral vaccine with transgenic plants

Technical field

The present invention relates to an oral antiprotozoal vaccine using a protozoan disease protective antigen expressed in a plant.

Background art

[0002] Leukocytosonosis in chickens is a disease caused by infection of leucocytozon caulleryi, a schistosporidian. L. caulleryi was first identified in Vietnam in 1909 as a circular gametocyte with no malaria granules in the chicken blood, and was so named as a protozoan of the genus Leukocytozone. It is.

[0003] In Japan, chicken leukocytosonosis was first identified in Hyogo Prefecture in 1954, and its causative agent was identified as Caulleryi. After that, the protozoan parasite was Diptera diptera, a kind of blood-sucking insect. It has been experimentally demonstrated that it is transmitted biologically by Culicoides arakawae (hereinafter abbreviated as Nuka power) belonging to the family Ceratopogonidae, and its life cycle has been almost clarified. The leucocytozone 'cowlery is composed of three species: schigogoni (increased reproduction) and gametogony (reproductive and reproductive) in the host chicken, and sporogo-one (spore-reproduced) in the body of the transmissible Nuka power. Have a growing season.

[0004] Sporozoites (species insects) that have entered the chicken body together with saliva during the blood feeding of the protozoa infected with Nuka power mainly infest cells of the vascular endothelial system such as the lung, liver, spleen and kidney. To form the first schizont (split). Five to seven days after infection, first-generation merozoites (divided bodies) are released into the blood, which re-invade vascular endothelial cells distributed throughout the body and proliferate as second-generation schizonts. In the late stage, the cells develop further in the intercellular space apart from the host cell. On day 14, these schizonts release merozoites of the second generation into the blood, which then invade red blood cells and develop, and on days 18-19, the host cells release their macrogametocytes ( It matures as a female reproductive mother and microgametocytes (a male reproductive mother).

[0005] Both gametosites are taken into the mid-gut together with chicken blood when sucking blood with Nuka power, They form and fuse (fertilize) microgamates (male reproductive bodies) with gametes (female reproductive bodies) to form okinates (ectophylls) via tigotes (fused bodies), invade into the intercellular space of the worm intestinal wall, It then migrates below the outer membrane and develops into a oocyst. Dozens of sporozoites are formed inside the oocyst, which migrate to the salivary glands after exiting the contralateral space of Nuka power as the oocyst wall collapses, completing its developmental cycle.

[0006] Symptoms and lesions in chickens caused by this protozoan infection are mainly observed in the late stage of schizogony, in which the second generation schizont develops, and in the period of gammetony, in which the second generation merozoites develop into gametes by parasitizing erythroid cells. Can be The most characteristic bleeding lesions and anemia in the organs and tissues of this disease are thought to be caused by bleeding associated with vascular embolism by the second schizont and the destruction of erythrocytes by parasitism of the gametogony parasite. I have.

[0007] Nukaka, a vector of this protozoan, is recognized as an endemic area in Southeast Asia, China, North Korea, and South Korea, which have paddy fields because they live in paddy fields and the like. Since the first case of leukocytosinopathy in Japan, the epidemic has recurred every summer, and has caused a large loss to chicken productivity.Pyrimethamine power since 1964.Pyrimethamine power since 1968. Since the combination of sulfa drugs and sulfa drugs has been added to feeds as a preventive agent for the disease, the incidence has dramatically decreased. However, since then, the use of active drugs has been limited due to the protozoan becoming resistant to these drugs and the persistence of the drugs, and the use of some active drugs has been banned due to safety issues. It has become more difficult to prevent such damages, and the damage has become permanent.

[0008] Vaccines that have been conventionally produced for chicken leukocytosonosis include live vaccines using sporozoites, inactivated dani vaccines using substances derived from insect bodies as antigens, and organ emulsions from chickens infected with protozoa. There is inactive dani vaccine used as a material. A live vaccine using sporozoites isolates sporozoites from the salivary glands of bran power and immunizes chickens with a small number of them (see Non-Patent Document 1). The inactive dani vaccine using insect-derived substances as antigens is as follows.

