WO2005116010A1 - Ep4 receptor agonist, compositions and methods thereof - Google Patents

Ep4 receptor agonist, compositions and methods thereof Download PDF

Info

Publication number
WO2005116010A1
WO2005116010A1 PCT/CA2005/000773 CA2005000773W WO2005116010A1 WO 2005116010 A1 WO2005116010 A1 WO 2005116010A1 CA 2005000773 W CA2005000773 W CA 2005000773W WO 2005116010 A1 WO2005116010 A1 WO 2005116010A1
Authority
WO
WIPO (PCT)
Prior art keywords
ethyl
oxy
phenyl
chloro
bromo
Prior art date
Application number
PCT/CA2005/000773
Other languages
French (fr)
Inventor
Michel Belley
John Colucci
Mario Girard
Yongxin Han
Patrick Lacombe
Original Assignee
Merck Frosst Canada Ltd.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Merck Frosst Canada Ltd. filed Critical Merck Frosst Canada Ltd.
Publication of WO2005116010A1 publication Critical patent/WO2005116010A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C65/00—Compounds having carboxyl groups bound to carbon atoms of six—membered aromatic rings and containing any of the groups OH, O—metal, —CHO, keto, ether, groups, groups, or groups
    • C07C65/21—Compounds having carboxyl groups bound to carbon atoms of six—membered aromatic rings and containing any of the groups OH, O—metal, —CHO, keto, ether, groups, groups, or groups containing ether groups, groups, groups, or groups
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C63/00—Compounds having carboxyl groups bound to a carbon atoms of six-membered aromatic rings
    • C07C63/33—Polycyclic acids
    • C07C63/331—Polycyclic acids with all carboxyl groups bound to non-condensed rings
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C63/00—Compounds having carboxyl groups bound to a carbon atoms of six-membered aromatic rings
    • C07C63/66—Polycyclic acids with unsaturation outside the aromatic rings
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C65/00—Compounds having carboxyl groups bound to carbon atoms of six—membered aromatic rings and containing any of the groups OH, O—metal, —CHO, keto, ether, groups, groups, or groups
    • C07C65/21—Compounds having carboxyl groups bound to carbon atoms of six—membered aromatic rings and containing any of the groups OH, O—metal, —CHO, keto, ether, groups, groups, or groups containing ether groups, groups, groups, or groups
    • C07C65/24—Compounds having carboxyl groups bound to carbon atoms of six—membered aromatic rings and containing any of the groups OH, O—metal, —CHO, keto, ether, groups, groups, or groups containing ether groups, groups, groups, or groups polycyclic
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C65/00—Compounds having carboxyl groups bound to carbon atoms of six—membered aromatic rings and containing any of the groups OH, O—metal, —CHO, keto, ether, groups, groups, or groups
    • C07C65/21—Compounds having carboxyl groups bound to carbon atoms of six—membered aromatic rings and containing any of the groups OH, O—metal, —CHO, keto, ether, groups, groups, or groups containing ether groups, groups, groups, or groups
    • C07C65/28—Compounds having carboxyl groups bound to carbon atoms of six—membered aromatic rings and containing any of the groups OH, O—metal, —CHO, keto, ether, groups, groups, or groups containing ether groups, groups, groups, or groups having unsaturation outside the aromatic rings
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D213/00—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members
    • C07D213/02—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members
    • C07D213/04—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen or carbon atoms directly attached to the ring nitrogen atom
    • C07D213/60—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen or carbon atoms directly attached to the ring nitrogen atom with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C07D213/61—Halogen atoms or nitro radicals
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D213/00—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members
    • C07D213/02—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members
    • C07D213/04—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen or carbon atoms directly attached to the ring nitrogen atom
    • C07D213/60—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen or carbon atoms directly attached to the ring nitrogen atom with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C07D213/62—Oxygen or sulfur atoms
    • C07D213/63—One oxygen atom
    • C07D213/64—One oxygen atom attached in position 2 or 6
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D213/00—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members
    • C07D213/02—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members
    • C07D213/04—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen or carbon atoms directly attached to the ring nitrogen atom
    • C07D213/60—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen or carbon atoms directly attached to the ring nitrogen atom with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C07D213/62—Oxygen or sulfur atoms
    • C07D213/63—One oxygen atom
    • C07D213/65—One oxygen atom attached in position 3 or 5
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D257/00—Heterocyclic compounds containing rings having four nitrogen atoms as the only ring hetero atoms
    • C07D257/02—Heterocyclic compounds containing rings having four nitrogen atoms as the only ring hetero atoms not condensed with other rings
    • C07D257/04—Five-membered rings
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D333/00—Heterocyclic compounds containing five-membered rings having one sulfur atom as the only ring hetero atom
    • C07D333/02—Heterocyclic compounds containing five-membered rings having one sulfur atom as the only ring hetero atom not condensed with other rings
    • C07D333/04—Heterocyclic compounds containing five-membered rings having one sulfur atom as the only ring hetero atom not condensed with other rings not substituted on the ring sulphur atom
    • C07D333/26—Heterocyclic compounds containing five-membered rings having one sulfur atom as the only ring hetero atom not condensed with other rings not substituted on the ring sulphur atom with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C07D333/38—Carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals
    • C07D333/40—Thiophene-2-carboxylic acid
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D401/00—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom
    • C07D401/02—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings
    • C07D401/10—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings linked by a carbon chain containing aromatic rings
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D401/00—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom
    • C07D401/02—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings
    • C07D401/12—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings linked by a chain containing hetero atoms as chain links
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D401/00—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom
    • C07D401/14—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing three or more hetero rings
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D409/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having sulfur atoms as the only ring hetero atoms
    • C07D409/02—Heterocyclic compounds containing two or more hetero rings, at least one ring having sulfur atoms as the only ring hetero atoms containing two hetero rings
    • C07D409/06—Heterocyclic compounds containing two or more hetero rings, at least one ring having sulfur atoms as the only ring hetero atoms containing two hetero rings linked by a carbon chain containing only aliphatic carbon atoms
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D409/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having sulfur atoms as the only ring hetero atoms
    • C07D409/14—Heterocyclic compounds containing two or more hetero rings, at least one ring having sulfur atoms as the only ring hetero atoms containing three or more hetero rings
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D413/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms
    • C07D413/02—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms containing two hetero rings
    • C07D413/06—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms containing two hetero rings linked by a carbon chain containing only aliphatic carbon atoms
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D413/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms
    • C07D413/14—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms containing three or more hetero rings

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

This invention relates to potent selective agonists of the EP4 subtype of prostaglandin E2 receptors, their use or a formulation thereof in the treatment of glaucoma and other conditions, which are related to elevated intraocular pressure in the eye of a patient. This invention further relates to the use of the compounds of this invention for mediating the bone modeling and remodeling processes of the osteoblasts and osteoclasts.