[0009] Insect-derived antigens include first-generation schizonts, first-generation merozoites, second-generation schizonts, second-generation merozoites, and soluble antigens derived from chicken and embryonated hen eggs. The soluble antigens detected in the sera of infected chickens on day 15 have almost the same immunogenic properties as the second generation schizonts, and similarly, relatively strong immunogenicity has been observed. Therefore The usefulness of this vaccine has been confirmed in a vaccine produced by inactivating the serum antigen material with formalin (see Non-Patent Document 2).

[0010] Furthermore, the organ emulsion inactivation vaccine was made in order to improve the difficulty in obtaining a large amount of protozoan antigens as described above. Liver, spleen, kidney, and F sac are collected to form an organ emulsion, and a vaccine is produced on a trial basis using a material inactivated with formalin, and its effect has also been recognized (see Non-Patent Document 3). .

[0011] Further, in order to enable stable and large-volume vaccine supply, the present inventors have developed a vaccine using a genetically modified microorganism expressing an immunogenic protein derived from Leukocytozone 'Cowrelli 2nd schizont. Are provided [see Patent Document 1].

[0012] However, all of the vaccines up to now have been premised on administration by injection, and there is a problem when their use is restricted due to their cost and inconvenience.

Patent Document 1: Japanese Patent No. 3582663

Non-Patent Document 1: Shiihara et al., Shizuoka Prefectural Poultry Experiment Station Research Report, 13: 25-27 (1978)

Non-Patent Document 2: Isobe and Suzuki, Jpn, J. Parasitol., 37: 214-219 (1988)

Non-Patent Document 3: Morii, T. et al. J. Parasitol.Res., 76: 630-632 (1990)

Disclosure of the invention

Problems to be solved by the invention

[0013] The present invention has been made in view of such a situation, and an object of the present invention is to provide an antiprotozoal vaccine which is inexpensive and can be easily administered. More specifically, an object of the present invention is to provide an antiprotozoal disease oral vaccine using a protozoan disease onset protective antigen expressed in a plant.

Means for solving the problem

[0014] In order to solve the above-mentioned problems, the present inventors have attempted to develop an antiprotozoal vaccine using transformed plants. Specifically, as an antigen gene, a leukocytozone 'immunogenic protein gene R7 (Patent H07-284392, Patent No. 3582663) derived from Cowrie's second generation schizont is selected, and a vector expressing this gene is selected. Was introduced into potato tubers via a grove bat, and the tuber power was also used to produce a regenerated individual. Next, the leaves of the transformed individual are dried, mixed with a mixed feed for chickens, and mixed with a leucocytozone derived from Escherichia coli. Chicken already vaccinated with the immunogenic R7 protein from Cowlery 2nd schizont was orally administered. As a result, the oral titration successfully raised the antibody titer in chickens. The increase in antibody titer was particularly remarkable in individuals having a high level of antibody titer at the start of the test. A similar approach can be applied to other protozoan protective antigens.

That is, the present invention relates to an oral antiprotozoal vaccine using a protozoan disease protective antigen expressed in a plant, and its production and use. More specifically, the present invention provides the following [1] to [8]. Is what you do.

[1] A vector comprising a gene encoding a protozoan disease protective antigen operably linked downstream of a promoter transcribable in plant cells.

[2] A transformed plant cell into which a gene encoding a protozoan disease protective antigen has been introduced. [3] A transformed sickle object comprising the transformed sickle cell according to [2].

[4] A transformed plant which is a progeny or clone of the transformed plant of [3]. [5] A material for propagation of the transformed plant according to [3] or [4].

[6] The processed product or extract of the transformant according to [3] or [4] or a propagation material thereof, comprising a protozoan disease protective antigen.

[7] Isolation of a protozoan disease protective antigen from the transformed plant cell according to [2], the transformed plant according to [3] or [4], or the propagation material according to [5] A method for producing a protozoan disease onset protective antigen, comprising the step of:

(8) the transformed plant cell according to (2), the transformed plant according to (3) or (4), the propagation material according to (5), the treated product or the extract according to (6), Alternatively, a method for conferring immunity against a protozoan to an animal, comprising a step of orally administering to the animal the protozoan disease protective antigen obtained by the method according to [7].

(9) the transformed plant cell according to (2), the transformed plant according to (3) or (4), the propagation material according to (5), the treated product or the extract according to (6), Or an oral antiprotozoal vaccine comprising a protozoan disease protective antigen obtained by the method according to [7].