Description

TITLE OF THE INVENTION
EP4 RECEPTOR AGONIST, COMPOSITIONS AND METHODS THEREOF
This Application claims the benefit of U.S. Provisional Application 60/574,653, filed May 26, 2004.
BACKGROUND OF THE INVENTION Glaucoma is a degenerative disease of the eye wherein the intraocular pressure is too high to permit normal eye function. As a result, damage may occur to the optic nerve head and result in irreversible loss of visual function. If untreated, glaucoma may eventually lead to blindness. Ocular hypertension, i.e., the condition of elevated intraocular pressure without optic nerve head damage or characteristic glaucomatous visual field defects, is now believed by the majority of ophthalmologists to represent merely the earliest phase in the onset of glaucoma. Many of the drugs formerly used to treat glaucoma proved unsatisfactory. Current methods of treating glaucoma include using therapeutic agents such as pilocarpine, carbonic anhydrase inhibitors, beta-blockers, prostaglandins and the like. However, these therapies often produce undesirable local effects. As can be seen, there are several current therapies for treating glaucoma and elevated intraocular pressure, but the efficacy and the side effect profiles of these agents are not ideal. Therefore, there still exists the need for new and effective therapies with little or no side effects. A variety of disorders in humans and other mammals involve or are associated with abnormal or excessive bone loss. Such disorders include, but are not limited to, osteoporosis, glucocorticoid induced osteoporosis, Paget's disease, abnormally increased bone turnover, periodontal disease, tooth loss, bone fractures, rheumatoid arthritis, periprosthetic osteolysis, osteogenesis imperfecta, metastatic bone disease, hypercalcemia of malignancy, and multiple myeloma. One of the most common of these disorders is osteoporosis, which in its most frequent manifestation occurs in postmenopausal women. Prostaglandins such as the PGE2 series are known to stimulate bone formation and increase bone mass in mammals, including man. It is believed that the four different receptor subtypes, designated EPj , EP2, EP3, and EP4 are involved in mediating the bone modeling and remodeling processes of the osteoblasts and osteoclasts. The major prostaglandin receptor in bone is EP4, which is believed to provide its effect by signaling via cyclic AMP. In the present invention it is found that the formula I agonists of the EP4 subtype receptor may be useful for stimulating bone formation. WO 02/24647, WO
02/42268, EP 1114816, WO 01/46140 and WO 01/72268 disclose EP4 agonists. However, they do not disclose the compounds of the instant invention. See also US Patent Nos. 5,530,157, 5,834,468 and
5,811,459 and EP 0,752,421 which disclose certain compounds and their use as anti-inflammatory agents. SUMMARY OF THE INVENTION This invention relates to agonists of the EP4 subtype of prostaglandin E2 receptors and their use or a formulation thereof in the treatment of glaucoma and other conditions that are related to elevated intraocular pressure in the eye of a patient. In particular, this invention relates to a series of p- phenylalkylbenzoic acid derivatives and their use to treat ocular diseases and to provide a neuroprotective effect to the eye of mammalian species, particularly humans. This invention further relates to the use of the compounds of this invention for mediating the bone modeling and remodeling processes of the osteoblasts and osteoclasts. More particularly, this invention relates to novel EP4 agonist having the structural formula I:
Figure imgf000003_0001
FORMULA I or a pharmaceutically acceptable salt, enantiomer, diastereomer, prodrug or mixture thereof, wherein,
Zi represents C-Wi , or N;
W, Wi and X independently are H, NR4R4, or halogen;
Y represents hydrogen, halogen, Ci-4 alkoxy, Ci-4 alkyl, C2-4 alkenyl, aryl, heterocyclyl, C3-6 cycloalkyl, NO2 or CF3, said alkyl, alkenyl, aryl and heterocyclyl optionally substituted with 1-3 groups of Rio;
Ri and R2 independently are H, halogen, or Cι_4 alkyl;
or Ri and R2 may optionally be linked together to form a 3 to 5 membered carbon ring optionally interrupted with 1-2 heteroatoms chosen from O, S, SO, SO2, and NR9'.
R3 represents Ri or OH or R3 and Ri attached to the same carbon may form a carbonyl group;
Q is CO2R4, tetrazolyl, SO3R4, -CF2SO2NH2, -SO2NH2. CONΗSO2R5, SO2NHCOR7, -PO(OH)2, CONHPO2R6, CONHR8, -COCH2OH, or heterocyclyl containing acidic hydroxyl groups, said heterocyclyl unsubstituted or substituted with 1 to 3 groups of R)θ; Ari represents phenyl, pyridinyl or thienyl provided that the two substituents (CRιR2)n and (CRιR2)m are para to each other for phenyl and pyridinyl or on the 2,5-positions of the thienyl; said Ari optionally substituted with 1-3 groups of RiO;
Aτ2 represents 2,l,3-benzoxadiazol-5-yl, phenyl, pyridyl or thienyl, optionally substituted with 1-3 groups selected from halogen, Ci-6 alkyl, OCι_6 alkyl, CO2H, SCi-6 alkyl, CF3, OCF3, and SCF3;
R4 represents H or Ci-6 alkyl;
R5, Rβ, R7 and Rs represents Ci-6 alkyl, CF3, aryls, heteroaryls, heterocyclyls, ZAryl or Zheteroaryl, said aryls, heteroaryls, heterocyclyls being unsubstituted or substituted with 1 to 3 groups of Ri O;
Z is an optional linker containing 0-4 carbon atoms, optionally substituted with Ci-4 alkyl;
R9 represents hydrogen, Ci-6 alkyl, said alkyl optionally substituted with 1-3 halogen, CN, OH, Ci-6 alkoxy, Ci-6 acyloxy or amino;
RiO represents halogen, C\. alkoxy, -6 alkyl, CF3, cyano, aryls, heteroaryls, heterocyclyls, SCi-6 alkyl, SC6-10 aryl, SC5-10 heterocyclyl, OC6-10 aryl, OC5-10 heterocyclyl, CH2OC1-6 alkyl, CH2S - 6 alkyl, CH2θaryl, CH2Saryl;
m represents 2 or 3; n represents 0 or 1; and p represents 0-2.
This and other aspects of the invention will be realized upon inspection of the invention as a whole.
DETAILED DESCRIPTION OF THE INVENTION The invention is described herein in detail using the terms defined below unless otherwise specified. The term "therapeutically effective amount", as used herein, means that amount of the
EP4 receptor subtype agonist of formula I, or other actives of the present invention, that will elicit the desired therapeutic effect or response or provide the desired benefit when administered in accordance with the desired treatment regimen. A preferred therapeutically effective amount relating to the treatment of abnormal bone resorption is a bone formation, stimulating amount. Likewise, a preferred therapeutically effective amount relating to the treatment of ocular hypertension or glaucoma is an amount effective for reducing intraocular pressure and/or treating ocular hypertension and/or glaucoma. "Pharmaceutically acceptable" as used herein, means generally suitable for administration to a mammal, including humans, from a toxicity or safety standpoint. The term "prodrug" refers to compounds which are drug precursors which, following administration and absorption, release the claimed drug in vivo via some metabolic process. A non- limiting example of a prodrug of the compounds of this invention would be an ester of the carboxylic acid group, where this ester functionality has a structure that makes it easily hydrolyzed after administration to a patient. The term "alkyl" refers to a monovalent alkane (hydrocarbon) derived radical containing from 1 to 10 carbon atoms unless otherwise defined. It may be straight, branched or cyclic. Preferred alkyl groups include methyl, ethyl, propyl, isopropyl, butyl, t-butyl, cyclopentyl and cyclohexyl. When the alkyl group is said to be substituted with an alkyl group, this is used interchangeably with "branched alkyl group". Cycloalkyl is a species of alkyl containing from 3 to 15 carbon atoms, without alternating or resonating double bonds between carbon atoms. It may contain from 1 to 4 rings, which are fused.
Examples of cycloalkyl groups are cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, and cycloheptyl. Alkoxy refers to Cj-Cg alkyl-O-, with the alkyl group optionally substituted as described herein. Examples of alkoxy groups are methoxy, ethoxy, propoxy, butoxy and isomeric groups thereof. Halogen (halo) refers to chlorine, fluorine, iodine or bromine. Aryl refers to aromatic rings e.g., phenyl, substituted phenyl and the like, as well as rings which are fused, e.g., naphthyl, phenanthrenyl and the like. An aryl group thus contains at least one ring having at least 6 atoms, with up to five such rings being present, containing up to 22 atoms therein, with alternating (resonating) double bonds between adjacent carbon atoms or suitable heteroatoms. The preferred aryl groups are phenyl, naphthyl and phenanthrenyl. Aryl groups may likewise be substituted as defined. Preferred substituted aryls include phenyl and naphthyl. The term "heterocycloalkyl" refers to a cycloalkyl group (nonaromatic) having 3 to 10 carbon atoms in which one of the carbon atoms in the ring is replaced by a heteroatom selected from O, S or N, and in which up to three additional carbon atoms may be replaced by hetero atoms. The term "cycloalkyl" refers to a cyclic alkyl group (nonaromatic) having 3 to 10 carbon atoms. The term "heteroatom" means O, S or N, selected on an independent basis. The term "heteroaryl" refers to a monocyclic aromatic hydrocarbon group having 5 or 6 ring atoms, or a bicyclic aromatic group having 8 to 10 atoms, containing at least one heteroatom, O, S or N, in which a carbon or nitrogen atom is the point of attachment, and in which one or two additional carbon atoms is optionally replaced by a heteroatom selected from O or S, and in which from 1 to 3 additional carbon atoms are optionally replaced by nitrogen heteroatoms, said heteroaryl group being optionally substituted as described herein. Examples of this type are pyrrole, pyridine, oxazole, thiazole, tetrazole, and oxazine. For purposes of this invention the tetrazole includes all tautomeric forms. Additional nitrogen atoms may be present together with the first nitrogen and oxygen or sulfur, giving, e.g., thiadiazole. The term heterocyclyl or heterocyclic, as used herein, represents a stable 5- to 7-membered monocyclic or stable 8- to 11-membered bicyclic heterocyclic ring which is either saturated or unsaturated, and which consists of carbon atoms and from one to four heteroatoms selected from the group consisting of N, O, and S, and including any bicyclic group in which any of the above-defined heterocyclic rings is fused to a benzene ring. The heterocyclic ring may be attached at any heteroatom or carbon atom, which results in the creation of a stable structure. A fused heterocyclic ring system may include carbocyclic rings and need include only one heterocyclic ring. The term heterocycle or heterocyclic includes heteroaryl moieties. Examples of such heterocyclic elements include, but are not limited to, azepinyl, benzimidazolyl, benzisoxazolyl, benzofurazanyl, benzopyranyl, benzothiopyranyl, benzofuryl, benzothiazolyl, benzothienyl, benzoxazolyl, chromanyl, cinnolinyl, dihydrobenzofuryl, dihydrobenzothienyl, dihydrobenzothiopyranyl, dihydrobenzothiopyranyl sulfone, 1 ,3-dioxolanyl, furyl, imidazolidinyl, imidazolinyl, imidazolyl, indolinyl, indolyl, isochromanyl, isoindolinyl, isoquinolinyl, isothiazolidinyl, isothiazolyl, isothiazolidinyl, morpholinyl, naphthyridinyl, oxadiazolyl, 2-oxoazepinyl, oxazolyl, 2-oxopiperazinyl, 2-oxopiperdinyl, 2-oxopyrrolidinyl, piperidyl, piperazinyl, pyridyl, pyrazinyl, pyrazolidinyl, pyrazolyl, pyridazinyl, pyrimidinyl, pyrrolidinyl, pyrrolyl, quinazolinyl, quinolinyl, quinoxalinyl, tetrahydrofuryl, tetrahydroisoquinolinyl, tetrahydroquinolinyl, tetrazolyl, thiamorpholinyl, thiamorpholinyl sulfoxide, thiazolyl, thiazolinyl, thienofuryl, thienothienyl, thienyl, and triazolyl.
For purposes of this invention, heterocyclyls containing acidic hydroxyl groups are those heterocyclyl groups that have an acidic hydroxy atom and can have a pKa in the range of 3 to 7. Non- limiting examples of heterocyclyls containing acidic hydroxyl groups are:
Figure imgf000007_0001
O G is -C(RC), jj-°Rd . -N(Re), O, or S and each Rc independently is H, fluorine, cyano or C^ alkyl; each Rd independently is H, C^.4 alkyl, or a pharmaceutically acceptable cation; each Re independently is H, -C(=0)-Rf, or -S02Rf, wherein Rf is C1.4 linear alkyl or phenyl
The term "EP4 agonist" as used herein means EP4 subtype compounds of formula I that interact with the EP4 receptor to produce maximal, super maximal or submaximal effects compared to the natural agonist, PGE2. See Goodman and Gilman, The Pharmacological Basis of Therapeutics, 9th edition, 1996, chapter 2. One embodiment of this invention is realized when p=n=0 and all other variables are as originally described. Another embodiment of this invention is realized when Z\ is C-Wi and all other variables are as originally described. Another embodiment of this invention is realized when Z\ is N and all other variables are as originally described.
Another embodiment of this invention is realized when Ar2 is phenyl or pyridyl, substituted in ortho and or meta position relative to O-CRιR2-(CRιR3)p with one or more halogen, OMe, OCF3 or SCF3 and all other variables are as originally described. A sub-embodiment of this invention is realized when Y is chloride, bromide, iodide or Ci-4 alkyl. Another sub-embodiment is realized when the pyridyl of Ar2 is 4-pyridyl. Another embodiment of this invention is realized when Ar) is phenyl, thienyl, and all other variables are as originally described. A subembodiment of this invention is realized when Y is chloride, bromide methyl or ethyl. Another embodiment of this invention is realized when W and Wi are hydrogen and all other variables are as originally described. Another embodiment of this invention is realized when Q is CO2R4 or tetrazolyl and all other variables are as originally described. Another embodiment of this invention is realized when R{ and R2 are H and all other variables are as originally described. Another embodiment of this invention is realized when (O)o-ι-CR]R2-(CRιR3)p -Ar2 is O-(CH2)ι-3-Ar2 and all other variables are as originally described. Another embodiment of this invention is realized when (CRιR2)m is CH2CH2 or 1,2- cyclopropyl and all other variables are as originally described. Another embodiment of this invention is realized when (O)θ-l-CRιR2-
(CRιR3)p-Ar2 is CH2CH2Ar2 Examples of compounds of this invention are:
4-{2-[2-(benzyloxy)-3-ethoxyphenyl]ethyl }benzoic acid;
4-{ 2-[2-(benzyloxy)-3-bromo-5-chlorophenyI]ethyl }benzoic acid; sodium 4-{ 2-[2-(benzyloxy)-3-ethoxyphenyl]ethyl } benzoate; sodium 4-{2-[2-(benzyloxy)-3-bromo-5-chlorophenyl]ethyl}benzoate;
4-{ 2-[2-(benzyloxy)-3,5-dichlorophenyl]ethyl Jbenzoic acid;
4-(2-{ 3-bromo-5-chloro-2-[(3-methoxybenzyl)oxy]phenyl }ethyl)benzoic acid;
4-{ 2-[3-bromo-5-chloro-2-(2-phenylethoxy)phenyl]ethyl Jbenzoic acid;
5-(4-{2-[2-(benzyloxy)-3,5-dichlorophenyl]ethyl}phenyl)-lH-tetrazole;
4-[2-(3-bromo-5-chloro-2-{ [3-(trifluoromethyl)benzyl]oxy}phenyl)ethyl]benzoic acid;
5-[4-(2-{3-bromo-5-chloro-2-[(3-methoxybenzyl)oxy]phenyl}ethyl)phenyl]-lH-tetrazole;
4-(2-{ 3-methoxy-2-[(3-methoxybenzyl)oxy]phenyl }ethyl)benzoic acid;
4-(2-{3-bromo-2-[(3-bromobenzyl)oxy]-5-chlorophenyl}ethyl)benzoic acid;
4-(2-{ 2-[(3-methoxybenzyl)oxy]-3-methylphenyl }ethyl)benzoic acid;
4-(2-{ 3-bromo-5-chloro-2-[(5-chloro-2-fluorobenzyl)oxy]phenyl }ethyl)benzoic acid;
4-(2-{ 3-bromo-5-chloro-2-[(3-methylbenzyl)oxy]phenyl }ethyl)benzoic acid;
4-(2-{ 3-bromo-5-chloro-2-[(2,4-difluorobenzyl)oxy]phenyl }ethyl)benzoic acid;
4-{2-[3-bromo-5-chloro-2-(2-oxo-2-phenylethoxy)phenyl]ethyl Jbenzoic acid;
4-(2-{3-bromo-5-chloro-2-[(2-fluoro-3-methylbenzyl)oxy]phenyl}ethyl)benzoic acid; 2-(3-bromo-5-chloro-2-{ [2-fluoro-3-(trifluoromethyl)benzyl]oxy }phenyl)-ethyl]benzoic acid; 2-{ 3-bromo-5-chloro-2-[(2-chloro-4-fluorobenzyl)oxy]phenyl }ethyl)benzoic acid; 2-{ 3-bromo-5-chloro-2-[(2,4,5-trifluorobenzyl)oxy]phenyl }ethyl)benzoic acid; 2-{ 3-bromo-5-chloro-2-[(3-chloro-2-fluorobenzyl)oxy]phenyl }ethyl)benzoic acid;-ι 2-{ 3-bromo-5-chloro-2-[(3,5-dimethylbenzyl)oxy]phenyl } ethyl )benzoic acid;-ι 2-{3-bromo-5-chloro-2-[(3,5-difluorobenzyl)oxy]phenyl}ethyl)benzoic acid;- 2-{ 3-bromo-5-chloro-2-[(3,4-difluorobenzyl)oxy]phenyl }ethyl)benzoic acid;- 2-(3-bromo-5-chloro-2-{ [3-(trifluoromethoxy)benzyl]oxy }phenyl)ethyl]benzoic acid;- 2-{ 3-bromo-5-chloro-2-[(3-iodobenzyl)oxy]phenyl }ethyl)benzoic acid; 2-{ 3-bromo-5-chloro-2-[(3-fluorobenzyl)oxy]phenyl } ethyl )benzoic acid; 2-[2-(2, 1 ,3-benzoxadiazol-5-ylmethoxy)-3-bromo-5-chlorophenyl]ethyl Jbenzoic acid; 2-{3-bromo-5-chloro-2-[(4-fluorobenzyl)oxy]phenyl}ethyl)benzoic acid; {2-bromo-6-[2-(4-carboxyphenyl)ethyl]-4-chlorophenoxy}methyl)benzoic acid; 2-(3-bromo-5-chloro-2-{ [2-(trifluoromethyl)benzyl]oxy }phenyl)ethyl]benzoic acid; 2-{ 3-bromo-5-chloro-2-[(2-iodobenzyl)oxy]phenyl }ethyl)benzoic acid; 2-{ 3-bromo-5-chloro-2-[(2-methylbenzyl)oxy]phenyl }ethyl)benzoic acid; 2-{ 3-bromo-2-[(2-bromobenzyl)oxy]-5-chlorophenyl }ethyl)benzoic acid; 2-{ 3-bromo-5-chloro-2-[(2-fluorobenzyl)oxy]phenyl }ethyl)benzoic acid; 2-{ 3-bromo-5-chloro-2-[(2-chlorobenzyl)oxy]phenyl }ethyl)benzoic acid; 2-{ 3-bromo-5-chloro-2-[(3,5-dimethoxybenzyl)oxy]phenyl }ethyl)benzoic acid; 2-{ 3-bromo-5-chloro-2-[(2,3,5-trifluorobenzyl)oxy]phenyl } ethyl)benzoic acid;-ι 2-{ 3-bromo-5-chloro-2-[(2,6-dichloropyridin-4-yl)methoxy]phenyl }ethyl)benzoic acid; 2-{ 3,5-dichloro-2-[2-(2-fluorophenyl)ethyl]phenyl }ethyl)benzoic acid;- 2-[2-(benzyloxy)-3,5-dichlorophenyl]ethyl}thiophene-2 -carboxylic acid;- 2-[3-bromo-5-chloro-2-(2-hydroxy-2-phenylethoxy)phenyl]ethyl Jbenzoic acid;-ι 3-{3,5-dichloro-2-[(3-methoxybenzyl)oxy]phenyl}prop-2-en-l-yl)benzoic acid;-ι 3-{3,5-dichloro-2-[(3-methoxybenzyl)oxy]phenyl}propyl)benzoic acid; 2-{2-[(3-methoxybenzyl)oxy]pyridin-3-yl}ethyl)benzoic acid; 2-{4,6-dibromo-3-[(3,5-dimethoxybenzyl)oxy]pyridin-2-yl}ethyl)benzoic acid; 2-{4,6-dibromo-3-[(2,6-dichloropyridin-4-yl)methoxy]pyridin-2-yl}ethyl)benzoic acid;-ι 2-{4-ethyl-3-[(3-methoxybenzyl)oxy]pyridin-2-yl }ethyl)benzoic acid; 2-{6-bromo-3-[(3,5-dimethoxybenzyl)oxy]pyridin-2-yl}ethyl)benzoic acid; ' (3 -methoxybenzyl)oxy ] -2- { 2-[4-( 1 H-tetrazol-5-yl)phenyl]ethyl } pyridine;- 2-{4-chloro-3-[(3,5-dimethoxybenzyl)oxy]pyridin-2-yl }ethyl)benzoic acid; 4-(2-{ 3-[(3-methoxybenzyl)oxy]pyridin-2-yl } ethyl )benzoic acid;
4-(2-{ 3-[(3,5-dimethoxybenzyl)oxy]pyridin-2-yl }ethyl)benzoic;
4-(2-{4-isopropyl-3-[(3-methoxybenzyl)oxy]pyridin-2-yl}ethyl)benzoic acid;
4-(2-{ 3-[(3-methoxybenzyl)oxy]-4-methylpyridin-2-yl }ethyl)benzoic acid;
4-chloro-3-[3,5-dimethoxybenzyl)oxy]-2-{2-[4-(lH-tetrazol-5-yl)phenyl]ethyl}pyridine;
4-(2-{3-bromo-5-chloro-2-[(3,5-dimethoxybenzyl)oxy]phenyl}ethyl)benzamide;
5-[4-(2-{3-bromo-5-chloro-2-[(3,5-dimethoxybenzyl)oxy]phenyl}ethyl)phenyl]-lH-tetrazole;
5-[4-(2-{5-chloro-2-[(3,5-dimethoxybenzyl)oxy]biphenyl-3-yl}ethyl)phenyl]-lH-tetrazole;
5-[4-(2-{5-chloro-3-cyclopropyl-2-[(3,5-dimethoxybenzyl)oxy]phenyl}ethyl)phenyl]-lH-tetrazole;
4-(2-{5-chloro-2-[(3,5-dimethoxybenzyl)oxy]biphenyl-3-yl}ethyl)benzoic acid;
4-chloro-3-[(3,5-dimethoxybenzyl)oxy]-2-{2-[4-(lH-tetrazol-5-yl)phenyl]ethyl}pyridine; isopropyl 4-(2-{4-chloro-3-[(3,5-dimethoxybenzyl)oxy]pyridin-2-yl}ethyl)benzoate; ethyl 4-(2-{4-chloro-3-[(3,5-dimethoxybenzyl)oxy]pyridin-2-yl}ethyl)benzoate; benzyl 4-(2-{4-chloro-3-[(3,5-dimethoxybenzyl)oxy]pyridin-2-yl}ethyl)benzoate;
3-[(3,5-dimethoxybenzyl)oxy]-4-methoxy-2-{ 2-[4-( lH-tetrazol-5-yl)phenyl]ethyl Jpyridine;
3-[(3,5-dimethoxybenzyl)oxy]-4-isopropoxy-2-{2-[4-(lH-tetrazol-5-yl)phenyl]ethyl}pyridine;
4-isopropenyl-3-[(3-methoxybenzyl)oxy]-2-{(£)-2-[4-(lH-tetrazol-5-yl)phenyl] vinyl Jpyridine;
4-cyclopropyl-3-[(3-methoxybenzyl)oxy]-2-{(£)-2-[4-(lH-tetrazol-5-yl)phenyl]vinyl Jpyridine;
4-cyclopropyl-3-[(3-methoxybenzyl)oxy]-2-{2-[4-(lH-tetrazol-5-yl)phenyl]ethyl Jpyridine;
4-isopropyl-3-[(3-methoxybenzyl)oxy]-2-{(.ι)-2-[4-(lH-tetrazol-5-yl)phenyl]vinyl Jpyridine;
4-isopropyl-3-[(3-methoxybenzyl)oxy]-2-{2-[4-(lH-tetrazol-5-yl)phenyl]ethyl Jpyridine;
4-isopropyl-3-[(3-methoxybenzyl)oxy]-2-{2-[4-(lH-tetrazol-5-yl)phenyl]cyclopropyl Jpyridine;
3-[(3,5-dibromobenzyl)oxy]-4-isopropyl-2-{ 2-[4-( lH-tetrazol-5-yl)phenyl]ethyl Jpyridine;
3-[(2,6-dichloropyridin-4-yl)methoxy]-4-isopropyl-2-{2-[4-(lH-tetrazol-5-yl)phenyl]ethyl Jpyridine;
3-{[3,5-bis(trifluoromethyl)benzyl]oxy}-4-isopropyl-2-{2-[4-(lH-tetrazol-5-yl)phenyl]ethyl}pyridine;
3-[(3,5-dimethoxybenzyl)oxy]-4-isopropyl-2-{2-[4-(lH-tetrazol-5-yl)phenyl]ethyl Jpyridine;
3-[(3,5-dichlorobenzyl)oxy]-4-isopropyl-2-{2-[4-(lH-tetrazol-5-yl)phenyl]ethyl Jpyridine;
3-{ [3-(difluoromethoxy)benzyl]oxy } -4-isopropyl-2-{ 2-[4-( lH-tetrazol-5-yl)phenyl]ethyl Jpyridine;
3-[(3,5-difluorobenzyl)oxy]-4-isopropyl-2-{2-[4-(lH-tetrazol-5-yl)phenyl]ethyl Jpyridine;
6-bromo-3-[(3,5-dichlorobenzyl)oxy]-4-isopropyl-2-{2-[4-(lH-tetrazol-5-yl)phenyl]ethyl Jpyridine;
6-bromo-3-[(3,5-dibromobenzyl)oxy]-4-isopropyl-2-{2-[4-(lH-tetrazol-5-yl)phenyl]ethyl Jpyridine;
5-[(3,5-dichlorobenzyl)oxyJ-4-isopropyl-NN-dimethyl-6-{2-[4-(lH-tetrazol-5-yl)phenyl]ethyl}pyridin-2- amine;
4-[(2-bromo-4-chloro-6-{2-[4-(lΗ-tetrazol-5-yl)phenyl]ethyl}phenoxy)methyl]methoxypyridine; 4-[(2-bromo-4-chloro-6-{2-[4-(lH-tetrazol-5-yl)phenyl]ethyl}phenoxy)methyl]-2,6-dichloropyridine; 5-[4-(2-{3-bromo-5-chloro-2-[2-(3,5-dimethoxyphenyl)ethyl]phenyl}ethyl)phenyl]-lH-tetrazole; 4-(3-{3-bromo-5-chloro-2-[(3,5-dimethoxybenzyl)oxy]phenyl}propyl)benzoic acid; 4-(3-{ 3-bromo-5-chloro-2-[(3,5-dimethoxybenzyl)oxy]phenyl }propyl)benzoic acid; 5-[4-(3-{3,5-dichloro-2-[(3,5-dimethoxybenzyl)oxy]phenyl}propyl)phenyl]-lH-tetrazole; 4-bromo-3-[(3,5-dimethoxybenzyl)oxy]-2-{ 2-[4-( lH-tetrazol-5-yl)phenyl]ethyl Jpyridine; 4-(2-{4-bromo-3-[2-(3,5-dimethoxyphenyl)ethyl]pyridin-2-yl}ethyl)benzoic acid; 4-(2-{4-bromo-3-[2-(3,5-dimethoxyphenyl)ethyl]pyridin-2-yl}ethyl)benzoic acid; 4-(2-{ 2-[(3-methoxybenzyl)oxy]pyridin-3-yl}ethyl)benzoic acid;
5-[4-(2-{3-bromo-5-chloro-2-[(3,5-dimethoxybenyl)oxy]phenylJethyl)phenyl]-lH-tetrazole; 4-(2-{4-chloro-3-[(3,5-dimethoxybenyl)oxy]pyridin-2-ylJethyl)benzoic acid; 4-(2-{4-ethyl-3-[(3-methoxybenyl)oxy]pyridin-2-yl}ethyl)benzoic acid; 4-chloro-3-[(3,5-dimethoxybenzyl)oxy]-2-{2-[4-(lH-tetrazol-5-yl)phenyl]ethyl Jpyridine;
or a pharmaceutically acceptable salt, enantiomer, diastereomer, prodrug or mixture thereof. Other examples of compounds of this invention are:
4-{2-[3-bromo-5-chloro-2-(2-hydroxy-3-phenylpropoxy)phenyl]
Figure imgf000011_0001
ethyl Jbenzoic acid
4-[(2-bromo-4-chloro-6-{ 2-[4-( lH-tetrazol-5- y l)phenyl]ethyl } phenoxy)methy 1] methoxypyridine
4-[(2-bromo-4-chloro-6-{2-[4-(lH-tetrazol-5-yl)phenyl]ethylJ phenoxy)methyl]-2,6-dichloropyridine
Figure imgf000011_0002
5-[4-(2-{3-bromo-5-chloro-2-[2-(3,5-dimethoxyphenyl)ethyl] phenyl } ethy l)pheny 1] - 1 H-tetrazole
Figure imgf000012_0001
4-(3-{ 3-bromo-5-chloro-2-[(3,5-dimethoxybenzyl)oxy]phenyl } propyl)benzoic acid
5-[4-(3- { 3 ,5-dichloro-2-[(3 ,5-dimethoxybenzyl)oxy]phenyl } propy l)phenyl] - 1 H-tetrazole
4-bromo-3-[(3,5-dimethoxybenzyl)oxy]-2-{2-[4-(lH-tetrazol-5-yl) phenyljethyl Jpyridine
4-(2-{4-bromo-3-[2-(3,5-dimethoxyphenyl)ethyl]pyridin-2-yl}ethyl) benzoic acid
4-(2-{2-[(3-methoxybenzyl)oxy]pyridin-3-yl}ethyl)benzoic acid
Figure imgf000012_0002
4-(2-{4,6-dibromo-3-[(2,6-dichloropyridin-4-yl)methoxy]pyridine- 2-yl}ethyl)benzoic acid
Figure imgf000013_0001
or a pharmaceutically acceptable salt, enantiomer, diastereomer, prodrug or mixture thereof. Another embodiment of this invention is directed to a composition containing an EP4 agonist of Formula I and optionally a pharmaceutically acceptable carrier. Yet another embodiment of this invention is directed to a method for decreasing elevated intraocular pressure or treating glaucoma by administration, preferably topical or intra-camaral administration, of a composition containing an EP4 agonist of Formula I and optionally a pharmaceutically acceptable carrier. Use of the compounds of formula I for the manufacture of a medicament for treating elevated intraocular pressure or glaucoma or a combination thereof is also included in this invention This invention is further concerned with a process for making a pharmaceutical composition comprising a compound of formula I. This invention is further concerned with a process for making a pharmaceutical composition comprising a compound of formula I, and a pharmaceutically acceptable carrier. The claimed compounds bind strongly and act on PGE2 receptor, particularly on the EP4 subtype receptor and therefore are useful for preventing and/or treating glaucoma and ocular hypertension. Dry eye is a common ocular surface disease afflicting millions of people. Although it appears that dry eye may result from a number of unrelated pathogenic causes, the common end result is the breakdown of the tear film, which results in dehydration of the exposed outer surface of the eye. (Lemp, Report of the Nation Eye Institute/Industry Workshop on Clinical Trials in Dry Eyes, The CLAO lournal, 21(4):221-231 (1995)). Functional EP4 receptors have been found in human conjunctival epithelial cells (see US Patent 6,344,477, incorporated by reference in its entirety) and it is appreciated that both human corneal epithelial cells (Progress in Retinal and Eye Research, 16:81-98(1997)) and conjunctival cells (Dartt et al. Localization of nerves adjacent to goblet cells in rat conjunctiva. Current Eye Research, 14:993-1000 (1995)) are capable of secreting mucins. Thus, the compounds of formula I are useful for treating dry eye. Macular edema is swelling within the retina within the critically important central visual zone at the posterior pole of the eye. It is believed that EP4 agonist which lower intraocular pressure (IOP) are useful for treating diseases of the macular such as macular edema or macular degeneration. Thus, another aspect of this invention is a method for treating macular edema or macular degeneration. Glaucoma is characterized by progressive atrophy of the optic nerve and is frequently associated with elevated intraocular pressure (IOP). It is possible to treat glaucoma, however, without necessarily affecting IOP by using drugs that impart a neuroprotective effect. See Arch. Ophthalmol. Vol. 112, Jan 1994, pp. 37-44; Investigative Ophthamol. & Visual Science, 32, 5, April 1991, pp. 1593-99. It is believed that EP4 agonist which lower IOP are useful for providing a neuroprotective effect. They are also believed to be effective for increasing retinal and optic nerve head blood velocity and increasing retinal and optic nerve oxygen by lowering IOP, which when coupled together benefits optic nerve health. As a result, this invention further relates to a method for increasing retinal and optic nerve head blood velocity, or increasing retinal and optic nerve oxygen tension or providing a neuroprotective effect or a combination thereof by using an EP4 agonist of formula I. The compounds produced in the present invention are readily combined with suitable and known pharmaceutically acceptable excipients to produce compositions which may be administered to mammals, including humans, to achieve effective IOP lowering. Thus, this invention is also concerned with compositions and methods of treating ocular hypertension, glaucoma, macular edema, macular degeneration, for increasing retinal and optic nerve head blood velocity, for increasing retinal and optic nerve oxygen tension, for providing a neuroprotective effect or for a combination thereof by administering to a patient in need thereof one of the compounds of formula I alone or in combination with one or more of the following active ingredients, a β-adrenergic blocking agent such as timolol, betaxolol, levobetaxolol, carteolol, levobunolol, a parasympathomimetic agent such as pilocarpine, a sympathomimetic agents such as epinephrine, iopidine, brimonidine, clonidine, para-aminoclonidine, a carbonic anhydrase inhibitor such as dorzolamide, acetazolamide, metazolamide or brinzolamide; COSOPT®, a Maxi-K channel blocker such as Penitrem A, paspalicine, charybdotoxin, iberiotoxin, Paxicillan, Aflitram, Verroculogen, and as disclosed in WO 03/105868 (USSN 60/389,205), WO 03/105724 (USSN 60/389,222), WO 03/105847 (USSN 60/458,981), USSN 60/424790, filed November 8, 2002 (Attorney docket 21260PV), USSN 60/424808, filed November 8, 2002 (Attorney docket 21281PV), USSN 09/765716, filed January 17, 2001, USSN 09/764738, filed January 17, 2001 and PCT publications WO 02/077168 and WO 02/02060863, all incorporated by reference in their entirety herein, and in particular Maxi-K channel blockers such as l-(l-isobutyl-6-methoxy-lH-indazol-3-yl)-2- methylpropan- 1 -one; 1 -[ 1 -(2,2-dimethylpropyl)-6-methoxy- 1 H-indazol-3-yl] -2-methylpropan- 1 -one; 1 - [ 1 -(cyclohexylmethy l)-6-methoxy- lH-indazol-3-y 1] -2-methylpropan- 1 -one; 1 -( 1 -hexyl-6-methoxy- 1 H- indazol-3-yl)-2-methylpropan-l-one; l-[l-(2-ethylhexyl)-6-methoxy-lH-indazol-3-yl]-2-methylpropan-l- one; l-(3-isobutyryl-6-methoxy-lH-indazol-l-yl)buan-2-one; l-(3-isobutyryl-6-methoxy-lH-indazol-l- yl)-3,3-dimethylbutan-2-one; l-(3-cyclopentylcarbonyl)-6-methoxy-lH-indazol-l-yl)-3,3-dimethylbutan- 2-one; l-(3,3-dimethyl-2-oxobutyl) -6-methoxy-lH-indazole-3-carboxylic acid; and l-[3-(3- hydroxypropanoyl) -6-methoxy-lH-indazol-l-yl]-3,3-dimethylbutan-2-one, a prostaglandin such as latanoprost, travaprost, unoprostone, rescula, S1033 (compounds set forth in US Patent Nos. 5,889,052; 5,296,504; 5,422,368; and 5,151,444); a hypotensive lipid such as lumigan and the compounds set forth in US Patent No. 5,352,708; a neuroprotectant disclosed in US Patent No. 4,690,931, particularly eliprodil and R-eliprodil as set forth in WO 94/13275, including memantine; and/or an agonist of 5-HT2 receptors as set forth in PCT/US00/31247, particularly l-(2-aminopropyl)-3-methyl-lH-imdazol-6-ol fumarate and 2-(3-chloro-6-methoxy-indazol-l-yl)-l-methyl-ethylamine. Use of the compounds of formula I for the manufacture of a medicament for treating ocular hypertension, glaucoma, macular edema, macular degeneration, for increasing retinal and optic nerve head blood velocity, for increasing retinal and optic nerve oxygen tension, for providing a neuroprotective effect or for a combination thereof is also included in this invention. The EP4 agonist used in the instant invention can be administered in a therapeutically effective amount intravaneously, subcutaneously, topically, transdennally, parenterally or any other method known to those skilled in the art. Ophthalmic pharmaceutical compositions are preferably adapted for topical administration to the eye in the form of solutions, suspensions, ointments, creams or as a solid insert. Ophthalmic formulations of this compound may contain from 0.0001 to 5% and especially 0.001 to 0.1% of medicament. Higher dosages as, for example, up to about 10% or lower dosages can be employed provided the dose is effective in reducing intraocular pressure, treating glaucoma, increasing blood flow velocity or oxygen tension. For a single dose, from between 0.05 ug to 5.0 mg, preferably 0.5 μg to 2.0 mg, and especially 0.001 to 1.0 mg of the compound can be applied to the human eye. The pharmaceutical preparation which contains the compound may be conveniently admixed with a non-toxic pharmaceutical organic carrier, or with a non-toxic pharmaceutical inorganic carrier. Typical of pharmaceutically acceptable carriers are, for example, water, mixtures of water and water-miscible solvents such as lower alkanols or aralkanols, vegetable oils, peanut oil, polyalkylene glycols, petroleum based jelly, ethyl cellulose, ethyl oleate, carboxymethyl-cellulose, polyvinylpyrrolidone, isopropyl myristate and other conventionally employed acceptable carriers. The pharmaceutical preparation may also contain non-toxic auxiliary substances such as emulsifying, preserving, wetting agents, bodying agents and the like, as for example, polyethylene glycols 200, 300, 400 and 600, carbowaxes 1,000, 1,500, 4,000, 6,000 and 10,000, antibacterial components such as quaternary ammonium compounds, phenylmercuric salts known to have cold sterilizing properties and which are non-injurious in use, thimerosal, methyl and propyl paraben, benzyl alcohol, phenyl ethanol, buffering ingredients such as sodium borate, sodium acetates, gluconate buffers, and other conventional ingredients such as sorbitan monolaurate, triethanolamine, oleate, polyoxyethylene sorbitan monopalmitylate, dioctyl sodium sulfosuccinate, monothioglycerol, thiosorbitol, ethylenediamine tetracetic acid, and the like. Additionally, suitable ophthalmic vehicles can be used as ca ier media for the present purpose including conventional phosphate buffer vehicle systems, isotonic boric acid vehicles, isotonic sodium chloride vehicles, isotonic sodium borate vehicles and the like. The pharmaceutical preparation may also be in the form of a microparticle formulation. The pharmaceutical preparation may also be in the form of a solid insert. For example, one may use a solid water soluble polymer as the carrier for the medicament. The polymer used to form the insert may be any water soluble non-toxic polymer, for example, cellulose derivatives such as methylcellulose, sodium carboxymethyl cellulose, (hydroxyloweralkyl cellulose), hydroxyethyl cellulose, hydroxypropyl cellulose, hydroxypropylmethyl cellulose; acrylates such as polyacrylic acid salts, ethylacrylates, polyactylamides; natural products such as gelatin, alginates, pectins, tragacanth, karaya, chondrus, agar, acacia; the starch derivatives such as starch acetate, hydroxymethyl starch ethers, hydroxypropyl starch, as well as other synthetic derivatives such as polyvinyl alcohol, polyvinyl pyrrolidone, polyvinyl methyl ether, polyethylene oxide, neutralized carbopol and xanthan gum, gellan gum, and mixtures of said polymer. Suitable subjects for the administration of the formulation of the present invention include primates, man and other animals, particularly man and domesticated animals such as cats, rabbits and dogs. The pharmaceutical preparation may contain non-toxic auxiliary substances such as antibacterial components which are non-injurious in use, for example, thimerosal, benzalkonium chloride, methyl and propyl paraben, benzyldodecinium bromide, benzyl alcohol, or phenylethanol; buffering ingredients such as sodium chloride, sodium borate, sodium acetate, sodium citrate, or gluconate buffers; and other conventional ingredients such as sorbitan monolaurate, triethanol amine, polyoxyethylene sorbitan monopalmitylate, ethylenediamine tetraacetic acid, and the like. The ophthalmic solution or suspension may be administered as often as necessary to maintain an acceptable IOP level in the eye. It is contemplated that administration to the mammalian eye will be from once up to three times daily. For topical ocular administration the novel formulations of this invention may take the form of solutions, gels, ointments, suspensions or solid inserts, formulated so that a unit dosage comprises a therapeutically effective amount of the active component or some multiple thereof in the case of a combination therapy. The compounds of the instant invention are also useful for mediating the bone modeling and remodeling processes of the osteoblasts and osteoclasts. See PCT US99/23757 filed October 12,
1999 and incorporated herein by reference in its entirety. The major prostaglandin receptor in bone is EP4, which is believed to provide its effect by signaling via cyclic AMP. See Ikeda T, Miyaura C,
Ichikawa A, Narumiya S, Yoshiki S and Suda T 1995, In situ localization of three subtypes (EPj, EP3 and EP4) of prostaglandin E receptors in embryonic and newborn mice., J Bone Miner Res 10 (sup 1):S172, which is incorporated by reference herein in its entirety. Use of the compounds of formula I for the manufacture of a medicament for mediating the bone modeling and remodeling processes are also included in this invention. Thus, another object of the present invention is to provide methods for stimulating bone formation, i.e. osteogenesis, in a mammal comprising administering to a mammal in need thereof a therapeutically effective amount of an EP4 receptor subtype agonist of formula I. Still another object of the present invention to provide methods for stimulating bone formation in a mammal in need thereof comprising administering to said mammal a therapeutically effective amount of an EP4 receptor subtype agonist of formula I and a bisphosphonate active. Use of the compounds of formula I for the manufacture of a medicament for stimulating bone formation is also included in this invention. Yet another object of the present invention is to provide pharmaceutical compositions comprising a therapeutically effective amount of an EP4 receptor subtype agonist of formula I and a bisphosphonate active. It is another object of the present invention to provide methods for treating or reducing the risk of contracting a disease state or condition related to abnormal bone resorption in a mammal in need of such treatment or prevention, comprising administering to said mammal a therapeutically effective amount of an EP4 receptor subtype agonist of formula I. Use of the compounds of formula I for the manufacture of a medicament for treating or reducing the risk of contracting a disease state or condition related to abnormal bone resorption is also included in this invention. The disease states or conditions related to abnormal bone resorption include, but are not limited to, osteoporosis, glucocorticoid induced osteoporosis, Paget's disease, abnormally increased bone turnover, periodontal disease, tooth loss, bone fractures, rheumatoid arthritis, periprosthetic osteolysis, osteogenesis imperfecta, metastatic bone disease, hypercalcemia of malignancy, and multiple myeloma. Within the method comprising administering a therapeutically effective amount of an EP4 receptor subtype agonist of formula I and a bisphosphonate active, both concurrent and sequential administration of the EP4 receptor subtype agonist of formula I and the bisphosphonate active are deemed within the scope of the present invention. Generally, the formulations are prepared containing 5 or 10 mg of a bisphosphonate active, on a bisphosphonic acid active basis. With sequential administration, the agonist and the bisphosphonate can be administered in either order. In a subclass of sequential administration the agonist and bisphosphonate are typically administered within the same 24 hour period. In yet a further subclass, the agonist and bisphosphonate are typically administered within about 4 hours of each other. Non-limiting classes of bisphosphonate actives useful in the instant invention are selected from the group consisting of alendronate, cimadronate, clodronate, tiludronate, etidronate, ibandronate, neridronate, olpandronate, risedronate, piridronate, pamidronate, zolendronate, pharmaceutically acceptable salts thereof, and mixtures thereof. A non-limiting subclass of the above-mentioned class in the instant case is selected from the group consisting of alendronate, pharmaceutically acceptable salts thereof, and mixtures thereof. A non-limiting example of the subclass is alendronate monosodium trihydrate. In the present invention, as it relates to bone stimulation, the agonist is typically administered for a sufficient period of time until the desired therapeutic effect is achieved. The term "until the desired therapeutic effect is achieved", as used herein, means that the therapeutic agent or agents are continuously administered, according to the dosing schedule chosen, up to the time that the clinical or medical effect sought for the disease or condition being mediated is observed by the clinician or researcher. For methods of treatment of the present invention, the compounds are continuously administered until the desired change in bone mass or structure is observed. In such instances, achieving an increase in bone mass or a replacement of abnormal bone structure with normal bone structure are the desired objectives. For methods of reducing the risk of a disease state or condition, the compounds are continuously administered for as long as necessary to prevent the undesired condition. In such instances, maintenance of bone mass density is often the objective. The compounds of this invention may also be useful for treating immune diseases, asthma, pulmonary injury, pulmonary fibrosis, pulmonary emphysema, bronchitis, chronic obstructive respiratory diseases, liver injury, acute hepatitis, renal failure, hypertension, myocardial ischemia, systemic inflammatory syndrome, and ulcerative colitis as described in WO 02/24647, incoφorated herein by reference. Non limiting examples of administration periods can range from about 2 weeks to the remaining lifespan of the mammal. For humans, administration periods can range from about 2 weeks to the remaining lifespan of the human, preferably from about 2 weeks to about 20 years, more preferably from about 1 month to about 20 years, more preferably from about 6 months to about 10 years, and most preferably from about 1 year to about 10 years. The instant compounds are also useful in combination with known agents useful for treating or preventing bone loss, bone fractures, osteoporosis, glucocorticoid induced osteoporosis, Paget's disease, abnormally increased bone turnover, periodontal disease, tooth loss, osteoarthritis, rheumatoid arthritis, periprosthetic osteolysis, osteogenesis imperfecta, metastatic bone disease, hypercalcemia of malignancy, and multiple myeloma. Combinations of the presently disclosed compounds with other agents useful in treating or preventing osteoporosis or other bone disorders are within the scope of the invention. A person of ordinary skill in the art would be able to discern which combinations of agents would be useful based on the particular characteristics of the drugs and the disease involved. Such agents include the following: an organic bisphosphonate; a cathepsin K inhibitor; an estrogen or an estrogen receptor modulator; an androgen receptor modulator; an inhibitor of osteoclast proton ATPase; an inhibitor of HMG-CoA reductase; an integrin receptor antagonist; an osteoblast anabolic agent, such as PTH; calcitonin; Vitamin D or a synthetic Vitamin D analogue; and the pharmaceutically acceptable salts and mixtures thereof. A preferred combination is a compound of the present invention and an organic bisphosphonate. Another prefened combination is a compound of the present invention and an estrogen receptor modulator. Another prefened combination is a compound of the present invention and an estrogen. Another prefened combination is a compound of the present invention and an androgen receptor modulator. Another prefened combination is a compound of the present invention and an osteoblast anabolic agent. Regarding treatment of abnormal bone resorption and ocular disorders, the formula I agonists generally have an EC50 value from about 0.001 nM to about 100 microM, although agonists with activities outside this range can be useful depending upon the dosage and route of administration. In a subclass of the present invention, the agonists have an EC50 value of from about 0.1 nM to about 1000 nM. In a further subclass of the present invention, the agonists have an EC50 value of from about 0.1 nM to about 50 nM. EC50 is a common measure of agonist activity well known to those of ordinary skill in the art and is defined as the concentration or dose of an agonist that is needed to produce half, i.e. 50%, of the maximal effect. See also, Goodman and Gilman's, The Pharmacologic Basis of Therapeutics, 9th edition, 1996, chapter 2, E. M. Ross, Pharmacodynamics, Mechanisms of Drug Action and the Relationship Between Drug Concentration and Effect, and PCT US99/23757, filed October 12, 1999, which are incorporated by reference herein in their entirety. The examples herein illustrate but do not limit the claimed invention. All of the claimed compounds are EP4 agonists and may be useful for a number of physiological ocular and bone disorders. The compounds of this invention can be made, with some modification, by following procedures described in USP 6211197, USP 5530157, USP 5834468, USP 5811459 and EP 752521. The following non-limiting schemes and examples given by way of illustration are demonstrative of the present invention. As used herein, the following terms and definitions apply unless indicated otherwise. The following abbreviations have the indicated meanings:
Ac = acetyl; AIBN = 2,2'-azobisisobutyronitrile; 9-BBN = 9-borabicyclo[3.3.1]nonane; Bn = benzyl; DD3AL = diisobutyl aluminum hydride; DJPHOS = l,2-bis(diphenylphosphino)ethane; DMAP = 4- (dimethylamino)pyridine; DMF = N,N-dimethylformamide; DMSO = dimethyl sulfoxide; EDCI = l-(3- dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride; Et3N = triethylamine; EtOAc = ethyl acetate; HBSS = Hanks balanced salt solution; HEPES = N-[2-hydroxyethyl]piperazine-N'-[2-ethanesulfonic acid]; HMPA = hexamethylphosphoramide; KHMDS = potassium hexamethyldisilazane; KOt-Bu = potassium tert-butoxide; LDA = lithium diisopropylamide; LiHMDS = lithium hexamethyldisilazane; LPS = lipopolysaccharide; MCPBA = metachloroperbenzoic acid; MES = 2-[N- morpholinojethanesulfonic acid; Ms = methanesulfonyl = mesyl; MsO = methanesulfonate = mesylate; NBS = N-bromosuccinimide; NCS = N-chlorosuccinimide; NSAID = non-steroidal anti-inflammatory drug; o.n. = overnight; PCC = pyridinium chlorochromate; PDC = pyridinium dichromate; PdCl2(dppf) = [l,r-bis(diphenylphosphino)fenocene]dichloropalladium(II); Ph = phenyl; PPTS = pyridinium p- toluenesulfonate; pTSA = p-toluenesulfonic acid; r.t. = room temperature; rac. = racemic; Tf = trifluoromethanesulfonyl = triflyl; TfO = trifluoromethanesulfonate = triflate; THF = tetrahydrofuran; THP = tetrahydropyran-2-yl; TLC = thin layer chromatography; Ts = p-toluenesulfonyl = tosyl; TsO = p- toluenesulfonate = tosylate; C3H5 = allyl; Me = methyl; Et = ethyl; n-Pr = normal propyl; i-Pr = isopropyl; n-Bu = normal butyl; i-Bu = isobutyl; s-Bu = secondary butyl; t-Bu = tertiary butyl; c-Pr = cyclopropyl; c-Bu = cyclobutyl; c-Pen = cyclopentyl; and c-Hex = cyclohexyl.
Example 1: 5-[4-(2-{ 3-bromo-5-chloro-2-[(3-methoxybenzyl)oxy]phenyl Jethyl)phenyl]-lH-tetrazole
Figure imgf000020_0001
Step 1: 3-bromo-5-chloro-2-[(3-methoxybenzyl)oxy]benzaldehyde
To a solution of 3-bromo-5-chloro-2-hydroxybenzaldehyde (2.004 g, 8.51 mmol) in DMF (20 ml), a solution of potassium tert-butoxide 1 M in THF (9.5 ml) was added slowly and the mixture was stined at r.t. for 10 min. Then, 3-methoxybenzyl bromide (1.43 ml, 1.2 equiv.) was added and the mixture was stined at r.t. for 1.5 h. The reaction was quenched by addition of a saturated solution of NHtCl and the product was extracted in EtOAc, washed with dilute HCl and brine, dried over Na2SO4 and concentrated. The residue was triturated in cold hexane to yield 2.507 g of the title material as a slightly yellow solid. Η NMR (acetone-d6) δ 10.08 (IH, s), 8.05 (IH, d), 7.70 (IH, d), 7.35 (IH, dd), 7.10 (2H, m), 6.96 (IH, dd), 5.22 (2H, s), 3.84 (3H, s).
Step 2: l-bromo-5-chloro-2-[(3-methoxybenzyl)oxy]-3-vinylbenzene To a suspension of methyl triphenylphonium bromide (2.78 g, 1.1 equiv.) in THF (28 ml) at 0 C was added 2.5 M n-BuLi in hexanes (3.0 ml, 1.07 equiv.) and the mixture was stined at r.t. for 45 min. to give an orange solution. The aldehyde from step 1 (2.504 g, 7.04 mmol) was then added at 0 C and the mixture was stined at r.t. for 1.5 h. The reaction was quenched by addition of a saturated solution of NH4CI and the product was extracted in i-PrOAc, dried over Na2SO4 and concentrated. The crude material was dissolved in 66 % toluene/hexane and purified by filtration through 60 ml silicagel with 50% toluene/hexane to yield 2.32 g of the title product as an oil. Η NMR (acetone-d6) δ 7.68 (IH, d), 7.64 (IH, d), 7.35 (IH, dd), 7.14 (2H, m), 6.98 (2H, m), 5.99 (IH, d), 5.45 (IH, d), 4.95 (2H, s), 3.85 (3H, s).
Step 3: 4-(2-{ 3-bromo-5-chloro-2-[(3-methoxybenzyl)oxy]phenyl }ethyl)benzonitrile A solution of 9-BBN 0.5 M in THF was added to the styrene of step 2 and the mixture was stirred at 50 C for an hour. The excess 9-BBN was quenched by addition of MeOH (75 uL). K2CO3 (235 mg), PdCl2(dppf) (26 mg), 4-bromobenzonitrile (168 mg) and DMF (4 ml) were then added and the mixture was degassed and stined at 55 C o.n. under N2. The reaction was quenched by addition of a saturated solution of NH4CI and the product was extracted in EtOAc, washed with dilute HCl and brine, dried over Na2SO4 and concentrated. The title product (176 mg, colorless oil) was obtained after purification by flash chromatography on silica using 10% EtOAc/hexane as eluent. Η NMR (acetone-d6) δ 7.67 (2H, d), 7.49 (IH, d), 7.38 (4H, m), 7.12 (2H, m), 6.97 (IH, dd), 5.01 (2H, s), 3.83 (3H, s), 3.00 (4H, m).
Step 4
The product of step 3 (176 mg), azidotributyltin (375 mg, 1.1 equiv.) and xylenes (0.5 ml) were heated to 120 C for 5 h. The crude mixture was purified by flash chromatography on silica using EtOAc:toluene:AcOH 10:90: 1 and 20:80: 1 as eluents to give a gummy solid, which was triturated in ether to afford 137 mg of the title product as a white solid. MS (-ESI) 497.0 (M-l), 499.0.
Example 2 Following the method of Example 1, steps 1-3, followed by the NaOH hydrolysis of the ester (as in example 3, step 3) or tetrazole formation (as in example 1), the compounds of Table 1 were prepared.
Table 1
Name Structure MS (-ESI)
a. 4-{2-[2-(benzyloxy)-3,5- dichlorophenyljethyl Jbenzoic acid
Figure imgf000021_0001
b. 5-{2-[2-(benzyloxy)-3,5- dichlorophenyl]ethyl}thiophene-2- 405.1, 407.1 carboxylic acid
Figure imgf000022_0001
c. 5-(4-{2-[2-(benzyloxy)-3,5- dichlorophenyl]ethyl}phenyl)-lH-tetrazole
Figure imgf000022_0002
Example 3: 4-(2-{2-[(3-methoxybenzyl)oxy]-3-methylphenyl }ethyl)benzoic acid
Figure imgf000022_0003
Step 1: ethyl 4-((£ -2-{2-[(3-methoxybenzyl)oxy]-3-methylphenyl}vinyl)benzoate A mixture containing 2-[(3-methoxybenzyl)oxy]-l-methyl-3-vinylbenzene (prepared as described in example 1, steps 1-2, 1.016 g, 3.6 mmol), ethyl 4-bromobenzoate (640 uL, 1.09 equiv.), palladium(JJ) acetate (24 mg), LiCl (150 mg), LiOAc (903 mg), Bu^Cl (1.90 g) and DMF (7 ml) was degassed and heated to 90 C o.n. under nitrogen. The reaction was quenched by addition of a saturated solution of NH4CI and the product was extracted in EtOAc, washed with diluted HCl and brine, dried over Na2SO4 and concentrated. Flash chromatography of the residue with 10% EtOAc/hexane afforded 1.18 g of the title product as an oil. MS (+ESI) 357.1, 403.1 (M+l).