[10] the transformed sickle cell of [2], the transformed sickle object of [3] or [4], the breeding material of [5], the processed product or extract of [6] , Or [7] Use of a protozoan disease protective antigen obtained by the method in the production of an oral antiprotozoal vaccine.

Brief Description of Drawings

FIG. 1 is a diagram showing the results of ELISA on transgenic potatoes and non-transgenic potatoes into which the R7 gene derived from Leucocytozone 'Cowlery 2nd schizont has been introduced.

FIG. 2 is an electrophoretic photograph showing the results of dienomic PCR in a recombinant ガイ potato transfected with an R7 gene derived from Leukocytozone's Cowlery 2nd schizont.

FIG. 3 is a graph showing the re-induction of blood antibodies in birds that had a history of injection immunization in which a transgenic R7 gene derived from Leukocytozone's Cowlery 2nd schizont was introduced orally ingested potatoes.

BEST MODE FOR CARRYING OUT THE INVENTION

[0017] The present invention provides a transformed plant cell into which a gene encoding a protozoan disease protective antigen has been introduced.

[0018] Protozoan disease is a disease caused by parasitism of a single-cell eukaryote, a protozoa, in a living body. In 1975, the WHO stated that control measures were urgently needed, including six major tropical diseases: malaria, trypanosomal disease, leishmaniasis, filariasis, schistosomiasis, and leprosy. The three diseases are protozoal diseases, and many protozoal diseases are violent, regardless of the animal or animal.

[0019] Among these, protozoa belonging to the order of the subfamily Coccididium subretinal spores include leucocytozone; leucocytozoenosis caused by infection with Kaurelie; and malaria caused by infection with Plasmodium protozoa. Malaria, vivax malaria, vivax malaria, oval malaria) and the like. In addition, examples of infectious diseases caused by schistoplasma belonging to flesinophyta include leishmaniasis, trypanosomal disease and the like. Examples of infectious diseases caused by schistoplasma belonging to Piroplasma subretinal include babesiosis and theileriasis.

[0020] The "protozoan disease onset protective antigen" is an antigen that protects against the onset of such protozoan disease. For example, for leukocytozone disease, leukocytozone The R7 antigen (see amino acid sequence Z SEQ ID NO: 1, base sequence Z SEQ ID NO: 2) responds to malaria with AMA-1 (apical membrane antigen 1) antigen (Cheng, Q. ana Saul, T., Mol. Biochem. Parasitol., 65: 183-187 (1994)), CSP (circum sporozoite protein) antigen (see Haeselee r Fet al., Mol. Biochem. Parasitol., 57: 117-126 (1993)), LSA-l (liver stage specific antigen-1) antigen (see Yang, C. et al., Mol. Biochem. Parasitol., 71: 291-294 (1995)), MSP-l (merozoite surface protein-1) ) Antigen (see Ranford-Cartwright, LC. Et al., Mol. Biochem. Parasitol., 46: 185-187 (1991)), PffiMPl (Plasmodium falciparum infected erythro cyte membrane protein 1) antigen (Ward'CP. Et al.) , 102: 167-177 (1999)), SERA (serine repeat antigen) antigen (Li, WB. Et al. 'Mol. Biochem.Parasitol., 33: 13-25 (1989) )), And TRAP (thrombospondin related adhesion protein) antigen (see Trotte ein. F. et al., Mol. Biochem. Parasitol., 74: 129-141 (1995)). Protozoal disease onset protective antigen of the present invention is not limited thereto. In addition, these protective antigens include mutant protective antigens whose gene sequence and amino acid sequence are changed. Also included are naturally or artificially produced mutant protective antigens.

[0021] Plants from which the transformed ^^ cells of the present invention are derived are not particularly limited as long as they are suitable for oral administration. For example, legumes such as potato, tomato, soybean and red bean, rice, wheat and corn. And fruits such as strawberries and pastures.