Step 2: ethyl 4-(2-{2-[(3-methoxybenzyl)oxy]-3-methylphenyl}ethyl)benzoate
The product of step 1 (233 mg) in EtOAc (3 ml) was hydrogenated over 10% Pd/C (25 mg) at 1 atm for 2 h. The solvent was evaporated and the residue purified by flash chromatography on silica using 10%
EtOAc/hexane as eluent to yield 211 mg of the title product as a colorless oil. MS (+ESI) 359.1, 405.1
(M+l). Step 3
The product of step 2 (211 mg) was stined at r.t. o.n. with 10 N NaOH (209 uL), water (800 uL), methanol (1.6 ml) and THF (3 ml). The reaction was quenched by addition of a solution of 2 N HCl and the product was extracted in EtOAc, dried over Na2SO4 and concentrated. Trituration of the residue in 15% ether/hexane afforded 142 mg of the title product as a white solid. MS (-ESI) 375.2 (M-l).
Example 4: 4-(2-{ 3-bromo-5-chloro-2-[(2,3,5-trifluorobenzyl)oxy]phenyl }ethyl)benzoic acid
Figure imgf000023_0001
Step 1: ethyl 4-[2-(5-chloro-2-hydroxyphenyl)ethyl]benzoate
This compound was prepared from 5-chlorosalicylaldehyde using the following sequence: benzylation of the phenol, Wittig reaction with methyltriphenylphosphonium bromide and Heck coupling with ethyl 4- bromobenzoate (as in example 3), followed by reduction of the double bond and debenzylation by catalytic hydrogenation in ethanol over 10% Pd/C at 45 psi o.n.
Step 2: ethyl 4-[2-(3-bromo-5-chloro-2-hydroxyphenyl)ethyl]benzoate
This compound was obtained by bromination of the phenol of step 1 following the procedure described in
I. Org. Chem. 1997, 62, 4504. MS (-ESI) 381.0 (M-l), 383.0, 385.0
Step 3:
To a solution of ethyl 4-[2-(3-bromo-5-chloro-2-hydroxyphenyl)ethyl]benzoate (400 mg) in THF (3 ml) was added 1.0 equiv. of a 1 M solution of potassium tert-butoxide in THF (1.1 ml) and the mixture was stined at r.t. for 10 min. A small portion of this solution (503 uL, 127 umol) was then added to 2,3,5- trifluorobenzyl bromide (28.6 mg) and the mixture was stined at r.t. o.n. The ester thus obtained was then hydrolyzed in situ by addition of a 0.8 M solution of NaOH in MeOH: water 2: 1 (1 ml) and stirring at r.t. for 1 day. Acidification with dilute HCl and filtration of the precipitate yielded the title product as a white solid (56 mg). MS (-APCI) 496.8 (M-l), 498.9.
Example 5
The products of Table 2 were prepared following the general method of example 4.
Table 2
Figure imgf000024_0001
Figure imgf000024_0002
Figure imgf000025_0001
Figure imgf000026_0001
(a) The alkylation of the phenol was performed with KOt-Bu and phenacyl bromide in DMF at r.t. for 4 h. (b) Alkylation with methyl 3-(bromomethyl)benzoate. (c) The alkylation of the phenol was performed with KOt-Bu and 3,5-dimethoxybenzyl chloride in DMF in the presence of Nal at 75 C o.n. (d) The alkylation of the phenol was performed with KOt-Bu and 4-(bromomethyl)-2,6- dichloropyridine in DMF at 75 C for 4 h.
Example 6: 4-(2-{ 3,5-Dichloro-2-[(2-fluorophenyl)ethyl]phenyl }ethyl)benzoic acid
Figure imgf000027_0001
Step 1 : 2,4-dichloro-6-formylphenyl trifluoromethanesulfonate
To a solution of 3,5-dichlorosalicylaldehyde (6.6 g, 34.6 mmol) in CH2C12 (100 ml) at 0 C was added triethylamine (8.8 mL, 62.6 mmol). A solution of triflic anhydride (10.5 mL, 62.2 mmol) in CH2C12 (20 mL) was then added slowly and the mixture was stined at 0 C for 1 hour and at r.t. overnight. The reaction was quenched by addition of a saturated solution of NHiCl and the product was extracted in EtOAc, washed with brine, dried over MgSO4 and concentrated. The title product (9 g) was obtained after purification by flash chromatography on silica using 7% Et2O/hexane as eluent.
Step 2: methyl 4-[2-(3,5-dichloro-2-{ [(trifluoromethyl)sulfonyl]oxy}phenyl)vinyl]benzoate To a solution of [4-(methoxycarbonyl)benzyl](triphenyl)phosphonium bromide (16 g, 32.6 mmol) in THF (200 ml) at 0 C was added a 0.5 M solution of KHMDS in toluene (62 mL, 31 mmol) and the mixture was stirred at 0 C for 1 h (red solution). Then, a solution 2,4-dichloro-6-formylphenyl trifluoromethanesulfonate (9 g, 27.9 mmol) in THF (50 mL) was added at 0 C and the mixture was stined at r.t. for 4 h. The reaction was quenched by addition of a saturated solution of NEUC1 and the product was extracted in EtOAc, washed with water and brine, dried over MgS04 and concentrated. Flash chromatography of the residue with 8% EtOAc/hexane afforded 9 g of the title product.
Step 3: methyl 4-[2-(3,5-dichloro-2-{ [(trifluoromethyl)sulfonyl]oxy}phenyl)ethyl]benzoate The methyl 4-[2-(3,5-dichloro-2-{ [(trifluoromethyl)sulfonyl]oxy}phenyl)vinyl]benzoate (1.66 g) was hydrogenated in EtOAc (30 ml) over 10% Pd/C (160 mg) at 1 atm overnight. The reaction was filtered through celite and concentrated to afford the title product, which was used as such in the next step. Step 4: methyl 4-(2-{3,5-dichloro-2-[(2-fluorophenyl)ethynyl]phenylJethyl)benzoate A mixture containing methyl 4-[2-(3,5-dichloro-2-{ [(trifluoromethyl)sulfonyl]oxyJ- phenyl)ethyl]benzoate (0.23 g, 0.503 mmol), l-ethynyl-2-fluorobenzene (180 uL, 1.588 mmol), copper(I) iodide (7 mg, 0.037 mmol), triethylamine (100 uL, 0.712 mmol), [1,1'- bis(diphenylphosphino)fenocene)dichloropalladium(II) and DMF (10 mL) was degassed and heated to 80 C for 6 h under nitrogen. The reaction was quenched by addition of a saturated solution of NFUC1 and the product was extracted in Et2O, washed with water and brine, dried over MgS0 and concentrated. Flash chromatography of the residue with 0-5% EtOAc/hexane afforded 130 mg of the title product.
Step 5: 4-(2-{3,5-dichloro-2-[(2-fluorophenyl)ethynyl]phenyl}ethyl)benzoic acid
The product of step 4 was hydrolyzed with NaOH as described in example 3, step 3. MS (-ESI) 410.9 (M-
1), 412.9.
Step 6
4-(2-{3,5-Dichloro-2-[(2-fluorophenyl)ethynyl]phenyl}ethyl)benzoic acid (60 mg) was hydrogenated in EtOAc (5 ml) over 10% Pd/C (16 mg) at 36 psi for 12 h. The reaction was filtered through celite and concentrated to afford the title product. MS (-ESI) 415.0 (M-l), 417.1.
Example 7: 4-{ 2-[2-(benzyloxy)-3-bromo-5-chlorophenyl]ethyl Jbenzoic acid
Figure imgf000028_0001
Step 1: 2-bromo-4-chloro-6-(hydroxymethyl)phenol
To a solution of 3-bromo-5-chlorosalicylaldehyde (2.0 g) in a 1:1 mixture of THF:EtOH (40 ml) was added NaBH4 (482 mg) and the mixture was stined at r.t. for 2.5 h. The reaction was quenched by addition of a saturated solution of NHUC1 and with 10 % HCl and the product was extracted in CH2C12, dried over Na2S0 and concentrated. It was used as such in the next step.
Step 2: (3-bromo-5-chloro-2-hydroxybenzyl)(triphenyl)phosphonium bromide
The product of step 1 (1.0 g) and triphenylphosphine hydrobromide (1.44 g) were heated to reflux in acetonitrile (9 ml) for 2 h and were aged at r.t. o.n. Ether was added and the precipitate was filtered to yield 990 mg of the title phosphonium salt.
Step 3: resin bound 4-formyl benzoate
To a suspension of Wang resin (20 g, 0.85 mmol g) in DMF (130 ml) was added 4-formylbenzoic acid (6.38 g), 4-(dimethylamino)pyridine (2.07 g) and EDCI (8.15 g) and the suspension was stined gently at 70 C o.n. The resin was filtered and washed sequentially with DMF: water 1:1, DMF, THF and CH2C12. and dried under high vacuum. The loading was found to be 0.19 mmol/g after hydrolysis of an aliquot with 20% TFA/CH2C12 containing some dimethyl sulfide at r.t. for 5 min.
Step 4: 4-[2-(3-bromo-5-chloro-2-hydroxyphenyl)vinyl]benzoic acid
To a suspension of the phosphonium salt of step 2 (986 mg) in THF (10 ml) at r.t. was added LiHMDS (3.5 ml of a 1.0 M solution) and the mixture was stirred at r.t. for 20 min. The resin bound 4-formyl benzoate of step 3 (2.2 g) was then added and the suspension was stined at r.t. for 3 days. The reaction was quenched by addition of 10 % HCl and the resin was filtered and washed sequentially with DMF: water 1: 1, DMF, THF and CH2C12. The title product was cleaved from the resin by treatment with 20% TFA/CH2C12 (15 ml) containing dimethyl sulfide (0.4 ml) at r.t. for 10 min. The resin was filtered and washed with CH2C12 and the solvent was evaporated to yield the title material, which was used as such in the next step.
Step 5: 4-[2-(3-bromo-5-chloro-2-hydroxyphenyl)ethyl]benzoic acid
The product of step 4 (about 300 mg) was hydrogenated in EtOAc:acetone 1: 1 (30 ml) over Pt02 (90 mg) under 1 atm of hydrogen for 5 h. The mixture was filtered through celite and the solvent evaporated to yield the title product, which was used as such for the next step.
Step 6: benzyl 4-{2-[2-(benzyloxy)-3-bromo-5-chlorophenyl]ethyl}benzoate
A suspension of 60% NaH in oil (90 mg) was added to a solution of the phenol of step 5 (200 mg) in DMF (10 ml) and the mixture was stined at r.t. for 15 min. Benzyl bromide (333 uL) was then added and the mixture stined at r.t. o.n. The reaction was quenched by addition of a saturated solution of NHiCl and the product was extracted in EtOAc, washed with diluted HCl, dried over Na2S0 and concentrated. Flash chromatography of the residue on silica using 80% toluene/hexane afforded the title product (313 mg).
Step 7
The benzyl ester of step 6 (313 mg) was hydrolyzed with 2 M NaOH (1.5 ml) in dioxane (15 ml) at r.t. o.n. The reaction was acidified with 10% HCl and the product was extracted in EtOAc, washed with brine, dried over Na2S04 and concentrated. Flash chromatography of the residue on silica using
EtOAc:CH2Cl2:AcOH 10:90:1 afforded an oil, which was crystallized from CH2Cl2:hexane to yield 70 mg of the title product. Η NMR (acetone-d6) δ 7.93 (2H, d), 7.58-7.20 (9H, m), 5.00 (2H, s), 2.97 (4H, m).
Example 8: 4-{2-[2-(benzyloxy)-3-ethoxyphenyl]ethyl Jbenzoic acid
Figure imgf000030_0001
Using the method of example 7, this product was prepared from 3-ethoxysalicylaldehyde. Η NMR (acetone-d6) δ 7.93 (2H, d), 7.53 (2H, d), 7.39 (2H, dd), 7.35 (IH, m), 7.25 (2H, d), 6.95 (IH, dd), 6.90 (IH, d), 6.78 (IH, d), 5.03 (2H, s), 4.10 (2H, q), 2.88 (4H, m), 1.44, (3H, t).
Example 9: 4-(2-{ 3-methoxy-2-[(3-methoxybenzyl)oxy]phenyl }ethyl)benzoic acid
Figure imgf000030_0002
3-Methoxysalicylaldehyde was benzylated with 3-methoxybenzyl bromide as in example 1, step 1. A Wittig reaction with [4-(methoxycarbonyl)benzyl](triphenyl)phosphonium bromide followed by an hydrogenation as in example 5, steps 2 and 3, afforded the methyl ester of the title product. This ester was then hydrolyzed with NaOH as described in example 3, step 3. MS (-APCI) 391.0 (M-l)
Example 10: 4-{2-[3-bromo-5-chloro-2-(2-hydroxy-2-phenylethoxy)phenyl]ethyl}benzoic acid
Figure imgf000031_0001
Methyl 4-{2-[3-bromo-5-chloro-2-(2-oxo-2-phenylethoxy)phenyl]ethyl}benzoate (obtained as an intermediate in example 5, 60 mg) was dissolved in boiling methanol and then reduced with NaBRi (20 mg) at 0 C for 2 h. The reaction was quenched by addition of a saturated solution of NΗ4CI and the product was extracted in EtOAc, dried over Na2S04 and concentrated. This crude ester was then hydrolyzed as in example 3, step 3, to yield the title compound (50 mg) after flash chromatography on silica using EtOAc:toluene:AcOH 20:80:1. MS (-ESI) 472.9, 474.8, 476.8.
Example 11: 4-(3-{3,5-dichloro-2-[(3-methoxybenzyl)oxy]phenyl}prop-2-en-l-yl)benzoic acid
Wittig
Figure imgf000031_0002
Figure imgf000031_0003
Example 12
Figure imgf000031_0004
Step 1: [2-(4-carboxyphenyl)ethyl](triphenyl)phosphonium chloride
4-(2-Chloroethyl)benzoic acid (1.012 g) and triphenylphosphine (1.444 g) were heated together at 140 C for 2 days. The resulting gum was dissolved in boiling ethanol and ether was added. An oil separated and crystallized under stirring at r.t. o.n. The title phosphonate was filtered, washed with etheπethanol 2: 1 and dried under high vacuum at 100 C for 2 h to yield 1.484 g of white solid.
Step 2:
At 0 C, a 0.75 M solution of KHMDS in toluene (1.5 ml) was added slowly to a suspension of the phosphonium salt of step 1 (259 mg) in THF:HMPA 10: 1 (3.3 ml) and the mixture was then stirred very rapidly at r.t. for 45 min. The mixture was cooled to 0 C, 3,5-dichloro-2-[(3- methoxybenzyl)oxy]benzaldehyde (prepared as in example 1, step 1, 153 mg) was added and the mixture was stined at r.t. for 2 h. The reaction was quenched by addition of a solution of 2 N HCl and the product was extracted in hot i-PrOAc:THF 1:1 and i-PrOAc:t-BuOH 1:1, dried over Na2S0 and concentrated. The title product (125 mg, cis trans mixture) was obtained after purification by flash chromatography on silica using EtOAc :toluene:AcOH 20:80:1 as eluent. MS (-APCI) 441.0 (M-l), 443.0.
Example 12: 4-(3-{ 3,5-dichloro-2-[(3-methoxybenzyl)oxy]phenyl }propyl)benzoic acid The product of example 11 (97 mg) was reduced by catalytic hydrogenation over 10% Pd/C in EtOAc as in example 3, step 2, to yield 80 mg of the title benzoic acid as a white solid after filtration of the reaction mixture through celite and trituration in hexane. MS (-APCI) 443.0 (M-l), 445.0
Example 13: 4-{ 2-[3-bromo-5-chloro-2-(2-phenylethoxy)phenyl]ethyl Jbenzoic acid
Figure imgf000032_0001
To a solution of ethyl 4-[2-(3-bromo-5-chloro-2-hydroxyphenyl)ethyl]benzoate (example 4, step 2, 159.6 mg, 0.416 mmol) in THF (5 mL) was added phenethyl alcohol (0.12 mL), di-tert-butyl azodicarboxylate (480 mg) and triphenylphosphine (563.4 mg) and the mixture was stined at r.t. overnight . The reaction was quenched by addition of a saturated solution of NHiCl and the product was extracted in EtOAc, washed with water and brine, dried over MgS04 and concentrated. Flash chromatography of the residue with 5-10 % EtOAc/hexane, followed by a preparative TLC with 10% EtOAc/hexane afforded 0.141 g of the ester. This ester was hydrolyzed with NaOH as described in example 3, step 3, to give the title product. MS (-ESI) 457.1 (M-l), 459.1 Example 14: 4-{ 2-[3-bromo-5-chloro-2-(2-hydroxy-3-phenylpropoxy)phenyl]ethyl Jbenzoic acid
Figure imgf000033_0001
To a solution of ethyl 4-[2-(3-bromo-5-chloro-2-hydroxyphenyl)ethyl]benzoate (267 mg, 0.696 mmol) in ethyl alcohol (20 mL) was added triethylamine (0.11 mL), (2,3-epoxypropyl)benzene (0.14 mL) and the mixture was heated to reflux overnight . The solvent was evaporated and quenched by addition of a saturated solution of NHtCl. The product was extracted in EtOAc, washed with water and brine, dried over MgS04 and concentrated. Flash chromatography of the residue withlO % acetone/toluene afforded 0.212 g of the ester of the title product. This ester was hydrolyzed with NaOH as described in example 3, step 3, to give the title product. MS (-ESI) 487.1 (M-l), 489.2, 491.1
Example 15: 4-(2-{ 3-[(3-methoxybenzyl)oxy]pyridin-2-yl }ethyl)benzoic acid
Figure imgf000033_0002
Step 1: 2-bromo-3-{[tert-butyl(dimethyl)silyl]oxy Jpyridine
To a solution of 2-bromo-3-hydroxypyridine (20 g, 115 mmol) in DMF (57 ml) was added triethylamine (22.5 mL, 160 mmol) followed by t-butyldimethylsilyl chloride (18.069 g, 120 mmol) in portions and the mixture was stined at r.t. for 12 hours. To this solution was added 500 mL of water followed by extraction of the product with 9: 1 hexanes:CH2Cl2. The combined extracts were dried over Na2S04 and concentrated. The title product (33 g, 99%) was obtained after purification by flash chromatography on silica using 10% EtOAc/hexane as eluent. Η NMR (acetone-d6) δ 8.0 (IH, m), 7.4-7.2 (2H, m), 1.1 (9H, s), 0.4 (6H, s). Step 2: methyl 4-[(Emethyl 4-[(tert-butyl(dimethyl)silyl]oxyJpyridin-2-yl)vinyl]benzoate To a solution the TBS ether from step 1 (10 g, 34.7 mmol) in DMF (50 ml) was added 4-vinylbenzoic acid methyl ester (6.2g, 38.2 mmol) and the solution was degassed with nitrogen for 5 minutes. Triethylamine (5.37 mL, 38.2 mmol), tri(o-tolyl)phosphine (2.11 g, 6.94 mmol) and tris (dibenzylideneacetone)dipalladium (3.18 g, 3.47 mmol) were then added and the mixture was stined at 100 C for 12 h. The reaction was cooled to it., water (500mL) was added and the product was extracted with 9: 1 hexanes :CH2C12. The combined extracts were dried over Na2S04 and concentrated. The title product (9 g, 70%) was obtained after purification by flash chromatography on silica using 10-30% EtOAc/hexane as eluent. MS (+ESI) 371.0.
Step 3: methyl 4-[(E)-2-(3-hydroxypyridin-2-yl)vinyl]benzoate
To a solution of the styrene of step 2 (9 g, 24 mmol) in THF (50 mL) was added tetrabutylammonium fluoride (27.1 mL of a IM solution in THF, 27.1 mmol) and the solution was stirred for 12 hours. Water (200 mL) was added and the product was extracted with EtOAc. The combined extracts were dried over Na2S04 and concentrated. The title product (4.3 g, 70%) was obtained after purification by flash chromatography on silica using 10-50% EtOAc/hexane as eluent. MS (+ESI) 256.0.
Step 4: methyl 4-[2-(3-hydroxypyridin-2-yl)ethyl]benzoate
To a solution of the product of step 3 (4.5 g, 17.6 mmol) in ethanol (75mL) was added 10% palladium on carbon (1.9 g) and the solution was stined under a hydrogen balloon for 12 hours. The solution was then filtered over a plug of celite and concentrated to yield the pure product (2.5g, 55%) as a pale yellow solid. MS (+ESI) 258.0.
Step 5: methyl 4-(2-{3-[(3-methoxybenzyl)oxy]pyridin-2-yl}ethyl)benzoate
To a solution of the product of step 4 (0.2 g, 0.78 mmol) in DMF (5 mL) was added 60% sodium hydride (31 mg, 0.78mmol). Once gas evolution ceased 3-methoxybenzyl bromide (0.1 mL, 0.78mmol) was added and the solution was stirred for 12 hours. Water (20 mL) was added and the product was extracted with 9: 1 hexanes:CH2Cl2.. The combined extracts were dried over Na2S04 and concentrated. The title product (0.25 g, 85%) was obtained after purification by flash chromatography on silica using 10-50% EtOAc/hexane as eluent. MS (+ESI) 378.0.
Step 6: 4-(2-{ 3-[(3-methoxybenzyl)oxy]pyridin-2-yl}ethyl)benzoic acid
To a solution of the product of step 5 (0.2 g, 0.53 mmol) in 3: 1:1 THF: MeOH: water (10 mL) was added lithium hydroxide monohydrate (42 mg, 1.0 mmol) and the solution was stined for 12 hours. The solution was neutralized with IM HCl (1 mL, 1 mmol) and the product extracted with ethyl acetate. The combined extracts were dried over Na2S0 and concentrated. The title product (50 mg, 26%) was obtained after trituration of the resultant white solid with ether. Η NMR (DMSO-d6) δ 12.9 (IH, bs), 8.1 (IH, s), 7.8 (2H, m), 7.5-6.8 (8H, m), 5.1 (2H, s), 3.8 (3H, s), 3.0 (4H, m). MS (+ESI) 364.1. MS (-ESI) 362.1.
Example 16: 4-(2-{3-[(3,5-dimethoxybenzyl)oxy]pyridin-2-yl}ethyl)benzoic
Figure imgf000035_0001
Step 1: methyl 4-[2-(3-{ [(trifluoromethyl)sulfonyl]oxy}pyridin-2-yl)ethyl]benzoate To a solution of methyl 4-[2-(3-hydroxypyridin-2-yl)ethyl]benzoate (from step 4, example 15, 500 mg, 1.94 mmol) in 1: 1 pyridine:CH2Cl2 (10 ml), was slowly added trifluoromethanesulfonic anhydride (0.492 mL, 2.9 mmol) at 0 C and the mixture was stined for 12 hours. To the solution was added 50 mL of water followed by extraction of the product with ethyl acetate. The combined extracts were dried over Na2S04 and concentrated. The title product (750 mg, 99%) was obtained after purification by flash chromatography on silica using 10-20% EtOAc/hexane as eluent. Η NMR (acetone-d6) δ 8.7 (IH, m), 8.0-7.8 (3H, m), 7.6-7.4 (3H, m), 3.9 (3H, s), 3.2 (4H, m).
Step 2: methyl 4-(2-{3-[2-(3,5-dimethoxyphenyl)ethyl]pyridin-2-yl}ethyl)benzoate To a solution of 3,5-dimethoxystyrene (prepared by a Wittig methylenation of the conesponding aldehyde, 80 mg, 0.488 mmol) in THF (5 mL) was added 9-BBN-dimer (119 mg, 0.488 mmol) and the resultant solution was heated to reflux for 2 hours. After cooling to room temperature, DMF (5mL), the triflate from step 1 (100 mg, 0.257 mmol), tripotassium phosphate (164 mg, 0.771 mmol) and (1,1'- Bis(diphenylphosphino)fertocene)dichloropalladium(U)-CH2Cl2 complex (21.2 mg, 0.026 mmol) were added and the mixture was stirred at 50 C for 12 h. The reaction was cooled to r.t., water (50mL) was added and the product was extracted with 9: 1 hexanes:CH2Cl2. The combined extracts were dried over Na2S04 and concentrated. The title product (100 mg, 95%) was obtained after purification by flash chromatography on silica using 10-30% EtOAc/hexane as eluent. Η NMR (acetone-d6) δ 8.5 (IH, m), 7.9 (2H, d), 7.6 (IH, d), 7.4 (2H, d), 7.2 (IH, m), 6.4 (3H, s), 3.9 (3H, s), 3.7 (6H, s), 3.1 (4H, m), 2.9 (2H, m), 2.8 (2H, m). MS (+ESI) 406.3. Step 3: 4-(2-{3-[(3,5-dimethoxybenzyl)oxy]pyridin-2-yl}ethyl)benzoic acid
To a solution of the product of step 2 (0.16 g, 0.395 mmol) in 3: 1:1 THF:MeOH: water (10 mL) was added lithium hydroxide monohydrate (42 mg, 1.0 mmol) and the solution was stirred for 12 hours. The solution was neutralized with IM HCl (1 mL, 1 mmol) and the product extracted with ethyl acetate. The combined extracts were dried over Na2S04 and concentrated. The title product (50 mg, 26%) was obtained after trituration of the resultant white solid with ether. Η NMR (CDC13) δ 8.7 (IH, m), 8.1 (2H, d), 7.6 (IH, d), 7.4 (2H, d), 7.2 (IH, m), 6.4 (3H, m), 3.8 (6H, s), 3.3-2.8 (8H, m). MS (+ESI) 392.2.
Example 17: 3-[(3-methoxybenzyl)oxy]-2-{ 2-[4-(2H-tetrazol-5-yl)phenyl]ethyl Jpyridine
Figure imgf000036_0001
Step 1 : 3-{ [tert-butyl(dimethyl)silyl]oxy } -2-vinylpyridine
To a solution of the silyl ether of example 15, step 1, (5 g, 17.35 mmol) and tetrakis(triphenylphosphine)palladium(0) (2.0 g, 1.735 mmol) in toluene (100 ml), was slowly added tributyl(vinyl)tin (5.6 mL, 19.1 mmol). The mixture was stined at reflux for 12 hours and then cooled to r.t. and concentrated. The title product (3 g, 73%) was obtained after purification by flash chromatography on silica using 10% EtOAc/hexane as eluent. Η NMR (acetone-d6) δ 8.2 (IH, d), 7.3- 7.1 (3H, m), 6.4 (IH, dd), 5.4 (IH, dd), 1.1 (9H, s), 0.3 (6H, s).
Step 2: 4-[(E)-2-(3-{[tert-butyl(dimethyl)silyl]oxy}pyridin-2-yl)vinyl]benzonitrile To a solution the vinyl pyridine from step 2 (2 g, 8.5 mmol) in DMF (10 ml) was added 4- bromobenzonitrile (1.7 g, 9.35 mmol) and the solution was degassed with nitrogen for 5 minutes. Triethylamine (1.3 mL, 9.35 mmol), tri(o-tolyl)phosphine (0.57 g, 1.7 mmol) and tris (dibenzylideneacetone)dipalladium (0.778 g, 0.85 mmol) were then added and the mixture was stined at 100 C for 12 h. The reaction was cooled to r.t., water (50mL) was added and the product was extracted with 9:1 hexanes: CH2C12. The combined extracts were dried over Na2S04 and concentrated. The title product (2 g, 70%) was obtained after purification by flash chromatography on silica using 10-30% EtOAc/hexane as eluent. MS (+ESI) 223.0. Step 3: 4-[(E)-2-(3-hydroxypyridin-2-yl)vinyl]benzonitrile
To a solution of the styrene of step 2 (2 g, 6 mmol) in THF (10 mL) was added tetrabutylammonium fluoride (10 mL of a IM solution in THF, 10 mmol) and the solution was stined for 12 hours. Water (100 mL) was added and the product was extracted with EtOAc. The combined extracts were dried over Na2S0 and concentrated. The title product (1 g, 75%) was obtained after purification by flash chromatography on silica using 10-80% EtOAc/hexane as eluent. MS (+ESI) 222.8.
Step 4: 4-((E)-2-{ 3-[(3-methoxybenzyl)oxy]pyridin-2-yl } vinyl)benzonitrile
To a solution of the product of step 3 (0.5 g, 2.25 mmol) in DMF (10 mL) was added 60% sodium hydride (108 mg, 2.7 mmol). Once gas evolution ceased 3-methoxybenzyl bromide (0.38 mL, 2.7 mmol) was added and the solution was stirred for 12 hours. Water (20 mL) was added and the product was extracted with 9: 1 hexanes:CH2Cl2.. The combined extracts were dried over Na2S04 and concentrated. The title product (0.40 g, 52%) was obtained after purification by flash chromatography on silica using 10-25% EtOAc/hexane as eluent. MS (+ESI) 343.0.
Step 5: 3-[(3-methoxybenzyl)oxy]-2-{ (E)-2-[4-(2H-tetrazol-5-yl)phenyl]vinyl Jpyridine The product of step 4 (200 mg, 0.584 mmol), azidotributyltin (0.48 mL, 1.752 mmol) and toluene (5 ml) were heated to 120 C for 12 hours. The title product (0.20 g, 89%) was obtained after purification by flash chromatography on silica using 50-100% EtOAc/hexane as eluent. Η NMR (MeOH-d4) δ 8.2 (IH, d), 8.1 (2H, d), 7.7 (4H, m), 7.5 (IH, d), 7.4 (IH, m), 7.3 (IH, m), 7.1 (2H, m), 6.9 (IH, m), 5.2 (2H, s), 3.8 (3H, s). MS (-ESI) 384.5.
Step 6: 3-[(3-methoxybenzyl)oxy]-2-{2-[4-(2H-tetrazol-5-yl)phenyl]ethyl Jpyridine To a solution of the product of step 5 (0.2 g, 0.52 mmol) in 1: 1 EtOAc:acetone (20mL) was added platinum oxide (13 mg, 0.052 mmol) and the solution was stined under a hydrogen balloon for 12 hours. The solution was then filtered over a plug of celite and concentrated to yield the pure product (50 mg, 25%) after purification by flash chromatography on silica using 50-100% EtOAc/hexane as eluent. Η NMR (acetone-d6) δ 8.2 (IH, d), 8.0 (2H, d), 7.5 (4H, m), 7.4 (IH, t), 7.2 (IH, dd), 7.1 (IH, m), 6.9 (IH, m), 5.1 (2H, s), 3.8 (3H, s), 3.2 (2H, m), 3.0 (2H, m). MS (-ESI) 386.5. Example 18: 4-(2-{4-isopropyl-3-[(3-methoxybenzyl)oxy]pyridin-2-yl}ethyl)benzoic acid
Figure imgf000038_0001