[0022] The transformed plant cell of the present invention can be prepared by introducing a vector containing a gene encoding a protozoan disease protective antigen into a plant cell and expressing it. The vector used for gene expression in plant cells is not particularly limited as long as it contains a promoter capable of being transcribed in plant cells and a terminator sequence including a polyadenylation site necessary for stabilizing the transcript. Plasmids “pBI121”, “pBI221”, “pBI101” (all manufactured by Clontech) and the like can be mentioned. As a promoter transcribable in a plant cell, for example, a promoter for constant gene expression in a plant cell or a promoter inducibly activated by an external stimulus can be used. . Examples of promoters for constitutive expression include cauliflower mosaic @ Inores 35S promoter (Odell et al. 1985 Nature 313: 810) and rice actin promoter (Zhang et all). 991 Plant Cell 3: 1155), corn ubiquitin promoter (Cornejo et al. 1993).

Plant Mol. Biol. 23: 567). By introducing a vector containing a gene encoding a protozoan disease protective antigen functionally linked to these promoters into plant cells, the protozoal disease protective antigen can be expressed in the plant cells. Here, “functionally linked” means that the promoter and the gene encoding the protozoan disease protective antigen are linked so that the protozoal disease protective antigen is expressed in the plant cell. The present invention

Further, the present invention also provides a vector for producing a transformed plant cell into which such a protozoan disease protective antigen has been incorporated.

[0023] The "plant cells" to be transformed include various forms of plant cells, for example, suspension culture cells, protoplasts, leaf sections, calli and the like.

[0024] The vector is introduced into a plant cell using various methods known to those skilled in the art, such as a method involving agrobacterium, a polyethylene glycol method, an electroporation method (electorifice poration method), and a particle gun method. be able to.

[0025] Transformed plant cells can regenerate plants by redifferentiation. The method of regeneration differs depending on the type of plant cells. For example, in the case of potatoes, the method of Visser et al. (Theor. Appl. Genet 78: 594 (1989)) and the method of regenerating plants by the tuber disk method For monocotyledons such as rice, Hiei et al.'S method (Hiei Y, Komari T, Kubo T: Transformation of rice mediated by Agrobacterium tumefacien s. Plant Mol Biol 1997 35: 1-2 205-18), Ishida et al. (Ishida Y, Saito H, Ohta S, Hiei Y, Komari T, Kumashiro T: High efficiency transformation of maize (Zea mays L.) mediated by Agrobacterium tumefaciens. Nat Biotechnol 1996 Jun 14: 6 745-50), Electro Strawberry, such as the Pole-Shiyon method (Shimamoto'K., Terada, R., Izawa, T. et al .: Fertile trans genic rice plants regenerated from transformed protoplasts. Nature 338, 274-276 (1989)) Asao et al.'S method (Asao, H., Y. Nishizawa, S. Arai, T. Sato, M. Hirai, Kyoshida. A. Shinmyo and T. Hibi .: Enhanced resistance against a funga l pathogen Sphae rotheca humuli in transgenic strawberry expressing a rice chitinase gene.Plant Biotechnology. 14 (3): 145-149 (1997)) and other technologies have already been established and widely used in the technical field of the present invention. In the present invention, these methods are preferably used. You can be there.

Once a transformed plant in which a gene encoding a protozoan disease protective antigen has been introduced into the genome (chromosome) is obtained, progeny can be obtained from the plant by sexual or asexual reproduction. Is possible. In addition, the plant, its progeny, or clonal power can be obtained by obtaining a propagation material (eg, seeds, fruits, cuttings, tubers, tubers, strains, calli, protoplasts, etc.), and mass-producing the plant based on them. It is possible. The present invention includes a plant containing the transformed plant cell of the present invention, progeny and clone of the plant, and propagation material of the plant, its progeny, and clone.

[0027] As an orally administered vaccine, the thus-produced transgenic cells, transgenic plants, or propagation materials thereof can be used directly. It is also possible to use those processed products or extracts containing As used herein, the term “processed product” refers to a product obtained by treating a transformed plant cell, a transformed plant, or a propagation material thereof in a form suitable for vaccine administration. Lyophilized. The term "extract" refers to an extract obtained from a transformed plant cell, a transformed plant, or a propagation material thereof, which contains a component containing a protozoan disease protective antigen, and includes a crudely purified product and a purified product. It is. Isolation (purification) of protozoan disease-protecting antigens from transformed plant cells, transformed plants, or their propagation materials requires salting-out, ultrafiltration, ion-exchange chromatography, and gel chromatography. General protein purification method can be used.