Step 1: 3-[(3-methoxybenzyl)oxy]-2-methylpyridin-4-yl trifluoromethanesulfonate To a solution of 3-[(3-methoxybenzyl)oxy]-2-methylpyridin-4(lH)-one (prepared in two steps according to literature procedures (Tetrahedron, 2001, 3479-3486) 10 g, 40.8 mmol) in 1: 1 pyridine:dichloromethane (60 ml), was slowly added trifluoromethanesulfonic anhydride (8.0 mL, 47.4 mmol) at 0 C and the mixture was stined for 12 hours. To this solution was added 50 mL of water followed by extraction of the product with ethyl acetate. The combined extracts were dried over Na2S0 and concentrated. The title product (14 g, 91%) was obtained after purification by flash chromatography on silica using 10-20% EtOAc/hexane as eluent. Η NMR (CDC13) δ 8.4 (IH, d), 7.3 (IH, m), 7.1 (IH, d), 7.0-6.9 (3H, m), 5.0 (2H, s), 3.9 (3H, s), 2.5 (3H, s).
Step 2: 3-[(3-methoxybenzyl)oxy]-2-methyl-4-{ l-[(trimethylsilyl)methyl] vinyl Jpyridine To a solution of the triflate of step 1 (4.46 g, 11.82 mmol), allyltrimethylsilane (19 mL, 118 mmol) and triethylamine (3.32 mL, 23.6 mmol) in CH3CN (50 mL) was added l, -bis(diphenylphosphino)ferrocene (1.44 g, 2.6 mmol) and palladium(II) acetate (133 mg, 0.59 mmol). The mixture was stirred at reflux for 12 hours and then cooled to r.t. Water (50 mL) was added and the product was extracted with ethyl acetate. The combined extracts were dried over Na2S04 and concentrated. The title product (2.0 g, 50%) was obtained after purification by flash chromatography on silica using 10-30% EtOAc/hexane as eluent. Η NMR (acetone-d6) δ 8.2 (IH, d), 7.4 (IH, t), 7.1 (3H, m), 6.9 (IH, d), 5.2 (2H, d), 4.9 (2H, s), 3.8 (3H, s), 2.5 (3H, s), 2.3 (2H, s), 0.0 (9H, s).
Step 3: 4-isopropenyl-3-[(3-methoxybenzyl)oxy]-2-methylpyridine
To a solution of the product of step 2 (2.0 g, 5.86 mmol) in DMSO (lOmL) was added potassium fluoride (1.7 g, 29.3 mmol). After stirring at reflux for 30 minutes the solution was cooled, water (100 mL) was added and the product was extracted with ethyl acetate. The combined extracts were dried over Na2S04 and concentrated. The title product (1.5 g, 95%) was obtained after purification by flash chromatography on silica using 10-30% EtOAc/hexane as eluent. Η NMR (acetone-d6) δ 8.2 (IH, d), 7.4 (IH, t), 7.1 (3H, m), 6.9 (IH, d), 5.4 (2H, d), 4.9 (2H, s), 3.8 (3H, s), 2.5 (3H, s), 2.2 (3H, s). MS (+ESI) 270.0.
Step 4: 4-isopropyl-3-[(3-methoxybenzyl)oxy]-2-methylpyridine
To a solution of the product of step 3 (1.5 g, 5.57 mmol) in 1: 1 EtOAc:acetone (20mL) was added platinum oxide (137 mg, 0.557 mmol) and the solution was stirred under a hydrogen balloon for 12 hours. The solution was then filtered over a plug of celite and concentrated to yield the pure product (1.0 g, 66%) after purification by flash chromatography on silica using 50-100% EtOAc/hexane as eluent. Η NMR (acetone-d6) δ 8.2 (IH, d), 7.4 (IH, t), 7.1 (3H, m), 6.9 (IH, d), 4.9 (2H, s), 3.8 (3H, s), 3.4 (IH, m), 2.5 (3H, s), 1.3 (3H, s), 1.2 (3H, s). MS (+ESI) 272.0.
Step 5: methyl 4-((E)-2-{4-isopropyl-3-[(3-methoxybenzyl)oxy]pyridin-2-yl }vinyl)benzoate To a solution of the 2-methylpyridine of step 4 (1.8 g, 6.63 mmol) in acetic anhydride (20 mL) was added methyl 4-formylbenzoate (2.18 g, 13.3 mmol) and the solution was refluxed for 12 hours. After cooling to r.t. the excess anhydride was hydrolyzed with saturated sodium carbonate followed by extraction of the product with ethyl acetate. The combined extracts were dried over Na2S04 and concentrated. The title product (0.5 g, 18%) was obtained after purification by flash chromatography on silica using 10-80% EtOAc/hexane as eluent. MS (+ESI) 418.2.
Step 6: methyl 4-(2-{4-isopropyl-3-[(3-methoxybenzyl)oxy]pyridin-2-yl}ethyl)benzoate To a solution of the product of step 5 (0.5 g, 0.52 mmol) in 1: 1 EtOAc:acetone (20mL) was added platinum oxide (29 mg, 0.12 mmol) and the solution was stirred under a hydrogen balloon for 12 hours. The solution was then filtered over a plug of celite and concentrated to yield the pure product (300 mg, 60%) after purification by flash chromatography on silica using 30-70% EtOAc/hexane as eluent. JH NMR (acetone-d6) δ 8.3 (IH, d), 7.9 (2H, m), 7.4-7.3 (3H, m), 7.2 (IH, d), 7.0-6.9 (3H, m), 4.8 (2H, s), 3.9 (3H, s), 3.8 (3H, s), 3.4 (IH, m), 3.2 (4H, m), 1.2 (6H, d). MS (+ESI) 420.2.
Step 7: 4-(2-{4-isopropyl-3-[(3-methoxybenzyl)oxy]pyridin-2-yl}ethyl)benzoic acid To a solution of the product of step 6 (0.30 g, 0.72 mmol) in 3:1: 1 THF: MeOH: water (10 mL) was added lithium hydroxide monohydrate (72 mg, 3.0 mmol) and the solution was stined for 12 hours. The solution was neutralized with IM HCl (3 mL, 3 mmol) and the product extracted with ethyl acetate. The combined extracts were dried over Na2S04 and concentrated. The title product (100 mg, 35%) was obtained after trituration of the resultant white solid with ether. Η NMR (d4-MeOH) δ 8.3 (IH, d), 7.9 (2H, m), 7.4-7.3 (2H, m), 7.1 (2H, d), 7.0-6.9 (3H, m), 4.8 (2H, s), 3.8 (3H, s), 3.4 (IH, m), 3.1-2.9 (4H, m), 1.2 (6H, d). MS (+ESI) 406.1. MS (-ESI) 404.2. Example 19: 4-(2-{ 3-[(3-methoxybenzyl)oxy]-4-methylpyridin-2-yl }ethyl)benzoic acid
Figure imgf000040_0001
Step 1: 3-[(3-methoxybenzyl)oxy]-2-methyl-4-vinylpyridine
To a solution of the triflate of example 18, step 1, (2 g, 5.3 mmol), bis(triphenylphosphine)palladium(II)dichloride (0.372 g, 0.53 mmol) and lithium chloride (674 mg, 15.9 mmol) in DMF (10 mL) was slowly added tributyl(vinyl)tin (1.7 mL, 5.83 mmol). The mixture was stined at reflux for 12 hours and then cooled to r.t. Water (50 mL) was added and the product was extracted with 9:1 hexanes:CH2Cl2. The combined extracts were dried over Na2S0 and concentrated. The title product (600 mg, 44%) was obtained after purification by flash chromatography on silica using 10- 30% EtOAc/hexane as eluent. lH NMR (acetone-d6) δ 8.3 (IH, d), 7.5 (IH, d), 7.4 (IH, t), 7.1-6.9 (3H, m), 6.1 (IH, d), 5.5 (IH, d), 4.9 (2H, s), 3.8 (3H, s), 2.5 (3H, s).
Step 2: 4-ethyl-3-[(3-methoxybenzyl)oxy]-2-methylpyridine
To a solution of the product of step 1 (0.5 g, 1.96 mmol) in 1: 1 EtOAc:acetone (20mL) was added platinum oxide (48 mg, 0.196 mmol) and the solution was stined under a hydrogen balloon for 12 hours. The solution was then filtered over a plug of celite and concentrated to yield the pure product (360 mg, 72%) after purification by flash chromatography on silica using 50-100% EtOAc/hexane as eluent. Η NMR (acetone-d6) δ 8.2 (IH, d), 7.4 (IH, t), 7.1 (3H, m), 7.0 (IH, d), 4.9 (2H, s), 3.8 (3H, s), 2.7 (2H, q), 2.5 (3H, s), 1.3 (3H, t).
Step 3-5 were performed as in example 18 to yield 50 mg of 4-(2-{4-ethyl-3-[(3- methoxybenzyl)oxy]pyridin-2-yl}ethyl)benzoic acid. Η NMR (d4-MeOH) δ 8.2 (IH, d), 7.9 (2H, d), 7.4 (IH, t), 7.3 (IH, d), 7.1 (2H, d), 7.0-6.9 (3H, m), 4.7 (2H, s), 3.2-3.0 (4H, m), 2.8 (2H, q), 1.3 (3H, t). MS (+ESI) 392.1. Example 20: 4-(2-{4-chloro-3-[(3,5-dimethoxybenzyl)oxy]pyridin-2-yl}ethyl)benzoic acid
Figure imgf000041_0001
Step 1: (4-chloro-3-methoxypyridin-2-yl)methanol
A solution of 4-chloro-3-methoxy-2-methylpyridine N-oxide (6.07 g) in acetic anhydride (50 mL) was heated to reflux for 5 hours, then it was cooled to room temperature and neutralized with sodium carbonate. The product was extracted in EtOAc, washed with water and brine, dried over MgS04 and concentrated to yield (4-chloro-3-methoxypyridin-2-yl)methyl acetate. This ester was then hydrolyzed with NaOH as in example 3, step 3.
Step 2: 4-chloro-3-methoxypyridine-2-carbaldehyde
To a solution of (4-chloro-3-methoxypyridin-2-yl)methanol (2.98 g) in CH2C12 (50 ml) was added the Dess-Martin periodinane (7.5 g) and the mixture was stirred for 2 hours. The reaction was concentrated and coevaporated with toluene. The crude product was dissolved with Et20, filtered on celite and concentrated. It was used as such in the next step.
Step 3: methyl 4-[(£)-2-(4-chloro-3-methoxypyridin-2-yl)vinyl]benzoate
The Wittig reaction with the aldehyde of step 2 was performed using the procedure of example 6, step 2.
Step 4: methyl 4-[2-(4-chloro-3-methoxypyridin-2-yl)ethyl]benzoate
To a solution of methyl 4-[(£ 2-(4-chloro-3-methoxypyridin-2-yl)vinyl]benzoate (1.2 g) in diglyme (20 mL) was added benzenesulfonyl hydrazide (2.4 g) and the mixture was heated to reflux for one hour (as in 1. Am. Chem. Soc., 1961 ,83 ,3729). The diglyme was distilled and the product was extracted in EtOAc, washed with water and brine, dried over MgS04 and concentrated. Flash chromatography of the residue afforded 0.36 g of the title material. Step 5: 4-[2-(4-chloro-3-hydroxypyridin-2-yl)ethyl]benzoic acid
A mixture of methyl 4-[2-(4-chloro-3-methoxypyridin-2-yl)ethyl]benzoate (0.310 g) in pyridine hydrochloride (7.78 g) was heated to 200 C for 15 min. The reaction was cooled to 150 C, water was added, and the mixture was neutralized with 10M sodium hydroxide to pH 6. The product was extracted with EtOAc, washed with water and brine, dried over MgS0 , concentrated, and finally triturated with Et20 to yield 150 mg.
Step 6
The product of step 5 was alkylated with 3,5-dimethoxybenzyl bromide as in example 1, step 1, and the ester was hydrolyzed with NaOH as in example 3, step 3. MS (-ESI) 425.8 (M-l), 428.2
Example 21: 4-(2-{4,6-dibromo-3-[(3,5-dimethoxybenzyl)oxy]pyridin-2-yl }ethyl)benzoic acid
Figure imgf000042_0001
Step 1: methyl 4-[2-(4,6-dibromo-3-hydroxypyridin-2-yl)ethyl]benzoate
To a suspension of methyl 4-[2-(3-hydroxypyridin-2-yl)ethyl]benzoate (0.432 g, example 15, step 4) in methyl alcohol (20 ml) at 0 C was added portionwise N-bromosuccinimide (0.605 g) and the mixture was stined at 0 C for 30 min. The reaction was quenched by addition of a saturated solution of NFUCl and the product was extracted in EtOAc, washed with brine, dried over MgS04 and concentrated. The title product (0.5 g) was obtained after purification by flash chromatography on silica using 20-30-40 % EtOAc /hexane as eluent.
Step 2
The product of step 1 was alkylated with 3,5-dimethoxybenzyl bromide as in example 1, step 1, and the ester was hydrolyzed with NaOH as in example 3, step 3. MS (-ESI) 547.8 (M-l), 549.8 Example 22: 4-(2-{6-bromo-3-[(3,5-dimethoxybenzyl)oxy]pyridin-2-yl}ethyl)benzoic acid
Figure imgf000043_0001
Step 1: methyl 4-(2-{6-bromo-3-[(3,5-dimethoxybenzyl)oxy]pyridin-2-yl}ethyl)benzoate. To a solution of methyl 4-(2-{4,6-dibromo-3-[(3,5-dimethoxybenzyl)oxy]pyridin-2-yl}ethyl)benzoate (43 mg, example 21, step 2) in acetic acid (2 ml) at room temperature was added zinc (excess) and the mixture was stined overnight (suspension) at r.t. DMF (2 mL) was then added and the mixture and heated to 40 C for 10 hours. The reaction was quenched by addition of a saturated solution of sodium bicarbonate and the product was extracted in EtOAc, washed with water and brine, dried over MgS04 and concentrated. The title product (14 mg) was obtained after purification by prep tic on silica using 25% EtOAc /hexane as eluent.
Step 2
The product of step 1 was hydrolyzed with NaOH as in example 3, step 3. MS (+ESI) 471.6 (M+l), 473.7
Example 23: 4-(2-{ 3-bromo-5-chloro-2-[(3,5-dimethoxybenzyl)oxy]phenyl }ethyl)benzamide
Figure imgf000043_0002
To 4-(2-{3-bromo-5-chloro-2-[(3,5-dimethoxybenzyl)oxy]phenyl}ethyl)benzoic acid (compound bb in table 2, Example 5; 3.5 g) dissolved in THF (200 ml) was added triethylamine (3.6 ml) and isobutyl chloroformate (1.4 ml) at 0 C and the mixture was stined at that temperature for 1 h. Ammonia was then bubbled into the mixture and the reaction was stirred at r.t. o.n. The mixture was quenched by addition of water and the product was extracted in EtOAc, washed with brine, dried over MgS0 and concentrated. Trituration of the residue in ether afforded the title product (5.74 g, 83% yield). MS 506.3, 504.3 (+ESI). Example 24: 5-[4-(2-{3-bromo-5-chloro-2-[(3,5-dimethoxybenzyl)oxy]phenyl}ethyl)phenyl]-lH- tetrazole
Figure imgf000044_0001
Step 1 : 4-(2-{ 3-bromo-5-chloro-2-[(3,5-dimethoxybenzyl)oxy]phenyl }ethyl)benzonitrile To a solution of 4-(2-{3-bromo-5-chloro-2-[(3,5-dimethoxybenzyl)oxy]phenyl}ethyl)benzamide (Example 23, 333 mg) in pyridine (10 ml) at 0 C was added methanesulfonyl chloride (440 uL, 1.5 equiv) and the mixture was stined at r.t. o.n. This mixture was quenched by addition of water and the product was extracted in EtOAc, washed with water and brine, dried over MgS04 and concentrated. The title product (226 mg, 70% yield) was obtained after purification by flash chromatography on silica using 20% EtOAc /hexane as eluent.
Step 2
The tetrazole was prepared from the product of step 1 as described in Example 1, step 4. MS (+ESI)
531.1, 528.8 (M+l).
Example 25: 5-[4-(2-{ 5-chloro-2-[(3,5-dimethoxybenzyl)oxy]biphenyl-3-yl }ethyl)phenyl]-l H-tetrazole
Figure imgf000044_0002
Step 1: 4-(2-{5-chloro-2-[(3,5-dimethoxybenzyl)oxy]biphenyl-3-yl }ethyl)benzamide A mixture containing phenylboric acid (145 mg), 4-(2-{3-bromo-5-chloro-2-[(3,5- dimethoxybenzyl)oxy]phenyl}ethyl)benzamide (Example 23, 400 mg), IM aq. sodium carbonate (3.2 ml), PdBr2(PPh3)2 (44 mg) in toluene:ethanol 3: 1 (12 ml) was degassed and stined at 100 C under nitrogen o.n. The mixture was quenched by addition of water and the product was extracted in EtOAc, washed with water and brine, dried over Na2S0 and concentrated. Trituration of the residue in ether afforded the title product (323 mg, 81% yield).
Step 2
The tetrazole was prepared from the product of step 1 as described in Example 24. MS (+ESI) 527.3
(M+l).
Example 26: 5-[4-(2-{ 5-chloro-3-cyclopropyl-2-[(3,5-dimethoxybenzyl)oxy]phenyl Jethyl)phenyl]-1H- tetrazole
Figure imgf000045_0001
Step 1: 4-(2-{5-chloro-3-cyclopropyl-2-[(3,5-dimethoxybenzyl)oxy]phenylJethyl)benzamide A mixture containing cyclopropaneboronic acid (22 mg), 4-(2-{3-bromo-5-chloro-2-[(3,5- dimethoxybenzyl)oxy]phenyl} ethyl )benzamide (Example 23, 100 mg), water (50 uL), Pd(OAc)2 (2.2 mg), tricyclohexylphosphine (5.6 mg) and potassium phosphate (147 mg) in toluene (1 ml) was degassed and stirred at 100 C under nitrogen for 6 h. The mixture was quenched by addition of sat NH CI and the product was extracted in EtOAc, dried over Na2S04 and concentrated. The title product (64 mg, 59% yield) was obtained after purification by flash chromatography on silica using 50% EtOAc /toluene as eluent.
Step 2: 4-(2-{ 5-chloro-3-cyclopropyl-2-[(3,5-dimethoxybenzyl)oxy]phenyl }ethyl)benzonitrile At 0 C, pyridine (66 uL) and trifluoroacetic anhydride (21 uL) were added to a solution of the amide of step 1 (64 mg) in THF (2 ml) and this mixture was stined at r.t. for 15 min. The reaction was quenched by addition of sat NPL.C1 and the product was extracted in EtOAc, dried over Na2S04 and concentrated. The title product (61.4 mg, 100% yield) was obtained after purification by flash chromatography on silica using 15% EtOAc /hexane as eluent.
Step 3
The tetrazole was prepared from the product of step 2 as described in Example 1, step 4. MS (-ESI) 489.0
(M-l). Example 27: 4-(2-{5-chloro-2-[(3,5-dimethoxybenzyl)oxy]biphenyl-3-yl}ethyl)benzoic acid
Figure imgf000046_0001
This compound was prepared from a palladium catalyzed reaction between phenylboric acid and 4-(2-{3- bromo-5-chloro-2-[(3,5-dimethoxybenzyl)oxy]phenyl}ethyl)benzoic acid (compound bb in table 2, Example 5) as described in Example 25, step 1. MS (-ESI) 503.4, 501.2 (M-l).
Example 28: 4-chloro-3-[(3,5-dimethoxybenzyl)oxy]-2-{2-[4-(lH-tetrazol-5-yl)phenyl]ethyl Jpyridine
Figure imgf000046_0002
Step 1: 4-[(£)-2-(4-chloro-3-methoxypyridin-2-yl)vinyl]benzonitrile
The Wittig reaction between 4-chloro-3-methoxypyridine-2-carbaldehyde (Example 20, step 2) and 4- cyanobenzyltriphenylphosphonium chloride was performed as described in Example 6, step 2.
Step 2: 4-[2-(4-chloro-3-methoxypyridin-2-yl)ethyl]benzonitrile
Reduction of the double bond was achieved as described in Example 18, step 4.
Step 3: 4-[2-(4-chloro-3-hydroxypyridin-2-yl)ethyl]benzonitrile
To the product of step 2 (74 mg) in DMF (10 ml) was added LiCl (34 mg) and this mixture was stined at reflux for 2 days. Water and a small amount of acetic acid were then added and the product was extracted in ether, washed with brine, dried over MgS04 and finally purified by flash chromatography on silica using EtOAc/Hexane 50% as eluent to give 34 mg (48% yield) of the title product.
Step 4: 4-(2-{4-chloro-3-[(3,5-dimethoxybenzyl)oxy]pyridin-2-yl }ethyl)benzonitrile To a solution of the product of step 3 (34 mg) in DMF (3 ml) was added a IM solution of KOt-Bu in THF (150 ul) and this mixture was stined at r.t. for 5 min before addition of 3,5-dimethoxybenzyl chloride (40 mg) and Nal (30 mg). The reaction was performed at 75 C for 3 h and was quenched by addition of a saturated solution of NHUG. The product was extracted in EtOAc, washed with water and brine, dried over MgS0 and purified by preparative TLC with acetone/toluene 20% to yield 40 mg (75%) of the title benzyl ether.
Step 5
Preparation of the tetrazole was performed as described in Example 1, step 4. MS (-APCI) 451.9, 449.8
(M-l).
Example 29: isopropyl 4-(2-{4-chloro-3-[(3,5-dimethoxybenzyl)oxy]pyridin-2-yl }ethyl)benzoate
Figure imgf000047_0001
To a solution of methyl 4-(2-{4-chloro-3-[(3,5-dimethoxybenzyl)oxy]pyridin-2-yl}ethyl)benzoate (Example 20, step 6; 520 mg) in isopropanol (20 ml) was added 60% NaH in oil (50 mg) and this mixture was stined at r.t. for 4 h. The reaction was then quenched by addition of a saturated solution of N tCl. The product was extracted in EtOAc, washed with water and brine, dried over MgS04 and concentrated to yield 553 mg (100 %) of the title material. MS (+ESI) 472.4, 470.3 (M+l). Example 30 Following the method of Example 29, the compounds of Table 3 were prepared.
Table 3
Name Structure MS (+ESI) a. ethyl 4-(2-{4-chloro-3-[(3,5- dimethoxybenzyl)oxy]pyridin-2- y 1 } ethyl)benzoate
Figure imgf000048_0001
b. benzyl 4-(2-{4-chloro-3-[(3,5- dimethoxybenzyl)oxy]pyridin-2- 518.3 (M+l) yl } ethy l)benzoate
Figure imgf000048_0002
Example 31: 3-[(3,5-dimethoxybenzyl)oxy]-4-methoxy-2-{2-[4-(lH-tetrazol-5-yl)phenyl]ethyl Jpyridine
Figure imgf000048_0003
To a solution of 4-chloro-3-[(3,5-dimethoxybenzyl)oxy]-2-{2-[4-(lH-tetrazol-5-yl)phenyl]ethyl Jpyridine (Example 28; 40 mg) in DMF (1 ml) was added methanol (50 ul) and NaΗ (60% in oil, 28 mg) and this mixture was stined at 60 C for 4 h. The reaction was quenched by addition of water and a small amount of acetic acid and the product was extracted in EtOAc, washed with water and brine, dried over MgS0 and concentrated. The title product (23 mg, 26% yield) was obtained after purification by flash chromatography on silica using MeOΗ:CΗ2Cl2:AcOΗ 10:90: 1 as eluent. MS (-ESI) 445.8 (M-l). Example 32: 3-[(3,5-dimethoxybenzyl)oxy]-4-isopropoxy-2-{2-[4-(lH-tetrazol-5- yl)phenyl]ethyl Jpyridine
Figure imgf000049_0001
This compound was prepared as described in Example 31, but with isopropanol instead of methanol. MS (+ESI) 476.
Example 33: 4-isopropenyl-3-[(3-methoxybenzyl)oxy]-2-{(£)-2-[4-(lH-tetrazol-5- y pheny 1] vinyl } pyridine
Figure imgf000049_0002
Step 1: 4-(( )-2-{4-isopropenyl-3-[(3-methoxybenzyl)oxy]pyridin-2-yl }vinyl)benzonitrile In a sealed glass vessel, 4-isopropenyl-3-[(3-methoxybenzyl)oxy]-2-methylpyridine (Example 18, step 3; 3.24 g), xylene (5 ml), Ac20 (2.1 ml) and 4-cyanobenzaldehyde (1.615 g) were heated together at 160 C o.n. This mixture was poured on top of a flash chromatography column and eluted with EtOAc:toluene 10% to yield 3.28 g (71%) of the title product. MS 424.2 (M-l).
Step 2
The tetrazole was prepared from the product of step 1 as described in Example 1, step 4. MS (-ESI) 424
(M-l). Example 34: 4-cyclopropyl-3-[(3-methoxybenzyl)oxy]-2-{ (£ 2-[4-( lH-tetrazol-5- yl)phenyl]vinyl Jpyridine
Figure imgf000050_0001
Step 1: 4-cyclopropyl-3-[(3-methoxybenzyl)oxy]-2-methylpyridine
The cyclopropanation of a solution of 3-[(3-methoxybenzyl)oxy]-2-methyl-4-vinylpyridine (Example 19, step 1; 1.055 g) in THF (10 ml) was achieved with an ethereal diazomethane solution and Pd(OAc)2, as described in Synthesis 1981, 714, to yield 861 mg (79%).
Step 2
Using the procedure of Example 33, the product of step 1 was converted to the title tetrazole. MS (-ESI)
424.2 (M-l).
Example 35: 4-cyclopropyl-3-[(3-methoxybenzyl)oxy]-2-{ 2-[4-( lH-tetrazol-5-yl)phenyl]ethyl Jpyridine
Figure imgf000050_0002
Using the procedure of Example 18, step 6 (with some TΗF to dissolve the compounds), the product of Example 34 was reduced under an atmosphere of hydrogen o.n. MS (-ESI) 426.3 (M-l).
Example 36: 4-isopropyl-3-[(3-methoxybenzyl)oxy]-2-{(£)-2-[4-(lH-tetrazol-5- yl)phenyl] vinyl } pyridine
Figure imgf000050_0003
This tetrazole was prepared from 4-isopropyl-3-[(3-methoxybenzyl)oxy]-2-methylpyridine (Example 18, step 4) using the procedure of Example 33. MS (-ESI) 426.1 (M-l).
Example 37: 4-isopropyl-3-[(3-methoxybenzyl)oxy]-2-{2-[4-(lH-tetrazol-5-yl)phenyl]ethyl Jpyridine
Figure imgf000051_0001
Using the procedure of Example 18, step 6, the product of Example 36 was reduced under an atmosphere of hydrogen. MS (-ESI) 428.1 (M-l).
Example 38: 4-isopropyl-3-[(3-methoxybenzyl)oxy]-2-{2-[4-(lH-tetrazol-5- yl)phenyl]cyclopropyl Jpyridine
Figure imgf000051_0002
Step l: 4-isopropenyl-3-[(3-methoxybenzyl)oxy]-2-{(£)-2-[4-(2-{ [2-(trimethylsilyl)ethoxy]methyl}-2H- tetrazol-5-yl)phenyl]vinyl Jpyridine and 4-isopropenyl-3-[(3-methoxybenzyl)oxy]-2-{(£)-2-[4-(l-{ [2-
(trimethylsilyl)ethoxy]methyl}-lH-tetrazol-5-yl)phenyl] vinyl Jpyridine
To a solution of 4-isopropenyl-3-[(3-methoxybenzyl)oxy]-2-{(£)-2-[4-(lH-tetrazol-5- yl)phenyl] vinyl Jpyridine (Example 33; 4.9 g) in TΗF (114 ml) was added NaΗ (60% in oil, 525 mg) and this mixture was stined at r.t. for 15 min. 2-(Trimethylsilyl)ethoxymethyl chloride (2.3 ml) was then added and this mixture was stirred at r.t. for an hour and quenched by addition of 25% NΗtOAc. The products were extracted in i-PrOAc, dried over Na2S04 and separated by flash chromatography on silica using a gradient of EtOAc :toluene (5 to 20%) to yield 4.84 g (76% yield) of the first isomer as an oil and
1.31 g (20% yield) of the second isomer as a white solid.
Step 2: 4-isopropyl-3-[(3-methoxybenzyl)oxy]-2-{2-[4-(l-{ [2-(trimethylsilyl)ethoxy]methyl J-1H- tetrazol-5-yl)phenyl]ethyl Jpyridine and 4-isopropyl-3-[(3-methoxybenzyl)oxy]-2-{(£)-2-[4-(l-{ [2- (trimethylsilyl)ethoxy]methyl}-lH-tetrazol-5-yl)phenyl]vinyl Jpyridine
The second isomer prepared in step 1 (1.31 g) was partially hydrogenated for 6 h as described in Example 18, step 6, to give two products, which were separated by flash chromatography on silica using EtOAc:toluene 20% and 40% to yield 413 mg (31% yield) of the monohydrogenated product and 739 mg (56% yield) of the dihydrogenated product.
Step 3: 4-isopropyl-3-[(3-methoxybenzyl)oxy]-2-{2-[4-(l-{ [2-(trimethylsilyl)ethoxy]methyl}-lH- tetrazol-5-yl)phenyl]cyclopropyl Jpyridine
The monohydrogenated compound prepared in step 2 was treated sequentially with diazomethane and palladium acetate (see Example 34, step 1) to yield the cyclopropane derivative.
Step 4
The protecting group of the product of step 3 (124 mg) was cleaved by treatment with 2.5 equiv of tetrabutylammonium fluoride in TΗF (2 ml) at 60 C for 16 h. The reaction was quenched by addition of 25% NELOAc and the product was extracted in EtOAc, dried over Na2S04 and purified by flash chromatography on silica using EtOAc:toluene:AcOΗ 40:60:2 to yield 75 mg (88% yield) of the deprotected tetrazole. MS (+ESI) 442.2 (M+l), 414. Example 39: 3-[(3,5-dibromobenzyl)oxy]-4-isopropyl-2-{2-[4-(lH-tetrazol-5-yl)phenyl]ethyl Jpyridine
Figure imgf000053_0001
Step 1: 4-isopropenyl-3-[(3-methoxybenzyl)oxy]-2-((£)-2-{4-[2-(methoxymethyl)-2H-tetrazol-5- yl]phenyl}vinyl)pyridine and 4-isopropenyl-3-[(3-methoxybenzyl)oxy]-2-((£)-2-{4-[l-(methoxymethyl)- lH-tetrazol-5-yl]phenyl}vinyl)pyridine
Using the procedure of Example 38, step 1, but replacing SEMCl by chloromethyl methyl ether, these two products were prepared. The first isomer was obtained as an oil in 77% yield and the second isomer was a yellow solid (23% yield).
Step 2: 4-isopropyl-2-(2-{4-[l-(methoxymethyl)-lH-tetrazol-5-yl]phenyl}ethyl)pyridin-3-ol The second isomer of step 1 (830 mg) was dissolved in ethanol:EtOAc:AcOΗ 20:10:3 (66 ml). It was hydrogenated in the presence of 10% Pd/C (200 mg) under 1 atm of hydrogen o.n. The catalyst was filtered through celite and the product was purified by flash chromatography on silica to yield 496 mg of an oil (81% yield).
Step 3
The pyridinol of step 2 was benzylated as described in Example 1, step 1. The protecting group was then removed by heating a solution of the protected tetrazole (311 mg) in THF (14 ml) with 6N HCl (3 ml) at 50 C for 7 h. This reaction was quenched by addition of 25% NHtOAc. The product was extracted in EtOAc, dried over Na2S04 and purified by flash chromatography on silica using MeOH:CH2Cl2: AcOH 7:93: 1 to yield 288 mg (100% yield) of the title tetrazole as a white solid after trituration in ether. MS (+ESI) 560.0, 558.0, 556.0 (M+l). Example 40 Following the method of Example 39, the compounds of Table 4 were prepared.
Table 4
Name Structure MS (+ESI)
a. 3-[(2,6-dichloropyridin-4-yl)methoxy]-4- isopropyl-2-{2-[4-(lH-tetrazol-5- 469.1 (M+l) yl)phenyl]ethyl Jpyridine (a)
b. 3-{ [3,5-bis(trifluoromethyl)benzyl]oxy }- 4-isopropyl-2-{ 2-[4-( lH-tetrazol-5- 536.3 (M+l) yl)phenyl]ethyl Jpyridine
c. 3-[(3,5-dimethoxybenzyl)oxy]-4- isopropyl-2-{2-[4-(lH-tetrazol-5- 460.2 (M+l) yl)phenyl]ethyl Jpyridine (a, b)
Figure imgf000054_0001
d. 3-[(3,5-dichlorobenzyl)oxy]-4-isopropyl- 2-{2-[4-(l/7-tetrazol-5- yl)phenyl]ethyl Jpyridine (a)
Figure imgf000054_0002
e. 3-{[3-(difluoromethoxy)benzyl]oxy}-4- isopropyl-2-{2-[4-(lH-tetrazol-5- 466.3 (M+l) yl)phenyl]ethyl Jpyridine
Figure imgf000055_0001
f. 3-[(3,5-difluorobenzyl)oxy]-4-isopropyl-2- {2-[4-(lH-tetrazol-5- yl)phenyl]ethyl } pyridine
Figure imgf000055_0002
(a) The alkylation of the pyridinol was performed with the benzyl chloride in DMF at 75 C o.n. in the presence of 1.3 equiv. of Nal. (b) Cleavage of the MOM protecting group at r.t. for 2 days.
Example 41: 6-bromo-3-[(3,5-dichlorobenzyl)oxy]-4-isopropyl-2-{2-[4-(lH-tetrazol-5- yl)phenyl]ethyl } pyridine
Figure imgf000055_0003
Step 1: 6-bromo-4-isopropyl-2-{2-[4-(2-{ [2-(trimethylsilyl)ethoxy]methyl}-2H-tetrazol-5- yl)pheny 1] ethyl } py ridin -3 -ol
Reduction of 4-isopropenyl-3-[(3-methoxybenzyl)oxy]-2-{ (E)-2-[4-(2-{ [2- (trimethylsilyl)ethoxy]methyl}-2H-tetrazol-5-yl)phenyl]vinyl}pyridine (Example 38, step 1) was performed as described in Example 39, step 2. To a solution of the pyridinol thus obtained (2.098 g) in CH2C12 (25 ml) was added N-bromosuccinimide at 0 C and this mixture was stirred at r.t. for 30 min. This reaction was quenched by addition of 25% NHjOAc and some sodium thiosulfate. The products were extracted in EtOAc, dried over Na2S0 and purified by flash chromatography on silica using 10% EtO Ac/toluene to yield 1.888 g (77%) of the bromopyridinol. MS (-ESI) 517.9, 515.9 (M-l)
Step 2
The product of step 1 was benzylated with dichlorobenzyl chloride as in Example 28, step 4, and the SEM protecting group was cleaved as in Example 38, step 4. MS (-ESI) 548.0, 546.0 (M-l), 544.0.
Example 42: 6-bromo-3-[(3,5-dibromobenzyl)oxy]-4-isopropyl-2-{ 2-[4-( lH-tetrazol-5- yl)phenyl]ethyl Jpyridine
Figure imgf000056_0001
This compound was prepared as described in Example 41, with the exception that the benzylation was performed with dibromobenzyl bromide at r.t. for 1 h. MS (+ESI) 639.6, 637.8, 635.8, 634.0 (M-l).
Example 43: 5-[(3,5-dichlorobenzyl)oxy]-4-isopropyl-N,N-dimethyl-6-{2-[4-(lH-tetrazol-5- yl)phenyl] ethyl }pyridin-2-amine
Figure imgf000056_0002
The palladium coupling reaction between 6-bromo-3-[(3,5-dichlorobenzyl)oxy]-4-isopropyl-2-{2-[4-(2- { [2-(trimethylsilyl)ethoxy]methyl}-2H-tetrazol-5-yl)phenyl]ethyl Jpyridine (intermediate in Example 41, step 2) and dimethylamine was performed as described in I. Org. Chem. 1996, 7240. The SEM protecting group was cleaved as in Example 38, step 4. MS (+ESI) 512.8, 510.8 (M+l). Assays for Determining Biological Activity The utility for the compounds of formula I for the treatment of glaucoma and other conditions that are related to elevated intraocular pressure in the eye, and for the treatment of diseases affecting the bone modeling and remodeling processes, can be demonstrated using the following assays. Their agonist activity in vitro and in vivo, along with their selectivity for the EP receptor, can be evaluated.
I. Effects of an EP Agonist on Intraocular Pressure (IOP) in Rabbits and Monkeys
A. Animals Drug-naive, male Dutch Belted rabbits and female cynomolgus monkeys are used in this study. Animal care and treatment in this investigation are in compliance with guidelines by the National Institute of Health (NUT) and the Association for Research in Vision and Ophthalmology (ARVO) resolution in the use of animals for research. All experimental procedures were approved by the Institutional Animal Care and Use Committee of Merck and Company.
B. Drug Preparation and Administration Drug concentrations are expressed in terms of the active ingredient (base). The compounds of this invention are dissolved in a suitable vehicle for topical administration in the eye at 0.05, 0.01, 0.001, 0.0001 % for rabbit study and 0.05, 0.005% for monkey studies. Drug or vehicle aliquots (25 ul) are administered topically unilaterally or bilaterally. In unilateral applications, the contralateral eyes receive an equal volume of vehicle. Proparacaine (0.5%) is applied to the cornea prior to tonometry to minimize discomfort. Intraocular pressure (IOP) is recorded using a pneumatic tonometer (Alcon Applanation Pneumatonograph) or equivalent.
C. Analysis The results are expressed as the changes in IOP from the basal level measured just prior to administration of drug or vehicle and represent the mean, plus or minus standard deviation. Statistical comparisons are made using the Student's t-test for non-paired data between responses of drug-treated and vehicle-treated animals and for paired data between ipsilateral and contralateral eyes at comparable time intervals. The significance of the data is also determined as the difference from the "t-0" value using Dunnett's "t" test. Asterisks represent a significance level of p < 0.05.
D. Intraocular Pressure Measurement in Rabbits Male Dutch Belted rabbits weighing 2.5-4.0 kg are maintained on a 12- hour light/dark cycle and rabbit chow. All experiments are performed at the same time of day to minimize variability related to diurnal rhythm. IOP is measured before treatment then the compounds of this invention or vehicle are instilled (one drop of 25 ul) into one or both eyes and IOP is measured at 30, 60, 120, 180, 240, 300, and 360 minutes after instillation. In some cases, equal number of animals treated bilaterally with vehicle only are evaluated and compared to drug treated animals as parallel controls.
E. Intraocular Pressure Measurements in Monkeys. Unilateral ocular hypertension of the right eye is induced in female cynomolgus monkeys weighing between 2 and 3 kg by photocoagulation of the trabecular meshwork with an argon laser system (Coherent Novus 2000, Palo Alto, USA) using the methods of De Gaasterland 1974 (Gaasterland de, Kupfer, C. (1974) Experimental glaucoma in the rhesus monkey Invest Ophthalmol 13,455-457) and Quigley (1983), (Quigley HA, Hohman, RM (1983) Laser energy levels for trabecular meshwork damage in the primate eye Invest Ophthalmol Vis Sci 24,1305-1307). The prolonged increase in intraocular pressure (IOP) results in changes to the optic nerve head that are similar to those found in glaucoma patients. For IOP measurements, the monkeys are kept in a sitting position in restraint chairs for the duration of the experiment. Animals are lightly anesthetized by the intramuscular injection of ketamine hydrochloride (3-5 mg/kg) approximately five minutes before each IOP measurement and one drop of 0.5% proparacaine was instilled prior to recording IOP. IOP is measured using a pneumatic tonometer (Alcon Applanation Tonometer) or a Digilab pneumatonometer (Bio-Rad Ophthalmic Division, Cambridge, MA, USA). IOP is measured before treatment and generally at 30, 60, 124, 180, 300, and 360 minutes after treatment. Baseline values are also obtained at these time points generally two or three days prior to treatment. Treatment consists of instilling one drop of 25 ul of the compounds of this invention (0.05 and 0.005 %) or vehicle. At least one-week washout period is employed before testing on the same animal. The normotensive (contralateral to the hypertensive) eye is treated in an exactly similar manner to the hypertensive eye. IOP measurements for both eyes are compared to the conesponding baseline values at the same time point. Results are expressed as mean plus-or-minus standard deviation in mm Hg. The activity range of the compounds of this invention for ocular use is between 0.01 and 100,000 nM.
II. Effects of an EP4 Agonist on Bone Resorption in Rats:
A. Animal Procedures: For mRNA localization experiments, 5-week old Sprague-Dawley rats (Charles River) are euthanized by C02, their tibiae and calvariae are excised, cleaned of soft tissues and frozen immediately in liquid nitrogen. For EP4 regulation experiments, 6-week old rats are given a single injection of either vehicle (7% ethanol in sterile water) or an anabolic dose of PGE2 (Cayman Chemical, Ann Arbor, MI), 3-6 mg/kg in the same vehicle, intraperitoneally. Animals are euthanized at several time points post-injection and their tibiae and calvariae, as well as samples from lung and kidney tissues are frozen in liquid nitrogen.
B. Cell Cultures RP-1 periosteal cells are spontaneously immortalized from primary cultures of periosteal cells from tibiae of 4-week old Sprague-Dawley rats and are cultured in DMEM (BRL, Gaithersburg, MD) with 10 % fetal bovine serum (JRH Biosciences, Lenexa, KS). These cells do not express osteoblastic phenotypic markers in early culture, but upon confluence, express type I collagen, alkaline phosphatase and osteocalcin and produce mineralized extracellular matrix. RCT-1 and RCT-3 are clonal cell lines immortalized by SV-40 large T antigen from cells released from fetal rat calvariae by a combination of collagenase/hyaluronidase digestion. RCT-1 cells, derived from cells released during the first 10 minutes of digestion (fraction I), are cultured in RPMI 1640 medium (BRL) with 10% fetal bovine serum and 0.4 mg/ml G418 (BRL). These cells differentiate and express osteoblastic features upon retinoic acid treatment. RCT-3 cells, immortalized from osteoblast- enriched fraction III cells, are cultured in F-12 medium (BRL) with 5% Fetal bovine serum and 0.4 mg/ml G418. TRAB-11 cells are also immortalized by SV40 large T antigen from adult rat tibia and are cultured in RPMI 1640 medium with 10% FBS and 0.4 mg/ml G418. ROS 17/2.8 rat osteosarcoma cells are cultured in F-12 containing 5% FBS. Osteoblast-enriched (fraction III) primary fetal rat calvaria cells are obtained by collagenase/hyaluronidase digestion of calvariae of 19 day-old rat fetuses. See Rodan et al., Growth stimulation of rat calvaria osteoblastic cells by acidic FGF, Endocrinology, 121, 1919-1923 (1987), which is incoφorated by reference herein in its entirety. Cells are released during 30-50 minutes digestion (fraction LTI) and are cultured in F-12 medium containing 5% FBS. P815 (mouse mastocytoma) cells, cultured in Eagles MEM with 10% FBS, and NRK (normal rat kidney fibroblasts) cells, cultured in DMEM with 10% FBS, are used as positive and negative controls for the expression of EP4, respectively. See Abramovitz et al., Human prostanoid receptors: cloning and characterization. In: Samulesson B. et al. ed, Advances in prostaglandin, Thromboxanes and leukotriene research, vol. 23, pp. 499-504 (1995) and de Larco et al., Epithelioid and fibroblastic rat kidney cell clones: EGF receptors and the effect of mouse sarcoma virus transformation, Cell Physiol, 94, 335-342 (1978), which are both incoφorated by reference herein in their entirety. C. Northern Blot Analysis: Total RNA is extracted from the tibial metaphysis or diaphysis and calvaria using a guanidinium isothiocyanate-phenol-chloroform method after pulverizing frozen bone samples by a tissue homogenizer. See P. Chomczynski et al., Single-step method of RNA isolation by acid guanidium thiocyanate-phenol-chloroform extraction., Analyt Biochem, 162, 156-159 (1987), which is incoφorated by reference herein in its entirety. RNA samples (20 mg) are separated on 0.9% agarose/formaldehyde gels and transfened onto nylon membranes (Boehringer Mannheim, Germany). Membranes are prehybridized in Hybrisol I (Oncor, Gaithersburg, MD) and 0.5 mg/ml sonicated salmon sperm DNA (Boehringer) at 42 C for 3 hours and are hybridized at 42 C with rat EP2 and mouse EP4 cDNA probes labeled with [32P]-dCTP (Amersham, Buckinghamshire, UK) by random priming using the rediprime kit (Amersham). After hybridization, membranes are washed 4 times in 2xSSC + 0.1% SDS at room temperature for a total of 1 hour and once with 0.2xSSC + 0.1% SDS at 55 C for 1 hour and then exposed to Kodak XAR 2 film at -70 C using intensifying screens. After developing the films, bound probes are removed twice with 0.1% SDS at 80 C and membranes are hybridized with a human GAPDH (Glyceraldehyde 3-Phosphate Dehydrogenase) cDNA probe (purchased from Clontech, Palo Alto, CA) for loading control.
D. In-Situ Hybridization: Frozen tibiae are sectioned coronally at 7 mm thickness and sections are mounted on charged slides (Probe On Plus, Fisher Scientific, Springfield, NJ) and are kept at -70 C until hybridization. cRNA probes are labeled with 35S-UTPgS (ICN, Costa Mesa, CA) using a Riboprobe II kit (Promega Madison, WI). Hybridization is performed overnight at 50 C. See M. Weinreb et al., Different pattern of alkaline phosphatase, osteopontin and osteocalcin expression in developing rat bone visualized by in-situ hybridization, 1. Bone Miner Res., 5, 831-842 (1990) and D. Shinar et al., Expression of alphav and beta3 integrin subunits in rat osteoclasts in situ, J. Bone Miner. Res., 8, 403-414 (1993), which are both incoφorated by reference herein in their entirety. Following hybridization and washing, sections are dipped in Ilford K5 emulsion diluted 2: 1 with 6% glycerol in water at 42 C and exposed in darkness at 4 C for 12-14 days. Slides are developed in Kodak D-19 diluted 1:1 with water at 15 C, fixed, washed in distilled water and mounted with glycerol -gelatin (Sigma) after hematoxylin staining. Stained sections are viewed under the microscope (Olympus, Hamburg, Germany), using either bright-field or dark-field optics.
E. Expression of EP in Osteoblastic Cell Lines and in Bone Tissue. The expression of EP and EP2 mRNA is examined in various bone derived cells including osteoblast-enriched primary rat calvaria cells, immortalized osteoblastic cell lines from fetal rat calvaria or from adult rat tibia and an osteoblastic osteosarcoma cell line. Most of the osteoblastic cells and cell lines show significant amounts of 3.8 kb EP4 mRNA, except for the rat osteosarcoma cell line ROS 17/2.8. Consistent with this finding, in ROS 17/2.8 cells PGE2 has no effect on intracellular cAMP, which is markedly induced in RCT-3 and TRAB-11 cells. Treatment of RCT-1 cells with retinoic acid, which promotes their differentiation, reduces the levels of EP mRNA. NRK fibroblasts do not express EP4 mRNA, while P815 mastocytoma cells, used as positive controls, express large amounts of EP4 mRNA. In contrast to EP mRNA, none of the osteoblastic cells and cell lines express detectable amounts of EP2 mRA in total RNA samples. Expression of EP4 mRNA in osteoblastic cells, EP4 is also expressed in total RNA isolated from tibiae and calvariae of 5-week-old rats. In contrast, no EP2 mRNA is found in RNA from tibial shafts.
F. PGE2 Induces the Expression of EP mRNA in RP-1 Periosteal Cells and in Adult Rat Tibiae PGE2 enhances its own production via upregulation of cyclooxygenase 2 expression in osteoblasts and in bone tissue thus autoamplifying its own effects. PGE2 also increases the levels of EP mRNA. RP-1 cells are immortalized from a primary culture of adult rat tibia periosteum is examined. These cells express osteoblast phenotypic markers upon confluence and form mineralized bone matrix when implanted in nude mice. Similar to the other osteoblastic cells examined, RP-1 periosteal cells express a 3.8 kb EP4 transcript. Treatment with PGE2 (10'6 M) rapidly increases EP4 mRNA levels peaking at 2 hours after treatment. PGE2 has no effect on EP mRNA levels in the more differentiated RCT-3 cells pointing to cell-type specific regulation of EP4 expression by PGE2. EP2 mRNA is not expressed in RP-1 cells before or after treatment with PGE . To examine if PGE2 regulates EP4 mRNA levels in vivo in bone tissue, five-week-old male rats are injected with PGE2 (3-6 mg/kg). Systemic administration of PGE2 rapidly increased EP4 mRNA levels in the tibial diaphysis peaking at 2 h after injection. A similar effect of PGE2 on EP4 mRNA is observed in the tibial metaphysis and in calvaria. PGE2 induces EP4 mRNA levels in vitro in osteogenic periosteal cells and in vivo in bone tissue in a cell type-specific and tissue-specific manner. PGE2 does not induce EP2 mRNA in RP-1 cells nor in bone tissue.
G. Localization of EP4 mRNA Expression in Bone Tissue In situ hybridization is used in order to localize cells expressing EP in bone. In control experiment (vehicle-injected) rats, low expression of EP is detected in bone manow cells. Administration of a single anabolic dose of PGE2 increased the expression of EP in bone manow cells. The distribution of silver grains over the bone manow is not uniform and occurs in clumps or patches in many areas of the metaphysis. Within the tibial metaphysis, EP4 expression is restricted to the secondary spongiosa area and is not seen in the primary spongiosa. Hybridization of similar sections with a sense probe (negative control) does not show any signal. EP4 is expressed in osteoblastic cells in vitro and in bone manow cells in vivo, and is upregulated by its ligand, PGE2.
Ill Collagen Type I Alpha 1 Expression in Rat Tibia
A. Animals: Eight-month-old intact female Sprague-Dawley rats were treated with an EP agonist or with PGE2 (positive control). Treatment was carried out by daily subcutaneous injections of the EP agonist at a suitable dose or PGE2 at 3mg/kg/day for 4 days. Six rats were sacrificed for each treatment 24 hours after the last injection. Tibia were removed and cleaned from sunounding muscle. Diaphysis part of tibia was washed with 0.9% sodium chloride to remove bone manow and frozen in liquid nitrogen prior to RNA isolation.
B. RNA Isolation: Frozen tibia from 3 animals (2 pools/group) were pooled together, crushed and homogenized in Trizol reagent (Life Technologies, Inc.) using Polytron PT 10-35. Total RNA was extracted from rat tibia diaphysis using Purescript RNA Isolation Kit (Gentra Systems) followed by DNase treatment on RNeasy Micro Columns (Qiagen) according to manufacturer's instructions.
C. Real-Time RT-PCR (TaqMan) Analysis Expression of Collagen Type I Alpha 1 gene was determined by real-time RT-PCR (TaqMan) analysis using an Applied Biosystems 7700 Sequence Detector System (Applied Biosystems). cDNA was prepared using TaqMan Reverse Transcription Reagents (Applied Biosystems). The PCR reaction was performed in duplicates using TaqMan PCR Core Reagent Kit (Applied Biosystems), 200nM each primer and probe, and lOul of cDNA template according to manufacturer's instructions. Gene-specific primers and fluorescence labeled probes (5 '-reporter dye: FAM, 3 '-quencher dye: TAMRA) were designed using Primer Express (version 1.5) software (Applied Biosystems) and synthesized by Applied Biosystems. Primer sequences were: COLI-Rat-F:
CAACAGTCGATTCACCTACAGCA and COLI-Rat-R: TGACTGTCTTGCCCCAAGTTC, probe sequence:TGTGGATGGCTGCACGAGTCACAC. Comparative Ct method was used to measure RNA expression levels, while 18S Ribosomal RNA Control Reagents (Applied Biosystems) were used for normalization. The effects of treatment on COLI mRNA are presented as expression levels relative to that of the vehicle group (set as 1). TV. In-Vitro Determination of EP4 Agonist Affinity, Selectivity and Potency
A. Radioligand Binding Assays: The assays used to test these compounds were performed essentially as described in: Abramovitz M, Adam M, Boie Y, Carriere M, Denis D, Godbout C, Lamontagne S, Rochette C, Sawyer N, Tremblay NM, Belley M, Gallant M, Dufresne C, Gareau Y, Ruel R, Juteau H, Labelle M, Ouimet N, Metters KM. The utilization of recombinant prostanoid receptors to determine the affinities and selectivities of prostaglandins and related analogs. Biochim Biophys Acta 2000J4δ3(2):285-293 and discussed below:
B. Stable expression of prostanoid receptors in the human embryonic kidney (HEK) 293(EBNA) cell line Prostanoid receptor (PG) cDNAs conesponding to full length coding sequences were subcloned into the appropriate sites of the mammalian expression vector pCEP4 (Invitrogen). pCEP4PG plasmid DNA was prepared using the Qiagen plasmid preparation kit (QIAGEN) and transfected into HEK 293(EBNA) cells using Lipofect AMINE® (GIBCO-BRL) according to the manufacturers' instructions. HEK 293(EBNA) cells expressing the cDNA together with the hygromycin resistance gene were selected in Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% heat inactivated fetal bovine serum, 1 mM sodium pyruvate, 100 U/ml Penicillin-G, 100 μg/ml Streptomycin sulphate, 250 μg/ml active GENETICIN™ (G418) (all from Life Technologies, Inc./BRL) and 200 μg/ml hygromycin (Calbiochem). Individual colonies were isolated after 2-3 weeks of growth under selection using the cloning ring method and subsequently expanded into clonal cell lines. Expression of the receptor cDNA was assessed by receptor binding assays. HEK 293(EBNA) cells were grown in supplemented DMEM complete medium at 37 C in a humidified atmosphere of 6% C02 in air, then harvested and membranes prepared by differential centrifugation (1000 x g for 10 min, then 160,000 x g for 30 min, all at 4 C) following lysis of the cells by nitrogen cavitation at 800 psi for 30 min on ice in the presence of protease inhibitors (2 mM phenylmethylsulfonylfluoride, 10 μM E-64, 100 μM leupeptin and 0.05 mg/ml pepstatin). The 160,000 x g pellets were resuspended in 10 mM HEPES/KOH (pH 7.4) containing 1 mM EDTA at approximately 5- 10 mg/ml protein by Dounce homogenisation (Dounce A; 10 strokes), frozen in liquid nitrogen and stored at -80 C.
C. Prostanoid Receptor Binding Assays Prostanoid receptor binding assays were performed in a final incubation volume of 0.2 ml in 10 mM MES/KOH (pH 6.0) (EP subtypes, FP and TP) or 10 mM HEPES/KOH (pH 7.4) (DP and IP), containing 1 mM EDTA, 10 mM MgCl2 (EP subtypes) or 10 mM MnCl2 (DP, FP, IP and TP) and radioligand [0.5-1.0 nM [3H]PGE2 (181 Ci/mmol) for EP subtypes, 0.7 nM [3H]PGD2 (115 Ci/mmol) for DP, 0.95 nM [3H]PGF2D (170 Ci/mmol) for FP, 5 nM [3H]iloprost (16 Ci/mmol) for IP and 1.8 nM [3H]SQ 29548 (46 Ci/mmol) for TP]. EP3 assays also contained 100 μM GTPγS. The reaction was initiated by addition of membrane protein (approximately 30 μg for EPi, 20 μg for EP2, 2 μg for EP3, 10 μg for EP4, 60 μg for FP, 30 μg for DP, 10 μg for IP and 10 μg for TP) from the 160,000 x g fraction. Ligands were added in dimethylsulfoxide (Me2SO) which was kept constant at 1 % (v/v) in all incubations. Non-specific binding was determined in the presence of 1 μM of the conesponding non- radioactive prostanoid. Incubations were conducted for 60 min (EP subtypes, FP and IP) or 30 min (DP and TP) at 30 C (EP subtypes, DP, FP and TP) or room temperature (IP) and terminated by rapid filtration through a 96-well Unifilter GF/C (Canbena Packard) prewetted in assay incubation buffer without EDTA (at 4 C) and using a Tomtec Mach HI 96-well semi-automated cell harvester. The filters were washed with 3-4 ml of the same buffer, dried for 90 min at 55 C and the residual radioactivity bound to the individual filters determined by scintillation counting with addition of 50 μl of Ultima Gold F (Canbena Packard) using a 1450 MicroBeta (Wallac). Specific binding was calculated by subtracting non-specific binding from total binding. Specific binding represented 90-95 % of the total binding and was linear with respect to the concentrations of radioligand and protein used. Total binding represented 5-10 % of the radioligand added to the incubation media.
D. EP prostanoid receptor agonist and antagonist assays Whole cell second messenger assays measuring stimulation of intracellular cAMP in HEK 293(ebna) cells recombinantly expressing the EP4 receptor are performed to determine whether receptor ligands are agonists or antagonists. For cAMP assays, cells are harvested and resuspended in HBSS containing 25 mM HEPES, pH 7.4. Incubations contain 0.5mM IBMX (phosphodiesterase type IV inhibitor, available from Biomol). Samples are incubated at 37 C for 30 min, the reaction is terminated and cAMP levels are then measured. Ligands are added in dimethyl sulfoxide which is kept constant at 1 % (v/v) in all incubations. For agonists, second messenger responses are expressed as a function of ligand concentration and both EC50 values and the maximum response as compared to a PGE2 standard are calculated. For antagonists, the ability of a ligand to inhibit an agonist response is determined by Schild analysis and both Kβ and slope values are calculated.
Table 3: Binding affinities (nM) to the various PGE2 receptors for representative compounds of USP 5,530,157 compared to compounds of this invention. Number Structure EP, EP2 EP3 EP4
Figure imgf000065_0001
Figure imgf000065_0002
Figure imgf000065_0003
Figure imgf000066_0001
USP 5,530,157 disclosed analogs of compounds 1-5 as anti-inflammatory agents, but their action on the PGE2 receptors was not discussed. In Table 3, compounds 1 and 2 are typical of the best compounds covered by USP 5,530,157 and they are almost completely inactive on the PGE2 receptors. Compounds 3- 5 show activity on EPi, EP2 and EP4 receptors; in general, they are more selective towards EP2. Compounds of the present invention 6-7, which contain a substituent on the middle benzene ring (conesponding to the substituent Y in formula I) possess at least a 10-20 fold greater activity on EP4 and are agonists on both EP2 and EP receptors. Compounds 8 and 9 of the present invention are even more active and selective for EP .