[0028] The present invention also provides a method for producing a protozoal disease preventive antigen, comprising a step of isolating such a protozoal disease protective antigen.

[0029] The present invention also relates to a method for orally administering the above-mentioned transformed plant cells, transformed plants, propagation materials, their processed products or extracts, or the protozoan disease protective antigen isolated by the above-mentioned method to animals. Also provided is a method of conferring immunity against a protozoan on said animal, comprising a step of administering.

[0030] Examples of the animal to which the protozoan disease protective antigen is administered in the present invention include avian power S when the protozoan disease is leukocytosonosis, and humans, monkeys and birds when the malaria is malaria. Is done. Also, if leishmaniasis occurs in humans and dogs, trypanosomal disease For example, if humans, pests, and pests are babesiosis, dogs, cats, pests, and pests are theiles, and if the disease is thirellosis, pests are used.

When the plant into which the protozoan disease protective antigen gene of the present invention is incorporated is orally administered, the above-mentioned transformed plant cell, transformed plant, propagation material, or a processed product or extract thereof Alternatively, it is also possible to administer the isolated protozoan disease onset protective antigen itself. Examples of other ingredients include mucosal immune adjuvant substances (cholera toxin, cytodynamics, etc.), feeds for animals to be administered, and combinations with additives (ratatose, etc.) for improving palatability. it can.

[0032] The dose varies depending on the animal to be administered. For example, in chickens, a plant having the protozoan disease protective antigen gene incorporated therein is mixed with a normal feed to take 2 g to 5 g per day. Is considered to be advantageous. In the case of other animals, the amount converted into body weight or the amount converted per body surface area can be administered, but is not limited to these amounts. The appropriate dose can be determined in consideration of the expression level of the protective antigen, the optimal antibody production, the properties of the compound feed, and the like.

[0033] The oral vaccine of the present invention can be administered to an individual whose antibody titer has already been increased by vaccine administration (for example, administration by injection), whereby the antibody titer of the individual can be further increased. it can. For example, in this example, an individual already inoculated with an antigen expressed in Escherichia coli and having a high and high antibody titer and having an antibody titer of 0.4 or more, preferably 0.7 or Oral administration to the above individuals) confirmed a marked increase in antibody titer.

All prior art documents cited in this specification are incorporated herein by reference.

Example

[0034] Hereinafter, the present invention will be described more specifically with reference to Examples, but the present invention is not limited to these Examples.

[Example 1] Transfer of the R7 gene encoding an immunogenic protein derived from Leucocytozone 'Cowlery 2nd schizont into a plasmid for plant expression

LeucocytozoneImmunogenic protein gene R7 derived from Cowlery 2nd schizont (specially Cleavage of the pTH-R7 plasmid vector containing H07-284392 (Japanese Patent No. 3582663) using the restriction enzymes Smal and Sad, the resulting R7 gene DNA fragment (SEQ ID NOS: 1 and 2) was transformed into a cauliflower mosaic virus. A plasmid vector pBI121 (manufactured by Clontech) having a 35S promoter, a 13-glucurodase gene, and a nopaline synthase terminator was cloned into the site cleaved with restriction enzymes Smal and Sad to obtain PBI-R7, an expression vector of the present invention. Got.

[Example 2] Introduction and expression of R7 gene derived from Leukocytozone 'Caulery 2nd schizont into potato

1. Introduction of R7 gene from leukocytozone 'kaureri 1st generation schizont into Agrobacterium

The leukocyte zone's R7 gene expression plasmid pB to R7 derived from the second generation of schizont obtained as described in [Example 1] above was directly introduced by freeze-thawing into Agrobacterium tumefaciens LBA 4404 (Clontech). Manufactured).

[0037] That is, Agrobacterium tumefaciens LBA 4404 was dissolved in 50 mL of LB liquid medium (1% Bacto torypton, 0.5% Yeast extracts, 1% sodium chloride) at 28 ° C until the absorbance of A600 reached about 1.0. The cells were cultured with shaking. After cooling on ice, the mixture was centrifuged at 4 ° C. at 3000 g (using Kubota RA-6). After collecting the cells, the cells were suspended in 1 mL of ice-cooled 20 mM salted calcium solution. This was dispensed to an Eppendorf tube every O.lmL.

[0038] To this, 1 µg of the recombinant plasmid pB-R7 was added, and the mixture was rapidly frozen in liquid nitrogen. Next, the obtained frozen cells were thawed at 37 ° C. and allowed to stand for 5 minutes. To this, 1 mL of LB medium was added, and cultured at 28 ° C for 2 to 4 hours with shaking. The cells were collected by centrifugation at about 10,000g for 1 minute (using Kubota KM-15200), suspended in O.lmL LB medium, rifampicin (100gZmL), kanamycin (25μg / mL) After spreading on an LB solid medium containing streptomycin and streptomycin (300 μg / mL), the cells were cultured at 28 ° C. for 2 to 3 days to obtain transformed bacteria into which pB-R7 had been incorporated.

[0039] The transformed Agrobacterium tumefaciens LBA4404 obtained above was shake-cultured in an LB liquid medium at 28 ° C, followed by centrifugation at 3000 ° C at 4 ° C (using Kubota RA-6). The cells are collected, suspended in an MS medium [Physiol. Plant. 15: 473 (1962)], and transformed into a plant. Used for the replacement operation.

[0040] 2. Introduction to potatoes by the aglobatery method

The introduction of the R7 gene from the leucocytozone 'Cowlery 2nd schizont into potatoes was carried out by the aglobata terium produced in the above and the tuba-disk method.

That is, the potato tubers were peeled, sterilized with a 1% sodium hypochlorite solution for 15 minutes, and washed six times with sterile distilled water. From the tubers, a column with a diameter of lcm was cut out with a sterilized cork borer, and sliced into a flat plate having a thickness of 2-3 mm. This disc was immersed for 15 minutes in the MS liquid medium suspension of Agrobacterium tumefaciens LBA4404 carrying PBI-R7 created in 1 above. After this, on an MS medium (containing 3% sucrose, 0.1 μg ZmL indoleacetic acid, 0.1 μg / mL gibberellin, 0.1 μg / mL abscisic acid, 2 μg / mL zeatin riboside (ρ Η5.9)) After culturing at 3 ° C for 3 days, the disc was washed with an MS liquid medium containing the antibiotic kanamycin 100 μg ZmL and carba-sylin 500 μg / mL (with Sigma also).

[0042] The discs after washing were subcultured at 25 ° C every two weeks on an MS solid medium (containing 3% sucrose) containing the above antibiotics (16 hours illumination, 8 hours dark period). Calli were formed on the disk surface at 4 to 8 weeks of culture, and shoots were induced by further subculture.

[0043] The shoots were also extirpated and transplanted onto a hormone-free MS solid medium [containing 3% sucrose, kanamycin 100 µg / m carbe-cillin 500 µg / mL (pH 5.9)]. Cultivated. Plants that had rooted 2 to 4 weeks later were transferred to pots (diameter 10 cm) containing culture soil and cultivated in an artificial weather device.

[0044] 3. Confirmation of introduction and expression of R7 gene derived from Leukocytozone's second generation schizont in regenerated plants

(l) Confirmation of R7 gene expression from leukocytozone 'kaureri 1st generation schizont by ELISA Regenerated potato leaves were washed with 3 times the volume of PBS-T buffer (135 mM sodium chloride, 1.5 mM phosphate). Triturated with sodium dihydrogen, 2.7 mM disodium hydrogen phosphate, 0.05% (vZv) Tween 20, pH 7.2], and centrifuged at 3000 g for 15 minutes (using Kubota KS-5000). The clear was used as a crude juice.

[0045] 0.05 M sodium carbonate buffer [1.59 g disodium carbonate, sodium hydrogen carbonate Peptide 2.93 g, (pH 9.6)], diluted to a concentration of 2 g / mL, anti-leukocytozone 'Cowlery 2nd generation schizont monoclonal antibody [Gotanda, T. et al., J. Vet. Med. Sci. 64 (3): 281-283 (2002)] was dispensed into a 96-well ELISA plate (manufactured by IWAKI) and left at 4 ° C for coating.

After washing the coated plate with a PBS-T buffer, a blocking solution added to the PBS-T buffer was dispensed to the plate so that the serum albumin concentration became 3% (w / v). The mixture was allowed to stand at 37 ° C for 1 hour to perform a blocking treatment.