Claims

WHAT IS CLAIMED IS: 1. A compound having the structural formula I:
Figure imgf000067_0001
FORMULA I or a pharmaceutically acceptable salt, enantiomer, diastereomer, prodrug or mixture thereof, wherein,
Zi represents C-Wi, or N;
W, Wi and X independently are H, NR4R4, or halogen;
Y represents hydrogen, halogen, Ci-4 alkoxy, Cι_4 alkyl, C2-4 alkenyl, aryl, heterocyclyl, C3.6 cycloalkyl, NO2 or CF3, said alkyl, alkenyl, aryl and heterocyclyl optionally substituted with 1-3 groups
Rl and R2 independently are H, halogen, or Ci-4 alkyl;
or Ri and 2 may optionally be linked together to form a 3 to 5 membered carbon ring optionally interrupted with 1-2 heteroatoms chosen from O, S, SO, SO2, and N 9;
R3 represents Ri or OH or R3 and R] attached to the same carbon may form a carbonyl group;
Q is CO2R4, tetrazolyl, SO3R4, -CF2SO2NH2, -SO2NH2, CONHSO2R5, SO2NHCOR7, -PO(OH)2, CONHP02R6. CONHRδ, -COCH2OH, or heterocyclyl containing acidic hydroxyl groups, said heterocyclyl unsubstituted or substituted with 1 to 3 groups of RiO;
Ari represents phenyl, pyridinyl or thienyl provided that the two substituents (CRιR2)n and (CRιR2)m are para to each other for phenyl and pyridinyl or on the 2,5-positions of the thienyl; said Ari optionally substituted with 1-3 groups of RiO; Aτ2 represents 2,l,3-benzoxadiazol-5-yl, phenyl, pyridyl or thienyl, optionally substituted with 1-3 groups selected from halogen, -6 alkyl, OCi-6 alkyl, CO2H, SCi-6 alkyl, CF3, OCF3, and SCF3;
R4 represents H or Ci-6 alkyl;
R5, R6, R7 and R8 represents Ci-6 alkyl, CF3, aryls, heteroaryls, heterocyclyls, ZAryl or Zheteroaryl, said aryls, heteroaryls, heterocyclyls being unsubstituted or substituted with 1 to 3 groups of RiO;
Z is an optional linker containing 0-4 carbon atoms, optionally substituted with Ci-4 alkyl;
R9 represents hydrogen, Ci -6 alkyl, said alkyl optionally substituted with 1-3 halogen, CN, OH, Ci-6 alkoxy, Ci -45 acyloxy or amino;
RiO represents halogen, Ci-6 alkoxy, Ci-6 alkyl, CF3, cyano, aryls, heteroaryls, heterocyclyls, SCi-6 alkyl, SC6-10 ryl' sc5-10 heterocyclyl, OC6-10 aryl, OC5 0 heterocyclyl, CH2OC1-6 alkyl, CH2SC1- 6 alkyl, CH2θaryl, CH2Saryl;
m represents 2 or 3; n represents 0 or 1 ; and p represents 0-2.
2. A compound according to claim 1 wherein Z\ is C-Wi.
3. A compound according to claim 1 wherein Z\ is N.
4. A compound according to claim 1 wherein Z is C-Wi t W and Wi are hydrogen, Q is CO2R4 or tetrazolyl, p=n=0, Ar2 is phenyl or pyridyl, substituted in ortho and or meta position relative to CR1R2 with one or more halogen, OMe, OCF3 or SCF3, and Y is chloride, bromide, iodide or C 1-4 alkyl.
5. A compound according to claim 1 wherein Y is chloride, bromide, iodide, methyl, ethyl, W and Wi are H, Q is CO2R4 or tetrazolyl, Ari is a benzyl or thienyl, optionally substituted by halogens, 0-CRιR2-(CRιR3)p-Ar2 is 0-(CH2)ι.3-Ar2, (CRιR2)m is CH2CH2 or 1,2- cyclopropyl and Ar2 is phenyl or 4-pyridyl. mono or disubstituted at the meta position relative to CR1R2 with Cl, Br, I, OMe, OCF3 or SCF3.
6. A compound according to claim 1 wherein (0)θ-l-CRιR2-(CRιR3)p-Ar2 is CH2CH2AT2 and (CRιR2)m is CH2CH2 or 1,2-cyclopropyl.
7. A compound according to claim 3 wherein Y is chloride, bromide, iodide, methyl, ethyl, W is H, Q is CO2R4 or tetrazolyl, Ari i a benzyl or thienyl, optionally substituted by halogens, 0-CRιR2-(CRιR3)p-Ar2 is 0-CH2-Ar2, (CRιR2)m is CH2CH2 or 1,2-cyclopropyl and Ar2 is phenyl or 4-pyridyl. mono or disubstituted at the meta position relative to CR1R2 with Cl, Br, I, OMe, OCF3 or SCF3,.
8. A compound which is: 4-{2-[2-(benzyloxy)-3-ethoxyphenyl]ethyl Jbenzoic acid;
4-{ 2-[2-(benzyloxy)-3-bromo-5-chlorophenyl]ethyl Jbenzoic acid; sodium 4-{ 2-[2-(benzyloxy)-3-ethoxyphenyl]ethyl Jbenzoate; sodium 4-{2-[2-(benzyloxy)-3-bromo-5-chlorophenyl]ethyl}benzoate;
4-{ 2-[2-(benzyloxy)-3,5-dichlorophenyl]ethyl Jbenzoic acid;
4-(2-{ 3-bromo-5-chloro-2-[(3-methoxybenzyl)oxy]phenyl }ethyl)benzoic acid;
4-{ 2-[3-bromo-5-chloro-2-(2-phenylethoxy)phenyl]ethyl Jbenzoic acid;
5-(4-{2-[2-(benzyloxy)-3,5-dichlorophenyl]ethyl}phenyl)-lH-tetrazole;
4-[2-(3-bromo-5-chloro-2-{ [3-(trifluoromethyl)benzyl]oxy }phenyl)ethyl]benzoic acid;
5-[4-(2-{3-bromo-5-chloro-2-[(3-methoxybenzyl)oxy]phenyl}ethyl)phenyl]-lH-tetrazole;
4-(2-{3-methoxy-2-[(3-methoxybenzyl)oxy]phenyl}ethyl)benzoic acid;
4-(2-{3-bromo-2-[(3-bromobenzyl)oxy]-5-chlorophenyl}ethyl)benzoic acid;
4-(2-{2-[(3-methoxybenzyl)oxy]-3-methylphenyl}ethyl)benzoic acid;
4-(2-{ 3-bromo-5-chloro-2-[(5-chloro-2-fluorobenzyl)oxy]phenyl }ethyl)benzoic acid;
4-(2-{ 3-bromo-5-chloro-2-[(3-methylbenzyl)oxy]phenyl }ethyl)benzoic acid;
4-(2-{ 3-bromo-5-chloro-2-[(2,4-difluorobenzyl)oxy]phenyl }ethyl)benzoic acid;
4-{ 2-[3-bromo-5-chloro-2-(2-oxo-2-phenylethoxy)phenyl]ethyl Jbenzoic acid;
4-(2-{ 3-bromo-5-chloro-2-[(2-fluoro-3-methylbenzyl)oxy]phenyl }ethyl)benzoic acid;
4-[2-(3-bromo-5-chloro-2-{ [2-fluoro-3 -(trifluoromethyl )benzyl] oxy }phenyl)-ethyl]benzoic acid;
4-(2-{ 3-bromo-5-chloro-2-[(2-chloro-4-fluorobenzyl)oxy]phenyl }ethyl)benzoic acid;
4-(2-{ 3-bromo-5-chloro-2-[(2,4,5-trifluorobenzyl)oxy]phenyl }ethyl)benzoic acid;
4-(2-{ 3-bromo-5-chloro-2-[(3-chloro-2-fluorobenzyl)oxy]phenyl }ethyl)benzoic acid;
4-(2-{3-bromo-5-chloro-2-[(3,5-dimethylbenzyl)oxy]phenyl}ethyl)benzoic acid; -(2-{3-bromo-5-chloro-2-[(3,5-difluorobenzyl)oxy]phenyl}ethyl)benzoic acid;-(2-{ 3-bromo-5-chloro-2-[(3,4-difluorobenzyl)oxy]phenyl }ethyl)benzoic acid;-[2-(3-bromo-5-chloro-2-{ [3-( trifluoromethoxy )benzyl] oxy }phenyl)ethyl]benzoic acid;-(2-{3-bromo-5-chloro-2-[(3-iodobenzyl)oxy]phenyl}ethyl)benzoic acid;-(2-{ 3-bromo-5-chloro-2-[(3-fluorobenzyl)oxy]phenyl }ethyl)benzoic acid;-{2-[2-(2,l,3-benzoxadiazol-5-ylmethoxy)-3-bromo-5-chlorophenyl]ethyl Jbenzoic acid;-(2-{3-bromo-5-chloro-2-[(4-fluorobenzyl)oxy]phenylJethyl)benzoic acid;-({2-bromo-6-[2-(4-carboxyphenyl)ethyl]-4-chlorophenoxy}methyl)benzoic acid;-[2-(3-bromo-5-chloro-2-{ [2-(trifluoromethyl)benzyl]oxy }phenyl)ethyl]benzoic acid;-(2-{ 3-bromo-5-chloro-2-[(2-iodobenzyl)oxy]phenyl }ethyl)benzoic acid;-(2-{ 3-bromo-5-chloro-2-[(2-methylbenzyl)oxy]phenyl }ethyl)benzoic acid;-(2-{ 3-bromo-2-[(2-bromobenzyl)oxy]-5-chlorophenyl }ethyl)benzoic acid;-(2-{ 3-bromo-5-chloro-2-[(2-fluorobenzyl)oxy]phenyl }ethyl)benzoic acid;-(2-{ 3-bromo-5-chloro-2-[(2-chlorobenzyl)oxy]phenyl }ethyl)benzoic acid;-(2-{ 3-bromo-5-chloro-2-[(3,5-dimethoxybenzyl)oxy]phenyl }ethyl)benzoic acid;-(2-{ 3-bromo-5-chloro-2-[(2,3,5-trifluorobenzyl)oxy]phenyl }ethyl)benzoic acid;-(2-{3-bromo-5-chloro-2-[(2,6-dichloropyridin-4-yl)methoxy]phenylJethyl)benzoic acid;-(2-{ 3,5-dichloro-2-[2-(2-fluorophenyl)ethyl]phenyl }ethyl)benzoic acid;-{2-[2-(benzyloxy)-3,5-dichlorophenyl]ethyl}thiophene-2-carboxylic acid;-{ 2-[3-bromo-5-chloro-2-(2-hydroxy-2-phenylethoxy)phenyl]ethyl Jbenzoic acid;-(3-{ 3,5-dichloro-2-[(3-methoxybenzyl)oxy]phenyl }prop-2-en-l-yl)benzoic acid;-(3-{ 3,5-dichloro-2-[(3-methoxybenzyl)oxy]phenyl }propyl)benzoic acid;-(2-{ 2-[(3-methoxybenzyl)oxy]pyridin-3-yl }ethyl)benzoic acid;-(2-{4,6-dibromo-3-[(3,5-dimethoxybenzyl)oxy]pyridin-2-yl}ethyl)benzoic acid;-(2-{4,6-dibromo-3-[(2,6-dichloropyridin-4-yl)methoxy]pyridin-2-yl}ethyl)benzoic acid;-(2-{4-ethyl-3-[(3-methoxybenzyl)oxy]pyridin-2-yl}ethyl)benzoic acid;-(2-{6-bromo-3-[(3,5-dimethoxybenzyl)oxy]pyridin-2-yl}ethyl)benzoic acid;-[(3-methoxybenzyl)oxy]-2-{2-[4-(lH-tetrazol-5-yl)phenyl]ethyl Jpyridine;-(2-{4-chloro-3-[(3,5-dimethoxybenzyl)oxy]pyridin-2-yl}ethyl)benzoic acid;-(2-{ 3-[(3-methoxybenzyl)oxy]pyridin-2-yl }ethyl)benzoic acid;-(2-{3-[(3,5-dimethoxybenzyl)oxy]pyridin-2-yl}ethyl)benzoic;-(2-{4-isopropyl-3-[(3-methoxybenzyl)oxy]pyridin-2-yl}ethyl)benzoic acid;-(2-{ 3-[(3-methoxybenzyl)oxy]-4-methylpyridin-2-yl }ethyl)benzoic acid;-chloro-3-[3,5-dimethoxybenzyl)oxy]-2-{ 2-[4-( lH-tetrazol-5-yl)phenyl]ethyl Jpyridine; 4-(2-{3-bromo-5-chloro-2-[(3,5-dimethoxybenzyl)oxy]phenyl}ethyl)benzamide; 5-[4-(2-{3-bromo-5-chloro-2-[(3,5-dimethoxybenzyl)oxy]phenyl}ethyl)phenyl]-lH-tetrazole; 5-[4-(2-{5-chloro-2-[(3,5-dimethoxybenzyl)oxy]biphenyl-3-yl}ethyl)phenyl]-lH-tetrazole; 5-[4-(2-{5-chloro-3-cyclopropyl-2-[(3,5-dimethoxybenzyl)oxy]phenyl}ethyl)phenyl]-lH-tetrazole; 4-(2-{5-chloro-2-[(3,5-dimethoxybenzyl)oxy]biphenyl-3-yl}ethyl)benzoic acid; 4-chloro-3-[(3,5-dimethoxybenzyl)oxy]-2-{2-[4-(lH-tetrazol-5-yl)phenyl]ethyl Jpyridine; isopropyl 4-(2-{4-chloro-3-[(3,5-dimethoxybenzyl)oxy]pyridin-2-yl}ethyl)benzoate; ethyl 4-(2-{4-chloro-3-[(3,5-dimethoxybenzyl)oxy]pyridin-2-yl}ethyl)benzoate; benzyl 4-(2-{4-chloro-3-[(3,5-dimethoxybenzyl)oxy]pyridin-2-ylJethyl)benzoate; 3-[(3,5-dimethoxybenzyl)oxy]-4-methoxy-2-{2-[4-(lH-tetrazol-5-yl)phenyl]ethyl Jpyridine; 3-[(3,5-dimethoxybenzyl)oxy]-4-isopropoxy-2-{2-[4-(lH-tetrazol-5-yl)phenyl]ethyl Jpyridine; 4-isopropenyl-3-[(3-methoxybenzyl)oxy]-2-{ (£)-2-[4-( lH-tetrazol-5-yl)phenyl]vinyl Jpyridine; 4-cyclopropyl-3-[(3-methoxybenzyl)oxy]-2-{(£)-2-[4-(lH-tetrazol-5-yl)phenyl]vinyl Jpyridine; 4-cyclopropyl-3-[(3-methoxybenzyl)oxy]-2-{2-[4-(lH-tetrazol-5-yl)phenyl]ethyl Jpyridine; 4-isopropyl-3-[(3-methoxybenzyl)oxy]-2-{(£)-2-[4-(lH-tetrazol-5-yl)phenyl]vinyl Jpyridine; 4-isopropyl-3-[(3-methoxybenzyl)oxy]-2-{2-[4-(lH-tetrazol-5-yl)phenyl]ethyl}pyridine; 4-isopropyl-3-[(3-methoxybenzyl)oxy]-2-{ 2-[4-( lH-tetrazol-5-yl)phenyl]cyclopropyl Jpyridine; 3-[(3,5-dibromobenzyl)oxy]-4-isopropyl-2-{ 2-[4-( lH-tetrazol-5-yl)phenyl]ethyl Jpyridine; 3-[(2,6-dichloropyridin-4-yl)methoxy]-4-isopropyl-2-{2-[4-(lH-tetrazol-5-yl)phenyl]ethyl Jpyridine; 3-{ [3,5-bis(trifluoromethyl)benzyl]oxy}-4-isopropyl-2-{2-[4-(lH-tetrazol-5-yl)phenyl]ethyl Jpyridine; 3-[(3,5-dimethoxybenzyl)oxy]-4-isopropyl-2-{2-[4-(lH-tetrazol-5-yl)phenyl]ethyl Jpyridine; 3-[(3,5-dichlorobenzyl)oxy]-4-isopropyl-2-{2-[4-(lH-tetrazol-5-yl)phenyl]ethyl Jpyridine; 3 - { [3 -(difluoromethoxy )benzy 1] oxy } -4-isopropy 1-2- { 2- [4-( lH-tetrazol-5 -y l)pheny 1] ethyl } pyridine ; 3-[(3,5-difluorobenzyl)oxy]-4-isopropyl-2-{ 2-[4-( lH-tetrazol-5-yl)phenyl]ethyl Jpyridine; 6-bromo-3-[(3,5-dichlorobenzyl)oxy]-4-isopropyl-2-{2-[4-(lH-tetrazol-5-yl)phenyl]ethyl Jpyridine; 6-bromo-3-[(3,5-dibromobenzyl)oxy]-4-isopropyl-2-{2-[4-(lH-tetrazol-5-yl)phenyl]ethyl Jpyridine; 5-[(3,5-dichlorobenzyl)oxy]-4-isopropyl-N, -dimethyl-6-{2-[4-(lH-tetrazol-5-yl)phenyl]ethyl}pyridin-2- amine; 4-[(2-bromo-4-chloro-6-{2-[4-(lΗ-tetrazol-5-yl)phenyl]ethyl}phenoxy)methyl]methoxypyridine;
4-[(2-bromo-4-chloro-6-{2-[4-(lH-tetrazoI-5-yl)phenyl]ethyl }phenoxy)methyl]-2,6-dichloropyridine; 5-[4-(2-{3-bromo-5-chloro-2-[2-(3,5-dimethoxyphenyl)ethyl]phenyl}ethyl)phenyl]-lH-tetrazole; 4-(3-{3-bromo-5-chloro-2-[(3,5-dimethoxybenzyl)oxy]phenyl}propyl)benzoic acid; 4-(3-{3-bromo-5-chloro-2-[(3,5-dimethoxybenzyl)oxy]phenyl}propyl)benzoic acid; 5-[4-(3-{3,5-dichloro-2-[(3,5-dimethoxybenzyl)oxy]phenyl }propyl)phenyl]-lH-tetrazole; 4-bromo-3-[(3,5-dimethoxybenzyl)oxy]-2-{2-[4-(lH-tetrazol-5-yl)phenyl]ethyl Jpyridine; 4-(2-{4-bromo-3-[2-(3,5-dimethoxyphenyl)ethyl]pyridin-2-yl}ethyl)benzoic acid; 4-(2-{4-bromo-3-[2-(3,5-dimethoxyphenyl)ethyl]pyridin-2-yl}ethyl)benzoic acid; 4-(2-{ 2-[(3-methoxybenzyl)oxy]pyridin-3-yl }ethyl)benzoic acid;
5-[4-(2-{3-bromo-5-chloro-2-[(3,5-dimethoxybenyl)oxy]phenyl}ethyl)phenyl]-lH-tetrazole; 4-(2-{4-chloro-3-[(3,5-dimethoxybenyl)oxy]pyridin-2-yl}ethyl)benzoic acid; 4-(2-{4-ethyl-3-[(3-methoxybenyl)oxy]pyridin-2-yl}ethyl)benzoic acid; 4-chloro-3-[(3,5-dimethoxybenzyl)oxy]-2-{2-[4-(lH-tetrazol-5-yl)phenyl]ethyl Jpyridine;
or a pharmaceutically acceptable salt, enantiomer, diastereomer, prodrug or mixture thereof.
9. A compound which is:
4-(2-{ 3-bromo-5-chloro-2-[(3-methoxybenzyl)oxy]phenyl }ethyl)benzoic acid; 5- [4-(2- { 3 -bromo-5 -chloro-2-[(3 -methoxy benzyl)oxy]phenyl } ethyl)pheny 1] - 1 H-tetrazole; 4-(2-{ 3-bromo-2-[(3-bromobenzyl)oxy]-5-chlorophenyl }ethyl)benzoic acid; 4-(2-{ 2-[(3-methoxybenzyl)oxy]-3-methylphenyl }ethyl)benzoic acid; 4-(2-{3-bromo-5-chloro-2-[(5-chloro-2-fluorobenzyl)oxy]phenylJethyl)benzoic acid; 4-(2-{ 3-bromo-5-chloro-2-[(3-methylbenzyl)oxy]phenyl }ethyl)benzoic acid; 4-(2-{ 3-bromo-5-chloro-2-[(2,4,5-trifluorobenzyl)oxy]phenyl JethyI)benzoic acid; 4-(2-{ 3-bromo-5-chloro-2-[(3-chloro-2-fluorobenzyl)oxy]phenyl }ethyl)benzoic acid; 4-(2-{ 3-bromo-5-chloro-2-[(3,5-dimethylbenzyl)oxy]phenyl }ethyl)benzoic acid; 4-(2-{ 3-bromo-5-chloro-2-[(3,5-difluorobenzyl)oxy]phenyl }ethyl)benzoic acid; 4-(2-{ 3-bromo-5-chloro-2-[(3,4-difluorobenzyl)oxy]phenyl }ethyl)benzoic acid; 4-[2-(3-bromo-5-chloro-2-{ [3-( trifluoromethoxy )benzyl]oxy }phenyl)ethyl]benzoic acid; 4-(2-{3-bromo-5-chloro-2-[(3-iodobenzyl)oxy]phenyl}ethyl)benzoic acid; 4-(2-{ 3-bromo-5-chloro-2-[(3-fluorobenzyl)oxy]phenyl }ethyl)benzoic acid; 4-{2-[2-(2,l,3-benzoxadiazol-5-ylmethoxy)-3-bromo-5-chlorophenyl]ethyl Jbenzoic acid; 4-(2-{ 3-bromo-5-chloro-2-[(3,5-dimethoxybenzyl)oxy]phenyl }ethyl)benzoic acid; 4-(2-{ 3-bromo-5-chloro-2-[(2,6-dichloropyridin-4-yl)methoxy]phenyl }ethyl)benzoic acid; 4-{ 2-[3-bromo-5-chloro-2-(2-hydroxy-2-phenylethoxy)phenyl]ethyl Jbenzoic acid; 4-(2-{ 3-bromo-5-chloro-2-[2-(3,5-dimethoxyphenyl)ethyl]phenyl }ethyl)benzoic acid; 4-(2-{3-bromo-5-chloro-2-[2-(2,6-dichloropyridin-4-yl)ethyl]phenyl}ethyl)benzoic acid; 5-[4-(2-{3-bromo-5-chloro-2-[(3,5-dimethoxybenzyl)oxy]phenyl}ethyl)phenyl]-lH-tetrazole; 4-[(2-bromo-4-chloro-6-{2-[4-(lH-tetrazol-5-yl)phenyl]ethyl }phenoxy)methyl]-2-methoxypyridine; 4-[(2-bromo-4-chloro-6-{2-[4-(lH-tetrazol-5-yl)phenyl]ethyl}phenoxy)methyl]-2,6-dichloropyridine; 5-[4-(2-{3-bromo-5-chloro-2-[2-(3,5-dimethoxyphenyl)ethyl]phenyl}ethyl)phenyl]-lH-tetrazole; 4-(3-{ 3,5-dichloro-2-[(3-methoxybenzyl)oxy]phenyl }propyl)benzoic acid; 4-(3-{ 3-bromo-5-chloro-2-[(3,5-dimethoxybenzyl)oxy]phenyl }propyl)benzoic acid; 5-[4-(3-{3,5-dichloro-2-[(3,5-dimethoxybenzyl)oxy]phenyl}propyl)phenyl]-lH-tetrazole; 4-bromo-3-[(3,5-dimethoxybenzyl)oxy]-2-{ 2-[4-( lH-tetrazol-5-yl)phenyl]ethyl Jpyridine; 4-(2-{4-bromo-3-[2-(3,5-dimethoxyphenyl)ethyl]pyridin-2-yl}ethyl)benzoic acid; 4-(2-{4-chloro-3-[(3,5-dimethoxybenzyl)oxy]pyridin-2-ylJethyl)benzoic acid; 4-(2-{ 2-[(3-methoxybenzyl)oxy]pyridin-3-yl }ethyl)benzoic acid; 4-(2-{4,6-dibromo-3-[(3,5-dimethoxybenzyl)oxy]pyridin-2-yl}ethyl)benzoic acid; 4-(2-{4,6-dibromo-3-[(2,6-dichloropyridin-4-yl)methoxy]pyridine-2-yl}ethyl)benzoic acid; 4-(2-{6-bromo-3-[(3,5-dimethoxybenzyl)oxy]pyridin-2-yl}ethyl)benzoic acid; 3-[(3-methoxybenzyl)oxy]-2-{2-[4-(lH-tetrazol-5-yl)phenyl]ethyl}pyridine; 4-(2-{4-chloro-3-[(3,5-dimethoxybenzyl)oxy]pyridin-2-yl}ethyl)benzoic acid; 4-(2-{ 3-[(3-methoxybenzyl)oxy]pyridin-2-yl }ethyl)benzoic acid; 4-(2-{4-isopropyl-3-[(3-methoxybenzyl)oxy]pyridin-2-yl}ethyl)benzoic acid; 4-(2-{ 3-[(3-methoxybenzyl)oxy]-4-mefhylpyridin-2-yl }ethyl)benzoic acid; 4-chloro-3-[3,5-dimethoxybenzyl)oxy]-2-{2-[4-(lH-tetrazol-5-yl)phenyl]ethyl Jpyridine;
5-[4-(2-{5-chloro-3-cyclopropyl-2-[(3,5-dimethoxybenzyl)oxy]phenyl}ethyl)phenyl]-lH-tetrazole; isopropyl 4-(2-{4-chloro-3-[(3,5-dimethoxybenzyl)oxy]pyridin-2-yl}ethyl)benzoate; 3-[(3,5-dimethoxybenzyl)oxy]-4-methoxy-2-{2-[4-(lH-tetrazol-5-yl)phenyl]ethyl Jpyridine; 3-[(3,5-dimethoxybenzyl)oxy]-4-isopropoxy-2-{2-[4-(lH-tetrazol-5-yl)phenyl]ethyl Jpyridine; 4-cyclopropyl-3-[(3-methoxybenzyl)oxy]-2-{2-[4-(lH-tetrazol-5-yl)phenyl]ethyl Jpyridine; 3-[(3,5-dibromobenzyl)oxy]-4-isopropyl-2-{2-[4-(lH-tetrazol-5-yl)phenyl]ethyl Jpyridine; 3-[(2,6-dichloropyridin-4-yl)methoxy]-4-isopropyl-2-{2-[4-(lH-tetrazol-5-yl)phenyl]ethyl}pyridine; 3-[(3,5-dimethoxybenzyl)oxy]-4-isopropyl-2-{2-[4-(lH-tetrazol-5-yl)phenyl]ethyl}pyridine; 3-[(3,5-dichlorobenzyl)oxy]-4-isopropyl-2-{ 2-[4-( lH-tetrazol-5-yl)phenyl]ethyl Jpyridine; 3-{ [3-(difluoromethoxy)benzyl]oxy}-4-isopropyl-2-{2-[4-(lH-tetrazol-5-yl)phenyl]ethyl Jpyridine; 3-[(3,5-difluorobenzyl)oxy]-4-isopropyl-2-{2-[4-(lH-tetrazol-5-yl)phenyl]ethyl Jpyridine; 6-bromo-3-[(3,5-dichlorobenzyl)oxy]-4-isopropyl-2-{2-[4-(lH-tetrazol-5-yl)phenyl]ethyl Jpyridine;
or a pharmaceutically acceptable salt, enantiomer, diastereomer, prodrug or mixture thereof.
10. A pharmaceutical composition comprising a pharmaceutically acceptable carrier, a compound of formula I, as recited in claim 1 and optionally xanthan gum or gellan gum.
11. Use of a compound of claim 1 for the manufacture of a medicament for the treatment of ocular hypertension, glaucoma, macular edema, macular degeneration, dry eye, increasing retinal and optic nerve head blood velocity, increasing retinal and optic nerve oxygen tension, providing neuroprotection or a combination thereof, said compound administered in a topical formulation as a solution or suspension.
12. The use according to claim 11 wherein one or more active ingredients belonging to the group consisting of: beta-adrenergic blocking agent, parasympatho-mimetic agent, sympathomimetic agent, carbonic anhydrase inhibitor, Maxi-K channel blocker, and a prostaglandin, hypotensive lipid, neuroprotectant, and 5-HT2 receptor agonist is added to the topical formulation.
13. The use according to claim 12 wherein the beta-adrenergic blocking agent is timolol, betaxolol, levobetaxolol, carteolol, or levobunolol; the parasympathomimetic agent is pilocaφine; the sympathomimetic agent is epinephrine, brimonidine, iopidine, clonidine, or para- aminoclonidine, the carbonic anhydrase inhibitor is dorzolamide, acetazolamide, metazolamide or brinzolamide; COSOPT®, the Maxi-K is Penitrem A, paspalicine, charybdotoxin, iberiotoxin, Paxicillan, Aflitram, Venoculogen, l-(l-isobutyl-6-methoxy-lH-indazol-3-yl)-2-methylpropan-l-one; l-[l-(2,2- dimethylpropyl)-6-methoxy- 1 H-indazol-3-yl]-2-methylpropan- 1 -one; 1 -[ 1 -(cyclohexylmethyl)-ό- methoxy-lH-indazol-3-yl]-2-methylpropan-l-one; l-(l-hexyl-6-methoxy-lH-indazol-3-yl)-2- methylpropan- 1 -one; l-[ 1 -(2-ethylhexy l)-6-methoxy- 1 H-indazol-3-y 1] -2-methylpropan- 1 -one; 1 -(3- isobutyryl-6-methoxy-lH-indazol-l-yl)buan-2-one; l-(3-isobutyryl-6-methoxy-lH-indazol-l-yl)-3,3- dimethylbutan-2-one; l-(3-cyclopentylcarbonyl)-6-methoxy-lH-indazol-l-yl)-3,3-dimethylbutan-2-one; l-(3,3-dimethyl-2-oxobutyl) -6-methoxy-lH-indazole-3-carboxylic acid; and l-[3-(3-hydroxypropanoyl) -6-methoxy-lH-indazol-l-yl]-3,3-dimethylbutan-2-one, the prostaglandin is latanoprost, travaprost, unoprostone, rescula, or S1033, the hypotensive lipid is lumigan, the neuroprotectant is eliprodil, R- eliprodil or memantine; and the 5-HT2 receptor agonist is l-(2-aminopropyl)-3-methyl-lH-imdazol-6-ol fumarate or 2-(3-chloro-6-methoxy-indazol- 1 -yl)- 1 -methyl-ethy lamine.
14. Use of a compound of claim 1 for the manufacture of a medicament for stimulating bone formation, treating or reducing the risk of contracting a disease state or condition related to abnormal bone resoφtion, or a combination thereof, said medicament optionally comprising another agent selected from an organic bisphosphonate; a cathepsin K inhibitor, an estrogen, an estrogen receptor modulator, an androgen receptor modulator, an inhibitor of osteoclast proton ATPase, an inhibitor of HMG-CoA reductase, an integrin receptor antagonist, an osteoblast anabolic agent, calcitonin, vitamin D, a synthetic Vitamin D analogue, or a pharmaceutically acceptable salt or mixture thereof.
PCT/CA2005/000773 2004-05-26 2005-05-20 Ep4 receptor agonist, compositions and methods thereof WO2005116010A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US57465304P 2004-05-26 2004-05-26
US60/574,653 2004-05-26

Publications (1)

Publication Number Publication Date
WO2005116010A1 true WO2005116010A1 (en) 2005-12-08

Family

ID=35450821

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CA2005/000773 WO2005116010A1 (en) 2004-05-26 2005-05-20 Ep4 receptor agonist, compositions and methods thereof

Country Status (1)

Country Link
WO (1) WO2005116010A1 (en)

Cited By (21)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007088190A1 (en) 2006-02-03 2007-08-09 Glaxo Group Limited Benzo (f) isoindol-2-ylphenyl acetic acid derivatives as ep4 receptor agonists
WO2008012852A1 (en) * 2006-07-27 2008-01-31 S.I.M.S. S.r.l. - SOCIETÀ ITALIANA MEDICINALI SCANDICCI Intermediate compounds for the preparation of angiotensin ii antagonists
WO2008017164A1 (en) * 2006-08-11 2008-02-14 Merck Frosst Canada Ltd. Thiophenecarboxamide derivatives as ep4 receptor ligands
WO2008071736A1 (en) 2006-12-15 2008-06-19 Glaxo Group Limited Benzamide derivatives as ep4 receptor agonists
WO2008092861A1 (en) * 2007-01-30 2008-08-07 Janssen Pharmaceutica N.V. Bicyclic derivatives as ep4 agonists
WO2008092862A1 (en) * 2007-01-30 2008-08-07 Janssen Pharmaceutica N.V. Bicyclic derivatives as ep4 agonists
WO2008092860A1 (en) * 2007-01-30 2008-08-07 Janssen Pharmaceutica N.V. Bicyclic derivatives as ep4 agonists
WO2008136519A1 (en) 2007-05-08 2008-11-13 National University Corporation, Hamamatsu University School Of Medicine Cytotoxic t cell activator comprising ep4 agonist
WO2008149965A1 (en) 2007-06-07 2008-12-11 Astellas Pharma Inc. Pyridone compound
WO2009056582A1 (en) 2007-11-02 2009-05-07 Glaxo Group Limited Novel compounds
WO2009042444A3 (en) * 2007-09-27 2009-05-14 Sirion Therapeutics Inc Methods and compounds for treating retinol-related diseases
WO2009147165A1 (en) * 2008-06-05 2009-12-10 Glaxo Group Limited Novel ep4 receptor agonist compounds
WO2009154190A1 (en) 2008-06-17 2009-12-23 アステラス製薬株式会社 Pyridone compound
WO2011047048A1 (en) 2009-10-14 2011-04-21 Gemmus Pharma, Inc. Combination therapy treatment for viral infections
US7973079B2 (en) 2007-09-27 2011-07-05 Revision Therapeutics, Inc. Methods and compounds for treating retinol-related diseases
WO2014078434A1 (en) * 2012-11-16 2014-05-22 Allergan, Inc. Compounds and methods for skin repair
WO2015021358A2 (en) 2013-08-09 2015-02-12 Dominique Charmot Compounds and methods for inhibiting phosphate transport
WO2016199111A1 (en) 2015-06-12 2016-12-15 Simon Fraser University Amide-linked ep4 agonist-bisphosphonate compounds and uses thereof
US9611284B2 (en) 2010-05-28 2017-04-04 Simon Fraser University Prostaglandin-bisphosphonate conjugate compounds, methods of making same, and uses thereof
US9650414B1 (en) 2014-05-30 2017-05-16 Simon Fraser University Dual-action EP4 agonist—bisphosphonate conjugates and uses thereof
WO2020237096A1 (en) 2019-05-21 2020-11-26 Ardelyx, Inc. Combination for lowering serum phosphate in a patient

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996011902A1 (en) * 1994-10-12 1996-04-25 Zeneca Limited Pharmaceutically active substituted aromatic compounds
US5530157A (en) * 1995-02-16 1996-06-25 Scios Nova Inc. Anti-inflammatory benzoic acid derivatives
US5834468A (en) * 1995-07-07 1998-11-10 Zeneca Limited Substituted aryl and heteroaryl compounds as E-type prostaglandin antagonists
US6211197B1 (en) * 1998-10-07 2001-04-03 Merck Frosst Canada & Co. Prostaglandin receptor ligands

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996011902A1 (en) * 1994-10-12 1996-04-25 Zeneca Limited Pharmaceutically active substituted aromatic compounds
US5530157A (en) * 1995-02-16 1996-06-25 Scios Nova Inc. Anti-inflammatory benzoic acid derivatives
US5834468A (en) * 1995-07-07 1998-11-10 Zeneca Limited Substituted aryl and heteroaryl compounds as E-type prostaglandin antagonists
US6211197B1 (en) * 1998-10-07 2001-04-03 Merck Frosst Canada & Co. Prostaglandin receptor ligands

Cited By (31)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2457897A1 (en) 2006-02-03 2012-05-30 Glaxo Group Limited Benzo (f) isoindol-2-ylphenyl acetic acid derivatives as ep4 receptor agonists
WO2007088190A1 (en) 2006-02-03 2007-08-09 Glaxo Group Limited Benzo (f) isoindol-2-ylphenyl acetic acid derivatives as ep4 receptor agonists
WO2008012852A1 (en) * 2006-07-27 2008-01-31 S.I.M.S. S.r.l. - SOCIETÀ ITALIANA MEDICINALI SCANDICCI Intermediate compounds for the preparation of angiotensin ii antagonists
JP2010500293A (en) * 2006-08-11 2010-01-07 メルク フロスト カナダ リミテツド Thiophenecarboxamide derivatives as EP4 receptor ligands
WO2008017164A1 (en) * 2006-08-11 2008-02-14 Merck Frosst Canada Ltd. Thiophenecarboxamide derivatives as ep4 receptor ligands
US8969394B2 (en) 2006-08-11 2015-03-03 Merck Frosst Canada Ltd. Thiophenecarboxamide derivatives as EP4 receptor ligands
CN101541778B (en) * 2006-08-11 2014-10-08 默克加拿大有限公司 Thiophenecarboxamide derivatives as EP4 receptor ligands
JP2010513242A (en) * 2006-12-15 2010-04-30 グラクソ グループ リミテッド Benzamide derivatives as EP4 receptor agonists
WO2008071736A1 (en) 2006-12-15 2008-06-19 Glaxo Group Limited Benzamide derivatives as ep4 receptor agonists
WO2008092862A1 (en) * 2007-01-30 2008-08-07 Janssen Pharmaceutica N.V. Bicyclic derivatives as ep4 agonists
WO2008092860A1 (en) * 2007-01-30 2008-08-07 Janssen Pharmaceutica N.V. Bicyclic derivatives as ep4 agonists
WO2008092861A1 (en) * 2007-01-30 2008-08-07 Janssen Pharmaceutica N.V. Bicyclic derivatives as ep4 agonists
WO2008136519A1 (en) 2007-05-08 2008-11-13 National University Corporation, Hamamatsu University School Of Medicine Cytotoxic t cell activator comprising ep4 agonist
WO2008149965A1 (en) 2007-06-07 2008-12-11 Astellas Pharma Inc. Pyridone compound
WO2009042444A3 (en) * 2007-09-27 2009-05-14 Sirion Therapeutics Inc Methods and compounds for treating retinol-related diseases
US7973079B2 (en) 2007-09-27 2011-07-05 Revision Therapeutics, Inc. Methods and compounds for treating retinol-related diseases
WO2009056582A1 (en) 2007-11-02 2009-05-07 Glaxo Group Limited Novel compounds
WO2009147165A1 (en) * 2008-06-05 2009-12-10 Glaxo Group Limited Novel ep4 receptor agonist compounds
WO2009154190A1 (en) 2008-06-17 2009-12-23 アステラス製薬株式会社 Pyridone compound
WO2011047048A1 (en) 2009-10-14 2011-04-21 Gemmus Pharma, Inc. Combination therapy treatment for viral infections
US9611284B2 (en) 2010-05-28 2017-04-04 Simon Fraser University Prostaglandin-bisphosphonate conjugate compounds, methods of making same, and uses thereof
WO2014078434A1 (en) * 2012-11-16 2014-05-22 Allergan, Inc. Compounds and methods for skin repair
JP2015537028A (en) * 2012-11-16 2015-12-24 アラーガン、インコーポレイテッドＡｌｌｅｒｇａｎ，Ｉｎｃｏｒｐｏｒａｔｅｄ Compositions and methods for skin repair
WO2015021358A2 (en) 2013-08-09 2015-02-12 Dominique Charmot Compounds and methods for inhibiting phosphate transport
EP3492106A1 (en) 2013-08-09 2019-06-05 Ardelyx, Inc. Compounds and methods for inhibiting phosphate transport
EP3884935A1 (en) 2013-08-09 2021-09-29 Ardelyx, Inc. Compounds and methods for inhibiting phosphate transport
US9650414B1 (en) 2014-05-30 2017-05-16 Simon Fraser University Dual-action EP4 agonist—bisphosphonate conjugates and uses thereof
WO2016199111A1 (en) 2015-06-12 2016-12-15 Simon Fraser University Amide-linked ep4 agonist-bisphosphonate compounds and uses thereof
US10400000B2 (en) 2015-06-12 2019-09-03 Simon Fraser University Amide-linked EP4 agonist-bisphosphonate compounds and uses thereof
US11312737B2 (en) 2015-06-12 2022-04-26 Simon Fraser University Amide-linked EP4 agonist-bisphosphonate compounds and uses thereof
WO2020237096A1 (en) 2019-05-21 2020-11-26 Ardelyx, Inc. Combination for lowering serum phosphate in a patient

Similar Documents

Publication Publication Date Title
WO2005116010A1 (en) Ep4 receptor agonist, compositions and methods thereof
US7053085B2 (en) EP4 receptor agonist, compositions and methods thereof
US20090270395A1 (en) EP4 Receptor Agonist, Compositions and Methods Thereof
US7109223B2 (en) Oxazolidin-2-one and thiazolidin-2-one derivatives for use as EP4 receptor agonists in the treatment of glaucoma
US20090105234A1 (en) EP4 Receptor Agonist, Compositions and Methods Thereof
JP2009541340A (en) Therapeutic compounds
WO2004037813A1 (en) Pyrrolidin-2-on derivatives as ep4 receptor agonists
WO2004037786A2 (en) 2-pyrrolidones as ep4 receptor agonists
EP1513523A1 (en) 1,5-disubstituted imidazolidin-2-one derivatives for use as ep4 receptor agonists in the treatment of eye and bone diseases
WO2003047417A2 (en) Ep4 receptor agonist, compositions and methods thereof
AU2004224261B2 (en) Prostaglandin analogs as EP4 receptor agonists

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KM KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NG NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SM SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DPEN Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed from 20040101)
NENP Non-entry into the national phase

Ref country code: DE

WWW Wipo information: withdrawn in national office

Country of ref document: DE

122 Ep: pct application non-entry in european phase