[0047] After the blocking treatment, the plate was washed with a PBS-T buffer, and the crude juice of the leaves was added to the plate and allowed to stand at 37 ° C for 1 hour to react with the antibody. After washing the plate with PBS-T buffer, the HRPO-labeled antibody was diluted 4000-fold with an antibody diluent added to PBS-T buffer to a final concentration of 0.3% (w / v) serum albumin. Leucocytozone 'Cowlery 2nd schizont monoclonal antibody [It ₀ , A. et al., J. Vet. Med. Sci. 64 (5): 405-411 (2002)] was dispensed into the plate. The reaction was carried out at 37 ° C for 1 hour. After washing the plate with PBS-T buffer, the substrate solution (14.6 g of disodium hydrogen phosphate, 10.2 g of citric acid monohydrate, 0-phenylene diamine lg, hydrogen peroxide solution in 1 L) (including 1 mL) was added to the plate, and allowed to stand at 37 ° C. for 15 minutes to react. After stopping the reaction with a stop solution (5N sulfuric acid aqueous solution), the absorbance value of A492 was measured using a microplate reader (using Corona MTP-120). As a result, it was revealed that leukocytozone zone R7 protein derived from the second generation of cowlery schizont was expressed in some regenerated potato individuals (see Fig. 1).

[0048] (2) Confirmation of introduction of the gene into the potato body of the R7 gene from Leucocytozone 'Caulery 2nd schizont

The leaves of some individuals, for which a reaction was confirmed by ELISA, were ground into a powder using a mortar in the presence of liquid nitrogen. For this, use the reagent RED Extract-N-Amp Plant PCR Kit (manufactured by SIGMA) as described in the instruction manual to extract the aforementioned total DNA from potato leaves and to use the primer R7f (specifically to amplify the R7 gene specifically). Dienomic PCR was performed using 5′-GGAAATGTGTCCTTAACTT C-3 ′: SEQ ID NO: 3) and primer R7r (5: CTTCTTCTTCATTACTTTTTC—3 ′: SEQ ID NO: 4). A portion of the sample after the reaction was subjected to 1.2% agarose gel electrophoresis, and as a result, bands were confirmed at the same position as the R7 gene. It was confirmed that the leukocytozone 'R7 gene from Cowlery's second generation schizont was introduced on the chromosome in the body (see the electrophoresis photograph in Fig. 2; the arrow in the figure indicates the leukocytozone'). The position of the band of the R7 gene from Cowlery 2nd schizont is shown).

[Example 3] Confirmation of antigenicity of R7 gene-transferred potato derived from Leukocytozone 'Cowrelli 2nd schizont

Leuco tito zone: Freeze-dried potato leaves into which the R7 gene from the Cowlery 2nd schizont has been introduced to a dry weight of about 1Z12 of the fresh weight (using a 48-hour process using RLE-204 manufactured by Kyowa Vacuum Engineering Co., Ltd.) Carried out. The dried leaves were ground into a powder and then mixed with a mixed feed for chickens (Funabashi Farm) to obtain a material for oral administration.

[0050] The SPF chicken (manufactured by Nisseiken Co., Ltd.) tested in the oral administration test was a chicken leukocytozone disease vaccine, which is currently widely used in the field [an oral nicotine zone expressed in Escherichia coli as a vaccine antigen component]. Three hens, 17 weeks after injection, using R7 protein derived from the second generation schizont (Japanese Patent Laid-Open No. H07-284392) were used. Orally administered material was fed 60 g per bird per day (4 g of which was lyophilized R7 transgenic potato leaves per day) and orally administered for 5 consecutive days (feeding spontaneously) )did. After the completion of the feeding including the R7 transgenic potato leaves, 60 g of a mixed feed for chickens (Funabashi Farm) was given per bird per day. One control chicken was dosed from the start of the test at 60 g per bird only with normal chicken compound feed. From the time of feeding the orally administered material, blood was collected from the wing vein of all test chickens including the control chicken at any time, and serum was obtained by centrifugation. Using these sera, antibody tests were performed by the ELISA method shown below.

[0051] Leuco titozone 'Cowlery 2nd generation diluted to a concentration of 0.1 gZmL with a 0.05 M sodium carbonate buffer solution (1.59 g disodium carbonate, 2.93 g sodium bicarbonate (pH 9.6) in 1 liter) Schizont sonication solubilized antigen [Ito, A. et al., J. Vet. Med. Sci. 64 (5): 405-411 (2002)] was distributed to a 96-well ELISA plate (IWAKI). It was poured and left at 4 ° C for coating.

[0052] After washing the coated plate with PBS-T buffer, a blocking solution added to PBS-T buffer was added to the plate so that the serum albumin had a final concentration of 3% (w / v). The mixture was allowed to stand at 37 ° C for 1 hour to perform a blocking treatment. [0053] After blocking treatment, washing with PBS-T buffer, antibody dilution diluted in PBS-T buffer to a final concentration of 0.3% (w / v) in PBS-T buffer, 100 times The serum, which had been serially diluted 2-fold from 1 to 51,200-fold, was dispensed to the plate and allowed to stand at 37 ° C. for 1 hour to react with the antibody. After washing this plate with PBS-T buffer, dispense 12,000-fold HRPO-labeled anti-Petori IgG (from ZYMED) diluted with antibody diluent into the plate, and incubate at 37 ° C for 1 hour. Reacted. After washing this plate with PBS-T buffer, the substrate solution (containing 14.6 g of disodium hydrogen phosphate, 10.2 g of citric acid monohydrate, 1-g of 0-phenylenediamine and lm L of hydrogen peroxide in 1 L) ) Was added to the plate, and allowed to stand at 37 ° C. for 15 minutes to react. After stopping the reaction with a stop solution (5N sulfuric acid aqueous solution), the absorbance value of A492 was measured with a microplate reader (using Coron a MTP-120).

FIG. 3 shows the results of this test. From FIG. 3, it was confirmed that, in all the chickens tested, after the oral administration of the R7 gene-transferred potato leaves, the antibody re-induction against leukocytozone's second generation schizont of Cowlery was confirmed. In particular, the higher the level of antibody titer at the start of the test, the more marked the increase.

Industrial potential

According to the present invention, (1) a plant cell expression vector containing a gene encoding a protozoan disease protective antigen, and (2) a transformed plant into which a gene encoding a protozoal disease protective antigen has been introduced. Cells, (3) a transformed plant containing the transformed plant cell and a transformed plant that is a progeny or clone thereof, (4) a propagation material of the transformed plant, (5) the transformed plant or a transformant thereof. (6) a step of isolating a protozoan disease protective antigen from the transformed plant cell, the transformed plant body, or the propagated material, Production method, and (7) Orally administering the above-mentioned transformed plant cell, transformed plant, propagation material, or a processed or extracted product thereof, or a protozoan disease protective antigen obtained by the above-mentioned method to an animal. The animal against protozoa How to confer immunity is provided. This has made it possible to develop an antiprotozoal disease vaccine that is excellent in cost performance and can be easily administered.

Claims

The scope of the claims

[1] A vector containing a gene encoding a protozoan disease onset protective antigen operably linked downstream of a promoter translatable in plant cells.

[2] A transformed plant cell into which a gene encoding a protozoan disease protective antigen has been introduced.

[3] A transformed plant comprising the transformed plant cell according to claim 2.

[4] A transformed plant which is a progeny or a clone of the transformed plant according to claim 3.

[5] A propagation material for the transformed plant according to claim 3 or 4.

[6] The processed product or extract of the transformant according to claim 3 or 4, which comprises a protozoan disease protective antigen.

[7] The transformed plant cell according to claim 2, and the transformed plant according to claim 3 or 4.

A method for producing a protozoan disease protective antigen, comprising a step of isolating a protozoan disease protective antigen from the propagation material according to claim 5.

[8] The transformed plant cell according to claim 2, and the transformed plant according to claim 3 or 4.

The step of orally administering to the animal the protozoal disease onset protective antigen obtained by the propagation material according to claim 5, the processed product or extract according to claim 6, or the method according to claim 7. A method for conferring immunity against a protozoan on said animal.

[9] The transformed plant cell according to claim 2, and the transformed plant according to claim 3 or 4.

An anti-protozoan disease oral vaccine comprising the propagation material according to claim 5, the processed product or extract according to claim 6, or the protozoan disease protective antigen obtained by the method according to claim 7. .